| AT1G01020 | ARV1 family protein;(source:Araport11) |
| AT1G01040 | Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs. The mRNA is cell-to-cell mobile. |
| AT1G01090 | pyruvate dehydrogenase E1 alpha subunit |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT1G01130 | CBL-interacting Serine/Threonine-kinase;(source:Araport11) |
| AT1G01150 | Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT1G01225 | NC domain-containing protein-like protein;(source:Araport11) |
| AT1G01240 | transmembrane protein;(source:Araport11) |
| AT1G01260 | bHLH13 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH14 and bHLH17 to negatively regulate jasmonate responses. |
| AT1G01305 | hypothetical protein;(source:Araport11) |
| AT1G01310 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT1G01350 | Zinc finger (CCCH-type/C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G01355 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT1G01370 | Encodes a centromere-identifying protein histone H3 variant. Localized at centromeres in both mitotic and meiotic cells. Aurora3 phosphorylates CENH3 at S65; this post-translational modification is required for the proper development of the floral meristem. |
| AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01410 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
| AT1G01450 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
| AT1G01460 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. |
| AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
| AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
| AT1G01610 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT8. |
| AT1G01620 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. Involved redundantly with PIP1;1/2/4/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G01640 | Putative role in flower development. Comparison of SALK_011721C to Columbia wild type resulted in a trend toward earlier flowering in the mutant (P=0.1) (Stapleton and Woodruff 2009, personal communication). |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01680 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01690 | Encodes a novel plant-specific protein that is involved in meiotic double strand break formation. |
| AT1G01700 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G01750 | actin depolymerizing factor 11;(source:Araport11) |
| AT1G01770 | propionyl-CoA carboxylase;(source:Araport11) |
| AT1G01780 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. The mRNA is cell-to-cell mobile. |
| AT1G01790 | Encodes a member of the cation/proton antiporters-2 antiporter superfamily, the K efflux antiporter KEA1 that is localized to the chloroplast envelope. |
| AT1G01820 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G01900 | Encodes AtSBT1.1, a subtilisin-like serine protease. Cleaves the phytosulfokine AtPSK4, a growth promoting peptide. |
| AT1G01930 | zinc finger protein-like protein;(source:Araport11) |
| AT1G01960 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT1G01980 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G02000 | UDP-D-glucuronate 4-epimerase The mRNA is cell-to-cell mobile. |
| AT1G02010 | member of KEULE Gene Family |
| AT1G02040 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G02070 | zinc ion-binding protein;(source:Araport11) |
| AT1G02080 | Acts as scaffold protein in the CCR4-NOT complex, by interacting with various NOT proteins and CAF1. Essential protein for proper pollen development and germination capacity. |
| AT1G02110 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT1G02150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G02280 | Encodes a GTP-binding GTP-ase. Component of the chloroplast protein import machinery. Required for import of POR B into plastids. Toc33 phosphorylation may not play an important role in vivo. |
| AT1G02330 | Encodes a nuclear coiled-coil domain-containing protein that interacts with and negatively regulates COP1's E3 ubiquitin ligase activity, and represses COP1 mediated HY5 degradation in cell-free extracts. |
| AT1G02335 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. |
| AT1G02380 | transmembrane protein;(source:Araport11) |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
| AT1G02405 | proline-rich family protein;(source:Araport11) |
| AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G02470 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G02510 | Encodes AtTPK4, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK4 is targeted to the plasma membrane. In contrast other members of the AtTPK proteins are located in tonoplast. AtTPK4 forms a voltage-independent K+ channel that is blocked by extracellular calcium ions. May form homomeric ion channels in vivo. |
| AT1G02520 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile. |
| AT1G02530 | P-glycoprotein 12;(source:Araport11) |
| AT1G02540 | hypothetical protein;(source:Araport11) |
| AT1G02570 | transmembrane protein;(source:Araport11) |
| AT1G02575 | transmembrane protein;(source:Araport11) |
| AT1G02590 | Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding protein;(source:Araport11) |
| AT1G02620 | Ras-related small GTP-binding family protein;(source:Araport11) |
| AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G02720 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G02750 | Drought-responsive family protein;(source:Araport11) |
| AT1G02790 | encodes a exopolygalacturonase. |
| AT1G02820 | Late embryogenesis abundant 3 (LEA3) family protein;(source:Araport11) |
| AT1G02830 | Ribosomal L22e protein family;(source:Araport11) |
| AT1G02850 | beta glucosidase 11;(source:Araport11) |
| AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
| AT1G02900 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. Mediates Ca2+-dependent signaling. Regulates the splicing of flowering genes and exerts an opposite effect on the flowering time compared with FER. |
| AT1G02950 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02980 | encodes an Arabidopsis cullin |
| AT1G02990 | hypothetical protein;(source:Araport11) |
| AT1G03010 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G03020 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
| AT1G03070 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT1G03090 | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT1G03103 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G03120 | responsive to abscisic acid 28;(source:Araport11) |
| AT1G03130 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
| AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT1G03240 | hypothetical protein;(source:Araport11) |
| AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT1G03340 | hypothetical protein;(source:Araport11) |
| AT1G03350 | BSD domain-containing protein;(source:Araport11) |
| AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G03400 | A single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers. |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G03445 | encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid. |
| AT1G03457 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G03490 | NAC domain containing protein 6;(source:Araport11) |
| AT1G03580 | pseudogene of MATH domain/coiled-coil protein;(source:Araport11) |
| AT1G03620 | ELMO/CED-12 family protein;(source:Araport11) |
| AT1G03640 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G03650 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G03660 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT1G03670 | Ankyrin repeat containing protein |
| AT1G03710 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT1G03740 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
| AT1G03830 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles. |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT1G03880 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT1G03890 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G03900 | member of NAP family, an heterogeneous subfamily of the ATP-binding Cassette (ABC) superfamily of membrane transporters. The NAPs proteins are characterized by having only one nucleotide-binding folds (NBFs) domain. |
| AT1G03905 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G03910 | Encodes the Arabidopsis homolog of a conserved eukaryotic protein without known functional domains. The protein that localizes to nuclear speckles and colocalizes with known splicing proteins. |
| AT1G03980 | Encodes a protein with phytochelatin synthase activity which binds Cd2+ and Cd-glutathione complexes with high affinity. The protein has been postulated to be involved in Cd2+ tolerance. AtPCS2 expression appears to be less than that of AtPCS1, explaining the inability of endogenous AtPCS2 to substitute for AtPCS1 in the cad1-3 mutant (AtPCS1 null). |
| AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT1G04000 | hypothetical protein;(source:Araport11) |
| AT1G04070 | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
| AT1G04090 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT1G04100 | Auxin induced gene, IAA10 (IAA10). |
| AT1G04110 | Initially identified as a mutation affecting stomatal development and distribution. Encodes a protein similar to serine proteases. |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT1G04140 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G04180 | YUCCA 9;(source:Araport11) |
| AT1G04220 | Encodes KCS2, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G04290 | Thioesterase superfamily protein;(source:Araport11) |
| AT1G04295 | Natural antisense transcript overlaps with AT1G04290;(source:Araport11) |
| AT1G04300 | Encodes MUSE13, a TRAF domain protein. Regulates the turnover of nucleotide-binding domain and leucine-rich repeat-containing (NLR) immune receptors SNC1 and RPS2. Loss of both MUSE13 and MUSE14 leads to enhanced pathogen resistance, NLR accumulation, and autoimmunity.In addition, MUSE13/14 physically interact with ATG6 and appear to regulate ATG6 ubiquitination and thus formation of autophagosomes. |
| AT1G04350 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G04390 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT1G04400 | Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus.The life-time of cry2 signaling state in situ (in planta) is about 16 min. |
| AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
| AT1G04430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G04450 | Encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. The protein most similar to RIC1 (family subgroup III). Gene is expressed predominantly in inflorescence and flower tissue. Interacts with ROP1 to modulate calcium ion influxes required to generate tip-focused calcium gradients.It |
| AT1G04457 | Pseudogene of AT2G33450; 50S ribosomal protein L28, chloroplast (CL28) |
| AT1G04470 | hypothetical protein (DUF810);(source:Araport11) |
| AT1G04500 | CCT motif family protein;(source:Araport11) |
| AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
| AT1G04530 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G04555 | transmembrane protein;(source:Araport11) |
| AT1G04570 | Similar to plastid solute transporters. |
| AT1G04580 | Encodes aldehyde oxidase AAO4 preferentially expressed in developing seeds. |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT1G04620 | Encodes a 7-hydroxymethyl chlorophyll a reductase, an enzyme of the chlorophyll cycle that converts 7-hydroxymethyl chlorophyll a to chlorophyll a. |
| AT1G04670 | hypothetical protein;(source:Araport11) |
| AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G04710 | EC2.3.1.16 thiolase. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G04778 | hypothetical protein;(source:Araport11) |
| AT1G04820 | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers. |
| AT1G04850 | ubiquitin-associated (UBA)/TS-N domain-containing protein;(source:Araport11) |
| AT1G04870 | Encodes a type I protein arginine methyltransferase based on the At1g04870.2 gene model. PRMT10 can catalyze the asymmetric dimethylation of arginine 3 on histone 4 and can also methylate myelin basic protein in vitro. Mutants lacking PRMT10 flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
| AT1G04890 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G04910 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G04920 | Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi. |
| AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G05030 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G05060 | coiled-coil protein;(source:Araport11) |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G05180 | Encodes a subunit of the RUB1 activating enzyme that regulates the protein degradation activity of Skp1-Cullin-Fbox complexes, primarily, but not exclusively, affecting auxin responses. Acts alongside AS1 to exclude BP expression from leaves. Promotes degradation of the cytokinin response repressor ARR5. Affects expression of key DNA repair and meiotic genes, signifcant role in DNA repair. |
| AT1G05205 | hexokinase-1 protein;(source:Araport11) |
| AT1G05220 | Transmembrane protein 97, Putative;(source:Araport11) |
| AT1G05240 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G05270 | TraB family protein;(source:Araport11) |
| AT1G05280 | ERV-F (C)1 provirus ancestral Env polyprotein, putative (DUF604);(source:Araport11) |
| AT1G05320 | myosin heavy chain, embryonic smooth protein;(source:Araport11) |
| AT1G05330 | hypothetical protein;(source:Araport11) |
| AT1G05350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G05490 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
| AT1G05510 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT1G05530 | Encodes a protein with glucosyltransferase activity with high sequence homology to UGT1 (AT1G05560). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT2 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. |
| AT1G05540 | hypothetical protein (DUF295);(source:Araport11) |
| AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
| AT1G05562 | Natural antisense transcript overlaps with AT1G05560;(source:Araport11) |
| AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
| AT1G05610 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS2 is a minor small subunit isoform present in all plant tissues tested. |
| AT1G05615 | B3 domain protein (DUF313);(source:Araport11) |
| AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
| AT1G05630 | Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light?stimulated increase in cytosolic calcium ion. |
| AT1G05670 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT1G05750 | Encodes a pentatricopeptide repeat protein required for editing of rpoA and clpP chloroplast transcripts. |
| AT1G05785 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT1G05800 | Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues. |
| AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
| AT1G05870 | hypothetical protein (DUF1685);(source:Araport11) |
| AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
| AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G05900 | endonuclease III 2;(source:Araport11) |
| AT1G05920 | B3 domain protein (DUF313);(source:Araport11) |
| AT1G05930 | B3 domain protein (DUF313);(source:Araport11) |
| AT1G05940 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT1G05960 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G05990 | EF hand calcium-binding protein family;(source:Araport11) |
| AT1G06020 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT1G06030 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
| AT1G06080 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression down-regulated by cold temperature. It is involved in the desaturation of VLCFAs to make monounsaturated VLCFAs. |
| AT1G06090 | Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation. |
| AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
| AT1G06130 | glyoxalase 2-4;(source:Araport11) |
| AT1G06135 | transmembrane protein;(source:Araport11) |
| AT1G06137 | transmembrane protein;(source:Araport11) |
| AT1G06148 | hypothetical protein;(source:Araport11) |
| AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
| AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT1G06190 | Encodes a novel ribonucleic acid-binding protein that interacts with the endonuclease RNase E and supports its function in processing plastid ribonucleic acids. |
| AT1G06230 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE4 show some resistance to agrobacterium-mediated root transformation. |
| AT1G06290 | Encodes an acyl-CoA oxidase with specificity for medium chain fatty acids. The mRNA is cell-to-cell mobile. |
| AT1G06330 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G06340 | Plant Tudor-like protein;(source:Araport11) |
| AT1G06370 | pseudogene of Alg9-like mannosyltransferase family;(source:Araport11) |
| AT1G06410 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G06450 | Deadenylase. |
| AT1G06475 | transmembrane protein;(source:Araport11) |
| AT1G06490 | Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding. |
| AT1G06500 | hypothetical protein;(source:Araport11) |
| AT1G06520 | sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile. |
| AT1G06530 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR2. Involved in mitochondrial morphogenesis. |
| AT1G06560 | NOL1/NOP2/sun family protein;(source:Araport11) |
| AT1G06570 | Mutation of the PDS1 locus disrupts the activity of p-hydroxyphenylpyruvate dioxygenase (HPPDase), the first committed step in the synthesis of both plastoquinone and tocopherols in plants. |
| AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT1G06645 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G06680 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. Phosphorylation of this protein is dependent on calcium. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the stroma. The mRNA is cell-to-cell mobile. |
| AT1G06750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT1G06820 | Encodes carotenoid isomerase. Catalyzes the isomerization of poly-cis-carotenoids to all-trans-carotenoids. Together with PDS and ZDS, CRTiso is required to complete the synthesis of lycopene from phytoene. |
| AT1G06850 | bZIP protein involved in heat stress response. Under heat stress localization moves exclusively to nucleus. |
| AT1G06860 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT1G06920 | Encodes OFP4, a member of the plant specific ovate family proteins. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. OFP4 interacts with KNAT7 to regulate secondary cell wall formation. |
| AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
| AT1G06930 | TPRXL;(source:Araport11) |
| AT1G06950 | Encodes a protein thought to be a part of the translocon at the chloroplast inner envelope. Involved in protein import into the chloroplast and chloroplast biogenesis. C-terminal half of Tic110 functions as scaffolds for protein-protein interactions. |
| AT1G06970 | member of Putative Na+/H+ antiporter family |
| AT1G06980 | PADRE protein |
| AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G07050 | FITNESS encodes a protein with a single CCT domain and belongs to the CCT motif family genes (CMF). FITNESS acts upstream JUB1 thereby controlling H2O2 levels. FITNESS has a role in cellular redox homeostasis controlling H2O2 levels, due to changes in enzymes, metabolites and transcripts related to ROS detoxification. |
| AT1G07051 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCACUCCUCUUCUUCUUGAUG |
| AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT1G07120 | CHUP1-like protein;(source:Araport11) |
| AT1G07130 | Encodes a protein with similarity to yeast STN1, an OB fold protein involved in protecting yeast telomeres. In Arabidopsis, loss of STN1 function mutations exhibit gross morphological abnormalities and defects in telomere architecture and maintenance. STN1 likely plays a role in telomere end capping. |
| AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
| AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
| AT1G07190 | Lon protease;(source:Araport11) |
| AT1G07220 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G07250 | UDP-glucosyl transferase 71C4;(source:Araport11) |
| AT1G07260 | Encodes a uridine diphosphate-glycosyltransferase that acts on methyl salicylate (MeSA) to form MeSA glucosides in vitro and in vivo and facilitates negative regulation of the SAR response by modulating homeostasis of MeSA and SA. |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G07290 | Encodes a GDP-mannose transporter. |
| AT1G07340 | sugar transporter 2;(source:Araport11) |
| AT1G07420 | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. The sterol 4alpha-methyl oxidase2 family proteins SMO2-1 and SMO2-2 function partially through effects on auxin accumulation, auxin response and PIN1 expression to regulate embryogenesis in Arabidopsis. |
| AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
| AT1G07460 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT1G07490 | ROTUNDIFOLIA like 3;(source:Araport11) |
| AT1G07520 | GRAS family transcription factor;(source:Araport11) |
| AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
| AT1G07540 | Arabidopsis thaliana telomere-binding protein, putative (At1g07540) |
| AT1G07550 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G07560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G07580 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G07600 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G07740 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G07747 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT1G07750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G07795 | forkhead box protein G1;(source:Araport11) |
| AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT1G07910 | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains, an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
| AT1G07960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G08010 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT1G08030 | Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine). |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT1G08050 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G08070 | Encodes a chloroplast RNA editing factor. |
| AT1G08080 | alpha carbonic anhydrase 7;(source:Araport11) |
| AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
| AT1G08120 | TP53-regulating kinase-like protein;(source:Araport11) |
| AT1G08130 | Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. In addition, it is an important component of the active DNA demethylation machinery and is indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT1G08150 | member of Putative Na+/H+ antiporter family |
| AT1G08170 | Histone superfamily protein;(source:Araport11) |
| AT1G08200 | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
| AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G08240 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT1G08340 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT1G08440 | aluminum activated malate transporter family protein;(source:Araport11) |
| AT1G08465 | Member of the YABBY family of Arabidopsis proteins involved in the abaxial cell fate specification in lateral organs |
| AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
| AT1G08520 | Encodes the CHLD subunit of the Mg-chelatase enzyme involved in chlorophyll biosynthesis. Lines carrying recessive mutations of this locus are white and seedling lethal. |
| AT1G08600 | The Arabidopsis ATRX harbours a N-terminal ADD domain and a C-terminal helicase domain and is devoid of the large central region involved in DAXX interaction in mammals. Arabidopsis ATRX mutant alleles are viable, but with reduced fertility. Their combination with mutants for the H3.3 chaperone HIRA impairs plant survival. ATRX loss affects cellular histone H3.3 pools and modulates the H3.1/H3.3 balance. Notably, at a genome-wide scale, loss of ATRX leads to a reduced H3.3 level at genes characterized by elevated H3.3 occupancy and high expression, including the 45S ribosomal DNA (45S rDNA) loci. Indeed, expression of specific 45S rDNA sequence variants is altered by ATRX loss (DOI:10.1105/tpc.16.00877) |
| AT1G08610 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G08620 | Member of family of Jumonji C (JmjC)-containing demethylases, its catalytic domain exhibits both H3K4 and H3K9 demethylation activities. Together with MMD1 promotes in male meiocytes gene expression in an H3K9me3-dependent manner and thereby contributes to meiotic chromosome condensation. |
| AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
| AT1G08640 | Encodes a choloroplast membrane protein CJD1 (Chloroplast J-like Domain 1). Predicted to contain a transit peptide, three transmembrane domains and an N-terminal J-like domain. Influences fatty acid composition of chloroplast lipids. |
| AT1G08730 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
| AT1G08760 | CORD2 is a member of a novel and plant specific family of microtubule associated proteins. CORD1 binds microtubules via a conserved protein domain shared among family members. CORD functions may overlap;cord1 / cord2 mutants have defects in secondary cell wall pit morphology. |
| AT1G08770 | prenylated RAB acceptor 1.E;(source:Araport11) |
| AT1G08790 | 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilon-1, putative (DUF1685);(source:Araport11) |
| AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G08810 | putative transcription factor of the R2R3-MYB gene family. Transcript increases under conditions that promote stomatal opening (white and blue light, abi1-1 mutation) and decreases under conditions that trigger stomatal closure (ABA, desiccation, darkness), with the exception of elevated CO2. Expressed exclusively in guard cells of all tissues. It is required for light-induced opening of stomata. Mutant shows reduced stomatal aperture which helps to limit water loss during drought. |
| AT1G08860 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Overexpression of this gene suppresses bon1-1 phenotypes. Double mutant analyses with bon1-1 suggest that BON1 and BON3 have overlapping functions in maintaining cellular homeostasis and inhibiting cell death. |
| AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT1G09000 | NPK1-related protein kinase 1S |
| AT1G09020 | Component of the regulatory subunit of SNF1-related protein kinase. As part of the regulatory complex it binds maltose which promotes kinase activity. |
| AT1G09070 | SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. The mRNA is cell-to-cell mobile. |
| AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT1G09110 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT1G09155 | phloem protein 2-B15;(source:Araport11) |
| AT1G09160 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G09170 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT1G09176 | transmembrane protein;(source:Araport11) |
| AT1G09190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G09220 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G09280 | rhodanese-like domain protein;(source:Araport11) |
| AT1G09320 | Heterochromatin-binding protein which can bind to three H3K9me2 tails. Preferentially binds to long TEs. Required for transcriptional silencing, non-CG DNA methylation, and H3K9 dimethylation at some loci. |
| AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G09380 | nodulin MtN21-like transporter family protein |
| AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT1G09410 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G09570 | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
| AT1G09575 | Mitochondrial calcium channel. |
| AT1G09610 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT1G09640 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
| AT1G09645 | transmembrane protein;(source:Araport11) |
| AT1G09680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G09710 | Paralog of DRMY1 with unknown function. |
| AT1G09720 | Member of NET domain family of actin binding proteins. Paralog of At3g22790 (NET2A). |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G09770 | Member of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1. The mRNA is cell-to-cell mobile. |
| AT1G09780 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT1G09795 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT1G09812 | multidrug resistance protein;(source:Araport11) |
| AT1G09820 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G09860 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G09870 | histidine acid phosphatase family protein;(source:Araport11) |
| AT1G09880 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT1G09890 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT1G09920 | TRAF-type zinc finger-like protein;(source:Araport11) |
| AT1G09930 | oligopeptide transporter |
| AT1G09932 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G09935 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
| AT1G10020 | formin-like protein (DUF1005);(source:Araport11) |
| AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT1G10060 | encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
| AT1G10160 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.9e-39 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G10170 | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
| AT1G10210 | Encodes ATMPK1. Kinase is activated by wounding. |
| AT1G10220 | ZCF37;(source:Araport11) |
| AT1G10270 | glutamine-rich protein 23;(source:Araport11) |
| AT1G10290 | involved in trafficking from the trans-Golgi Network to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT1G10300 | GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1. |
| AT1G10310 | encodes a NADPH-dependent pterin aldehyde reductase that accepts pterin aldehyde as well as dihydropterin aldehyde as substrates involved in metabolism and salvage of folate and its derivatives. |
| AT1G10320 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G10380 | Putative membrane lipoprotein;(source:Araport11) |
| AT1G10385 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT1G10450 | Encodes SIN3-like 6, a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT1G10530 | PADRE protein |
| AT1G10538 | pseudogene of CPL4 (phosphoprotein phosphatase) |
| AT1G10540 | nucleobase-ascorbate transporter 8;(source:Araport11) |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G10580 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G10610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G10620 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress. |
| AT1G10680 | P-glycoprotein 10;(source:Araport11) |
| AT1G10730 | Clathrin adaptor complexes medium subunit family protein;(source:Araport11) |
| AT1G10770 | Encodes a putative pectin methylesterase/invertase inhibitor. Anti-sense reduction of this gene's transcript results in pollen tube growth retardation and then partial male sterility and reduced seed set. |
| AT1G10790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G10810 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G10880 | Putative role in response to salt stress. Mutants grow larger than the wild type under salt stress condition (Ann Stapleton and Ashley Green, 2009, personal communication). |
| AT1G10890 | arginine/glutamate-rich 1 protein;(source:Araport11) |
| AT1G10910 | Member of the P subfamily of PRR proteins. Loss of function results in defects in abnormal plastid RNA edit and chloroplast biogenesis |
| AT1G10980 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT1G11030 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
| AT1G11040 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G11090 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
| AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
| AT1G11250 | member of SYP12 Gene Family |
| AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
| AT1G11265 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-253 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G11300 | The annotation for At1g11300 in TAIR10 is incorrect. This locus has been split into two At1g11300 (symbol: EGM1) and At1g11305 (symbol: EGM2) (Olivier Loudet, personal communication, 2013-04-03). See Comment field for revised annotation. |
| AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
| AT1G11330 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G11380 | PLAC8 family protein;(source:Araport11) |
| AT1G11390 | Atypical kinase which functions in plant salt stress tolerance by regulating reactive oxygen species (ROS). |
| AT1G11410 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT1G11482 | pseudogene of hypothetical protein (DUF295);(source:Araport11) |
| AT1G11500 | DUF1218 family member. |
| AT1G11520 | pliceosome associated protein-like protein;(source:Araport11) |
| AT1G11545 | xyloglucan endotransglucosylase/hydrolase 8;(source:Araport11) |
| AT1G11570 | NTF2-like protein;(source:Araport11) |
| AT1G11572 | Encodes a Plant thionin family protein |
| AT1G11600 | member of CYP77B |
| AT1G11608 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G11620 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G11670 | MATE efflux family protein;(source:Araport11) |
| AT1G11690 | BRANCHLESS TRICHOME-like protein;(source:Araport11) |
| AT1G11700 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G11740 | ankyrin repeat family protein;(source:Araport11) |
| AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G11800 | endonuclease/exonuclease/phosphatase family protein;(source:Araport11) |
| AT1G11803 | pseudogene of (SAUR) auxin-responsive family protein |
| AT1G11850 | transmembrane protein;(source:Araport11) |
| AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
| AT1G11915 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT1G11920 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G11925 | Encodes a Stigma-specific Stig1 family protein |
| AT1G11930 | Putative pyridoxal phosphate-dependent enzyme, YBL036C type;(source:Araport11) |
| AT1G11950 | Transcription factor jumonji (jmjC) domain-containing protein;(source:Araport11) |
| AT1G11990 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G12000 | Phosphofructokinase family protein;(source:Araport11) |
| AT1G12040 | encodes a a chimeric leucine-rich repeat/extensin protein that regulates root hair morphogenesis and elongation. Null mutants develop root hairs that frequently abort, swell, or branch. Gene is expressed in root hair cells and protein is specifically localized in the wall of the hair proper. The mRNA is cell-to-cell mobile. |
| AT1G12080 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
| AT1G12090 | extensin-like protein (ELP) |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT1G12130 | Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates. |
| AT1G12140 | Encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates. It is a suppressor of the bp mutant phenotype. |
| AT1G12150 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
| AT1G12160 | Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates. |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G12260 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT1G12280 | Encodes a NB-LRR protein SUMM2 involved in defense response to bacterium. |
| AT1G12320 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT1G12360 | encodes a Sec1 protein and expressed throughout the plant. physically interacts with Syntaxin1 and is required for cytokinesis. |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G12470 | zinc ion binding protein;(source:Araport11) |
| AT1G12500 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G12590 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT1G12630 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G12700 | Encodes RNA PROCESSING FACTOR 1 (RPF1), a pentatricopeptide repeat (PPR) protein of the P-class containing canonical PPR-repeats. RPF1 is required for the 5?-end processing of the nad4 mRNA in mitochondria. Ler and other accessions impaired in processing of the nad4 mRNA 5′-end, contain a single nucleotide polymorphism (SNP) 807 nucleotides downstream of the predicted translation start codon (G807A). The resulting premature translation termination codon abolishes the function of the RPF1 gene in Ler. Required for the formation of nad4L-atp4 transcripts with -318 5′ termini. |
| AT1G12725 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G28570.1);(source:TAIR10) |
| AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G12850 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G12855 | F-box family protein;(source:Araport11) |
| AT1G12870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G12920 | Encodes a eukaryotic release factor one homolog. |
| AT1G12940 | member of High affinity nitrate transporter family |
| AT1G12960 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
| AT1G13020 | Encodes eIF4B2, eukaryotic initiation factor 4B2. |
| AT1G13050 | proline-rich receptor-like kinase;(source:Araport11) |
| AT1G13070 | putative cytochrome P450 |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT1G13090 | putative cytochrome P450 |
| AT1G13100 | putative cytochrome P450 |
| AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
| AT1G13130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT1G13140 | member of CYP86C |
| AT1G13160 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G13190 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G13195 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G13200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G13220 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
| AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile. |
| AT1G13290 | Encodes a putative zinc finger protein (C2H2 family, type IIIA, subclass A1d) that has a WIP domain. Seedlings with mutations in DOT5 have a misaligned venation defect in their leaves and cotyledons. Additional developmental abnormalities, such as elongated petioles and aberrant phyllotaxy suggest that DOT5 is required for normal shoot and root development. |
| AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G13360 | hypothetical protein;(source:Araport11) |
| AT1G13370 | Histone superfamily protein;(source:Araport11) |
| AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
| AT1G13390 | translocase subunit seca;(source:Araport11) |
| AT1G13410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G13430 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT1G13440 | The expression level of GAPC-2 is upregulated in Arabidopsis seedlings exposed to cadmium. |
| AT1G13470 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G13480 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G13485 | hypothetical protein;(source:Araport11) |
| AT1G13490 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G13520 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G13570 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G13580 | Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
| AT1G13590 | Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus. |
| AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
| AT1G13610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G13620 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G13680 | Encodes a phospholipase C-like protein that serves as a convergence point for fumonisin B1 and extracellular ATP signalling, and functions in Arabidopsis stress response to fumonisin B1. |
| AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
| AT1G13730 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
| AT1G13820 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G13860 | Encodes QUASIMODO2 LIKE1 (QUL1), a paralog of QUASIMODO2 (QUA2). AT1G78240 (QUA2), AT1G13860 (QUL1) and AT2G03480 (QUL2) form a clade with a possible role in plant vasculature development. |
| AT1G13920 | Remorin family protein;(source:Araport11) |
| AT1G13950 | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced. |
| AT1G13960 | Encodes WRKY DNA-binding protein 4 (WRKY4). |
| AT1G13970 | beta-hexosaminidase (DUF1336);(source:Araport11) |
| AT1G14030 | Encodes a lysine methyltransferase whose main soluble physiological substrates are chloroplastic fructose 1,6-bisphosphate aldolases, FBA1, FBA2, and FBA3. Lysines near the C-terminal end of the target proteins are trimethylated. |
| AT1G14070 | member of Xyloglucan fucosyltransferase family |
| AT1G14090 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G14100 | member of Glycosyltransferase Family- 37. FUT8 was previously associated to AT1G14110 |
| AT1G14160 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G14180 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G14185 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT1G14190 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT1G14200 | E3 ligase involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT1G14210 | Ribonuclease T2 family protein;(source:Araport11) |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT1G14250 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT1G14260 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G14270 | CAAX amino terminal protease family protein;(source:Araport11) |
| AT1G14280 | Encodes phytochrome kinase substrate 2. PKS proteins are critical for hypocotyl phototropism. Forms a complex with Phot1, Phot2 and NPH3. |
| AT1G14315 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G14330 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
| AT1G14390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G14410 | Encodes a homolog of the potato p24 protein. Binds single strand telomeric repeats. Negatively regulates telomerase activity and telomere length. |
| AT1G14420 | Pectate lyase family protein;(source:Araport11) |
| AT1G14500 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G14510 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT1G14518 | other_RNA;(source:Araport11) |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G14640 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT1G14650 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein;(source:Araport11) |
| AT1G14686 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G14688 | E3 ubiquitin ligase;(source:Araport11) |
| AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT1G14770 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT1G14790 | Encodes RNA-dependent RNA polymerase. While not required for virus-induced post-transcriptional gene silencing (PTGS), it can promote turnover of viral RNAs in infected plants. Nomenclature according to Xie, et al. (2004). Involved in the production of Cucumber Mosaic Virus siRNAs. |
| AT1G14810 | encodes an aspartate semialdehyde dehydrogenase, which produces the branch point intermediate for lysine and threonine/methionine biosynthesis |
| AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT1G14940 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G15060 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
| AT1G15160 | MATE efflux family protein;(source:Araport11) |
| AT1G15175 | Natural antisense transcript overlaps with AT1G15170;(source:Araport11) |
| AT1G15180 | MATE efflux family protein;(source:Araport11) |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
| AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
| AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
| AT1G15220 | Encodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2. |
| AT1G15330 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
| AT1G15370 | TPLATE adaptor complex subunit. |
| AT1G15405 | other_RNA;(source:Araport11) |
| AT1G15460 | Encodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions. |
| AT1G15480 | PPR motif containing protein. Found in mitochondria. Mutants flower early and have reduced levels of the ABI5, a regulator of FLC expression. |
| AT1G15500 | TLC ATP/ADP transporter;(source:Araport11) |
| AT1G15510 | Encodes a pentatricopeptide repeat protein required for chloroplast transcript accD RNA editing and early chloroplast biogenesis. |
| AT1G15520 | ABC transporter family involved in ABA transport and resistance to lead. Localizes to plasma membrane. Upregulated by lead. Expressed in leaves, flowers, stomata and roots. |
| AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G15560 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G15570 | A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues. |
| AT1G15590 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT1G15680 | F-box family protein;(source:Araport11) |
| AT1G15772 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT1G15790 | mediator of RNA polymerase II transcription subunit 15a-like protein;(source:Araport11) |
| AT1G15830 | hypothetical protein;(source:Araport11) |
| AT1G15850 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
| AT1G15990 | Encodes a plasma membrane localized member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT1G16022 | transmembrane protein;(source:Araport11) |
| AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
| AT1G16070 | Member of TLP family |
| AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
| AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
| AT1G16160 | WAK-like kinase The mRNA is cell-to-cell mobile. |
| AT1G16190 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT1G16225 | Target SNARE coiled-coil domain protein;(source:Araport11) |
| AT1G16280 | Encodes a putative DEAD-box RNA helicase. Essential for female gametogenesis. |
| AT1G16290 | transglycosylase;(source:Araport11) |
| AT1G16310 | Cation efflux family protein which affects ABA-JA crosstalk and susceptibility to Mamestra brassicae herbivory. |
| AT1G16320 | plant/protein (DUF2358);(source:Araport11) |
| AT1G16330 | core cell cycle genes |
| AT1G16340 | Encodes a protein with putative 3-deoxy-D-manno-octulosonic acid 8-phosphate synthetase activity. This gene share a very high sequence homology with its homologue AtkdsA1 (AT1G79500). |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT1G16380 | member of Putative Na+/H+ antiporter family |
| AT1G16390 | organic cation/carnitine transporter 3;(source:Araport11) |
| AT1G16420 | Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0. |
| AT1G16440 | Member of AGC VIIIa Kinase gene family. Invovled in the maintenance of (p)ppGpp level to accustom plastidial gene expression to darkness. |
| AT1G16460 | encodes a cytoplasmic thiosulfate:cyanide sulfurtransferase, activity of which increased the rhodanese activity of transgenic yeast. Can also act as a mercaptopyruvate sulfurtransferase. |
| AT1G16500 | filamentous hemagglutinin transporter;(source:Araport11) |
| AT1G16530 | ASYMMETRIC LEAVES 2-like 9;(source:Araport11) |
| AT1G16560 | Per1-like family protein;(source:Araport11) |
| AT1G16570 | Encodes a encodes a putative UDP-glycosyltransferase superfamily protein belonging to the glycosyltransferase (GT) family 33 that is localized to the endoplasmic reticulum. Loss of function alleles are male sterile, with pollen tubes bursting after germination. Loss of function also causes increased callose deposition in the female gametophyte, pollen tube overgrowth and reduced transmission. |
| AT1G16660 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-268 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G16710 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides. |
| AT1G16740 | Ribosomal protein L20;(source:Araport11) |
| AT1G16750 | GPI-anchored adhesin-like protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G16760 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G16770 | hypothetical protein;(source:Araport11) |
| AT1G16900 | Encodes the Arabidopsis ortholog of the yeast/human ALG9 catalyzing the luminal addition of two alpha-1,2 Man residues in assembling Glc3Man9GlcNAc2. |
| AT1G16905 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT1G16940 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G16950 | transmembrane protein;(source:Araport11) |
| AT1G16960 | Ubiquitin domain-containing protein;(source:Araport11) |
| AT1G16980 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
| AT1G17000 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
| AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G17020 | Encodes a novel member of the Fe(II)/ascorbate oxidase gene family; senescence-related gene. |
| AT1G17030 | hypothetical protein;(source:Araport11) |
| AT1G17060 | Encodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls. |
| AT1G17140 | Encodes a ROP/RAC effector, designated interactor of constitutive active ROPs 1 (ICR1), that interacts with GTP-bound ROPs. ICR1 is a scaffold mediating formation of protein complexes that are required for cell polarity. ICR1 is comprised of coiled-coil domains and forms complexes with itself and the exocyst vesicle-tethering complex subunit SEC3. |
| AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
| AT1G17170 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). It is involved in the detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plants over-expressing At1g17170 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
| AT1G17180 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plant over-expressing At1g17180 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
| AT1G17240 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. |
| AT1G17255 | Natural antisense transcript overlaps with AT1G17250;(source:Araport11) |
| AT1G17270 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G17310 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G17370 | Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA. |
| AT1G17380 | jasmonate-zim-domain protein 5;(source:Araport11) |
| AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
| AT1G17410 | Nucleoside diphosphate kinase family protein;(source:Araport11) |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT1G17480 | Transient expression of Pro35S:GFP-IQD7 in leaves of N. benthamiana alters microtubule organization, in patterns similar to Pro35S:GFP-IQD8 and Pro35S:GFP-IQD6.Member of IQ67 (CaM binding) domain containing family. |
| AT1G17495 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-213 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G17510 | hypothetical protein;(source:Araport11) |
| AT1G17540 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
| AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
| AT1G17615 | TN2 is an atypical TIR-NBS protein that lacks the LRR domain common in typical NLR receptors. It interacts with EXO70B1, a subunit of the exocyst complex. Loss of function mutants in TN2 can suppress EXO70B1 mutants suggesting that EXO70B1 acts through TN2. |
| AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G17650 | Glyoxylate reductase located in chloroplasts. |
| AT1G17700 | prenylated RAB acceptor 1.F1;(source:Araport11) |
| AT1G17744 | hypothetical protein;(source:Araport11) |
| AT1G17760 | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex. |
| AT1G17770 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A paternally expressed imprinted gene. |
| AT1G17780 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT1G17930 | Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing. |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G17950 | putative transcription factor: R2R3-MYB transcription family |
| AT1G17960 | Threonyl-tRNA synthetase;(source:Araport11) |
| AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G17980 | Encodes a poly(A) polymerase. Located in the nucleus. It limits founder-cell recruitment to organ primordia and suppresses the salicylic acid-independent immune response downstream of EDS1/PAD4. |
| AT1G18060 | localized to chloroplasts |
| AT1G18150 | Encodes mitogen-activated protein kinase 8 (MPK8). MPK8 connects protein phosphorylation, Ca2+, and ROS in the wound-signaling pathway. |
| AT1G18191 | Pseudogene of AT1G18200; AtRABA6b (Arabidopsis Rab GTPase homolog A6b); GTP binding |
| AT1G18265 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G18270 | ketose-bisphosphate aldolase class-II family protein;(source:Araport11) |
| AT1G18300 | nudix hydrolase homolog 4;(source:Araport11) |
| AT1G18310 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
| AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
| AT1G18390 | Serine/Threonine kinase family catalytic domain protein;(source:Araport11) |
| AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT1G18410 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G18415 | Natural antisense transcript overlaps with AT1G18420;(source:Araport11) |
| AT1G18420 | Involved in malate efflux response to P-deficiency in root hairs. |
| AT1G18470 | Putative C3HC4 zinc-finger ubiquitin E3 ligase that is induced by ABA and plays a positive role in ABA signaling. |
| AT1G18485 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G18490 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT1G18510 | Member of TETRASPANIN family |
| AT1G18530 | Calmodulin like protein. Paralog of CML16. Expression in flowers is restricted to anthers and mature pollen. |
| AT1G18540 | Ribosomal protein L6 family protein;(source:Araport11) |
| AT1G18590 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with preference with methionine-derived desulfoglucosinolates. |
| AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
| AT1G18790 | RWP-RK domain-containing protein;(source:Araport11) |
| AT1G18810 | phytochrome kinase substrate-like protein;(source:Araport11) |
| AT1G18830 | Together with SEC31B a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT1G18840 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G18860 | member of WRKY Transcription Factor; Group II-b |
| AT1G18871 | hypothetical protein;(source:Araport11) |
| AT1G18879 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AUCAGUUUCUUGUUCGUUUCA |
| AT1G18890 | encodes a calcium-dependent protein kinase whose gene expression is induced by dehydration and high salt. Kinase activity could not be detected in vitro. |
| AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G18910 | E3 ubiquitin ligase that functions redundantly in the root with BTSL1 to negatively regulate iron uptake. |
| AT1G18960 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G18970 | Encodes a germin-like protein with possible oxalate oxidase activity (based on GenBank record). |
| AT1G19020 | Modulates defense against bacterial pathogens and tolerance to oxidative stress. |
| AT1G19040 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G19086 | hypothetical protein;(source:Araport11) |
| AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
| AT1G19160 | F-box family protein;(source:Araport11) |
| AT1G19200 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT1G19240 | transmembrane protein;(source:Araport11) |
| AT1G19250 | FMO1 is required for full expression of TIR-NB-LRR conditioned resistance to avirulent pathogens and for basal resistance to invasive virulent pathogens. Functions in an EDS1-regulated but SA-independent mechanism that promotes resistance and cell death at pathogen infection sites. FMO1 functions as a pipecolate N-hydroxylase and catalyzes the biochemical conversion of pipecolic acid to N-hydroxypipecolic acid (NHP). NHP systemically accumulates in the plant foliage and induces systemic acquired resistance to pathogen infection. |
| AT1G19260 | Encodes a ceramide synthase that uses very-long- chain fatty acyl-CoA and trihydroxy LCB substrates. |
| AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
| AT1G19371 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
| AT1G19390 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G19440 | Encodes KCS4, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G19470 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G19485 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G19490 | Putative bZIP transcription factor. Expression is induced by drought and mutants are sensitive to drought. |
| AT1G19510 | RAD-like 5;(source:Araport11) |
| AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
| AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
| AT1G19560 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G19600 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT1G19610 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G19630 | cytochrome P450, family 722, subfamily A, polypeptide 1;(source:Araport11) |
| AT1G19640 | Encodes a S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase that catalyzes the formation of methyljasmonate from jasmonic acid. Its expression is induced in response to wounding or methyljasmonate treatment. |
| AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G19660 | Wound-responsive family protein;(source:Araport11) |
| AT1G19690 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G19700 | Encodes a member of the BEL family of homeodomain proteins. Its interaction with PLP (PAS/LOV PROTEIN) is diminished by blue light. |
| AT1G19710 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G19715 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT1G19830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19835 | TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly. |
| AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
| AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
| AT1G19930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G19940 | glycosyl hydrolase 9B5;(source:Araport11) |
| AT1G20000 | Encodes TAF11b, a putative TBP-associated factor (TBP: TATA binding protein). |
| AT1G20080 | Encodes a synaptotagmin localized on the Golgi apparatus and that regulates protein secretion via the unconventional protein transport from the cytosol to the extracellular matrix in plant cells. |
| AT1G20130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G20150 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
| AT1G20240 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT1G20260 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
| AT1G20280 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
| AT1G20290 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT1G20310 | syringolide-induced protein;(source:Araport11) |
| AT1G20320 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT1G20360 | F-box family protein;(source:Araport11) |
| AT1G20400 | hypothetical protein (DUF1204);(source:Araport11) |
| AT1G20440 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock. |
| AT1G20500 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G20540 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G20570 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT1G20650 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G20670 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT1G20735 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT1G20750 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
| AT1G20760 | EH domain containing protein. |
| AT1G20790 | F-box family protein;(source:Araport11) |
| AT1G20795 | F-box family protein;(source:Araport11) |
| AT1G20800 | F-box family protein |
| AT1G20830 | Encodes MCD1 (MULTIPLE CHLOROPLAST DIVISION SITE 1). Determines the site of chloroplast division in concert with MinD (AT5G24020). |
| AT1G20850 | Cysteine peptidase. Enzyme activity detected in leaf. |
| AT1G20860 | Encodes Pht1;8, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G20875 | hypothetical protein;(source:Araport11) |
| AT1G20890 | caveolin-1 protein;(source:Araport11) |
| AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
| AT1G20920 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G20940 | F-box family protein;(source:Araport11) |
| AT1G20970 | calponin-like domain protein;(source:Araport11) |
| AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
| AT1G20990 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G21050 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G21070 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G21100 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G21240 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
| AT1G21260 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-23 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G21270 | cytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase. |
| AT1G21290 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-25 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G21320 | nucleic acid/nucleotide binding protein;(source:Araport11) |
| AT1G21330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10) |
| AT1G21340 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
| AT1G21430 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT1G21440 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT1G21470 | hypothetical protein;(source:Araport11) |
| AT1G21480 | Exostosin family protein;(source:Araport11) |
| AT1G21520 | hypothetical protein;(source:Araport11) |
| AT1G21528 | hypothetical protein;(source:Araport11) |
| AT1G21529 | DRIR is a 755 nt long non coding RNA. Over-expression results in plants with increased salt and drought tolerance and ABA sensitivity. DRIR probably regulates the accumulation of genes involved in drought stress response. DRIR likely acts as a regulator of drought stress responsive gene expression. |
| AT1G21530 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G21540 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G21560 | hypothetical protein;(source:Araport11) |
| AT1G21620 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G21640 | Encodes a protein with NAD kinase activity. The protein was also shown to bind calmodulin. |
| AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
| AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G21810 | Encodes a protein that localizes at motile vesicle-like small compartments in differentiating xylem cells that is associated with microtubule plus-ends. VETH-positive compartments are unlikely to be elements in conventional endomembrane trafficking pathways. It can associate with COG2, and together these two proteins co-localize with the EXO70A1 exocyst subunit, tethering EXO70A1 to compartments associated with cortical microtubules. |
| AT1G21850 | SKU5 similar 8;(source:Araport11) |
| AT1G21900 | Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER. |
| AT1G21910 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G21960 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G21980 | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
| AT1G21990 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G22020 | Encodes a putative serine hydroxymethyltransferase. |
| AT1G22050 | membrane-anchored ubiquitin-fold protein 6 precursor;(source:Araport11) |
| AT1G22080 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G22090 | hypothetical protein;(source:Araport11) |
| AT1G22100 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
| AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
| AT1G22150 | sulfate transporter Sultr1;3 |
| AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G22200 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
| AT1G22210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G22240 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G22270 | Encodes SMO2 (Small Organ 2). Modulates progression of cell division during organ growth. |
| AT1G22290 | 14-3-3 family protein;(source:Araport11) |
| AT1G22310 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT1G22340 | UDP-glucosyl transferase 85A7;(source:Araport11) |
| AT1G22350 | pseudogene of UDP-glucosyl transferase 85A5;(source:Araport11) |
| AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
| AT1G22380 | Encodes a putative UDP-glucosyl transferase. At1g22380 was initially identified as encoding the protein AAF87154, which has been classified as a bHLH protein (AtbHLH152). Subsequently it has been found that the AAF87154 protein appears to be encoded by the AT1G23970 genomic locus. |
| AT1G22400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G22403 | other_RNA;(source:Araport11) |
| AT1G22410 | Class-II DAHP synthetase family protein;(source:Araport11) |
| AT1G22420 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G22430 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G22460 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G22500 | Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus. |
| AT1G22510 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT1G22530 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G22560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-20 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G22580 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 32%25 identity and 1.1e-13 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT1G22600 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G22650 | Plant neutral invertase family protein;(source:Araport11) |
| AT1G22660 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT1G22700 | Encodes a TPR protein with homology to Ycf37 from Synechocystis that is localized to the thylakoid membrane and is involved in photosystem I biogenesis. |
| AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
| AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
| AT1G22790 | Low affinity potassium transport system protein;(source:Araport11) |
| AT1G22840 | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. Double mutants with CYTC-2 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
| AT1G22880 | cellulase 5;(source:Araport11) |
| AT1G22882 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G22885 | transmembrane protein;(source:Araport11) |
| AT1G22910 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G22930 | T-complex protein 11;(source:Araport11) |
| AT1G22940 | Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media. |
| AT1G22985 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT1G22990 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
| AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G23060 | hypothetical protein;(source:Araport11) |
| AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G23090 | Encodes AST91 mRNA for sulfate transporter. |
| AT1G23150 | hypothetical protein;(source:Araport11) |
| AT1G23180 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G23190 | Encodes a cytosolic phosphoglucomutase (PGM). Two Arabidopsis PGM proteins (AT1G70730/PGM2 and AT1G23190/PGM3) have high sequence similarities and redundant functions. Mature plants possessing a single cPGM allele had a major reduction in cPGM activity. Whereas pgm2 and pgm3 single mutants are undistinguishable from the wild type, loss of both PGM2 and PGM3 severely impairs male and female gametophyte development. The mRNA is cell-to-cell mobile. |
| AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
| AT1G23205 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G23240 | Caleosin-related family protein |
| AT1G23300 | MATE efflux family protein;(source:Araport11) |
| AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G23340 | carboxyl-terminal proteinase, putative (DUF239);(source:Araport11) |
| AT1G23380 | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants. |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G23410 | cytosolic ribosomal protein gene, part of eS31 family |
| AT1G23450 | pentatricopeptide (PPR) repeat-containing protein |
| AT1G23510 | OBP32pep protein;(source:Araport11) |
| AT1G23520 | hypothetical protein (DUF220);(source:Araport11) |
| AT1G23530 | transmembrane protein;(source:Araport11) |
| AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
| AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
| AT1G23580 | transmembrane protein, putative (Domain of unknown function DUF220);(source:Araport11) |
| AT1G23590 | OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11) |
| AT1G23600 | OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11) |
| AT1G23610 | hypothetical protein;(source:Araport11) |
| AT1G23640 | OBP32pep protein;(source:Araport11) |
| AT1G23650 | hypothetical protein;(source:Araport11) |
| AT1G23690 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
| AT1G23700 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G23740 | AOR is an alkenal/one oxidoreductase that acts on compounds with unsaturated alpha,beta-carbonyls. The activity of this enzyme with a number of substrates, including acrolein and 3-buten-2-one, was demonstrated in vitro using a truncated form of the protein that lacked approximately 80 of the first amino acids. This protein appears to localize to the chloroplast where it likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT1G23790 | dicer-like protein (DUF936);(source:Araport11) |
| AT1G23830 | transmembrane protein;(source:Araport11) |
| AT1G23840 | transmembrane protein;(source:Araport11) |
| AT1G24030 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G24062 | Encodes a defensin-like (DEFL) family protein. |
| AT1G24068 | other_RNA;(source:Araport11) |
| AT1G24070 | encodes a gene similar to cellulose synthase |
| AT1G24095 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT1G24110 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G24147 | transmembrane protein;(source:Araport11) |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G24180 | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900. Serine 296 phosphorylation of IAR4 has critical function in root hair formation and root development. Changing Ser296 in IAR4 to Ala resulted in a phenotype intermediate between mutant and wild-type, while substitution to Asp was either lethal or caused an extreme dwarf phenotype. |
| AT1G24200 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G24212 | pseudogene of paired amphipathic helix repeat-containing protein |
| AT1G24220 | paired amphipathic helix repeat-containing protein;(source:Araport11) |
| AT1G24250 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G24256 | hypothetical protein;(source:Araport11) |
| AT1G24267 | bZIP transcription factor, putative (DUF1664);(source:Araport11) |
| AT1G24270 | hypothetical protein;(source:Araport11) |
| AT1G24320 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT1G24400 | High-affinity transporter for neutral and acidic amino acids, expressed in tapetum tissue of anthers. Transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
| AT1G24420 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G24540 | member of CYP86C |
| AT1G24560 | Effector molecule of the plant-unique RAB5, ARA6. Acts in the vacuolar/endocytic trafficking pathway with canonical RAB5 and SYP. Promotes recruitment of VSP9a onto the endosome, which is required for efficient RAB5 activation. Colocalizes with RAB5 on endosomes, where it coordinates transport with canonical RAB5. |
| AT1G24570 | transmembrane protein, putative (DUF707);(source:Araport11) |
| AT1G24577 | hypothetical protein;(source:Araport11) |
| AT1G24580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G24590 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and LEAFY PETIOLE. This gene functions in the regeneration of shoots in tissue culture, probably through transcriptional regulation of CUC1. May also be involved in activation of the cell cycle via CycD1;1. |
| AT1G24625 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G24640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G24706 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. Mutations in THO have severe developmental defects and affect the production of several different classes of small RNAs indicating a broader role in small RNA biosynthesis. |
| AT1G25240 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT1G25250 | Encodes a transcription factor that, together with IDD14 and IDD15, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses . IDD16 also binds to the SPCH promoter and regulates stomata initiation. |
| AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G25310 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT1G25370 | hypothetical protein (DUF1639);(source:Araport11) |
| AT1G25380 | Encodes a mitochondrial-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G25490 | One of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem |
| AT1G25500 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
| AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT1G26100 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT1G26110 | Encodes Decapping 5, required for mRNA decapping, P-body formation and translational repression during postembryonic development. |
| AT1G26140 | hypothetical protein;(source:Araport11) |
| AT1G26150 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G26200 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G26290 | hypothetical protein;(source:Araport11) |
| AT1G26300 | BSD domain-containing protein;(source:Araport11) |
| AT1G26340 | encodes a member of the cytochromes b5 family of proteins that localizes to the outer envelope of the chloroplast. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro. |
| AT1G26350 | hypothetical protein;(source:Araport11) |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT1G26390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26420 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26450 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G26570 | UDP-glucose dehydrogenase 1;(source:Araport11) |
| AT1G26580 | ELM2 domain protein;(source:Araport11) |
| AT1G26590 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G26600 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT1G26620 | T-box transcription factor, putative (DUF863);(source:Araport11) |
| AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
| AT1G26660 | Prefoldin chaperone subunit family protein;(source:Araport11) |
| AT1G26680 | transcriptional factor B3 family protein;(source:Araport11) |
| AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G26700 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G26710 | transmembrane protein;(source:Araport11) |
| AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G26760 | SET domain protein 35;(source:Araport11) |
| AT1G26762 | transmembrane protein;(source:Araport11) |
| AT1G26770 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G26780 | Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560). |
| AT1G26790 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G26797 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G26798 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT1G26820 | Encodes ribonuclease RNS3. |
| AT1G26830 | Cullin, putative, similar to Cullin homolog 3 (CUL-3) SP:Q13618, GI:3639052 from (Homo sapiens); contains Pfam profile PF00888: Cullin family. Interacts with other components of E3 ligase complex suggesting it functions in RUB-modification. Forms complexes with BTB domain proteins forming a novel class of E3-based ubiquitin protein-ligase complexes. Mutant is early flowering and has a reduced sensitivity to far-red light. cul3a/cul3b homozygous/heterozygous plants are embryo lethal. |
| AT1G26870 | NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
| AT1G26880 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT1G26910 | Ribosomal protein L16p/L10e family protein;(source:Araport11) |
| AT1G26911 | Pseudogene of AT1G66590; cox19 family protein |
| AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT1G27040 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
| AT1G27090 | glycine-rich protein;(source:Araport11) |
| AT1G27140 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
| AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G27200 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT1G27260 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G27270 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G27290 | transmembrane protein;(source:Araport11) |
| AT1G27385 | phosphoribosylformylglycinamidine synthase;(source:Araport11) |
| AT1G27460 | encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits. The mRNA is cell-to-cell mobile. |
| AT1G27461 | Nuclear localized protein involved in osmotic stress tolerance. |
| AT1G27595 | Encodes a protein of unknown function containing a Symplekin C domain that is involved in negative regulation of glucose response. Mutants show increased sensitivity to glucose with a variety of assays. |
| AT1G27620 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G27660 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G27670 | transmembrane protein;(source:Araport11) |
| AT1G27680 | ADP-glucose pyrophosphorylase catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms of the large subunit (ApL1-4) have been described.Mutational analysis of APS1 suggests that APL1 and APL2 can compensate for loss of APS1 catalytic activity,suggesting both have catalytic as well as regulatory functions. The mRNA is cell-to-cell mobile. |
| AT1G27690 | lipase, putative (DUF620);(source:Araport11) |
| AT1G27710 | Glycine-rich protein family;(source:Araport11) |
| AT1G27740 | Basic helix-loop-helix (bHLH) transcription factor that is sufficient to promote postmitotic cell growth in root-hair cells. RSL4 is a direct transcriptional target of RHD6 |
| AT1G27910 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT1G27940 | P-glycoprotein 13;(source:Araport11) |
| AT1G27970 | Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. The mRNA is cell-to-cell mobile. |
| AT1G27980 | Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response. |
| AT1G27990 | transmembrane protein;(source:Araport11) |
| AT1G28000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G28010 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT1G28020 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G28030 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G28040 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G28080 | RING finger protein;(source:Araport11) |
| AT1G28090 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT1G28110 | serine carboxypeptidase-like 45;(source:Araport11) |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT1G28135 | hypothetical protein;(source:Araport11) |
| AT1G28180 | DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11) |
| AT1G28200 | VirF-interacting protein FIP1 |
| AT1G28220 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
| AT1G28240 | strawberry notch protein (DUF616);(source:Araport11) |
| AT1G28260 | Telomerase activating protein Est1;(source:Araport11) |
| AT1G28280 | VQ motif-containing protein;(source:Araport11) |
| AT1G28300 | Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants. |
| AT1G28305 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G28306 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G28323 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-140 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
| AT1G28370 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G28395 | hypothetical protein;(source:Araport11) |
| AT1G28430 | member of CYP705A |
| AT1G28440 | HAESA-like 1;(source:Araport11) |
| AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
| AT1G28520 | VOZ transcription factor which acts as positive regulator of several salt-responsive genes. Functionally redundant in salt stress with VOZ2. |
| AT1G28560 | Encodes a protein similar to human SNAP50. Mutants display different temperature sensitivities in the dedifferentiation of cells from different organs. Mutation inhibits the dedifferentiation-associated accumulation of U-snRNAs and some other small RNA species encoded by independent-type genes carrying the USE and TATA box. Required for the elevation of cell proliferation competence in hypocotyl dedifferentiation. |
| AT1G28570 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28590 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28591 | Pseudogene of AT1G28610; GDSL-motif lipase, putative |
| AT1G28600 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28640 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28670 | Arabidopsis thaliana lipase |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
| AT1G28930 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G29000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G29010 | verprolin;(source:Araport11) |
| AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
| AT1G29080 | Papain family cysteine protease;(source:Araport11) |
| AT1G29090 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G29100 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G29110 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G29140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G29150 | specifically interacts with FUS6/COP11 via the C-terminal domain of FUS6/COP11 and associates with an ATPase subunit of the 19S proteasome regulatory complex, AtS6A. The mRNA is cell-to-cell mobile. |
| AT1G29160 | Encodes a DOF transcription factor involved in seed coat development. Regulates PRX2 and PRX25, involved in seed longevity. |
| AT1G29170 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT1G29290 | Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2. |
| AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G29360 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-24 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G29460 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29475 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-91 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G29480 | hypothetical protein;(source:Araport11) |
| AT1G29560 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G29570 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G29580 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT1G29600 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G29690 | Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity. |
| AT1G29700 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT1G29710 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G29715 | pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G29720 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G29740 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G29870 | tRNA synthetase class II (G, H, P and S) family protein;(source:Araport11) |
| AT1G29880 | glycyl-tRNA synthetase / glycine-tRNA ligase;(source:Araport11) |
| AT1G29920 | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II. |
| AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
| AT1G30040 | Encodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive to cytokinin and KNOX activities. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT1G30080 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT1G30130 | DUF1365 family protein;(source:Araport11) |
| AT1G30150 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.2e-24 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT1G30170 | Hypothetical protein (DUF295) of unknown function. |
| AT1G30180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G30190 | cotton fiber protein;(source:Araport11) |
| AT1G30210 | TCP family protein involved in heterochronic regulation of leaf differentiation. |
| AT1G30220 | Inositol transporter presenting conserved extracellular loop domains homologs of plexins/semaphorin/integrin (PSI) domains from animal type I receptors. |
| AT1G30250 | hypothetical protein;(source:Araport11) |
| AT1G30260 | galactosyltransferase family protein;(source:Araport11) |
| AT1G30270 | Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile. |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT1G30350 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT1G30380 | Encodes subunit K of photosystem I reaction center. The mRNA is cell-to-cell mobile. |
| AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT1G30410 | member of MRP subfamily |
| AT1G30430 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT1G30455 | cyclin/Brf1-like TBP-binding domain-containing protein;(source:Araport11) |
| AT1G30470 | SIT4 phosphatase-associated family protein;(source:Araport11) |
| AT1G30480 | recombination and DNA-damage resistance protein (DRT111) |
| AT1G30500 | nuclear factor Y, subunit A7;(source:Araport11) |
| AT1G30515 | GATA zinc finger protein;(source:Araport11) |
| AT1G30520 | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT1G30560 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT1G30570 | Encodes HERCULES2 (HERK2), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT1G30590 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
| AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
| AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
| AT1G30640 | Protein kinase family protein;(source:Araport11) |
| AT1G30650 | member of WRKY Transcription Factor; Group II-e |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT1G30670 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G30680 | Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B. |
| AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30730 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30750 | TPRXL;(source:Araport11) |
| AT1G30760 | Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. The mRNA is cell-to-cell mobile. |
| AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G30790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G30810 | JMJ18 encodes a novel JmjC domain- containing histone H3K4 demethylase. PHD finger-containing protein. |
| AT1G30820 | Cytidine triphosphate synthase. |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT1G30835 | Member of Sadhu non-coding retrotransposon family The mRNA is cell-to-cell mobile. |
| AT1G30840 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G30845 | cell growth defect protein;(source:Araport11) |
| AT1G30850 | root hair specific 4;(source:Araport11) |
| AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G30870 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G30880 | hypothetical protein;(source:Araport11) |
| AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
| AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
| AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G30940 | pseudogene of F-box family protein;(source:Araport11) |
| AT1G30945 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G30950 | Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY. |
| AT1G30975 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G31000 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G31040 | ORE15 is a nuclear localized member of the PLATZ family of transcription factors. Based on over expression and loss of function phenotypes, ORE15 functions in regulation of leaf cell proliferation and senescence. |
| AT1G31050 | Together with PFA2 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
| AT1G31072 | pseudogene of F-box family protein |
| AT1G31080 | F-box family protein;(source:Araport11) |
| AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
| AT1G31160 | Encodes a member of the histidine triad nucleotide-binding family of proteins, but its activity has not been determined. |
| AT1G31175 | cytochrome C oxidase biogenesis Cmc1-like protein;(source:Araport11) |
| AT1G31190 | Encodes a myo-inositol monophosphatase IMPL1 (myo-Inositol monophosphatase like 1). |
| AT1G31220 | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide |
| AT1G31245 | Encodes a defensin-like (DEFL) family protein. |
| AT1G31260 | member of Fe(II) transporter isolog family |
| AT1G31290 | ARGONAUTE 3;(source:Araport11) |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G31370 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT1G31380 | TRAF-like family protein;(source:Araport11) |
| AT1G31390 | TRAF-like family protein;(source:Araport11) |
| AT1G31400 | TRAF-like family protein;(source:Araport11) |
| AT1G31450 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT1G31490 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G31510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G31520 | hypothetical protein;(source:Araport11) |
| AT1G31530 | Deadenylase. |
| AT1G31540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G31630 | AGAMOUS-like 86;(source:Araport11) |
| AT1G31640 | A paternally expressed imprinted gene. |
| AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G31710 | Copper amine oxidase family protein;(source:Araport11) |
| AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT1G31740 | Encodes a putative β-galactosidase. |
| AT1G31760 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT1G31780 | Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen. |
| AT1G31790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G31820 | Encodes POLYAMINE UPTAKE TRANSPORTER 1, an amino acid permease family protein. |
| AT1G31880 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. BRX encodes a key regulator of cell proliferation and elongation in the root, which has been implicated in the brassinosteroid (BR) pathway as well as regulation of auxin-responsive gene expression. Also involved in cytokinin-mediated inhibition of lateral root initiation. A loss-of-function allele, named brx-2 in Rodrigues et al. (2009) Plant Physiol. but changed to brx-3 to resolve nomenclature conflict (Li et al. Planta 2009:229(3):593-603), shows enhanced response to ABA-mediated inhibition of root growth. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with PAX, thereby timing PPSE differentiation. Dampens PIN-mediated auxin efflux. |
| AT1G31910 | GHMP kinase family protein;(source:Araport11) |
| AT1G31920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G31930 | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses. |
| AT1G31935 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT1G31960 | hypothetical protein;(source:Araport11) |
| AT1G31970 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G31990 | transmembrane protein;(source:Araport11) |
| AT1G32030 | plant-specific B3-DNA-binding domain protein (DUF313);(source:Araport11) |
| AT1G32080 | Encodes a plant LrgAB/CidAB protein localized to the chloroplast envelope that is involved in chloroplast development, carbon partitioning, ABA/drought response, and leaf senescence. The gene may have evolved from gene fusion of bacterial lrgA and lrgB. |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
| AT1G32130 | The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. |
| AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
| AT1G32172 | other_RNA;(source:Araport11) |
| AT1G32180 | encodes a gene similar to cellulose synthase |
| AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
| AT1G32210 | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT1G32250 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G32300 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
| AT1G32310 | Encodes a plant-specific negative regulator of the APC/C complex. It is expressed during embryogenesis and early plant development and plays a key role in organ size control. Mutants are defective in mitosis I of pollen development, resulting in pollen without sperm nuclei. |
| AT1G32320 | member of MAP Kinase Kinase |
| AT1G32360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
| AT1G32385 | snoRNA;(source:Araport11) |
| AT1G32390 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT1G32440 | encodes a chloroplast pyruvate kinase beta subunit. The enzyme is less active than the other chloroplast pyruvate kinase beta subunit encoded by AT5G52920. Involved in seed oil biosynthesis. Can partially complement the AT5G52920 mutant. |
| AT1G32450 | Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to high and low concentrations of nitrate. Not involved in nitrate uptake. Expressed in root pericycle cells under the control of MYB59. Also functions as a proton-coupled H+/K+ antiporter for K+ loading into the xylem. |
| AT1G32460 | hypothetical protein;(source:Araport11) |
| AT1G32510 | NAC domain containing protein 11;(source:Araport11) |
| AT1G32550 | Encodes FdC2, a ferredoxin protein capable of alternative electron partitioning. FdC1 level increases in conditions of acceptor limitation at PSI. |
| AT1G32600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
| AT1G32690 | DUF740 family protein;(source:Araport11) |
| AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G32710 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT1G32740 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G32750 | This gene is predicted to encode a histone acetyltransferase. Five lines with RNAi constructs directed against HAF1 grow normally and can produce root calli, but have defects in agrobacterium-mediated transformation. |
| AT1G32770 | Encodes SND1, a NAC Domain transcription factor involved in secondary wall biosynthesis in fibers. Expressed specifically in interfascicular fibers and xylary fibers in stems. Expressed in the procambium of stem inflorescences and root. May act as a negative regulator of secondary wall thickening in xylary fibers. Acts redundantly with NST1 to control development of secondary walls in siliques. |
| AT1G32780 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G32850 | ubiquitin-specific protease 11;(source:Araport11) |
| AT1G32870 | Expression in rosette leaves is activated by high concentration of boron. |
| AT1G32880 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G32890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-37 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G32910 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G32920 | hypothetical protein;(source:Araport11) |
| AT1G32940 | Subtilase family protein;(source:Araport11) |
| AT1G32950 | Subtilase family protein;(source:Araport11) |
| AT1G32960 | Subtilase family protein;(source:Araport11) |
| AT1G32970 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G32975 | hypothetical protein;(source:Araport11) |
| AT1G33020 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G33030 | O-methyltransferase family protein;(source:Araport11) |
| AT1G33060 | NAC 014;(source:Araport11) |
| AT1G33160 | pseudogene of actin 7;(source:Araport11) |
| AT1G33170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G33180 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-05 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G33230 | TMPIT-like protein;(source:Araport11) |
| AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
| AT1G33260 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G33280 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
| AT1G33290 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G33320 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G33350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G33410 | Encodes a nucleoporin that regulates CONSTANS (CO) protein stability through affecting nuclear pore complex localization of an E3-ubiquitin ligase, HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES1 (HOS1), which destabilizes CO protein in the morning period. |
| AT1G33415 | Natural antisense transcript overlaps with AT1G33420 and AT1G33430;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G33430 | UPEX1 is arabinogalactan b-(1,3)-galactosyltransferase involved in the formation of pollen exine. Belongs to GT31 family. Mutants have reduced levels of AGPs. GALT8 has some but not complete functional overlap with KNS4/UPEX1. |
| AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G33470 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G33475 | SNARE-like superfamily protein;(source:Araport11) |
| AT1G33510 | pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G33530 | F-box family protein;(source:Araport11) |
| AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
| AT1G33550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G33590 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G33615 | None;(source:Araport11) |
| AT1G33660 | Pseudogene of AT1G33660; peroxidase family protein |
| AT1G33670 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G33700 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT1G33710 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G33720 | cytochrome P450, family 76, subfamily C, polypeptide 6;(source:Araport11) |
| AT1G33730 | cytochrome P450, family 76, subfamily C, polypeptide 5;(source:Araport11) |
| AT1G33770 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
| AT1G33813 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-39 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G33817 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-100 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G33835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-12 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G33860 | hypothetical protein;(source:Araport11) |
| AT1G33890 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33950 | Avirulence induced gene (AIG1) family protein;(source:Araport11) |
| AT1G33960 | Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
| AT1G33970 | IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens. |
| AT1G33990 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT1G34000 | Encodes a novel member of the Lhc family from Arabidopsis with one predicted transmembrane alpha-helix closely related to helix I of Lhc protein from PSI (Lhca4). Gene expression is triggered by light stress and both transcript and protein accumulate in a light intensity-dependent manner. Ohp2 is associated with PSI under low- or high-light conditions. Together with OHP1, OHP2 is essential for the formation of photosystem II reaction center, even though neither is a part of the final PSII RC. It forms a complex with OHP1 and HCF244, D1, D2, PsbI, and cytochrome b559 at an early stage of PSII de novo assembly and of PSII repair under high-light conditions. |
| AT1G34030 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G34095 | hypothetical protein;(source:Araport11) |
| AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT1G34110 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT1G34140 | polyadenylate-binding protein, putative / PABP, putative, non-consensus splice donor TA at exon 1; similar to polyadenylate-binding protein (poly(A)-binding protein) from (Triticum aestivum) GI:1737492, (Nicotiana tabacum) GI:7673355, {Arabidopsis thaliana} SP:P42731; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Only member of the class IV PABP family. |
| AT1G34160 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
| AT1G34190 | Encodes a NAC domain transcription factor that regulates the mitochondrial retrograde response and coordinates organellar functions and stress responses. |
| AT1G34290 | receptor like protein 5;(source:Araport11) |
| AT1G34330 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G34340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G34360 | translation initiation factor 3 (IF-3) family protein;(source:Araport11) |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT1G34480 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G34490 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34500 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34520 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34530 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G34540 | member of CYP94D |
| AT1G34545 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-112 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G34570 | Essential protein Yae1, N-terminal;(source:Araport11) |
| AT1G34575 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G34580 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G35115 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-168 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G35130 | gypsy-like retrotransposon family (Athila), has a 2.1e-28 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G35210 | hypothetical protein;(source:Araport11) |
| AT1G35220 | FAM91 carboxy-terminus protein;(source:Araport11) |
| AT1G35230 | Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile. |
| AT1G35310 | MLP-like protein 168;(source:Araport11) |
| AT1G35320 | transmembrane protein;(source:Araport11) |
| AT1G35330 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G35340 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G35360 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-38 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35465 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-27 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G35470 | Encodes a homologue of human RanBPM that belongs to the uncharacterized family of plant SPRY, LisH, CTLH and CRA domain-containing proteins. |
| AT1G35535 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-252 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G35570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
| AT1G35620 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. The mRNA is cell-to-cell mobile. |
| AT1G35630 | Protease-associated (PA) RING/U-box zinc finger family protein;(source:Araport11) |
| AT1G35663 | transposable_element_gene;(source:Araport11);similar to DNA binding / transposase [Arabidopsis thaliana] (TAIR:AT4G04635.1);(source:TAIR10) |
| AT1G35690 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0041J06.18, blastp match of 27%25 identity and 1.6e-07 P-value to GP|27818010|dbj|BAC55773.1||AP005176 OSJNBb0041J06.18 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G35710 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT1G35730 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G35750 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G35770 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G06860.1);(source:TAIR10) |
| AT1G35790 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.3e-42 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G35820 | heat shock protein;(source:Araport11) |
| AT1G35850 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G35880 | hypothetical protein;(source:Araport11) |
| AT1G36010 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.8e-40 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G36078 | transmembrane protein;(source:Araport11) |
| AT1G36110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G36180 | acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile. |
| AT1G36220 | pseudogene of seryl-tRNA synthetase / serine-tRNA ligase;(source:Araport11) |
| AT1G36240 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT1G36330 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-71 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT1G36360 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-39 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G36390 | Chloroplast GrpE protein. |
| AT1G36420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0.00011 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G36440 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287;(source:TAIR10) |
| AT1G36622 | transmembrane protein;(source:Araport11) |
| AT1G36670 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37050.1);(source:TAIR10) |
| AT1G36770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.3e-41 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G36790 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.7e-38 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G36880 | pseudogene of FAR1-related sequence 5;(source:Araport11) |
| AT1G36890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-20 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G36922 | hypothetical protein;(source:Araport11) |
| AT1G36925 | hypothetical protein;(source:Araport11) |
| AT1G36927 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.8e-29 P-value blast match to GB:BAA01703 ORF (Ty1_Copia-element) (Drosophila simulans);(source:TAIR10) |
| AT1G36936 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 43%25 identity and 2.1e-28 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
| AT1G37012 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.7e-43 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT1G37030 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.1e-17 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G37036 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 6.6e-26 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT1G37037 | transposable_element_gene;(source:Araport11) |
| AT1G37050 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G43320.1);(source:TAIR10) |
| AT1G37120 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.3e-14 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G37130 | Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940. The mRNA is cell-to-cell mobile. |
| AT1G37190 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains similarity to hypothetical proteins from (Arabidopsis thaliana);(source:TAIR10) |
| AT1G38065 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G38140 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 9.2e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G38430 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.8e-109 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G40470 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-102 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G41760 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-11 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT1G41825 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.9e-98 P-value blast match to gb|AAL06422.1|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT1G41840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-23 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G41850 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-29 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G42240 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G42310 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G42400 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G35090.1);(source:TAIR10) |
| AT1G42490 | pseudogene of glutamate dehydrogenase 2;(source:Araport11) |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT1G42655 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative retroelement, blastp match of 45%25 identity and 3.2e-41 P-value to GP|21671994|gb|AAM74356.1|AC115686_23|AC115686 Putative retroelement {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G42700 | hypothetical protein;(source:Araport11) |
| AT1G42980 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus. |
| AT1G43000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G43005 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G43010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G43020 | electron protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G43040 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G43270 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-37 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G43570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G52065.1);(source:TAIR10) |
| AT1G43575 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-34 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G43600 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G43630 | plant/protein (DUF793);(source:Araport11) |
| AT1G43640 | Member of TLP family of tubby like proteins that also contain an F-Box. |
| AT1G43710 | Encodes a serine decarboxylase that is involved in ethanolamine metabolism and is crucial for plant growth. |
| AT1G43725 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-107 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT1G43775 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G43781 | Pseudogene of AT1G53790; F-box family protein |
| AT1G43800 | Δ9 stearoyl-ACP desaturase which together with FAB2, AAD1, and AAD5 redundantly participates in oil storage during the maturation phase. |
| AT1G43810 | hypothetical protein;(source:Araport11) |
| AT1G43835 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT1G43850 | Encodes a transcriptional co-regulator of AGAMOUS, that functions with LEUNIG to repress AG in the outer floral whorls. |
| AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G43895 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT1G43897 | transposable_element_gene;(source:Araport11);pseudogene, similar to ORF-c, blastp match of 58%25 identity and 1.7e-32 P-value to GP|6069570|dbj|BAA85461.1||AB022081 ORF-c {Brassica rapa};(source:TAIR10) |
| AT1G43900 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G43940 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42540.1);(source:TAIR10) |
| AT1G44075 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G44080 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT1G44130 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G44160 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT1G44180 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT1G44191 | Encodes a ECA1 gametogenesis related family protein |
| AT1G44382 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G44542 | Cyclase family protein;(source:Araport11) |
| AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
| AT1G44608 | hypothetical protein;(source:Araport11) |
| AT1G44780 | translation initiation factor;(source:Araport11) |
| AT1G44900 | Encodes MCM2 (MINICHROMOSOME MAINTENANCE 2), a protein essential to embryo development. Overexpression results in altered root meristem function. |
| AT1G44920 | transmembrane protein;(source:Araport11) |
| AT1G44940 | hypothetical protein;(source:Araport11) |
| AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
| AT1G45100 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G45130 | beta-galactosidase 5;(source:Araport11) |
| AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
| AT1G45191 | beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1 |
| AT1G45201 | Target of AtGRP7 regulation. |
| AT1G45231 | Encodes a trimethylguanosine synthase that is required for chilling tolerance. tgs1 mutant have a striking chilling sensitive phenotype in which leaf and flower development are dramatically disrupted after long-term chilling treatment. |
| AT1G45238 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G45246 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G45545 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
| AT1G45616 | receptor like protein 6;(source:Araport11) |
| AT1G45760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-37 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G45976 | S-ribonuclease binding protein 1;(source:Araport11) |
| AT1G46048 | pseudogene of hypothetical protein;(source:Araport11) |
| AT1G46192 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
| AT1G46480 | Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
| AT1G46768 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.1). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.10. |
| AT1G46840 | F-box family protein;(source:Araport11) |
| AT1G46912 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G46984 | F-box family protein;(source:Araport11) |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT1G47220 | Cyclin A3;(source:Araport11) |
| AT1G47265 | hypothetical protein;(source:Araport11) |
| AT1G47271 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
| AT1G47290 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT1G47300 | F-box family protein;(source:Araport11) |
| AT1G47310 | signal peptidase I;(source:Araport11) |
| AT1G47320 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G27870.1);(source:TAIR10) |
| AT1G47350 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G47370 | RBA1 variant in Ag0 background is a TIR-only receptor protein that binds to the bacterial type III effector protein HopBA. The Col-0 variant, which is not expressed, is likely a psuedogene and more highly methylated than the Ag0 variant which is expressed. |
| AT1G47389 | transmembrane protein;(source:Araport11) |
| AT1G47400 | Involved in regulation of iron deficiency response genes. Overexpression results in hyperaccumulation of Fe and Mn. |
| AT1G47405 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC63678 (Arabidopsis thaliana) from (;(source:TAIR10) |
| AT1G47420 | predicted to encode subunit 5 of mitochondrial complex II and to participate in the respiratory chain |
| AT1G47520 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.3e-256 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G47530 | MATE efflux family protein;(source:Araport11) |
| AT1G47565 | transposable_element_gene;(source:Araport11);retrotransposon gag protein, contains Pfam:PF03732 Retrotransposon gag protein;(source:TAIR10) |
| AT1G47578 | Redundant octanoyltransferase involved in fatty acid synthesis. |
| AT1G47580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G47590 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.Previously annotated as pseudogene, evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G47603 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G47630 | member of CYP96A |
| AT1G47680 | hypothetical protein;(source:Araport11) |
| AT1G47770 | Beta-galactosidase related protein;(source:Araport11) |
| AT1G47810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G47830 | SNARE-like superfamily protein;(source:Araport11) |
| AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G47880 | pseudogene of receptor like protein 6;(source:Araport11) |
| AT1G47885 | Ribonuclease inhibitor;(source:Araport11) |
| AT1G47890 | receptor like protein 7;(source:Araport11) |
| AT1G47930 | pseudogene of Glutamyl/glutaminyl-tRNA synthetase;(source:Araport11) |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G48080 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G48090 | calcium-dependent lipid-binding family protein;(source:Araport11) |
| AT1G48120 | Encodes a nuclear localized aminotransferase-like protein containing a plant mobile domain. |
| AT1G48130 | encodes a protein similar to the 1-cysteine (1-Cys) peroxiredoxin family of antioxidants. Expression is limited to seed (aleurone and embryo) and is not induced by ABA or drought. |
| AT1G48150 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G48195 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G48220 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT1G48268 | pseudogene of F-box family protein |
| AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
| AT1G48360 | Encodes a FAN1 homolog that is involved in interstrand crosslink repair. FAN1 appears to act in in a different pathway from MUS81 but in similar pathway with RECQ4A, RAD5A and MFH1. |
| AT1G48380 | Encodes a novel nuclear protein required for root hair initiation and ploidy-dependent cell growth. Its sequence has similarity to the C-terminal domain of mammalian DNA topo IIalpha. Shows in vitro DNA binding activity and is likely to be part of the topo VI complex by binding to subunit A. |
| AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT1G48440 | B-cell receptor-associated 31-like protein;(source:Araport11) |
| AT1G48470 | Encodes cytosolic glutamine synthase isozyme. Expression of mRNA is not detectable in roots. |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT1G48510 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis. |
| AT1G48520 | Encodes Glu-tRNA(Gln) amidotransferase subunit B (from Genbank record AF239836). |
| AT1G48530 | proteasome inhibitor-like protein;(source:Araport11) |
| AT1G48540 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT1G48610 | AT hook motif-containing protein;(source:Araport11) |
| AT1G48625 | pseudogene of F-box family protein |
| AT1G48630 | Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1B has no phenotype on its own and probably acts redundantly with RACK1A and RACK1C. |
| AT1G48640 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G48698 | Potential natural antisense gene, locus overlaps with AT1G48700 |
| AT1G48700 | Belongs to the 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteins and contains an oxoglutarate/iron-dependent oxygenase domain (InterPro:IPR005123) of the prolyl 4-hydroxylase, alpha subunit subtype (P4Hc; InterPro:IPR006620). |
| AT1G48745 | hypothetical protein;(source:Araport11) |
| AT1G48750 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G48830 | Ribosomal protein S7e family protein;(source:Araport11) |
| AT1G48870 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G48910 | A paternally expressed imprinted gene. |
| AT1G48912 | hypothetical protein;(source:Araport11) |
| AT1G48930 | glycosyl hydrolase 9C1;(source:Araport11) |
| AT1G48953 | hypothetical protein;(source:Araport11) |
| AT1G48960 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G48970 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT1G48980 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G49005 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT1G49015 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT1G49032 | hypothetical protein;(source:Araport11) |
| AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
| AT1G49060 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G49100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G49110 | hypothetical protein;(source:Araport11) |
| AT1G49120 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G49180 | protein kinase family protein;(source:Araport11) |
| AT1G49190 | member of Response Regulator: B- Type |
| AT1G49260 | mechanosensitive ion channel-like protein;(source:Araport11) |
| AT1G49270 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G49280 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT1G49290 | Paternally expressed gene that is localized around the sperm nuclei of pollen. PEG2 acts as a sponge for siRNA854 during endosperm development, this action is necessary to induce triploid seed abortion. |
| AT1G49310 | transmembrane protein;(source:Araport11) |
| AT1G49330 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G49350 | PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
| AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G49405 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G49430 | Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation. |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
| AT1G49530 | encodes a mitochondria-targeted geranylgeranyl pyrophosphate synthase |
| AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G49580 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT1G49600 | RNA-binding protein 47A;(source:Araport11) |
| AT1G49610 | F-box family protein;(source:Araport11) |
| AT1G49630 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed in flower, leaf and root. Not expressed in silique and shoot. |
| AT1G49650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
| AT1G49690 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT1G49730 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G49760 | polyadenylate-binding protein, putative / PABP, putative, similar to poly(A)-binding protein GB:AAF66825 GI:7673359 from (Nicotiana tabacum). Highly and ubiquitously expressed. Member of the class II PABP family. |
| AT1G49770 | Encodes a member of the basic helix loop helix family of transcription factors. Loss of RGE1 function causes shriveled seeds that contain small embryos. The cuticle in the embryos does not develop normally, possible due to the adeherence of the endosperm to the developing embryo. RGE1 is expressed in the endosperm surrounding region which directly surrounds the developing embryo, however it exerts its effect non autonomously- in the developing embryo. Mutant seedlings are extremely sensitive to desiccation due to the abnormal cuticle. Together with ICE1, ZOU determines primary seed dormancy depth independently of their joint role in endosperm development. |
| AT1G49790 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G49800 | Homolog of PIP1. |
| AT1G49832 | None;(source:Araport11) |
| AT1G49850 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
| AT1G49880 | Encodes Erv1, a component of the mitochondrial intermembrane space assembly machinery involved in the import pathway of the small intermembrane space proteins. It contains a Cys-X-Cys shuttle disulfide and oxidizes thioredoxin in vitro. Flavoenzyme-encoding gene. |
| AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
| AT1G49920 | MuDR family transposase;(source:Araport11) |
| AT1G49960 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G49975 | photosystem I reaction center subunit N;(source:Araport11) |
| AT1G49980 | DNA/RNA polymerases superfamily protein;(source:Araport11) |
| AT1G50020 | tubulin alpha-6 chain;(source:Araport11) |
| AT1G50040 | formin-like protein, putative (DUF1005);(source:Araport11) |
| AT1G50070 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT1G50090 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein;(source:Araport11) |
| AT1G50100 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT1G50120 | Encodes a Golgi-localized protein which regulates pollen tube growth. Required for TGN formation and Golgi structure maintenance. |
| AT1G50130 | pseudogene of ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
| AT1G50140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G50170 | encodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis |
| AT1G50190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G50210 | pseudogene of NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G50220 | B3 domain protein;(source:Araport11) |
| AT1G50240 | The FUSED (FU) gene belongs to Ser/Thr protein kinase family and has a key role in the hedgehog signaling pathway known to control cell proliferation and patterning in fruit flies and humans . Arabidopsis thaliana genome has a single Fu gene that is involved in male meiosis cytokinesis. Cytokinesis-defective mutants, named two-in-one (tio), result from mutations in Arabidopsis Fu. Phenotypic analysis of tio mutants reveals an essential role for TIO in conventional modes of cytokinesis in plant meristems and during male gametogenesis. TIO is tightly localized to the midline of the nascent phragmoplast and remains associated with the expanding phragmoplast ring. This gene was previously annotated as two gene models, AT1G50230.1 and AT1G50240.1, however the experimental evidence exists (Oh et al, Current Biology, 2005) showing that these two models are in fact single gene, named FUSED. |
| AT1G50250 | encodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes. |
| AT1G50270 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
| AT1G50330 | pseudogene of methylesterase PCR A;(source:Araport11) |
| AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT1G50390 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT1G50400 | Eukaryotic porin family protein;(source:Araport11) |
| AT1G50410 | Encodes a member of the SNF2 family of helicase-like proteins and is involved in RNA-directed DNA methylation. It is functionally redundant with FRG1. |
| AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT1G50500 | encodes a member of VPS53 family protein involved in the retrograde trafficking of vesicles to the late Golgi. Mutants in this gene are more sensitive to heat and osmotic stress. |
| AT1G50580 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT1G50680 | AP2/B3 transcription factor family protein;(source:Araport11) |
| AT1G50690 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G50710 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT1G50732 | transmembrane protein;(source:Araport11) |
| AT1G50770 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT1G50870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G50890 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G50900 | Encodes GDC1 (Grana Deficient Chloroplast 1), an ankyrin domain containing protein required fro chloroplast thylakoid grana formation. The mRNA is cell-to-cell mobile. |
| AT1G50910 | hypothetical protein;(source:Araport11) |
| AT1G50930 | Serine/Threonine-kinase;(source:Araport11) |
| AT1G50990 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT1G51000 | hypothetical protein;(source:Araport11) |
| AT1G51020 | hypothetical protein;(source:Araport11) |
| AT1G51035 | hypothetical protein;(source:Araport11) |
| AT1G51040 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G51050 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G51055 | FBD-like domain family protein;(source:Araport11) |
| AT1G51100 | Chloroplast NADH dehydrogenase assembly protein. Mutants are defective in the accumulation of subcomplex A. |
| AT1G51110 | localized to chloroplasts |
| AT1G51120 | AP2/B3 transcription factor family protein;(source:Araport11) |
| AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
| AT1G51160 | TRAPP protein BET5 homolog. |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G51340 | Encodes a root citrate transporter which together with the root malate transporter ALMT1 are the primary mechanism of aluminum tolerance. |
| AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G51370 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G51380 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G51390 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile. |
| AT1G51410 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
| AT1G51420 | sucrose-phosphatase 1;(source:Araport11) |
| AT1G51440 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
| AT1G51580 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT1G51620 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G51650 | ATP synthase epsilon chain;(source:Araport11) |
| AT1G51670 | hypothetical protein;(source:Araport11) |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT1G51710 | Ubiquitin-specific protease 6 (UBP6). Deubiquinating enzyme. Interacts with calmodulin. |
| AT1G51730 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
| AT1G51802 | Encodes a defensin-like (DEFL) family protein. |
| AT1G51805 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51840 | kinase-like protein;(source:Araport11) |
| AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51880 | root hair specific 6;(source:Araport11) |
| AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G51910 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51930 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
| AT1G51965 | Encodes ABA Overly-Sensitive5 (ABO5), a pentatricopeptide repeat protein required for cis-splicing of mitochondrial nad2 intron 3. Involved in response to abscisic acid. |
| AT1G51970 | B3 domain protein;(source:Araport11) |
| AT1G52000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52020 | transposable_element_gene;(source:Araport11);pseudogene, Ulp1 protease family, contains Pfam profile PF02902: Ulp1 protease family, C-terminal catalytic domain;(source:TAIR10) |
| AT1G52030 | Similar to myrosinase binding proteins which may be involved in metabolizing glucosinolates and forming defense compounds to protect against herbivory. Also similar to lectins and other agglutinating factors. Expressed only in flowers. |
| AT1G52040 | Encodes myrosinase-binding protein expressed in flowers. |
| AT1G52085 | pseudogene of Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52087 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35110.1);(source:TAIR10) |
| AT1G52090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27590.1);(source:TAIR10) |
| AT1G52100 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52140 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT1G52150 | Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation. |
| AT1G52155 | transmembrane protein;(source:Araport11) |
| AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
| AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G52200 | PLAC8 family protein;(source:Araport11) |
| AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G52220 | Thylakoid membrane localized protein that interacts with other CURT family proteins. Oligomerization is associated with grana thylakoid curavature. |
| AT1G52230 | Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
| AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G52290 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G52300 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT1G52315 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT1G52343 | Similar to GET2, transmembrane protein that interacts with GET1. |
| AT1G52347 | None;(source:Araport11) |
| AT1G52370 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT1G52390 | hypothetical protein;(source:Araport11) |
| AT1G52400 | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation The mRNA is cell-to-cell mobile. |
| AT1G52410 | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. The mRNA is cell-to-cell mobile. |
| AT1G52415 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G52440 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G52450 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G52470 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G52490 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G52520 | FAR1-related sequence 6;(source:Araport11) |
| AT1G52530 | Hus1-like protein;(source:Araport11) |
| AT1G52540 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G52610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.0e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G52618 | hypothetical protein;(source:Araport11) |
| AT1G52620 | Mitochondrial pentatricopeptide repeat protein required for stabilizing nad1 transcripts. |
| AT1G52630 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G52640 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G52660 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G52680 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT1G52690 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT1G52750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G52760 | Encodes caffeoyl shikimate esterase and is involved in lignin biosynthesis. CSE converts caffeoyl shikimate to caffiate. Loss of function mutations have reduced lignin content and collapsed vessel elements. It is also reported to function as a lysophospholipase 2 (LysoPL2) involved in tolerance to cadmium-induced oxidative stress. Binds Acyl-CoA-binding protein 2 (ACBP2). |
| AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
| AT1G52790 | encodes a putative oxidoreductase, 2OG-Fe(II) oxygenase family protein, similar to GS-AOP loci (GI:16118889, GI:16118887, GI:16118891, GI:16118893); contains PF03171 2OG-Fe(II) oxygenase superfamily domain |
| AT1G52810 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G52857 | transmembrane protein;(source:Araport11) |
| AT1G52880 | Transcription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo. |
| AT1G52910 | fiber (DUF1218);(source:Araport11) |
| AT1G52942 | Pseudogene of AT2G18120; SRS4 (SHI-RELATED SEQUENCE 4) |
| AT1G52980 | Encodes a GTPase that belongs to the subfamily of YlqF/YawG GTPases. Functions in Pre-60S ribosomal subunit maturation. The mRNA is cell-to-cell mobile. |
| AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53020 | Cognate nuclear E2 enzyme that interacts with the RFA4 E3 ligase and forms UBC26-RFA4-Receptor complexes in nuclear speckles. |
| AT1G53025 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
| AT1G53030 | encodes a copper chaperone, can functional complements the yeast COX17 null mutant. May play a role in the delivery of copper to mitochondria. Expressed in roots and thus may also play a role in copper transport in the roots. |
| AT1G53050 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
| AT1G53100 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G53140 | Encodes DRP5A, a dynamin protein involved in cytokinesis in Arabidopsis. |
| AT1G53160 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G53180 | hypothetical protein;(source:Araport11) |
| AT1G53270 | ABC-2 type transporter family protein;(source:Araport11) |
| AT1G53290 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G53330 | encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes. |
| AT1G53366 | hypothetical protein;(source:Araport11) |
| AT1G53390 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
| AT1G53440 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G53470 | mechanosensitive channel of small conductance-like 4;(source:Araport11) |
| AT1G53530 | Mitochondrial ATP-independent protease |
| AT1G53550 | F-box family protein;(source:Araport11) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT1G53570 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT1G53590 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G53620 | transmembrane protein;(source:Araport11) |
| AT1G53625 | hypothetical protein;(source:Araport11) |
| AT1G53630 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAD17398 GI:4335720 from (Arabidopsis thaliana);(source:TAIR10) |
| AT1G53635 | hypothetical protein;(source:Araport11) |
| AT1G53690 | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G53705 | putative aminoacyl-tRNA ligase;(source:Araport11) |
| AT1G53708 | ROTUNDIFOLIA like 9;(source:Araport11) |
| AT1G53730 | STRUBBELIG-receptor family 6;(source:Araport11) |
| AT1G53760 | K+-H+ exchange-like protein;(source:Araport11) |
| AT1G53780 | 26S proteasome regulatory complex ATPase;(source:Araport11) |
| AT1G53790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53850 | Encodes alpha5 subunit of 20s proteosome involved in protein degradation and RNA degradation. |
| AT1G53930 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G53970 | GDSL esterase/lipase-like protein;(source:Araport11) |
| AT1G53990 | Contains lipase signature motif and GDSL domain. The mRNA is cell-to-cell mobile. |
| AT1G54000 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G54010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G54035 | pseudogene of epithiospecifier protein |
| AT1G54070 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT1G54120 | hypothetical protein;(source:Araport11) |
| AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT1G54150 | Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase. |
| AT1G54180 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
| AT1G54230 | Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT1G54280 | Encodes a member of the P4 subfamily of P-type ATPases expressed in the pollen plasma membrane. Double mutants with ALA7 display pollen and pollen tube defects. |
| AT1G54300 | hypothetical protein;(source:Araport11) |
| AT1G54310 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G54450 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G54470 | Encodes a Cf-like gene in Arabidopsis that confers downy mildew resistance to several isolates of Peronospora parasitica. |
| AT1G54560 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
| AT1G54600 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G54640 | F-box family protein-like protein;(source:Araport11) |
| AT1G54730 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G54740 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
| AT1G54860 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT1G54940 | Encodes a xylan glucuronosyltransferase. |
| AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
| AT1G55030 | RNI-like superfamily protein;(source:Araport11) |
| AT1G55035 | pseudogene of importin alpha isoform 1;(source:Araport11) |
| AT1G55050 | hypothetical protein;(source:Araport11) |
| AT1G55060 | Ubiquitin-like gene, believed to be a pseudogene because of amino acid substitutions in 3 of the 5 ubiquitin repeats found in the UBQ12 gene product |
| AT1G55070 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
| AT1G55152 | hypothetical protein;(source:Araport11) |
| AT1G55170 | DNA double-strand break repair protein;(source:Araport11) |
| AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
| AT1G55190 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G55230 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
| AT1G55240 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
| AT1G55250 | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
| AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G55290 | encodes a protein whose sequence is similar to oxidoreductase, 2OG-Fe(II) oxygenase |
| AT1G55320 | Encodes a protein with similarity to acyl activating enzymes. AAE18 is localized to the peroxisome where it may be involved in metabolism of auxin precursors to active auxins. |
| AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
| AT1G55340 | hypothetical protein (DUF1639);(source:Araport11) |
| AT1G55365 | hypothetical protein;(source:Araport11) |
| AT1G55380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G55450 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G55520 | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex. |
| AT1G55540 | Nuclear pore complex protein;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G55570 | SKU5 similar 12;(source:Araport11) |
| AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
| AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
| AT1G55604 | Pseudogene of AT1G26762 |
| AT1G55610 | mutant has Altered vascular cell differentiation; LRR Receptor Kinase |
| AT1G55660 | FOF2, is the F-box protein family. Overexpression of FOF2 results in delayed transitions to flowering under both LD and SD conditions.FOF2 expression is induced by ABA during seed germination where it acts through ABI3 and ABI5 to modulate germination. |
| AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
| AT1G55675 | transmembrane protein;(source:Araport11) |
| AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G55720 | member of Low affinity calcium antiporter CAX2 family |
| AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT1G55750 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
| AT1G55760 | Expression induced under NaCl, mannitol, ABA and indole-3-acetic acid (IAA) treatment. |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G55830 | coiled-coil protein;(source:Araport11) |
| AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT1G55860 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G55900 | component of a translocase in the mitochondrial inner membrane |
| AT1G55910 | member of Putative zinc transporter ZIP2 - like family |
| AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
| AT1G55940 | cytochrome P450 family protein;(source:Araport11) |
| AT1G55970 | HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain. |
| AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
| AT1G56030 | RING/U-box protein;(source:Araport11) |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT1G56120 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G56130 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G56140 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G56145 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G56150 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
| AT1G56190 | One of a pair of plastid localized phosphoglycerate kinases involved in galactolipid biosynthesis. Functions redundantly with AT3g12780 (PGK1) in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal. |
| AT1G56210 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G56230 | enolase (DUF1399);(source:Araport11) |
| AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G56310 | DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation. |
| AT1G56380 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G56400 | F-box family protein;(source:Araport11) |
| AT1G56415 | Expressed protein;(source:Araport11) |
| AT1G56423 | hypothetical protein;(source:Araport11) |
| AT1G56500 | Encodes a thylakoid membrane protein with thioredoxin-like and beta-propeller domains located in the lumen and a haloacid-dehalogenase domain exposed to the chloroplast stroma. The protein's role may be to prevent formation of a slowly reversible form of antenna quenching, thereby maintaining the efficiency of light harvesting. The mRNA is cell-to-cell mobile. |
| AT1G56510 | TIR-NB-LRR protein that confers resistance to four races of Albugo candida. The mRNA is cell-to-cell mobile. |
| AT1G56520 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G56540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
| AT1G56590 | Involved in vesicle trafficking between the trans -Golgi network and vacuoles. |
| AT1G56620 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G56650 | Encodes a putative MYB domain containing transcription factor involved in anthocyanin metabolism and radical scavenging. Essential for the sucrose-mediated expression of the dihydroflavonol reductase gene. Auxin and ethylene responsiveness of PAP1 transcription is lost in myb12 mutants. Interacts with JAZ proteins to regulate anthocyanin accumulation. |
| AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G56720 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G56730 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G57560 | Member of the R2R3 factor gene family. |
| AT1G57565 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT1G57580 | F-box family protein;(source:Araport11) |
| AT1G57590 | Pectinacetylesterase family protein;(source:Araport11) |
| AT1G57630 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G57660 | Translation protein SH3-like family protein;(source:Araport11) |
| AT1G57670 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G57690 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G57720 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
| AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
| AT1G57770 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G57810 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 29%25 identity and 1.1e-12 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT1G57820 | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
| AT1G57830 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G57850 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
| AT1G58037 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G58040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G58050 | RNA helicase family protein;(source:Araport11) |
| AT1G58090 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G58120 | hypothetical protein;(source:Araport11) |
| AT1G58170 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G58190 | receptor like protein 9;(source:Araport11) |
| AT1G58220 | Plays an essential role in organ development by regulating cell expansion either directly by affecting cell wall architecture and/or cytoplasmic growth or indirectly through the ethylene and/or ABA signaling pathways.DRMY1 is Involved in regulating floral organ development, especially ensuring organ size robustness (PMID:32451448). |
| AT1G58225 | hypothetical protein;(source:Araport11) |
| AT1G58230 | binding protein;(source:Araport11) |
| AT1G58248 | Encodes a Plant thionin family protein |
| AT1G58260 | member of CYP79C subfamily of cytochrome p450s. Encodes a putative xylan endohydrolase. similar to some closely linked pseudogenes. |
| AT1G58265 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
| AT1G58330 | transcription factor-like protein;(source:Araport11) |
| AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
| AT1G58370 | Encodes a protein with xylanase activity. |
| AT1G58380 | Ribosomal protein S5 family protein;(source:Araport11) |
| AT1G58410 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G58430 | Encodes an anther-specific proline-rich protein. |
| AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT1G58643 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
| AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
| AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT1G59580 | encodes a mitogen-activated kinase involved in innate immunity The mRNA is cell-to-cell mobile. |
| AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G59620 | Encodes CW9. |
| AT1G59630 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT1G59660 | Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control. |
| AT1G59675 | F-box family protein;(source:Araport11) |
| AT1G59720 | Pentatricopeptide Repeat Protein containing the DYW motif. Required for editing of multiple plastid transcripts. Endonuclease activity. |
| AT1G59722 | hypothetical protein;(source:Araport11) |
| AT1G59730 | Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G59760 | Encodes MTR4, a putative RNA helicase and exosome co-factor. Required for proper rRNA biogenesis and development. |
| AT1G59780 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G59850 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G59860 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G59880 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT1G59890 | SIN3-like 5;(source:Araport11) |
| AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile. |
| AT1G59920 | MADS-box family protein;(source:Araport11) |
| AT1G59950 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G59970 | Matrix metalloproteinase important for root development and root bacterial communities. Modulates auxin/ABA signaling rendering the plant sensitive to drought stress and recruiting differential root bacterial communities. |
| AT1G59980 | ARG1-like 2;(source:Araport11) |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT1G60030 | nucleobase-ascorbate transporter 7;(source:Araport11) |
| AT1G60040 | AGAMOUS-like 49;(source:Araport11) |
| AT1G60050 | nodulin MtN21-like transporter family protein |
| AT1G60060 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT1G60080 | 3-5-exoribonuclease family protein;(source:Araport11) |
| AT1G60095 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G60110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G60120 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.3e-38 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT1G60130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT1G60240 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60250 | B-box zinc finger family protein;(source:Araport11) |
| AT1G60260 | beta glucosidase 5;(source:Araport11) |
| AT1G60280 | NAC domain containing protein 23;(source:Araport11) |
| AT1G60300 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60320 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G60330 | pseudogene of Chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT1G60340 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60350 | NAC domain containing protein 24;(source:Araport11) |
| AT1G60380 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60390 | polygalacturonase 1;(source:Araport11) |
| AT1G60400 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G60430 | actin-related protein C3;(source:Araport11) |
| AT1G60460 | Encodes a structural homolog of the archaeal topo VIB subunit that forms a complex with the two Arabidopsis thaliana SPO11 orthologs required for meiotic DSB formation (SPO11-1 and SPO11-2) and is essential for meiotic DSB formation. |
| AT1G60470 | Predicted to encode a galactinol synthase. |
| AT1G60480 | pseudogene of ADP-ribosylation factor A1E;(source:Araport11) |
| AT1G60490 | Encodes a phosphatidylinositol 3-kinase that is expressed in most plant tissues. Defects in VPS34 affect a number of cellular processes. Loss of function mutations are not transmitted through the male gametophyte due to defects in microgametogenesis therefore it is difficult to assess the effects of loss of VPS34 function in the whole plant. Involved in salt-stress responses. |
| AT1G60500 | Dynamin related protein 4C;(source:Araport11) |
| AT1G60510 | pseudogene of Dynamin related protein 4C;(source:Araport11) |
| AT1G60520 | pseudogene of Dynamin related protein 4A;(source:Araport11) |
| AT1G60530 | Dynamin related protein 4A;(source:Araport11) |
| AT1G60540 | Annotated as pseudogene of the dynamin family.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G60550 | enoyl-CoA hydratase/isomerase D;(source:Araport11) |
| AT1G60590 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G60600 | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
| AT1G60625 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT1G60720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G60740 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G60750 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G60835 | Encodes a Rapid ALkalinization Factor (RALF) family protein [pseudogene] |
| AT1G60880 | Root Specific |
| AT1G60890 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
| AT1G60900 | Putative U2A65 splicing factor which functions in abscisic acid mediated flowering via regulating the precursor messenger RNA splicing of ABI5 and FLC in shoot apex. Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65a. |
| AT1G60920 | AGAMOUS-like 55;(source:Araport11) |
| AT1G60980 | gibberellin 20-oxidase 4;(source:Araport11) |
| AT1G60985 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G60990 | Encodes a chloroplast-localized COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
| AT1G61050 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT1G61060 | F-box family protein;(source:Araport11) |
| AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G61090 | hypothetical protein;(source:Araport11) |
| AT1G61095 | hypothetical protein;(source:Araport11) |
| AT1G61097 | Expressed protein;(source:Araport11) |
| AT1G61105 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G61120 | Encodes a geranyllinalool synthase that produces a precursor to TMTT, a volatile plant defense C16-homoterpene. GES transcript levels rise in response to alamethicin, a fungal peptide mixture that damages membranes. This transcriptional response is blocked in JA biosynthetic and JA signaling mutants, but GES transcript levels still rise in response to alamethicin in mutants with salicylic acid and ethylene biosynthetic and/or signaling defects. GES transcripts also accumulate in response to a larval infestation. This enzyme does not localize to the plastids, and it may be present in the cytosol or endoplasmic reticulum. The mRNA is cell-to-cell mobile. |
| AT1G61130 | serine carboxypeptidase-like 32;(source:Araport11) |
| AT1G61140 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
| AT1G61150 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT1G61215 | Bromodomain protein with a DNA binding motif |
| AT1G61224 | Encodes a microRNA that targets several Jacalin lectin family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAUGGUCAGAUCCGUCAUCC |
| AT1G61330 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G61360 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61400 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61475 | ATP binding / protein kinase;(source:Araport11) |
| AT1G61480 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61490 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61520 | PSI type III chlorophyll a/b-binding protein (Lhca3*1) The mRNA is cell-to-cell mobile. |
| AT1G61540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G61550 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G61575 | Serine/Threonine kinase;(source:Araport11) |
| AT1G61590 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61600 | DUF1262 family protein (DUF1262);(source:Araport11) |
| AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61620 | Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile. |
| AT1G61630 | equilibrative nucleoside transporter 7;(source:Araport11) |
| AT1G61640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61650 | pseudogene of chromomethylase 1;(source:Araport11) |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G61665 | pseudogene of S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61710 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G61720 | Negative regulator of flavonoid biosynthesis, mutants accumulate flavonoid pigments in their seed coat, putative oxidoreductase. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
| AT1G61730 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT1G61732 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUAAGUCUUCUAUUGAUGUU |
| AT1G61740 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT1G61750 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G61760 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G61800 | glucose6-Phosphate/phosphate transporter 2. Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
| AT1G61820 | beta glucosidase 46;(source:Araport11) |
| AT1G61830 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G61850 | Encodes a non-specific lipase that hydrolyzes phospholipids as well as galactolipids, at both sn-1 and sn-2 positions. Involved in basal jasmonic acid biosynthesis by releasing the precursor fatty acid from membrane lipids. Mutant plants were impacted in resistance to fungus B. cinerea. |
| AT1G61860 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61870 | Generic translation factor involved in mitochondrial translation. |
| AT1G61880 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT1G61900 | hypothetical protein;(source:Araport11) |
| AT1G61930 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G61940 | Member of TLP family |
| AT1G61950 | member of Calcium Dependent Protein Kinase |
| AT1G62020 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. Required for the acceptance of compatible pollen. |
| AT1G62090 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G62160 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G62170 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G62180 | encodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis. |
| AT1G62190 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT1G62220 | transmembrane protein;(source:Araport11) |
| AT1G62225 | transmembrane protein;(source:Araport11) |
| AT1G62270 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G62280 | Encodes a protein with ten predicted transmembrane helices. The SLAH1 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement a slac1-2 mutant suggesting that it performs a similar function. SLAH1:GFP localizes to the plasma membrane. |
| AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT1G62320 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT1G62340 | Subtilisin-like serine protease required for epidermal surface formation in embryos and juvenile plants |
| AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G62400 | Protein kinase involved in regulation of stomatal aperture in response to CO2. |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT1G62500 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G62510 | Expressed in the root cortex. |
| AT1G62550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10) |
| AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62620 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT1G62630 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G62640 | 3-ketoacyl-acyl carrier protein synthase III (KAS III) |
| AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT1G62690 | hypothetical protein;(source:Araport11) |
| AT1G62695 | transposable_element_gene;(source:Araport11);pseudogene, similar to Unknown protein, blastp match of 30%25 identity and 1.6e-09 P-value to GP|22773232|gb|AAN06838.1||AC099401 Unknown protein {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT1G62780 | dimethylallyl, adenosine tRNA methylthiotransferase;(source:Araport11) |
| AT1G62790 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G62800 | Encodes aspartate aminotransferase (Asp4). |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G62830 | Encodes a homolog of human Lysine-Specific Demethylase1. Involved in H3K4 methylation of target genes including the flowering time loci FLC and FWA. Located in nucleus. Negatively regulates root elongation. Involved in repression of LRP1 via histone deacetylation. |
| AT1G62835 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G62840 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT1G62920 | proteasome maturation factor;(source:Araport11) |
| AT1G62935 | transmembrane protein;(source:Araport11) |
| AT1G62940 | encodes an acyl-CoA synthetase, has in vitro activity towards medium- to long-chain fatty acids and their hydroxylated derivatives. Expressed in the tapetum. Involved in pollen wall exine formation. Null mutants were devoid of pollen grains at anther maturity and were completely male sterile. |
| AT1G62950 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G62981 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
| AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11) |
| AT1G63050 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. Involved in triacylglycerol biosynthesis. |
| AT1G63060 | ribosome biogenesis NEP1-like protein;(source:Araport11) |
| AT1G63090 | phloem protein 2-A11;(source:Araport11) |
| AT1G63100 | Transcription factor belonging to the GRAS family which controls the mitotic cell cycle and division plane orientation. |
| AT1G63105 | hypothetical protein;(source:Araport11) |
| AT1G63120 | AtRBL2 has been identified as a rhomboid protein involved in regulated intramembrane proteolysis (RIP). The enzyme has the proteolytic activity and substrate specificity comparable to the Drosophila Rho-1 protein. |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
| AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G63295 | Remorin family protein;(source:Araport11) |
| AT1G63340 | Flavin-containing monooxygenase family protein;(source:Araport11) |
| AT1G63350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G63360 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G63410 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G63430 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
| AT1G63480 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT1G63490 | Histone demethylase belonging to the KDM5/JARID1 family which plays crucial roles in response to dehydration stress and abscisic acid (ABA). Directly binds the chromatin of OPEN STOMATA 1 (OST1) and demethylated H3K4me3 for the regulation of OST1 mRNA abundance, thereby modulating the dehydration stress response. |
| AT1G63520 | hypothetical protein (DUF3527);(source:Araport11) |
| AT1G63530 | hypothetical protein;(source:Araport11) |
| AT1G63535 | Encodes a defensin-like (DEFL) family protein. |
| AT1G63540 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G63550 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G63570 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G63580 | Encodes a plasma membrane-localized protein with two DUF26 domains and a GPI anchor domain. |
| AT1G63600 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G63650 | Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY. |
| AT1G63680 | Encodes AtMurE, a homolog of the bacterial MurE that catalyze the ATP-dependent formation of UDP-N-acetylmuramic acid-tripeptide in bacterial peptidoglycan biosynthesis. Localized to plastids. AtMurE is involved in chloroplast biogenesis. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT1G63750 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G63760 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT1G63770 | Peptidase M1 family protein;(source:Araport11) |
| AT1G63800 | ubiquitin-conjugating enzyme 5;(source:Araport11) |
| AT1G63850 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT1G63870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G63880 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. The mRNA is cell-to-cell mobile. |
| AT1G63950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G63960 | Copper transport protein family;(source:Araport11) |
| AT1G63980 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT1G63990 | Encodes AtSPO11-2, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. Plants homozygous for atspo11-2 exhibit a severe sterility phenotype. Both male and female meiosis are severely disrupted in the atspo11-2 mutant, and this is associated with severe defects in synapsis during the first meiotic division and reduced meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. Required for double-strand break induction. |
| AT1G64010 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G64030 | serpin 3;(source:Araport11) |
| AT1G64035 | pseudogene of serpin 2;(source:Araport11) |
| AT1G64050 | hypothetical protein;(source:Araport11) |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
| AT1G64090 | Reticulan like protein B3;(source:Araport11) |
| AT1G64107 | Encodes a defensin-like (DEFL) family protein. |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT1G64160 | Encodes a dirigent protein involved in the synthesis of (-)pinoresinol. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT1G64170 | member of Putative Na+/H+ antiporter family |
| AT1G64180 | intracellular protein transport protein USO1-like protein;(source:Araport11) |
| AT1G64270 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G64290 | F-box protein-like protein;(source:Araport11) |
| AT1G64295 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G64320 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G64330 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G64360 | SAQR is a clade specific protein present in single copy in Arabidopsis.It's expression is increased during light induced oxidative stress ,drought stress and also during senescence. Promoter contains two AGL15 binding sites. |
| AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT1G64385 | transmembrane protein;(source:Araport11) |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT1G64400 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G64490 | DEK, chromatin associated protein;(source:Araport11) |
| AT1G64500 | A member of a protein family found in plants and animals that contain conserved C-terminal glutaredoxin-like and putative zinc-binding cysteine-rich domains. It is involved in light stimulated actin bundling and chloroplast movement. The mRNA is cell-to-cell mobile. |
| AT1G64530 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT1G64540 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT1G64560 | pseudogene of S-adenosylmethionine-dependent methyltransferase/rRNA (adenine-N6,N6-)-dimethyltransferase/rRNA methyltransferase |
| AT1G64570 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G64600 | copper ion binding / methyltransferase;(source:Araport11) |
| AT1G64610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G64620 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT1G64670 | Encodes a epidermally expressed extracellular protein that likely functions as an alpha-beta hydrolase and is required for normal cuticle formation. Homozygous mutant plants are dwarfed and have abnormal leaves, collapsed cells, reduced numbers of trichomes. The specific role of BDG is unclear: it may function in cutin biosynthesis or as a cross-linking enzyme in the cell wall itself. |
| AT1G64680 | beta-carotene isomerase D27;(source:Araport11) |
| AT1G64690 | Encodes BRANCHLESS TRICHOME (BLT) involved in trichome development. A large portion of the internal amino acid sequence of BLT is predicted to form a coiled-coil domain. BLT mutants form branchless trichomes with blunt tips. |
| AT1G64710 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT1G64770 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. |
| AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
| AT1G64790 | ILITHYIA (ILA) is a HEAT repeat protein involved in plant immunity. The gene is also involved in systemic acquired resistance induced by P. syringae expressing avrRps4. Loss-of-function mutants of ILA caused pleiotropic defects in the mutant plants. The mutant plants are smaller in size and the leaves are serrated and yellow to light green in color. Required for bacterium-triggered stomatal closure. |
| AT1G64800 | DNA binding / transcription factor;(source:Araport11) |
| AT1G64820 | MATE efflux family protein;(source:Araport11) |
| AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G64840 | LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11) |
| AT1G64850 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT1G64870 | hypothetical protein;(source:Araport11) |
| AT1G64900 | Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile. |
| AT1G64910 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G64920 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G64930 | member of CYP89A |
| AT1G64990 | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG1 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG1 and may act to down-regulate GTG1 binding to ABA. GTG1 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG1 transcript levels do not appear to change in response to ABA or abiotic stresses. |
| AT1G65010 | Encodes a microtubule-associated protein. Putative role in flower development. Comparison of SALK_061426C to Columbia wild type in normal lighting and under low light of 33 micromoles per meter-squared per second resulted in a trend toward earlier bolting in the mutant under low light (P=0.055) (Ann Stapleton and Patrick Pridgen, 2009, personal communication). |
| AT1G65070 | DNA mismatch repair protein MutS, type 2;(source:Araport11) |
| AT1G65110 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G65113 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G65120 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G65140 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65160 | ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65190 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G65200 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G65230 | transmembrane protein, putative (DUF2358);(source:Araport11) |
| AT1G65300 | Encodes PHERES2, a homolog of PHERES1. PHERES1 and PHERES2 are both target genes of the FIS Polycomb group complex but only PHERES1 is regulated by genomic imprinting, which is likely caused by the presence of repeat sequences in the proximity of the PHERES1 locus. |
| AT1G65310 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT1G65330 | Type I MADS-box protein, regulated by MEA and FIE, expressed transiently after fertilization in embryo and endosperm. |
| AT1G65340 | member of CYP96A |
| AT1G65342 | transmembrane protein;(source:Araport11) |
| AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
| AT1G65385 | pseudogene of serpin 3;(source:Araport11) |
| AT1G65420 | Chloroplast localized YCF20-like gene involved in nonphotochemical quenching. Has overlapping functions with npq6. |
| AT1G65430 | IBR domain-containing protein;(source:Araport11) |
| AT1G65483 | hypothetical protein;(source:Araport11) |
| AT1G65484 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65486 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65541 | hypothetical protein;(source:Araport11) |
| AT1G65560 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G65570 | Encodes a glycosyl hydrolase 28 (GH28) family polygalacturonase (PG) protein. Involved in root cap development. |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT1G65620 | required for formation of a symmetric flat leaf lamina, encodes a member of a family of proteins characterized by cysteine repeats and a leucine zipper; involved in KNOX gene regulation. Acts together with ASL1 in proximal-distal symmetry determination. Forms a complex with AS1 that binds to the BP promoter and leads to silencing of BP. |
| AT1G65630 | Encodes a putative DegP protease. |
| AT1G65642 | pseudogene of F-box family protein |
| AT1G65660 | Encodes a CCHC zinc finger protein that may function as a step II splicing factor. In an epigenetic allele of SMP1 (in which SMP1 and SMP2 mRNA is reduced) organs are smaller and contain fewer cells. |
| AT1G65670 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT1G65680 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
| AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT1G65750 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-18 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G65770 | Encodes AMR1 (Ascorbic acid Mannose Pathway Regulator 1). Coordinately and negatively regulates the mannose/L-galactose ascorbic acid biosynthetic pathway in response to developmental and environmental cues. |
| AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
| AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G65845 | transmembrane protein;(source:Araport11) |
| AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G65880 | Encodes a benzoate-CoA ligase. Involved in the biosynthesis of benzoyloxyglucosinolate in Arabidopsis seeds. |
| AT1G65890 | acyl activating enzyme 12;(source:Araport11) |
| AT1G65920 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT1G65970 | thioredoxin-dependent peroxidase 2 |
| AT1G65980 | thioredoxin-dependent peroxidase |
| AT1G65990 | type 2 peroxiredoxin-related / thiol specific antioxidant / mal allergen family protein;(source:Araport11) |
| AT1G66000 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G66010 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G66030 | Encodes a protein with cytochrome P450 domain. Probable psuedogene. |
| AT1G66060 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G66110 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G66120 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G66150 | Receptor-like transmembrane kinase I (TMK1); key regulator in auxin signaling. High auxin and TMK1 play essential and positive roles in ABA signaling through regulating ABA INSENSITIVE 1 and 2 (ABI1/2). Inhibits the phosphatase activity of ABI2 by direct phosphorylation of threonine 321 (T321), a conserved phosphorylation site in ABI2 proteins, whose phosphorylation status is important for both auxin and ABA responses. |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G66235 | no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
| AT1G66245 | hypothetical protein;(source:Araport11) |
| AT1G66260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G66300 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G66340 | Similar to prokaryote sensory transduction proteins. Contains a histidine kinase and a response regulator domain. Homodimer. Membrane component. Binds ethylene. Mutations affect ethylene binding and metabolism of other plant hormones such as auxin, cytokinins, ABA and gibberellic acid. Ethylene receptor. Has histidine kinase activity. Is regulated by RTE1. Mutations in ETR1 block ethylene stimulation of flavonol synthesis. |
| AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
| AT1G66390 | Production of anthocyanin pigment 2 protein (PAP2). |
| AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G66460 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT1G66510 | AAR2 protein family;(source:Araport11) |
| AT1G66520 | formyltransferase;(source:Araport11) |
| AT1G66540 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G66550 | member of WRKY Transcription Factor; Group III |
| AT1G66570 | sucrose-proton symporter 7;(source:Araport11) |
| AT1G66630 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT1G66700 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes PXMT1, a methyltransferase that methylates 1,7-paraxanthine. |
| AT1G66760 | MATE efflux family protein;(source:Araport11) |
| AT1G66780 | MATE efflux family protein;(source:Araport11) |
| AT1G66820 | glycine-rich protein;(source:Araport11) |
| AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G66860 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT1G66870 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G66910 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66920 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66930 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66940 | kinase-like protein;(source:Araport11) |
| AT1G66950 | Encodes a plasma membrane-localized ABC transporter. Confers tolerance to herbicide paraquat. |
| AT1G66960 | Terpenoid cyclases family protein;(source:Araport11) |
| AT1G66970 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT1G66990 | pseudogene of suppressor of npr1-1 constitutive 4;(source:Araport11) |
| AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G67020 | transmembrane protein;(source:Araport11) |
| AT1G67040 | DnaA initiator-associating protein;(source:Araport11) |
| AT1G67050 | membrane-associated kinase regulator;(source:Araport11) |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT1G67105 | other_RNA;(source:Araport11) |
| AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
| AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
| AT1G67130 | F-box family protein;(source:Araport11) |
| AT1G67150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G67220 | histone acetyltransferase of the CBP family 2;(source:Araport11) |
| AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT1G67238 | other_RNA;(source:Araport11) |
| AT1G67270 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT1G67300 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G67390 | F-box family protein;(source:Araport11) |
| AT1G67430 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT1G67460 | Minichromosome maintenance (MCM2/3/5) family protein;(source:Araport11) |
| AT1G67470 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G67480 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G67520 | lectin protein kinase family protein;(source:Araport11) |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
| AT1G67580 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G67590 | Remorin family protein;(source:Araport11) |
| AT1G67635 | phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11) |
| AT1G67650 | SRP72 RNA-binding domain-containing protein;(source:Araport11) |
| AT1G67660 | Restriction endonuclease, type II-like superfamily protein;(source:Araport11) |
| AT1G67690 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT1G67720 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G67750 | Pectate lyase family protein;(source:Araport11) |
| AT1G67770 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined. |
| AT1G67800 | Copine (Calcium-dependent phospholipid-binding protein) family;(source:Araport11) |
| AT1G67810 | Encodes a protein capable of stimulating the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. SufE2:GFP localizes to the chloroplasts where it is likely to play a role in iron-sulfur cluster assembly. Transcript levels for this gene are high in the pollen relative to other organs based on RT-PCR analysis. The mRNA is cell-to-cell mobile. |
| AT1G67855 | hypothetical protein;(source:Araport11) |
| AT1G67856 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G67870 | glycine-rich protein;(source:Araport11) |
| AT1G67900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G67920 | hypothetical protein;(source:Araport11) |
| AT1G67930 | Golgi transport complex protein-like protein;(source:Araport11) |
| AT1G67990 | Encodes a tapetum-specific O-methyltransferase. In vitro enzyme assay indicated activity with caffeoyl-CoA, caffeoyl glucose, chlorogenic acid and polyamine conjugates. RNAi mutants had impaired silique development and seed setting. |
| AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT1G68090 | Encodes a calcium-binding protein annexin (AnnAt5). Plays a vital role in pollen development via Ca2+ dependent membrane trafficking. |
| AT1G68100 | member of IAA-alanine resistance protein 1 |
| AT1G68130 | Encodes the longer of two splice variants of a transcription factor involved in regulating starch metabolism in response to cold. |
| AT1G68140 | zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11) |
| AT1G68150 | member of WRKY Transcription Factor; Group II-b The mRNA is cell-to-cell mobile. |
| AT1G68190 | B-box zinc finger family protein;(source:Araport11) |
| AT1G68220 | aerobic coproporphyrinogen-III oxidase (DUF1218);(source:Araport11) |
| AT1G68230 | Reticulon family protein;(source:Araport11) |
| AT1G68238 | transmembrane protein;(source:Araport11) |
| AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
| AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
| AT1G68350 | cotton fiber protein;(source:Araport11) |
| AT1G68360 | Encodes a nuclear localized member of the C2H2 family of TFIIIA transcription factors.GIS3 is involved in trichome initiation and development downstream of GA and cytokinin signaling. GIS regulates the expression GIS and GIS2. |
| AT1G68370 | DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins. |
| AT1G68390 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G68400 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G68420 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT1G68480 | Encodes a putative zinc finger transcription factor that is necessary for proper lateral organ shape and is sufficient to induce the proliferation of lateral organ tissue. Together with NUB, it is involved in stamen and carpel development. |
| AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT1G68568 | Natural antisense transcript overlaps with AT1G68570;(source:Araport11) |
| AT1G68585 | hypothetical protein;(source:Araport11) |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G68725 | AGP19 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP18, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers. Non-consensus splice site at the intron:exon boundary (AT:exon) |
| AT1G68730 | Zim17-type zinc finger protein;(source:Araport11) |
| AT1G68735 | Encodes a defensin-like (DEFL) family protein. |
| AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
| AT1G68765 | Encodes a small protein of 77 amino acids. Loss of function mutations are defective in the process of ethylene independent floral organ abscission. Although the mutants have a normal appearing abscission zone, the floral organs do not abscisce. The peptide appears to be secreted and may function as a ligand. Arabidopsis 35S:IDA lines constitutively overexpressing IDA exhibit earlier abscission of floral organs, showing that the abscission zones are responsive to IDA soon after the opening of the flowers. In addition, ectopic abscission was observed at the bases of the pedicel, branches of the inflorescence, and cauline leaves. The silique valves also dehisced prematurely. |
| AT1G68780 | RNI-like superfamily protein;(source:Araport11) |
| AT1G68820 | Putative C3HC4 zinc-finger ubiquitin E3 ligase, negative regulator in ABA and drought stress response. May act as a positive role in regulating the high temperature by mediating the degradation of unknown target proteins. |
| AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
| AT1G68845 | hypothetical protein;(source:Araport11) |
| AT1G68850 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G68880 | basic leucine-zipper 8;(source:Araport11) |
| AT1G68890 | Homologous to the four eubacterial men genes involved in menanoquinone biosynthesis. Studies of mutants defective in this gene demonstrated its involvement in phylloquinone biosynthesis in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT1G68905 | Encodes a defensin-like (DEFL) family protein. |
| AT1G68930 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G68940 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G68960 | hypothetical protein (DUF295);(source:Araport11) |
| AT1G68970 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G68980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT1G69020 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT1G69030 | BSD domain-containing protein;(source:Araport11) |
| AT1G69060 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G69070 | nucleolar-like protein;(source:Araport11) |
| AT1G69080 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G69190 | encodes a bifunctional cytosolic hydroxymethyldihydropterin pyrophosphokinase/ dihydropteroate synthase (HPPK/DHPS)that is involved in tetrahydrofolate biosynthesis and is responsive to oxidative stress. |
| AT1G69200 | Encodes a fructokinase-like protein (AT3G54090/FLN1, AT1G69200/FLN2), a member of the pfkB-carbohydrate kinase family. FLN1 and FLN2 are potential plastidial thioredoxin z (TRX z) targets. Mutants display mutant chloroplast development, general plant growth and development defects and defects in PEP-dependent transcription. The mRNA is cell-to-cell mobile. |
| AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
| AT1G69320 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G69400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
| AT1G69500 | Encodes a cytochrome P450, designated CYP704B1. Expressed in the developing anthers. Essential for pollen exine development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis. |
| AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G69540 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. |
| AT1G69550 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
| AT1G69572 | Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689). |
| AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G69588 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini |
| AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
| AT1G69620 | putative 60S ribosomal protein L34 The mRNA is cell-to-cell mobile. |
| AT1G69630 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G69670 | cullin, putative, contains similarity to Cullin homolog 3 (CUL-3) SP:Q13618, GI:3639052 from (Homo sapiens); contains Pfam profile PF00888: Cullin family. Interacts with members of AtBPM family and RBX1 suggesting it is part of an E3 ligase complex involved in RUB modification. |
| AT1G69700 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. The mRNA is cell-to-cell mobile. |
| AT1G69710 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT1G69720 | Encodes a member (HO3) of the heme oxygenase family. |
| AT1G69730 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G69770 | Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing. |
| AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69820 | Note that conflicting nomenclature exists in the literature: At1g69820 is named as GGT4 in Plant J. 2007 Mar 49(5):878-88; and as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT1G69830 | Encodes a plastid-localized α-amylase. Expression is reduced in the SEX4 mutant. Loss of function mutations show normal diurnal pattern of starch accumulation/degradation. Expression follows circadian rhythms. |
| AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT1G69900 | Actin cross-linking protein;(source:Araport11) |
| AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69970 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
| AT1G70000 | Encodes a MYB-like Domain transcription factor that plays a positive role in anthocyanin accumulation in response to light and cytokinin via repression of MYBL2.MYBD expression increased in response to light or cytokinin, and MYBD enhanced anthocyanin biosynthesis via the repression of MYBL2 encoding for a transcription factor that had a negative effect on this process. In addition, MYBD can bind in vivo to the MYBL2 promoter and a lower level of histone H3K9 acetylation (H3K9ac) at upstream region of MYBL2 in MYBD-OX in comparison to wild-type plants, implies that MYBD represses MYBL2 expression via an epigenetic mechanism. |
| AT1G70040 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT1G70060 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). The mRNA is cell-to-cell mobile. |
| AT1G70070 | Allelic to ISE2(increased size exclusion limit of plasmodesmata 2). Mutants maintain dilated plasmodesmata at the embryonic torpedo stage. |
| AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G70110 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G70120 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT1G70130 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT1G70180 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT1G70230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G70250 | Encodes a Protease inhibitor/seed storage/LTP family protein. |
| AT1G70260 | Encodes an endoplasmic reticulum (ER)-localized nodulin MtN21-like transporter family protein that negatively regulates resistance against biotrophic pathogens but not the necrotrophic pathogen, B. cinerea, possibly by regulating ROS production, cell death and PR1 expression. |
| AT1G70310 | Spermidine synthase. |
| AT1G70320 | encodes a ubiquitin-protein ligase-like protein containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. |
| AT1G70380 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G70390 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G70400 | NOSIC domain protein;(source:Araport11) |
| AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
| AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
| AT1G70430 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G70440 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
| AT1G70480 | Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast. |
| AT1G70490 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT1G70510 | A member of class I knotted1-like homeobox gene family (together with KNAT1). Similar to the knotted1 (kn1) homeobox gene of maize. KNAT2 acts synergistically with cytokinins and antagonistically with ethylene based on ectopic expression studies in different mutant backgrounds and hormone treatments. In addition, KNAT2 is negatively regulated by AS and YABBY genes. KNAT2 is strongly expressed in the shoot apex of seedlings, while in mature plants the gene is primarily expressed in flowers and inflorescence stems. |
| AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
| AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G70670 | The gene encodes a stress-responsive and OB-associated non-seed caleosin-like protein. It plays a negative regulator role in ABA signaling. |
| AT1G70680 | Caleosin-related family protein;(source:Araport11) |
| AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT1G70700 | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
| AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
| AT1G70830 | MLP-like protein 28;(source:Araport11) |
| AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G70950 | Microtubule-stabilizing protein. Module with MREL57 regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT1G70970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G71002 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection. |
| AT1G71010 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the proposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
| AT1G71015 | PADRE protein. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71070 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G71120 | Contains lipase signature motif and GDSL domain. |
| AT1G71210 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G71270 | Encodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network. |
| AT1G71280 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G71300 | Vps52 / Sac2 family;(source:Araport11) |
| AT1G71360 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. |
| AT1G71370 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G71380 | cellulase 3;(source:Araport11) |
| AT1G71400 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile. |
| AT1G71440 | Encodes tubulin-folding cofactor E. Mutant embryos consist of one or a few grossly enlarged cells, surrounded by an endosperm that fails to cellularize and contains a few big nuclei. |
| AT1G71530 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G71680 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G71691 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G71695 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
| AT1G71700 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
| AT1G71820 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT1G71830 | Plasma membrane LRR receptor-like serine threonine kinase expressed during embryogenesis in locules until stage 6 anthers, with higher expression in the tapetal cell layer. SERK1 and SERK2 receptor kinases function redundantly as an important control point for sporophytic development controlling male gametophyte production. SERK1 interacts with and transphosphorylates EMS1 |
| AT1G71865 | PyrD;(source:Araport11) |
| AT1G71866 | Member of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G71890 | Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation. |
| AT1G71930 | Encodes a NAC-domain transcription factor with transcriptional activation activity that is involved in xylem formation. Induces transdifferentiation of various cells into protoxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids. |
| AT1G71940 | SNARE associated Golgi protein family;(source:Araport11) |
| AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
| AT1G72000 | Plant neutral invertase family protein;(source:Araport11) |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT1G72131 | pseudogene of proton-dependent oligopeptide transporter |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT1G72160 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT1G72180 | Encodes a leucine-rich repeat receptor kinase that functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT1G72220 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G72260 | Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
| AT1G72270 | Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
| AT1G72330 | Encodes for alanine aminotransferase ALAAT2. |
| AT1G72350 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G72360 | Encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT1G72390 | nuclear receptor coactivator;(source:Araport11) |
| AT1G72430 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G72470 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G72480 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT1G72490 | DRO1 is a member of the IGT gene family and has a unknown function . It is expressed in roots and involved in leaf root architecture, specifically the orientation of lateral root angles. Involved in determining lateral root branch angle. |
| AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein;(source:Araport11) |
| AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G72530 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT1G72540 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G72560 | Encodes a karyopherin, specifically the Arabidopsis ortholog of LOS1/XPOT, a protein that mediates nuclear export of tRNAs in yeast and mammals. PSD is capable of rescuing the tRNA export defect of los1 in S. cerevisiae. psd mutants display disrupted initiation of the shoot apical meristem and delay leaf initiation after germination; they also display delayed transition from vegetative to reproductive development. |
| AT1G72610 | germin-like protein (GLP1) |
| AT1G72620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G72670 | Member of IQ67 (CaM binding) domain containing family. IQ67 DOMAIN proteins facilitate preprophase band formation and division-plane orientation. |
| AT1G72700 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT1G72710 | Encodes a member of the casein kinase 1 protein family that is localized to the cytoplasm and nucleus. The mRNA is cell-to-cell mobile. |
| AT1G72720 | hypothetical protein (DUF3511);(source:Araport11) |
| AT1G72730 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G72760 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G72780 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G72790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G72800 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G72810 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G72830 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT1G72880 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
| AT1G72900 | Toll-Interleukin-Resistance (TIR) domain-containing protein;(source:Araport11) |
| AT1G72960 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
| AT1G72970 | Originally identified as a mutation that causes floral organs to fuse together. About 10-20% of mutants also have defects in ovules. Mutants have reduced fertility most likely as because of fusions that pistil emergence. The protein has similarity to the mandelonitrile lyase family of FAD containing oxidoreductases and is predicted to be secreted (SignalP).It is expressed in all tissue layers of roots, inflorescences, stems, leaves, and flowers and is also expressed in siliques. Expression is highest in inflorescence and flower tissue.Transmission of mutant alleles to the progeny shows non mendelian segregation- a percentage of mutant alleles revert back to a previous parental (e.g. grandparental) wild type allele. It has been suggested that an RNA template driven or other extra-DNA genomic mechanism may be responsible for the non-mendelian inheritance of HTH. Reversion events in alleles at other loci have also been observed to occur in plants with an hth mutant background indicating a genome wide effect. |
| AT1G72980 | LOB domain-containing protein 7;(source:Araport11) |
| AT1G72990 | beta-galactosidase 17;(source:Araport11) |
| AT1G73000 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT1G73010 | Encodes PPsPase1, a pyrophosphate-specific phosphatase catalyzing the specific cleavage of pyrophosphate (Km 38.8 uM) with an alkaline catalytic pH optimum. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT1G73040 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G73050 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT1G73066 | Leucine-rich repeat family protein;(source:Araport11) |
| AT1G73110 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G73120 | F-box/RNI superfamily protein;(source:Araport11) |
| AT1G73150 | Bromodomain and extra terminal domain family protein. Binds to acetyl-histone H3. Binding is reduced when GTE3 is SUMOylated by SIZ1. |
| AT1G73165 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
| AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G73210 | hypothetical protein (DUF789);(source:Araport11) |
| AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
| AT1G73250 | encodes a bifunctional 3, 5-epimerase-4-reductase in L-fucose synthesis and converts GDP-D-mannose to GDP-L-fucose in vitro along with MUR1 (GDP-D-mannose 4,6-dehydratase). It is expressed in all tissues examined, but most abundantly in roots and flowers. |
| AT1G73270 | serine carboxypeptidase-like 6;(source:Araport11) |
| AT1G73280 | serine carboxypeptidase-like 3;(source:Araport11) |
| AT1G73300 | serine carboxypeptidase-like 2;(source:Araport11) |
| AT1G73310 | serine carboxypeptidase-like 4;(source:Araport11) |
| AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
| AT1G73350 | ankyrin repeat protein;(source:Araport11) |
| AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
| AT1G73370 | Encodes a protein with sucrose synthase activity (SUS6). |
| AT1G73440 | calmodulin-like protein;(source:Araport11) |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G73490 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
| AT1G73510 | hypothetical protein;(source:Araport11) |
| AT1G73650 | 3-oxo-5-alpha-steroid 4-dehydrogenase (DUF1295);(source:Araport11) |
| AT1G73655 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT1G73710 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G73780 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G73790 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G73870 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G73875 | Deadenylase. |
| AT1G73880 | UDP-glucosyl transferase 89B1;(source:Araport11) |
| AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
| AT1G73910 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. |
| AT1G73950 | Transmembrane Fragile-X-F-associated protein;(source:Araport11) |
| AT1G73965 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT1G73990 | Encodes a putative protease SppA (SppA). |
| AT1G74000 | encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis. |
| AT1G74010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G74040 | Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). |
| AT1G74060 | Ribosomal protein L6 family protein;(source:Araport11) |
| AT1G74090 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with preference with methionine-derived desulfoglucosinolates. |
| AT1G74100 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with different desulfoglucosinolates, the best substrate is indole-3-methyl-dsGS, followed by benzyl-dsGS. Expression was induced by wounding, jasmonate and ethylene stimulates. |
| AT1G74110 | member of CYP78A |
| AT1G74150 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G74170 | receptor like protein 13;(source:Araport11) |
| AT1G74180 | receptor like protein 14;(source:Araport11) |
| AT1G74220 | homeobox-like protein;(source:Araport11) |
| AT1G74290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G74410 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G74430 | Encodes a putative transcription factor (MYB95). The mRNA is cell-to-cell mobile. |
| AT1G74458 | transmembrane protein;(source:Araport11) |
| AT1G74470 | Encodes for a multifunctional protein with geranylgeranyl reductase activity shown to catalyze the reduction of prenylated geranylgeranyl-chlorophyll a to phytyl-chlorophyll a (chlorophyll a) and free geranylgeranyl pyrophosphate to phytyl pyrophosphate. The mRNA is cell-to-cell mobile. |
| AT1G74480 | RWP-RK domain-containing protein;(source:Araport11) |
| AT1G74540 | Encodes a tricoumaroylspermidine / triferuloylspermidine meta-hydroxylase that participates in the formation of N1,N5-di(hydroxyferuloyol)- N10-sinapoyl spermidine, an important constituent of pollen. This gene appears to be expressed in young flower buds and inflorescence tips with notably high levels of expression in the tapetum and pollen. |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT1G74670 | Gibberellin-regulated family protein;(source:Araport11) |
| AT1G74680 | Exostosin family protein;(source:Araport11) |
| AT1G74750 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G74770 | zinc ion binding protein;(source:Araport11) |
| AT1G74800 | Encodes a Golgi-localized hydroxyproline galactosyltransferase GALT5. Functions together with GALT2 as redundant GALTs that control AGP (arabinogalactan-proteins) O-glycosylation, which is essential for normal growth and development. Mutants display multiple phenotypes including reduced root hair growth. |
| AT1G74810 | HCO3- transporter family;(source:Araport11) |
| AT1G74820 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G74830 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G74850 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. PEP complex component. |
| AT1G74870 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G74880 | Encodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly. |
| AT1G74890 | Encodes a nuclear response regulator that acts as a negative regulator in cytokinin-mediated signal transduction. Transcript accumulates in leaves and roots in response to cytokinin treatment. |
| AT1G74910 | KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1. |
| AT1G74929 | hypothetical protein;(source:Araport11) |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT1G74960 | Encodes a plastidic beta-ketoacyl-ACP synthase II, involved in fatty acid elongation from 16:0-ACP to 18:0-ACP. Homozygous knock-out mutants are embryo lethal, indicating early embryo development is sensitive to elevated 16:0. |
| AT1G75030 | encodes a PR5-like protein |
| AT1G75040 | Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment. The mRNA is cell-to-cell mobile. |
| AT1G75050 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT1G75110 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT1G75140 | membrane protein;(source:Araport11) |
| AT1G75150 | DNA ligase-like protein;(source:Araport11) |
| AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G75180 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT1G75210 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
| AT1G75230 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G75260 | oxidoreductases, acting on NADH or NADPH;(source:Araport11) |
| AT1G75261 | Pseudogene of AT4G39230; isoflavone reductase, putative |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT1G75430 | BEL1-like homeodomain 11;(source:Araport11) |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT1G75460 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT1G75470 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G75510 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
| AT1G75580 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75600 | Histone superfamily protein;(source:Araport11) |
| AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. |
| AT1G75690 | Thylakoid Thiol/Disulfide-Modulating Protein. |
| AT1G75700 | HVA22-like protein G;(source:Araport11) |
| AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G75720 | WEB family protein (DUF827);(source:Araport11) |
| AT1G75730 | hypothetical protein;(source:Araport11) |
| AT1G75750 | GA-responsive GAST1 protein homolog regulated by BR and GA antagonistically. Possibly involved in cell elongation based on expression data The mRNA is cell-to-cell mobile. |
| AT1G75770 | hypothetical protein;(source:Araport11) |
| AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G75810 | transmembrane protein;(source:Araport11) |
| AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
| AT1G75910 | Member of Lipase proteins. Involved in lipid metabolism and pollen wall formation. DYT1 and bHLH089 specifically recognize the TCATGTGC box to activate expression. |
| AT1G75940 | encodes a protein similar to the BGL4 beta-glucosidase from Brassica napus. The ATA27 protein is predicted to have an ER retention signal and an acidic isoelectric point, suggesting that it may be localized to the ER lumen. |
| AT1G75960 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G75980 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT1G76040 | member of Calcium Dependent Protein Kinase |
| AT1G76050 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
| AT1G76130 | alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase, putative, strong similarity to alpha-amylase GI:7532799 from (Malus x domestica);contains Pfam profile PF00128: Alpha amylase, catalytic domain. Predicted to be secreted based on SignalP analysis. |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
| AT1G76190 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G76210 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G76250 | transmembrane protein;(source:Araport11) |
| AT1G76280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G76310 | core cell cycle genes |
| AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G76410 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
| AT1G76500 | Encodes an AT hook domain containing protein. Identified in a screen of activation tagged lines that suppress the long-hypocotyl phenotype of a weak phyB allele. Affects cell elongation in the hypocotyl and leaves.Acts redundantly with ESC to modulate hypocotyl growth inhibition in response to light |
| AT1G76510 | ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
| AT1G76530 | Auxin efflux carrier family protein;(source:Araport11) |
| AT1G76550 | Phosphofructokinase family protein. Target of miRNA sRNA6. |
| AT1G76560 | CP12 domain-containing protein 3;(source:Araport11) |
| AT1G76570 | Chlorophyll A-B binding family protein;(source:Araport11) |
| AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11) |
| AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT1G76610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G76640 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G76700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G76760 | Encodes a y-type thioredoxin (Trx-y1) localized in chloroplast stroma. |
| AT1G76780 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G76790 | Encodes a protein with similarity to N-acetylserotonin O-methyltransferase (ASMT) but it does not have ASMT activity in vitro. |
| AT1G76830 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT1G76892 | Natural antisense transcript overlaps with AT1G76890;(source:Araport11) |
| AT1G76930 | Encodes an Arabidopsis extensin gene that belongs to cell-wall hydroxyproline-rich glycoproteins. The cross-link of extensins enforces cell wall strength. Transgenic plants overexpressing this gene show an increase in stem thickness. |
| AT1G76940 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G76980 | patatin-like phospholipase domain protein;(source:Araport11) |
| AT1G76990 | ACT domain repeat 3;(source:Araport11) |
| AT1G76994 | hypothetical protein;(source:Araport11) |
| AT1G77010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G77020 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G77030 | Required for functional maturation of male and female gametophytes. |
| AT1G77080 | MADS domain protein - flowering regulator that is closely related to FLC. Deletion of this locus in Nd ecotype is correlated with earlier flowering in short days suggesting function as a negative regulator of flowering. |
| AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G77100 | peroxidase superfamily protein;(source:Araport11) |
| AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
| AT1G77138 | other_RNA;(source:Araport11) |
| AT1G77150 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G77210 | AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose. |
| AT1G77240 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G77250 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
| AT1G77320 | Mutant is defective in meiosis and produces abnormal microspores. Encodes a BRCT-domain-containing protein that could be specific to the meiotic cell cycle and that plays a crucial role in some DNA repair events independent of SPO11 DSB recombination repair. |
| AT1G77360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G77380 | Amino acid permease which transports basic amino acids. |
| AT1G77390 | Encodes a core cell cycle gene involved in meiosis II during microsporogenesis. Recessive mutants exhibit delayed and asynchronous meiosis in pollen mother cell populations and uncoordinated nuclear division and cytokinesis resulting in dyad microspores. |
| AT1G77460 | Encodes a plasma membrane, microtubule associated protein with sequence similarity to CSI1 that is involved in cellulose biosynthesis and cell elongation. A mutation in CSI3 alone do not appear to affect growth but enhances the cell elongation phenotype of CSI1 mutants. CSI3 co localizes with CSI1 and CESA3 and CESA6. |
| AT1G77470 | Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent. |
| AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
| AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
| AT1G77530 | O-methyltransferase family protein;(source:Araport11) |
| AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
| AT1G77570 | Winged helix-turn-helix transcription repressor DNA-binding. Expressed in pollen and mutants show enlarged pollen grain nucleoli. |
| AT1G77610 | EamA-like transporter family protein;(source:Araport11) |
| AT1G77620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G77730 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. The mRNA is cell-to-cell mobile. |
| AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
| AT1G77830 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G77840 | Translation initiation factor IF2/IF5;(source:Araport11) |
| AT1G77880 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G77885 | hypothetical protein;(source:Araport11) |
| AT1G77890 | One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis. |
| AT1G77932 | FANTASTIC four protein, putative (DUF3049);(source:Araport11) |
| AT1G77940 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT1G77990 | Encodes a low-affinity sulfate transporter. |
| AT1G77992 | Natural antisense transcript overlaps with AT1G77990;(source:Araport11) |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT1G78010 | tRNA modification GTPase;(source:Araport11) |
| AT1G78040 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G78050 | phosphoglycerate/bisphosphoglycerate mutase;(source:Araport11) |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile. |
| AT1G78090 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G78160 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G78190 | Trm112p-like protein;(source:Araport11) |
| AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT1G78265 | Natural antisense transcript overlaps with AT1G78270;(source:Araport11) |
| AT1G78270 | UDP-glucosyl transferase 85A4;(source:Araport11) |
| AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
| AT1G78320 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78340 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78360 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78370 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
| AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT1G78450 | SOUL heme-binding family protein;(source:Araport11) |
| AT1G78470 | F-box/LRR protein;(source:Araport11) |
| AT1G78490 | member of CYP708A family. The mRNA is cell-to-cell mobile. |
| AT1G78520 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G78530 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G78570 | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli. |
| AT1G78580 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain but no trehalose phosphatase (TPP)-like domain. ATTPS1 is able to complement yeast tps1 mutants in vivo. The gene product modulates cell growth but not cell differentiation by determining cell wall deposition and cell division. The N-terminal domain of TPS1 has a nuclear localization signal and an autoinhibitory function. The C-terminal domain is important for catalytic fidality of TPS1 and for appropriate signaling of the sucrose status by trehalose 6-phosphate levels in the plant (10.1105/tpc.19.00837). |
| AT1G78590 | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
| AT1G78600 | light-regulated zinc finger protein 1;(source:Araport11) |
| AT1G78610 | mechanosensitive channel of small conductance-like 6;(source:Araport11) |
| AT1G78640 | B3 domain protein;(source:Araport11) |
| AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
| AT1G78700 | BES1/BZR1 homolog 4;(source:Araport11) |
| AT1G78720 | SecY protein transport family protein;(source:Araport11) |
| AT1G78730 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G78750 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G78760 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G78780 | pathogenesis-related family protein;(source:Araport11) |
| AT1G78800 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G78820 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT1G78830 | In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance. |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
| AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
| AT1G78910 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G78915 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G78930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G78940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G78950 | Terpenoid cyclases family protein;(source:Araport11) |
| AT1G78955 | Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system. |
| AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
| AT1G78990 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G79080 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G79190 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G79200 | Encodes a nuclear localized protein involved in auxin-dependent control of cell proliferation in pistil development. Loss of function mutations have increased cell proliferation in the stigma. |
| AT1G79240 | pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10) |
| AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT1G79250 | AGC kinase 1.7;(source:Araport11) |
| AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
| AT1G79280 | Encodes a 237-kDA protein with similarity to vertebrate Tpr, a long coiled-coil proteins of nuclear pore inner basket filaments. It is localized to the inner surface of the nuclear envelope and is a component of the nuclear pore-associated steps of sumoylation and mRNA export in plants. Mutations affect flowering time regulation and other developmental processes. Probably acts in the same pathway as ESD4 in affecting flowering time, vegetative and inflorescence development. |
| AT1G79320 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT1G79330 | Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT1G79370 | member of CYP79C |
| AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT1G79390 | centrosomal protein;(source:Araport11) |
| AT1G79400 | member of Putative Na+/H+ antiporter family |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
| AT1G79430 | Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. |
| AT1G79440 | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
| AT1G79460 | Encodes for a protein with ent-kaurene synthase B activity which catalyzes the second step in the cyclization of GGPP to ent-kaurene in the gibberellins biosynthetic pathway. |
| AT1G79480 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G79540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G79550 | Encodes cytosolic phosphoglycerate kinase (PGK3). Expression studies in PGK mutants showed that PGK1 and PGK3 were down-regulated in pgk3.2 and pgk1.1, respectively. These results indicate that the down-regulation of photosynthetic activity could be a plant strategy when glycolysis is impaired to achieve metabolic adjustment and optimize growth. |
| AT1G79590 | Encodes one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
| AT1G79630 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G79640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G79730 | Encodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
| AT1G79750 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed. |
| AT1G79760 | Identified as target of the AGL15 binding motif CArG. |
| AT1G79790 | Encodes a chloroplast-localized FMN hydrolase that whose phosphatase activity is FMN-specific. |
| AT1G79850 | nuclear-encoded 30S chloroplast ribosomal protein S17 |
| AT1G79910 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G79915 | Putative methyltransferase family protein;(source:Araport11) |
| AT1G79960 | ovate family protein 14;(source:Araport11) |
| AT1G80010 | FAR1-related sequence 8;(source:Araport11) |
| AT1G80020 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.0e-62 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G80050 | Encodes an adenosine phosphoribosyl transferase(E.C:2.4.2.7), a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. This isozyme has high affinity for cytokinins and is likely to be localized to the cytosol. |
| AT1G80070 | Encodes a factor that influences pre-mRNA splicing and is required for embryonic development. Mutations result in an abnormal suspensor and embryo lethality. The mRNA is cell-to-cell mobile. |
| AT1G80080 | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G80110 | phloem protein 2-B11;(source:Araport11) |
| AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G80190 | Similar to the PSF1 component of GINS complex, which in other organism was shown to be involved in the initiation of DNA replication. |
| AT1G80220 | hypothetical protein (DUF1644);(source:Araport11) |
| AT1G80240 | DUF642 gene |
| AT1G80280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G80290 | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
| AT1G80320 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G80450 | VQ motif-containing protein;(source:Araport11) |
| AT1G80470 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G80500 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT1G80570 | RNI-like superfamily protein;(source:Araport11) |
| AT1G80580 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G80590 | member of WRKY Transcription Factor; Group III |
| AT1G80610 | hypothetical protein;(source:Araport11) |
| AT1G80650 | RNAse THREE-like protein 1;(source:Araport11) |
| AT1G80660 | H[+]-ATPase 9;(source:Araport11) |
| AT1G80670 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT1G80680 | Mutant has early-flowering phenotype, encodes a putative nucleoporin. Required for the activation of downstream defense pathways by the snc1 mutation. Involved in basal resistance against bacterial pathogens. |
| AT1G80760 | Encodes a protein with boron transporter activity. It helps to preferentially direct boron to young developing tissues in the shoot, such as immature leaves, under low boron conditions. This boron channel appears to be impermeable to water, unlike the closely related NIP5;1 boron transporter. This protein also allows the transport of glycerol, urea, and formimide but not larger uncharged solutes such as arabitol and sucrose when it is expressed heterologously. |
| AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
| AT1G80940 | Snf1 kinase interactor-like protein;(source:Araport11) |
| AT1G80950 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 16:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
| AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G80970 | XH domain-containing protein;(source:Araport11) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT2G01140 | Aldolase superfamily protein;(source:Araport11) |
| AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
| AT2G01190 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT2G01200 | Belongs to auxin inducible gene family. |
| AT2G01220 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT2G01240 | reticulon-like protein B15;(source:Araport11) |
| AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G01290 | Cytosolic ribose-5-phosphate isomerase. Knockout mutation causes chloroplast dysfunction, late flowering and premature cell death. |
| AT2G01300 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT2G01350 | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01360 | pentatricopeptide (PPR) repeat protein;(source:Araport11) |
| AT2G01440 | Encodes an ortholog of the bacterial RecG translocase, an organellar protein with multiple roles in mtDNA maintenance. The protein is targeted to mitochondria and plastids and is required for recombination-dependent repair and for suppression of ectopic recombination in mitochondria, most likely because of its role in recovery of stalled replication forks. |
| AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
| AT2G01460 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G01500 | PFS2 encodes a homeodomain gene that is a member of the WUS clade of transcription factors. It delays differentiation and maturation of primordia and regulates ovule patterning. The pfs2 mutant exhibits developmental defects in the maternal integuments and gametophyte, specifically, the boundary between the chalaza and the nucellus shifted towards the distal end of pfs2 ovule primordia. In addition, leaves displayed curling and petals were wavy and crenulated. Overexpression of PFS2 affects floral organ and leaf development. Single- and double-mutant analyses reveal that PFS2 activity represses AGAMOUS expression in young floral primordia. Also involved in regulation of response to low temperature. |
| AT2G01520 | Encodes a cis-cinnamic acid responsive gene that is a member of the major latex protein-like gene family and plays a role in promoting vegetative growth and delaying flowering. The mRNA is cell-to-cell mobile. |
| AT2G01550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-48 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT2G01560 | Plant protein 1589 of unknown function;(source:Araport11) |
| AT2G01580 | transmembrane protein;(source:Araport11) |
| AT2G01610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G01630 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G01660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT2G01667 | hypothetical protein;(source:Araport11) |
| AT2G01720 | Ribophorin I;(source:Araport11) |
| AT2G01780 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT2G01790 | TRAF-like family protein;(source:Araport11) |
| AT2G01800 | COP1-interacting protein-like protein;(source:Araport11) |
| AT2G01810 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
| AT2G01840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-34 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G01870 | transmembrane protein;(source:Araport11) |
| AT2G01880 | PEP complex component. |
| AT2G01900 | Encodes an inositol polyphosphate phosphatidylinositol 5-phosphatase that is expressed in roots and is involved in mediating salt tolerance through endocytosis. |
| AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
| AT2G01960 | Member of TETRASPANIN family |
| AT2G02000 | glutamate decarboxylase 3;(source:Araport11) |
| AT2G02010 | glutamate decarboxylase 4;(source:Araport11) |
| AT2G02020 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G02030 | F-box family protein;(source:Araport11) |
| AT2G02050 | NADH-ubiquinone oxidoreductase B18 subunit;(source:Araport11) |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02130 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. The mRNA is cell-to-cell mobile. |
| AT2G02147 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
| AT2G02230 | phloem protein 2-B1;(source:Araport11) |
| AT2G02240 | F-box family protein;(source:Araport11) |
| AT2G02250 | phloem protein 2-B2;(source:Araport11) |
| AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
| AT2G02290 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G02300 | phloem protein 2-B5;(source:Araport11) |
| AT2G02380 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G02430 | pseudogene of Arginyl-tRNA synthetase;(source:Araport11) |
| AT2G02440 | transmembrane protein;(source:Araport11) |
| AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
| AT2G02480 | STICHEL mutant shows trichomes with fewer than normal branches. |
| AT2G02540 | Zinc finger homeobox protein. Expressed in vascular tissue. In a yeast one hybrid system was not able to transactivate a reporter gene. |
| AT2G02580 | member of CYP71B |
| AT2G02630 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G02680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G02700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G02720 | Pectate lyase family protein;(source:Araport11) |
| AT2G02730 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
| AT2G02780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G02795 | transmembrane protein;(source:Araport11) |
| AT2G02800 | Encodes protein kinase APK2b. |
| AT2G02870 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G02900 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT2G02950 | Encodes a basic soluble protein which can independently bind to either PHYA or PHYB, regardless of whether the phytochromes are in the Pr or Pfr state. PKS1 can be phosphorylated by oat phyA in vitro in a light regulated manner. It is postulated to be a negative regulator of phyB signalling. |
| AT2G02980 | Encodes a chloroplast RNA editing factor. |
| AT2G03000 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G03010 | hypothetical protein (DUF577);(source:Araport11) |
| AT2G03050 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT2G03060 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL30 is expressed in pollen.It forms heterodimers with other MICK family members. |
| AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G03130 | Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11) |
| AT2G03150 | Encodes a nuclear-localized calcium-binding protein RSA1 (SHORT ROOT IN SALT MEDIUM 1), which is required for salt tolerance. |
| AT2G03160 | SKP1-like 19;(source:Araport11) |
| AT2G03190 | one of SKP1 homologs. Gene is expressed specifically in the silique. |
| AT2G03200 | Atypical aspartic protease which modulates lateral root development. |
| AT2G03230 | GCK domain-containing protein;(source:Araport11) |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
| AT2G03460 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G03520 | Encodes AtUPS4, a member of the Arabidopsis ureide permease family. |
| AT2G03540 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT2G03550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G03560 | F-box only protein (DUF295);(source:Araport11) |
| AT2G03565 | hypothetical protein;(source:Araport11) |
| AT2G03580 | F-box family protein-like protein;(source:Araport11) |
| AT2G03590 | Encodes a member of a class of allantoin transporters. |
| AT2G03610 | F-box family protein;(source:Araport11) |
| AT2G03720 | Involved in root hair development |
| AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
| AT2G03750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
| AT2G03790 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT2G03800 | encodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype. |
| AT2G03840 | TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development. |
| AT2G03860 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.0e-62 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G03920 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G03935 | pseudogene similar to putative carboxyl-terminal proteinase |
| AT2G03958 | Encodes a defensin-like (DEFL) family protein. |
| AT2G03970 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 33%25 identity and 1.2e-17 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
| AT2G03972 | pseudogene of heat shock protein |
| AT2G04010 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.3e-76 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G04030 | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response and crucial for protein import into the chloroplast stroma. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G04032 | zinc transporter 7 precursor;(source:Araport11) |
| AT2G04036 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.6e-169 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT2G04039 | NdhV is loosely associated with the NDH complex and is required for stabilizing NDH subcomplexes A and E. |
| AT2G04040 | AtDTX1 (At2g04040) has been identified as a detoxifying efflux carrier for plant-derived antibiotics and other toxic compounds, including Cd2+. Expression in rosette leaves is activated by high concentration of boron.Mistakenly referred to as At2g04070 in PMID:11739388. |
| AT2G04045 | Encodes a defensin-like (DEFL) family protein. |
| AT2G04047 | Encodes a defensin-like (DEFL) family protein. |
| AT2G04050 | MATE efflux family protein;(source:Araport11) |
| AT2G04063 | glycine-rich protein;(source:Araport11) |
| AT2G04066 | MATE efflux family protein;(source:Araport11) |
| AT2G04070 | Expression in rosette leaves is activated by high concentration of boron. |
| AT2G04080 | MATE efflux family protein;(source:Araport11) |
| AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
| AT2G04190 | TRAF-like family protein;(source:Araport11) |
| AT2G04220 | DUF868 family protein (DUF868);(source:Araport11) |
| AT2G04230 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT2G04250 | pseudogene of ribonuclease H;(source:Araport11) |
| AT2G04260 | pseudogene of P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT2G04270 | Similar to E.coli endoribonuclease E. Functions as a ribonuclease, is located in the chloroplast, and is involved in chloroplast development. Loss of function mutants are white and arrest at the cotyledon stage. The phenotype is rescued by providing sucrose. |
| AT2G04290 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.1e-36 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G04300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G04430 | nudix hydrolase homolog 5;(source:Araport11) |
| AT2G04480 | hypothetical protein;(source:Araport11) |
| AT2G04495 | transmembrane protein;(source:Araport11) |
| AT2G04500 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
| AT2G04560 | transferases, transferring glycosyl groups;(source:Araport11) |
| AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT2G04600 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G13865.1);(source:TAIR10) |
| AT2G04680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G04690 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT2G04790 | PTB domain engulfment adapter;(source:Araport11) |
| AT2G04800 | hypothetical protein;(source:Araport11) |
| AT2G04810 | F-box only protein (DUF295);(source:Araport11) |
| AT2G04820 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.8e-214 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G04840 | F-box only protein (DUF295);(source:Araport11) |
| AT2G04890 | Encodes a scarecrow-like protein (SCL21). Member of GRAS gene family. |
| AT2G05060 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G05090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G37080.1);(source:TAIR10) |
| AT2G05110 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-51 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G05115 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G05120 | Nucleoporin, Nup133/Nup155-like protein;(source:Araport11) |
| AT2G05160 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
| AT2G05180 | member of CYP705A |
| AT2G05185 | hypothetical protein;(source:Araport11) |
| AT2G05280 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-30 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G05330 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G05360 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G05390 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-200 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G05420 | TRAF-like family protein;(source:Araport11) |
| AT2G05430 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT2G05440 | GLYCINE RICH PROTEIN 9;(source:Araport11) |
| AT2G05441 | Annotated as unknown pseudogene.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G05490 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.4e-88 P-value blast match to Q9SL18 /349-510 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G05550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.6e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G05580 | Glycine-rich protein family;(source:Araport11) |
| AT2G05590 | TLDc domain protein that confers increased tolerance to oxidative stress. |
| AT2G05600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G05710 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. ACO3 is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile. |
| AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT2G05765 | snoRNA;(source:Araport11) |
| AT2G05790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G05800 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.1e-19 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G05801 | Pseudogene of AT5G30520; unknown protein |
| AT2G05845 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-45 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G05910 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT2G05920 | Subtilase family protein;(source:Araport11) |
| AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
| AT2G06020 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G06045 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-12 P-value blast match to GB:AAC02672 polyprotein (Ty1_Copia-element) (Arabidopsis arenosa);(source:TAIR10) |
| AT2G06060 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G06140 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32605.1);(source:TAIR10) |
| AT2G06210 | Encodes a yeast CTR9 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast CTR9 is a component of a five-member PAF1 complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
| AT2G06255 | DUF1313 domain containing protein. |
| AT2G06410 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.0e-85 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G06480 | transposable_element_gene;(source:Araport11) |
| AT2G06500 | hAT family dimerization domain-containing protein;(source:Araport11) |
| AT2G06560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.8e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G06770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-15 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G06840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-184 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G06860 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT2G06875 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-46 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G06890 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.3e-184 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G06908 | hypothetical protein;(source:Araport11) |
| AT2G06910 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 4.3e-100 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT2G06950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-243 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G06980 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G07000 | hypothetical protein;(source:Araport11) |
| AT2G07020 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G07040 | Pollen receptor kinase. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth. |
| AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
| AT2G07150 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0707D10.17, blastp match of 27%25 identity and 3.3e-12 P-value to GP|13603432|dbj|BAB40159.1||AP002910 P0707D10.17 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT2G07180 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G07200 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G07213 | Natural antisense transcript overlaps with AT2G07215;(source:Araport11) |
| AT2G07340 | PREFOLDIN 1;(source:Araport11) |
| AT2G07360 | TPLATE-associated SH3 domain containing protein. |
| AT2G07420 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-170 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G07540 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-90 P-value blast match to gb|AAL06421.1|AF378079_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT2G07550 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-313 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
| AT2G07620 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, very low similarity to SP|Q9UUA2 DNA repair and recombination protein pif1, mitochondrial precursor {Schizosaccharomyces pombe};(source:TAIR10) |
| AT2G07640 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G07680 | Encodes ABCC13/MRP11, a member of the multidrug resistance associated protein MRP/ABCC subfamily. Its expression is induced by gibberellic acid and downregulated by naphthalene acetic acid, abscisic acid, and zeatin. |
| AT2G07687 | Cytochrome c oxidase, subunit III;(source:Araport11) |
| AT2G07690 | Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin. |
| AT2G07700 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.7e-21 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT2G09800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-162 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT2G09994 | pseudogene of U-box domain-containing protein / armadillo/beta-catenin repeat family protein |
| AT2G10120 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-18 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G10220 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.3e-151 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G10230 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10) |
| AT2G10260 | Ulp1 protease family protein;(source:Araport11) |
| AT2G10265 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 0.00012 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT2G10300 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G10310 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-31 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G10430 | pseudogene of hypothetical protein;(source:Araport11) |
| AT2G10440 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT2G10602 | hypothetical protein;(source:Araport11) |
| AT2G10610 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-162 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G10617 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-32 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G10660 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.3e-277 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G10710 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to MURA transposase of maize Mutator transposon;(source:TAIR10) |
| AT2G10790 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G10800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.9e-92 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT2G10802 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-28 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G10860 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-156 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G10930 | transmembrane protein;(source:Araport11) |
| AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G11235 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-94 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G11240 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-38 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G11405 | transmembrane protein;(source:Araport11) |
| AT2G11410 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.9e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G11620 | hypothetical protein;(source:Araport11) |
| AT2G11630 | pseudogene of hAT transposon superfamily protein;(source:Araport11) |
| AT2G11778 | transmembrane protein;(source:Araport11) |
| AT2G11810 | MGD3 is the major enzyme for galactolipid metabolism during phosphate starvation. Does not contribute to galactolipid synthesis under P1-sufficient conditions. |
| AT2G11820 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.3e-40 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G11880 | None;(source:Araport11) |
| AT2G11950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-158 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G12160 | pseudogene of Transcriptional factor B3 family protein;(source:Araport11) |
| AT2G12320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32169.1);(source:TAIR10) |
| AT2G12461 | hypothetical protein;(source:Araport11) |
| AT2G12475 | Encodes a defensin-like (DEFL) family protein. |
| AT2G12480 | serine carboxypeptidase-like 43;(source:Araport11) |
| AT2G12770 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-24 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT2G12890 | pseudogene of Class-II DAHP synthetase family protein;(source:Araport11) |
| AT2G13110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-102 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G13115 | pseudogene of bZIP family transcription factor |
| AT2G13116 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G13120 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.1e-109 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT2G13160 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.1e-126 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G13230 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.2e-157 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT2G13274 | Pseudogene of AT2G13150; transcription factor |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT2G13370 | Chromatin-remodeling factor; has large number of MAPK docking sites (D-sites). |
| AT2G13610 | ABC-2 type transporter family protein;(source:Araport11) |
| AT2G13620 | member of Putative Na+/H+ antiporter family |
| AT2G13630 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G13680 | Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen. |
| AT2G13706 | Pseudogene of AT4G15975; zinc finger (C3HC4-type RING finger) family protein |
| AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
| AT2G13920 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G14060 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus) |
| AT2G14070 | wound-responsive protein-like protein;(source:Araport11) |
| AT2G14090 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G14095 | hypothetical protein;(source:Araport11) |
| AT2G14170 | Arabidopsis thaliana methylmalonate-semialdehyde dehydrogenase |
| AT2G14200 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-133 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G14220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-167 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G14247 | Expressed protein;(source:Araport11) |
| AT2G14288 | F-box/kelch-repeat SKIP6-like protein;(source:Araport11) |
| AT2G14370 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.2e-116 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G14440 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G14500 | F-box family protein;(source:Araport11) |
| AT2G14510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G14520 | CBS domain protein (DUF21);(source:Araport11) |
| AT2G14530 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G14540 | serpin 2;(source:Araport11) |
| AT2G14550 | pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G14560 | Encodes LURP1, a member of the LURP cluster (late upregulated in response to Hyaloperonospora parasitica) which exhibits a pronounced upregulation after recognition of the pathogenic oomycte H. parasitica. LURP1 is required for full basal defense to H. parasitica and resistance to this pathogen mediated by the R-proteins RPP4 and RPP5. The mRNA is cell-to-cell mobile. |
| AT2G14580 | pathogenesis related protein, encodes a basic PR1-like protein. Expresses in flowers, roots, and not in leaves and responses to ethylene and methyl jasmonate. Salicylic acid represses gene expression. |
| AT2G14640 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.5e-119 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT2G14661 | Pseudogene of AT2G04040; ATDTX1; antiporter/ multidrug efflux pump/ multidrug transporter/ transporter |
| AT2G14670 | sucrose-proton symporter 8;(source:Araport11) |
| AT2G14690 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT2G14692 | hypothetical protein;(source:Araport11) |
| AT2G14710 | F-box family protein;(source:Araport11) |
| AT2G14750 | Encodes adenosine-5'-phosphosulfate kinase. Provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. Essential for pollen viability. The mRNA is cell-to-cell mobile. |
| AT2G14800 | hypothetical protein;(source:Araport11) |
| AT2G14830 | Ist1p;(source:Araport11) |
| AT2G14835 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G14840 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
| AT2G14878 | other_RNA;(source:Araport11) |
| AT2G14920 | Encodes a brassinosteroid sulfotransferase that may be involved in brassinosteroid inactivation. In vitro experiements show that this enzyme can act on a broad group of naturally occurring brassinosteroids, including the 24-epimers and (22R,23R)-28 homobrassinosteroids, that have an array of different side chains, though it shows a preference for (22R,23R)-28 homobrassinosteroids. ST4A is expressed in the roots and transcript levels fall in response to cytokinin treatment. |
| AT2G14980 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-247 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT2G15090 | Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
| AT2G15120 | pseudogene of Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT2G15128 | other_RNA;(source:Araport11) |
| AT2G15130 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT2G15140 | transposable_element_gene;(source:Araport11);pseudogene, Ulp1 protease family, contains Pfam profile PF02902: Ulp1 protease family, C-terminal catalytic domain;(source:TAIR10) |
| AT2G15220 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT2G15230 | Lipase active on medium and short chain triacylglycerols, but not on phospho- or galactolipids. Active between pH4 and 7 with an optimum at pH6. Knock-out mutant has not obvious phenotype. Predicted to be extracellular. |
| AT2G15300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G15310 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor (GI:861205) (Chlamydomonas reinhardtii), other ARFs and ARF-like proteins. |
| AT2G15325 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT2G15345 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G15350 | member of Glycosyltransferase Family- 37 |
| AT2G15370 | Predicted fucosyltransferase, based on similarity to FUT1, but not functionally redundant with FUT1. |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT2G15480 | UDP-glucosyl transferase 73B5;(source:Araport11) |
| AT2G15490 | UDP-glycosyltransferase 73B4;(source:Araport11) |
| AT2G15500 | RNA-binding protein;(source:Araport11) |
| AT2G15630 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G15640 | F-box family protein;(source:Araport11) |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT2G15670 | transmembrane protein;(source:Araport11) |
| AT2G15680 | Encodes a calmodulin-like protein. |
| AT2G15695 | peptide methionine sulfoxide reductase (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
| AT2G15740 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
| AT2G15760 | calmodulin-binding protein (DUF1645);(source:Araport11) |
| AT2G15765 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G15815 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G26350.1);(source:TAIR10) |
| AT2G15830 | hypothetical protein;(source:Araport11) |
| AT2G15840 | pseudogene of hypothetical protein;(source:Araport11) |
| AT2G15910 | CSL zinc finger domain-containing protein;(source:Araport11) |
| AT2G16010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07630.1);(source:TAIR10) |
| AT2G16050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G16060 | Encodes a class 1 nonsymbiotic hemoglobin induced by low oxygen levels with very high oxygen affinity. It is not likely to be a hemoglobin transporter because of its extremely high affinity for oxygen. Overexpression impairs cold stress-induced nitric oxide (NO) production. |
| AT2G16080 | pseudogene of Polynucleotidyl transferase;(source:Araport11) |
| AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
| AT2G16130 | polyol/monosaccharide transporter 2;(source:Araport11) |
| AT2G16145 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:GGTTCGTACGTACACTGTTCA |
| AT2G16190 | hypothetical protein;(source:Araport11) |
| AT2G16210 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT2G16220 | Stress induced gene. Mutants show increased sensitivity to arsenate. |
| AT2G16230 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G16245 | Natural antisense transcript overlaps with AT2G16250;(source:Araport11) |
| AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
| AT2G16300 | F-box family protein;(source:Araport11) |
| AT2G16310 | pseudogene of endoplasmatic reticulum retrieval protein 1B;(source:Araport11) |
| AT2G16360 | 40S ribosomal protein S25;(source:Araport11) |
| AT2G16367 | Encodes a defensin-like (DEFL) family protein. |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G16385 | CAF1 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF2 it is required for formation of the casparian band. |
| AT2G16420 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-39 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G16430 | Encodes an acid phosphatase involved plant acclimation to Pi deprivation. |
| AT2G16450 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G16460 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
| AT2G16500 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
| AT2G16510 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
| AT2G16570 | Amidophosphoribosyltransferase (ATase: EC 2.4.2.14) is a key enzyme in the pathway of purine nucleotide biosynthesis |
| AT2G16595 | Translocon-associated protein (TRAP), alpha subunit;(source:Araport11) |
| AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G16690 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G41570.1);(source:TAIR10) |
| AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
| AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
| AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
| AT2G16740 | ubiquitin-conjugating enzyme 29;(source:Araport11) |
| AT2G16750 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G16810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G16840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-06 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
| AT2G16850 | plasma membrane intrinsic protein 2;(source:Araport11) |
| AT2G16860 | GCIP-interacting family protein;(source:Araport11) |
| AT2G16870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G16895 | pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G16910 | Encodes a basic helix-loop helix transcription factor involved in tapetal cell development, that directly regulates MGT5 expression in tapetum cells. Loss of function mutations are male sterile. AMS binds to a region termed the E box of target gene promoters. |
| AT2G16950 | TRN1 is an importin beta protein that functions as a nuclear import receptor for AtGRP7 and in interacts with AGO1 to affect miRNA loading. |
| AT2G16960 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G16990 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
| AT2G17010 | MSL8 encodes a protein with similarity to mechano-sensitive channel proteins. MSL8 is expressed specifically in pollen and germinating pollen tubes.It regulates pollen germination and is needed to maintain cellular integrity during pollen hydration and germination. |
| AT2G17036 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G17040 | Member of the NAC transcription factor family and more specifically, the ONAC022 subfamily. Involved in leaf and inflorescence stem morphogenesis. The mRNA is cell-to-cell mobile. |
| AT2G17043 | hypothetical protein;(source:Araport11) |
| AT2G17050 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT2G17060 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G17090 | Encodes a N-myrystolylated plasma membrane associated member of the RLCK II family of IRAK/Pelle-like kinases that regulates the MAPK pathway that promotes the elongation of the Arabidopsis zygote and the development of its basal daughter cell into the extra-embryonic suspensor. SSP transcripts are produced in mature pollen but are not translated until delivery to the zygote and the endosperm after fertilization, exerting a paternal effect on embryonic development. The primary role of its kinase domain may lie in protein binding rather than in catalysis as key residues of the active site are absent. |
| AT2G17150 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT2G17160 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT2G17170 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G17180 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT2G17210 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
| AT2G17230 | EXORDIUM like 5;(source:Araport11) |
| AT2G17300 | hypothetical protein;(source:Araport11) |
| AT2G17305 | F-box/LRR protein;(source:Araport11) |
| AT2G17310 | Encodes an F-Box protein that regulates a novel induced defense response independent of both salicylic acid and systemic acquired resistance |
| AT2G17420 | NADPH-dependent thioredoxin reductase, major cytosolic isoform The mRNA is cell-to-cell mobile. |
| AT2G17440 | Encodes PIRL5, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
| AT2G17460 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.5e-22 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G17470 | Encodes ALMT6, a member of the aluminum-activated malate transporter family. |
| AT2G17477 | Pseudogene of AT3G22350; F-box family protein |
| AT2G17580 | Encodes a bacterial-type poly(A) polymerase, AGS1. |
| AT2G17590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G17630 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT2G17670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G17680 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT2G17710 | Big1;(source:Araport11) |
| AT2G17720 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
| AT2G17740 | VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development. |
| AT2G17750 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
| AT2G17770 | Encodes a paralog of bZIP transcription factor FD. This protein interacts with FD and FT. |
| AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
| AT2G17820 | Encodes a member of the histidine kinase family. |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT2G17850 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G17860 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G17880 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G17890 | Encodes a member of Calcium Dependent Protein Kinase. Protein is N-myristoylated. Localizes to the plasma membrane. Localizes to the chloroplast when the myristoylation motif is mutated. |
| AT2G17920 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT2G17930 | Component of the SPT module of the SAGA complex. |
| AT2G17940 | WEB family protein (DUF827);(source:Araport11) |
| AT2G17960 | hypothetical protein;(source:Araport11) |
| AT2G17970 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G18030 | Peptide methionine sulfoxide reductase family protein;(source:Araport11) |
| AT2G18050 | encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA. The mRNA is cell-to-cell mobile. |
| AT2G18060 | Encodes a NAC-domain transcription factor that is expressed in developing vessels and protoxylem. Along with other members of this family, VND1 appears to regulate the development of genes required for secondary cell wall biosynthesis. |
| AT2G18070 | hypothetical protein;(source:Araport11) |
| AT2G18115 | pseudogene of glycine-rich protein;(source:Araport11) |
| AT2G18140 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G18150 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G18170 | MAP kinase 7;(source:Araport11) |
| AT2G18180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G18190 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18245 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G18260 | member of SYP11 Gene Family |
| AT2G18270 | hypothetical protein;(source:Araport11) |
| AT2G18300 | DNA-binding bHLH protein involved in positive regulation of cell elongation and proliferation and, negative control of plant immunity.One component of PRE-IBH1-HBI1 tripartite module. |
| AT2G18328 | RAD-like 4;(source:Araport11) |
| AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G18340 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT2G18380 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G18460 | like COV 3;(source:Araport11) |
| AT2G18465 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G18470 | Proline-rich extensin-like receptor kinase 4. Functions at an early stage of ABA signalling inhibiting primary root cell elongation by perturbing Ca2+ homeostasis. |
| AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G18490 | GAZ is a nuclear localized transcriptional activator that is regulated (decreased) by GA and ABA levels. GAZ is expressed in the root stele and may function non-cell autonomously to effect hormone mediated control of ground tissue maturation. |
| AT2G18500 | ovate family protein 7;(source:Araport11) |
| AT2G18510 | Essential gene (embryo lethal) that is similar to component of splicosome. Regulates embryonic pattern formation through Pol II-Mediated transcription of WOX2 an PIN7 (DOI:10.1016/j.isci.2019.09.004). JANUS positively regulates PLT1 expression in the root meristem by recruiting RNA polymerase II (Pol II) to PLT1 and by interacting with PLT1. Nuclear accumulation of JANUS in root meristem depends on IMB4. (DOI:10.1105/tpc.20.00108 ) |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G18550 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT2G18560 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G18570 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT2G18660 | Encodes PNP-A (Plant Natriuretic Peptide A). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. PNP-A contains a signal peptide domain and is secreted into the extracellular space. Co-expression analyses using microarray data suggest that PNP-A may function as a component of plant defence response and SAR in particular, and could be classified as a newly identified PR protein. It is stress responsive and can enhance its own expression. |
| AT2G18670 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G18680 | transmembrane protein;(source:Araport11) |
| AT2G18690 | transmembrane protein;(source:Araport11) |
| AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT2G18721 | hypothetical protein;(source:Araport11) |
| AT2G18750 | Calmodulin-binding protein;(source:Araport11) |
| AT2G18760 | chromatin remodeling 8;(source:Araport11) |
| AT2G18770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G18790 | Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule. The mRNA is cell-to-cell mobile. |
| AT2G18810 | B3 domain protein (DUF313);(source:Araport11) |
| AT2G18820 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT2G18876 | Encodes a microtubule-associated protein. |
| AT2G18880 | vernalization5/VIN3-like protein;(source:Araport11) |
| AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
| AT2G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G18917 | Natural antisense transcript overlaps with AT2G18920 and AT2G18915;(source:Araport11) |
| AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile. |
| AT2G18990 | thioredoxin-like/ATP-binding protein;(source:Araport11) |
| AT2G19040 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT2G19060 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
| AT2G19080 | metaxin-like protein;(source:Araport11) |
| AT2G19090 | DUF630 family protein (DUF630 and DUF632);(source:Araport11) |
| AT2G19100 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-33 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT2G19130 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT2G19140 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G19180 | hypothetical protein;(source:Araport11) |
| AT2G19190 | Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6. |
| AT2G19200 | pseudogene of hypothetical protein (DUF626);(source:Araport11) |
| AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT2G19230 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT2G19270 | mitotic checkpoint protein PRCC-carboxy-term protein;(source:Araport11) |
| AT2G19310 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT2G19390 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
| AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G19420 | hypothetical protein;(source:Araport11) |
| AT2G19440 | Homolog of ZET, an atypical β-1,3 glucanase. Differentially expressed in Ler (very low) vs Col (very high) backgrounds. |
| AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT2G19530 | transmembrane protein;(source:Araport11) |
| AT2G19550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G19580 | Member of TETRASPANIN family |
| AT2G19610 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G19630 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G19640 | ASH1-related protein 2;(source:Araport11) |
| AT2G19650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G19680 | Mitochondrial ATP synthase subunit G protein;(source:Araport11) |
| AT2G19700 | hypothetical protein;(source:Araport11) |
| AT2G19755 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-08 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT2G19825 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G19830 | SNF7 family protein;(source:Araport11) |
| AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
| AT2G19870 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
| AT2G19890 | hypothetical protein;(source:Araport11) |
| AT2G19893 | Encodes a defensin-like (DEFL) family protein. |
| AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G19920 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G19960 | hAT family dimerization domain-containing protein;(source:Araport11) |
| AT2G20000 | Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap. |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G20080 | hypothetical protein;(source:Araport11) |
| AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
| AT2G20160 | E3 ubiquitin ligase SCF complex subunit SKP1/ASK1 family protein;(source:Araport11) |
| AT2G20180 | Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression. |
| AT2G20208 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G20230 | Tetraspanin family protein;(source:Araport11) |
| AT2G20270 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G20280 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G20298 | pseudogene of exonuclease family protein |
| AT2G20300 | Encodes ABNORMAL LEAF SHAPE 2 (ALE2), a receptor-like protein kinase (RLK) with a cluster of basic amino acid residues followed by a cysteine-containing sequence in the putative extracellular domain. Function together with ACR4 (Arabidopsis homolog of the Crinkly4) and ALE1 in positively regulating protoderm-specific gene expression and for the formation of leafy organs. ale2 mutants have various epidermal defects, including disorganization of epidermis-related tissues, defects in the leaf cuticle and the fusion of organs. |
| AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT2G20360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G20380 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G20420 | ATP citrate lyase (ACL) family protein;(source:Araport11) |
| AT2G20470 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT2G20510 | One of two loci encoding the TIM44 subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is the part of the complex that hydrolyzes ATP to provide energy for protein translocation to the inner membrane. |
| AT2G20520 | fasciclin-like arabinogalactan-protein 6 (Fla6). Possibly involved in embryogenesis and seed development. |
| AT2G20530 | prohibitin 6;(source:Araport11) |
| AT2G20585 | nuclear fusion defective 6;(source:Araport11) |
| AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. Induced in epidermal cells attacked by powdery mildew. The RTY enzyme is expected to function as a dimer (or a higher order multimeric complex), as all RTY-related enzymes with a defined crystal structure are known to form dimers or tetramers. |
| AT2G20616 | QWRF motif protein (DUF566);(source:Araport11) |
| AT2G20625 | hypothetical protein (DUF626);(source:Araport11) |
| AT2G20635 | protein kinase and Mad3-BUB1-I domain-containing protein;(source:Araport11) |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT2G20680 | Encodes a mannanase belonging to clade 1 of the GH5 7 phylogenetic tree that exhibits high substrate affinity and catalytic efficiency on mannan substrates with main chains containing both glucose and mannose units such as konjac glucomannan and spruce galactoglucomannan. It is likely a glycoprotein. |
| AT2G20720 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G20724 | Annotated as pseudogene of unknown protein.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT2G20760 | Clathrin light chain protein;(source:Araport11) |
| AT2G20770 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT2G20790 | clathrin adaptor complexes medium subunit family protein;(source:Araport11) |
| AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
| AT2G20815 | QWRF motif protein (DUF566);(source:Araport11) |
| AT2G20825 | Developmental regulator, ULTRAPETALA;(source:Araport11) |
| AT2G20970 | lipid-binding protein;(source:Araport11) |
| AT2G20980 | Similar to MCM10, which in other organism was shown to be involved in the initiation of DNA replication. |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G21080 | Ras guanine nucleotide exchange factor K;(source:Araport11) |
| AT2G21100 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G21140 | Proline-rich protein expressed in expanding leaves, stems, flowers, and siliques. |
| AT2G21172 | Pseudogene of AT5G16486 |
| AT2G21180 | transmembrane protein;(source:Araport11) |
| AT2G21195 | hypothetical protein;(source:Araport11) |
| AT2G21210 | Putative auxin-regulated protein whose expression is downregulated in response to chitin oligomers. |
| AT2G21220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G21290 | 30S ribosomal protein S31;(source:Araport11) |
| AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT2G21330 | fructose-bisphosphate aldolase 1;(source:Araport11) |
| AT2G21340 | Encodes a homolog of the multidrug and toxin extrusion transporter ENHANCED DISEASE SUSCEPTIBILITY5 that is constitutively expressed in green tissues independent of pathogen infection and is expressed in the chloroplast envelope. Unlike EDS5, it does not contribute to pathogen-induced SA accumulation. |
| AT2G21350 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT2G21410 | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation. |
| AT2G21420 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, key regulator of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
| AT2G21430 | Papain family cysteine protease;(source:Araport11) |
| AT2G21450 | chromatin remodeling 34;(source:Araport11) |
| AT2G21480 | BUSP2 plays a smaller role than BUSP1 in pollen tube growth. bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule but single busp2 mutants are fertile. BUSP2 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth. |
| AT2G21490 | dehydrin LEA;(source:Araport11) |
| AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G21540 | SEC14-like 3;(source:Araport11) |
| AT2G21550 | One of three DRTS genes, this is the most divergent one.THY3/DRTS3 is preferentially expressed in the shoot apex, stipules and root caps. |
| AT2G21560 | nucleolar-like protein;(source:Araport11) |
| AT2G21610 | pectinesterase 11;(source:Araport11) |
| AT2G21630 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT2G21640 | Encodes a protein of unknown function that is a marker for oxidative stress response.Expression in rosette leaves is activated by high concentration of boron. |
| AT2G21650 | RSM1 is a member of a small sub-family of single MYB transcription factors. Analysis of overexpressin lines indicate its involvement during early morphogenesis. |
| AT2G21680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G21690 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G21720 | ArgH (DUF639);(source:Araport11) |
| AT2G21740 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT2G21780 | hypothetical protein;(source:Araport11) |
| AT2G21820 | seed maturation protein;(source:Araport11) |
| AT2G21830 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G21840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G21850 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G21860 | violaxanthin de-epoxidase-like protein;(source:Araport11) |
| AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
| AT2G21910 | member of CYP96A |
| AT2G21950 | Encodes an SKP1 interacting partner (SKIP6). |
| AT2G21980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT2G22050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G22060 | galactose oxidase/kelch repeat protein;(source:Araport11) |
| AT2G22170 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT2G22241 | hypothetical protein;(source:Araport11) |
| AT2G22360 | Essential for chloroplast iron?sulfur cluster biogenesis. |
| AT2G22370 | Encodes a subunit of the mediator complex that affects flowering time and floral organ formation through FLOWERING LOCUS C (FLC) and AGAMOUS (AG). Together with MED20, another subunit of the head domain of MEDIATOR, MED18 is proposed to control the balance of salicylic acid and jasmonate associated defense pathways. |
| AT2G22410 | SLOW GROWTH 1;(source:Araport11) |
| AT2G22426 | hypothetical protein;(source:Araport11) |
| AT2G22460 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT2G22530 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT2G22560 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT2G22610 | Malectin domain kinesin. Possible role in cell division, with a possible secondary function in the nuclei. |
| AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT2G22650 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT2G22807 | Encodes a defensin-like (DEFL) family protein. |
| AT2G22810 | key regulatory enzyme in the biosynthesis of the plant hormone ethylene. ACS4 is specifically induced by indoleacetic acid (IAA). |
| AT2G22820 | hypothetical protein;(source:Araport11) |
| AT2G22830 | squalene epoxidase 2;(source:Araport11) |
| AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT2G22955 | Natural antisense transcript overlaps with AT2G22960;(source:Araport11) |
| AT2G22980 | serine carboxypeptidase-like 13;(source:Araport11) |
| AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G23000 | serine carboxypeptidase-like 10;(source:Araport11) |
| AT2G23010 | serine carboxypeptidase-like 9;(source:Araport11) |
| AT2G23030 | encodes a member of SNF1-related protein kinases (SnRK2) |
| AT2G23050 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT2G23060 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G23093 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G23110 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
| AT2G23140 | PUB4 encodes a functional ubiquitin-protein ligase. The gene is expressed in most plant tissues and the protein localizes to the nucleus. PUB4 has been recovered as a second site suppressor from several different genetic screens and from these, it has been inferred to have roles in regulating root development, pollen tapetum development and ROS induced chloroplast degredation. |
| AT2G23142 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G23150 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp4, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. |
| AT2G23170 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. |
| AT2G23180 | member of CYP96A |
| AT2G23200 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G23220 | member of CYP81D |
| AT2G23250 | UDP-glucosyl transferase 84B2;(source:Araport11) |
| AT2G23270 | Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. Finetuning role in modulation of immunity through the regulation of SA and JA biosynthesis and signalling pathways. |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT2G23300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G23310 | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. |
| AT2G23321 | hypothetical protein;(source:Araport11) |
| AT2G23330 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT2G23350 | polyadenylate-binding protein, putative / PABP, putative.Member of the Class II family of PABP proteins. Highly and ubiquitously expressed. The mRNA is cell-to-cell mobile. |
| AT2G23380 | Similar to the product of the Polycomb-group gene Enhancer of zeste. Catalytic component of the PRC2 complex.Required for stable repression of AG and AP3. Putative role in cell fate determination. Involved in the control of leaf morphogenesis. mutants exhibit curled, involute leaves. AGAMOUS and APETALA3 are ectopically expressed in the mutant. |
| AT2G23390 | acyl-CoA;(source:Araport11) |
| AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT2G23410 | Encodes cis-prenyltransferase involved in dolichol biosynthesis. |
| AT2G23420 | nicotinate phosphoribosyltransferase 2;(source:Araport11) |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G23470 | DUF647 domain containing protein. Mutants are male sterile with defects in endothecium, tapetum and stamen maturation. |
| AT2G23500 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.4e-80 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G23510 | BAHD acyltransferase which transfers acyl-groups from different acyl-donors specifically to amines. Catalyzes the multisite acylation of spermidine. Uses caffeoyl/feruoyl/sinapoyl-CoA with the N1 and N10 positions of spermidine. |
| AT2G23630 | SKU5 similar 16;(source:Araport11) |
| AT2G23640 | Encodes RTNLB13, a reticulon protein integral to the endoplasmic reticulum (ER) membrane that have the ability to shape the ER into tubules. |
| AT2G23660 | LOB domain-containing protein 10;(source:Araport11) |
| AT2G23673 | Pseudogene of AT2G23680; stress-responsive protein, putative |
| AT2G23680 | Cold acclimation protein WCOR413 family;(source:Araport11) |
| AT2G23690 | PADRE protein. |
| AT2G23700 | Itga6 (Protein of unknown function, DUF547);(source:Araport11) |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G23800 | encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT2G23808 | pseudogene of transcriptional factor B3 family protein |
| AT2G23810 | Member of TETRASPANIN family |
| AT2G23830 | PapD-like superfamily protein;(source:Araport11) |
| AT2G23834 | hypothetical protein;(source:Araport11) |
| AT2G23870 | pseudogene of Terpenoid cyclases family protein;(source:Araport11) |
| AT2G23880 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-41 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G23960 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT2G23980 | Encodes a cyclic GMP-activated non-selective cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT2G24010 | serine carboxypeptidase-like 23;(source:Araport11) |
| AT2G24040 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G24060 | SUPPRESSOR OF VARIEGATION9 (SVR9),encodes a chloroplast-localized prokaryotic type translation initiation factor 3. Mutant plants shows both chloroplast development defect, and a series of leaf developmental abnormalities including more serrated leaf margin, disorganized mesophyll cells, and altered cotyledon venation patterns. |
| AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT2G24140 | myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G24150 | heptahelical transmembrane protein HHP3 |
| AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
| AT2G24170 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. The mRNA is cell-to-cell mobile. |
| AT2G24190 | Encodes an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. In addition, this enzyme can reduce methylglyoxal in vitro. It is believed that this enzyme localizes to the cytosol like the closely related protein encoded by AT3G61220. |
| AT2G24255 | LOW protein: F-box/kelch-repeat protein;(source:Araport11) |
| AT2G24270 | Encodes a protein with non-phosphorylating NADP-dependent glyceraldehyde-3-phosphate dehydrogenase activity. The activity of the enzyme was determined from leaf extracts; the enzyme has not been purified to confirm activity. |
| AT2G24300 | Calmodulin-binding protein;(source:Araport11) |
| AT2G24310 | TPRXL;(source:Araport11) |
| AT2G24340 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G24360 | STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4. |
| AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G24420 | DNA repair ATPase-like protein;(source:Araport11) |
| AT2G24460 | C3HC4-type RING finger protein;(source:Araport11) |
| AT2G24510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G24540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G24545 | Natural antisense transcript overlaps with AT2G24540;(source:Araport11) |
| AT2G24560 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT2G24592 | hypothetical protein;(source:Araport11) |
| AT2G24617 | hypothetical protein;(source:Araport11) |
| AT2G24620 | S-locus glycoprotein family protein;(source:Araport11) |
| AT2G24650 | B3 domain-containing protein REM13;(source:Araport11) |
| AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT2G24710 | member of Putative ligand-gated ion channel subunit family |
| AT2G24735 | other_RNA;(source:Araport11) |
| AT2G24740 | Encodes a SU(VAR)3-9 homolog, a SET domain protein (Homology Subgroup V; Orthology Group 1). Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. This protein is a putative histone methyltransferase (predicted to methylate H3K9/20) related to the the Drosophila Su(var)3-9 and mammalian G9a proteins. |
| AT2G24760 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-16 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G24761 | pseudogene of self-incompatibility protein-related protein |
| AT2G24762 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT2G24790 | Positive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching. The mRNA is cell-to-cell mobile. |
| AT2G24791 | Pseudogene of AT5G18880; glucose transmembrane transporter |
| AT2G24800 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G24820 | translocon at the inner envelope membrane of chloroplasts 55-II;(source:Araport11) |
| AT2G24945 | transmembrane protein;(source:Araport11) |
| AT2G25015 | pseudogene of DNA repair protein-like protein;(source:Araport11) |
| AT2G25025 | pseudogene of AGAMOUS-like 28;(source:Araport11) |
| AT2G25040 | pseudogene of casein lytic proteinase B4;(source:Araport11) |
| AT2G25090 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance. |
| AT2G25120 | Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
| AT2G25140 | Encodes ClpB4, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Targeted to the mitochondrion, also referred to as ClpB-m. Transcripts of ClpB4 accumulate dramatically at high temperatures, suggesting that it may be involved in response to heat stress. |
| AT2G25190 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
| AT2G25220 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
| AT2G25260 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT2G25290 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT2G25320 | TRAF-like family protein;(source:Araport11) |
| AT2G25330 | TRAF-like family protein;(source:Araport11) |
| AT2G25360 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G25380 | pseudogene of zinc finger protein-related |
| AT2G25409 | hypothetical protein;(source:Araport11) |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT2G25470 | receptor like protein 21;(source:Araport11) |
| AT2G25480 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT2G25482 | Encodes a ECA1 gametogenesis related family protein |
| AT2G25500 | Inosine triphosphate pyrophosphatase family protein;(source:Araport11) |
| AT2G25520 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
| AT2G25530 | AFG1-like ATPase family protein;(source:Araport11) |
| AT2G25540 | cellulose synthase |
| AT2G25590 | Plant Tudor-like protein;(source:Araport11) |
| AT2G25600 | Encodes SPIK, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutant plants have impaired pollen-tube growth. |
| AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT2G25640 | SPOC domain / Transcription elongation factor S-II protein;(source:Araport11) |
| AT2G25685 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G25770 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G25790 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
| AT2G25840 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT2G25870 | Encodes an endoribonuclease that is required for chloroplast rRNA processing. |
| AT2G26020 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT2G26030 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G26130 | Encodes a RING-type zinc finger ubiquitin ligase involved in seed longevity.Gain of function (35S promoter) increases, and loss of function decreases, seed longevity. |
| AT2G26135 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT2G26150 | member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay. |
| AT2G26160 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
| AT2G26190 | IQM4 is a plastid localized, Ca2+ independent calmodulin binding protein that is involved in promoting seed dormancy. |
| AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
| AT2G26320 | AGAMOUS-like 33;(source:Araport11) |
| AT2G26350 | Zinc-binding peroxisomal integral membrane protein (PEX10). Inserted directly from the cytosol into peroxisomes and is involved in importing proteins into the peroxisome. Required for embryogenesis. |
| AT2G26400 | Encodes a protein predicted to belong to the acireductone dioxygenase (ARD/ARD?)family. |
| AT2G26410 | Member of IQ67 (CaM binding) domain containing family. |
| AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
| AT2G26440 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G26455 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT2G26460 | Encodes SMU2, a protein involved in RNA splicing. |
| AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
| AT2G26500 | cytochrome b6f complex subunit (petM);(source:Araport11) |
| AT2G26510 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT2G26540 | Encodes a uroporphyrinogen-III synthase involved in tetrapyrrole biosynthesis. The protein localizes to the chloroplast. Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT2G26680 | FkbM family methyltransferase;(source:Araport11) |
| AT2G26692 | Natural antisense transcript overlaps with AT2G26690;(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT2G26700 | Member of AGC VIIIa Kinase gene family. Encodes PID2, a homolog of PID. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT2G26730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G26740 | Encodes a soluble epoxide hydrolase whose expression is induced by auxin and water stress. |
| AT2G26750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G26760 | Cyclin B1;(source:Araport11) |
| AT2G26790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G26800 | Mutant has increased seed ile, leu and val as well as his and arg. |
| AT2G26830 | Encodes a member of a small family of choline/ethanolamine kinases that is localized to the plasma membrane. Homozygous loss of function alleles are embryo lethal. Overexpression results in altered phospholipid levels suggesting a critical role in phospholipid biosynthesis. |
| AT2G26865 | Encodes a Plant thionin family protein |
| AT2G26880 | AGAMOUS-like 41;(source:Araport11) |
| AT2G26930 | Encodes a 4-(cytidine 5'-phospho)-2-C-methyl-D-erithritol kinase. |
| AT2G26950 | Member of the R2R3 factor gene family. |
| AT2G26960 | Member of the R2R3 factor gene family.Expressed in microspores and required for progression into pollen mitosis I. |
| AT2G27000 | member of CYP705A |
| AT2G27010 | member of CYP705A |
| AT2G27035 | Has been classified as a stellacyanin. Has also been classified as an early nodulin-like protein (ENODL), because it does not have a His residue involved in Cu binding. ENODLs are proteins having one plastocyanin-like (PCNL) domain lacking the amino acid residues necessary for Cu binding. |
| AT2G27050 | ethylene-insensitive3-like1 (EIL1) The mRNA is cell-to-cell mobile. |
| AT2G27060 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G27120 | Encodes a protein with similarity to DNA polymerase epsilon catalytic subunit. Based on yeast two hybrid analysis, not predicted to be a subunit of the DNA polymerase epsilon complex. No phenotype observed in homozygous mutant embryos or plants but in combination with TIL1-1/til1-1 heterozygotes arrest earlier than til1 homozygotes suggesting TIL2 functions redundantly with TIL1. |
| AT2G27130 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G27160 | hypothetical protein;(source:Araport11) |
| AT2G27170 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT2G27180 | hypothetical protein;(source:Araport11) |
| AT2G27210 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT2G27220 | BEL1-like homeodomain 5;(source:Araport11) |
| AT2G27270 | transmembrane protein;(source:Araport11) |
| AT2G27280 | coiled-coil protein (DUF2040);(source:Araport11) |
| AT2G27310 | F-box family protein;(source:Araport11) |
| AT2G27380 | Encodes an extensin like gene involved in seed germination. |
| AT2G27410 | B3 domain protein, putative (DUF313);(source:Araport11) |
| AT2G27430 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G27440 | pseudogene of rac GTPase activating protein |
| AT2G27480 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G27505 | FBD-like domain family protein;(source:Araport11) |
| AT2G27520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G27540 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G27580 | Regulated by heat shock. |
| AT2G27600 | Encodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function. The mRNA is cell-to-cell mobile. |
| AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G27670 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
| AT2G27700 | eukaryotic translation initiation factor 2 family protein / eIF-2 family protein;(source:Araport11) |
| AT2G27750 | Surfeit locus protein 6;(source:Araport11) |
| AT2G27760 | Encodes tRNA isopentenyltransferase, similar to yeast MOD5. |
| AT2G27780 | Transcription factor IIS family protein;(source:Araport11) |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
| AT2G27900 | coiled-coil protein;(source:Araport11) |
| AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
| AT2G27930 | PLATZ transcription factor family protein;(source:Araport11) |
| AT2G27940 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G27950 | Ring/U-Box superfamily protein;(source:Araport11) |
| AT2G27980 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT2G27990 | Encodes a BEL1-like homeobox gene that functions together with PNY in meristem maintenance by regulating the allocation process during vegetative and reproductive development. Both gene products are required for the competence of the SAM to respond properly to floral inductive signals. |
| AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G28090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G28105 | replication factor-A carboxy-terminal domain protein;(source:Araport11) |
| AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
| AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
| AT2G28140 | enabled-like protein (DUF1635);(source:Araport11) |
| AT2G28150 | DUF966 domain containing protein, expressed during embryogenesis. |
| AT2G28190 | Encodes a chloroplastic copper/zinc superoxide dismutase CSD2 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Activation depends totally on CCS. Overexpression of a miR398-resistant form of CSD2 leads to more dramatic improvements in stress (hight light, Cu2+ and methyl viologen) tolerance than overexpression of wild-type CSD2. The mRNA is cell-to-cell mobile. |
| AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT2G28260 | member of Cyclic nucleotide gated channel family |
| AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G28280 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G28290 | Encodes a SWI2/SNF2-like protein in the SNF2 subclass. Homozygous plants with null mutations exhibit premature termination of the meristem and carpelloid structures from the inflorescence meristem. Co-activator of floral homeotic gene expression. Acts with LFY to regulate shoot apical meristem identity. Required for meristem maintenance. Regulates flowering under a non-inductive photoperiod. It promotes the expression of CUC2 during cotyledon boundary formation. Affects reproductive shoot apical meristem function by regulating the expression of WUS. In CHiP experiments SYD binds to WUS promoter. Present as two forms in the nucleus, full-length and truncated, with the latter apparently lacking the C-terminal domain. The ratio of the two forms differs in juvenile and in adult tissues. The C-terminal domain is not required for activity. The mRNA is cell-to-cell mobile. |
| AT2G28315 | UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and ER. UXT1 functions as a UDP-Xyl transporter. The mRNA is cell-to-cell mobile. |
| AT2G28320 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
| AT2G28390 | SAND family protein;(source:Araport11) |
| AT2G28400 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28420 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT2G28450 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G28520 | Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network. The mRNA is cell-to-cell mobile. |
| AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G28580 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28610 | Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia. |
| AT2G28625 | Encodes a cytoplasmic protein that genetically interacts with AtRZF1, a RING-type subunit of the E3 ubiquitin ligase family, to mediate proline accumulation in response to abiotic stress. |
| AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G28660 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
| AT2G28710 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT2G28720 | Histone superfamily protein;(source:Araport11) |
| AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
| AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
| AT2G28840 | Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3. |
| AT2G28880 | ADCS encodes a protein that has two functional domains. The N-terminal domain has glutamine amidotransferase activity while the C-terminal domain has aminodeoxychorismate synthase (ADCS) activity. These two domains act together to catalyze the transformation of chorismate to 4-amino-4-deoxychorismate. This reaction is required for 4-aminobenzoate (pABA) production and ultimately for folate biosynthesis. The putative target peptide of ADCS can direct GFP to the chloroplast. |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT2G28900 | Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment. |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28930 | protein kinase 1B;(source:Araport11) |
| AT2G28970 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G28990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G29040 | Exostosin family protein;(source:Araport11) |
| AT2G29050 | RHOMBOID-like 1;(source:Araport11) |
| AT2G29060 | GRAS family transcription factor;(source:Araport11) |
| AT2G29065 | GRAS family transcription factor;(source:Araport11) |
| AT2G29070 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
| AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
| AT2G29100 | member of Putative ligand-gated ion channel subunit family |
| AT2G29110 | member of Putative ligand-gated ion channel subunit family |
| AT2G29120 | member of Putative ligand-gated ion channel subunit family |
| AT2G29150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29160 | pseudogene of senescence-associated gene 13;(source:Araport11) |
| AT2G29170 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29180 | transmembrane protein;(source:Araport11) |
| AT2G29200 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT2G29220 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29250 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29280 | pseudogene of tropinone reductase;(source:Araport11) |
| AT2G29300 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29350 | Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis. |
| AT2G29360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29370 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29430 | coiled-coil protein (DUF572);(source:Araport11) |
| AT2G29440 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29450 | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
| AT2G29460 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Role in the degradation of H2O2 to water using glutathione as electron donor |
| AT2G29480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29490 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29520 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT2G29570 | Functionally interacts with POLH to repair DNA damaged by UVB damage. May be sumoylated. |
| AT2G29590 | Thioesterase superfamily protein;(source:Araport11) |
| AT2G29610 | pseudogene of the F-box protein family, contains Pfam profile PF00646: F-box domain |
| AT2G29620 | dentin sialophosphoprotein;(source:Araport11) |
| AT2G29640 | JOSEPHIN-like protein;(source:Araport11) |
| AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT2G29679 | hypothetical protein;(source:Araport11) |
| AT2G29720 | Encodes CTF2B. |
| AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
| AT2G29750 | UDP-glucosyl transferase 71C1;(source:Araport11) |
| AT2G29770 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29780 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
| AT2G29800 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29810 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29820 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29860 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29870 | Aquaporin-like superfamily protein;(source:Araport11) |
| AT2G29910 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G29940 | pleiotropic drug resistance 3;(source:Araport11) |
| AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
| AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
| AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
| AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
| AT2G29995 | PSY3-like protein;(source:Araport11) |
| AT2G30010 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G30060 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT2G30090 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G30105 | LRR/ubiquitin-like domain protein;(source:Araport11) |
| AT2G30110 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. Mutant is able to revert the constitutive defense responses phenotype of snc1, which indicates the gene is involved in defense response. It also indicates that ubiquitination plays a role in plant defense signalling. |
| AT2G30160 | Mitochondrial iron transport protein. Member of the substrate carrier family (MCF) of protein transporters. |
| AT2G30170 | Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens. |
| AT2G30190 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT2G30210 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT2G30290 | VACUOLAR SORTING RECEPTOR 2;(source:Araport11) |
| AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G30310 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT2G30380 | MYB family transcription factor;(source:Araport11) |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT2G30400 | ovate family protein 2;(source:Araport11) |
| AT2G30430 | hypothetical protein;(source:Araport11) |
| AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
| AT2G30500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G30520 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT2G30540 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
| AT2G30575 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G30660 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT2G30690 | lateral signaling target-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G30695 | bacterial trigger factor;(source:Araport11) |
| AT2G30710 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT2G30740 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G30750 | Putative cytochrome P450; together with CYP71A13 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
| AT2G30766 | Functions in iron homeostasis, activates iron deficiency response genes such as bHLH38, bHLH39, IRT1, and FRO2. |
| AT2G30780 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G30820 | aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit;(source:Araport11) |
| AT2G30830 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT2G30900 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G30942 | Encodes a 56-amino acid polypeptide with low but significant similarity to human small subunit of serine palmitoyltransferase that localizes to the ER and physically interacts with and greatly stimulates the activity of LCB1/LCB2 heterodimer ser palmitoyltransferase complex. |
| AT2G31020 | OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11) |
| AT2G31035 | oxysterol-binding-like protein;(source:Araport11) |
| AT2G31050 | Cupredoxin superfamily protein;(source:Araport11) |
| AT2G31081 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT2G31130 | hypothetical protein;(source:Araport11) |
| AT2G31141 | hypothetical protein;(source:Araport11) |
| AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT2G31250 | Glutamyl-tRNA reductase family protein;(source:Araport11) |
| AT2G31310 | LOB domain-containing protein 14;(source:Araport11) |
| AT2G31335 | hypothetical protein;(source:Araport11) |
| AT2G31345 | transmembrane protein;(source:Araport11) |
| AT2G31380 | a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction. |
| AT2G31410 | coiled-coil protein;(source:Araport11) |
| AT2G31460 | B3 domain protein, putative (DUF313);(source:Araport11) |
| AT2G31470 | Encodes a F-Box protein DOR (Drought tolerance Repressor) functionally as an inhibitory factor for abscisic acid-induced stomatal closure under drought stress. |
| AT2G31500 | member of Calcium Dependent Protein Kinase |
| AT2G31510 | IBR domain-containing protein;(source:Araport11) |
| AT2G31520 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.9e-44 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT2G31550 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
| AT2G31570 | glutathione peroxidase GPx |
| AT2G31580 | ICA1 is a nuclear localized member of the tRNA(His) guanylyl transferase superfamily. Loss of function alleles show increased sensitivity to growth at high temperatures defects in cell cycle progression and DNA repair. |
| AT2G31690 | encodes a triacylglycerol lipase located in plastoglobuli and involved in the degradation of triacylglycerol. It also has impact on leaf senescence and maintaining the structural integrity of thylakoids. |
| AT2G31710 | Vacuolar ATPase assembly integral membrane protein VMA21-like domain-containing protein;(source:Araport11) |
| AT2G31720 | B3 domain protein (DUF313);(source:Araport11) |
| AT2G31725 | FAM136A-like protein (DUF842);(source:Araport11) |
| AT2G31740 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT2G31751 | Potential natural antisense gene, locus overlaps with AT2G31750 |
| AT2G31760 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
| AT2G31820 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G31830 | Encodes a 5-inositol-polyphosphate phosphatase, that, in vitro, shows some activity against Ins(1,4,5)P3 and PI(3,4,5)P3, but even higher activity against PI(4,5)P2 |
| AT2G31850 | hypothetical protein;(source:Araport11) |
| AT2G31860 | pseudogene of poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
| AT2G31862 | B3 domain protein;(source:Araport11) |
| AT2G31865 | poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
| AT2G31902 | Natural antisense transcript overlaps with AT2G31900;(source:Araport11) |
| AT2G31920 | Member of a novel, plant specific family of microtubule associated proteins. |
| AT2G31953 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G31985 | lipoprotein (DUF1264);(source:Araport11) |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G32050 | cell cycle control-like protein (DUF572);(source:Araport11) |
| AT2G32130 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
| AT2G32140 | transmembrane receptor;(source:Araport11) |
| AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G32235 | hypothetical protein;(source:Araport11) |
| AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
| AT2G32290 | beta-amylase 6;(source:Araport11) |
| AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G32360 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G32380 | Transmembrane protein 97, predicted |
| AT2G32440 | ent-kaurenoic acid hydroxylase (KAO2) |
| AT2G32460 | Member of the R2R3 factor gene family. |
| AT2G32470 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G32480 | Metalloprotease essential for plastid development. Located in the inner membrane of chloroplasts. |
| AT2G32500 | Stress responsive alpha-beta barrel domain protein;(source:Araport11) |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT2G32530 | encodes a gene similar to cellulose synthase |
| AT2G32540 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT2G32610 | encodes a gene similar to cellulose synthase |
| AT2G32620 | encodes a gene similar to cellulose synthase |
| AT2G32630 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT2G32740 | galactosyltransferase 13;(source:Araport11) |
| AT2G32750 | Exostosin family protein;(source:Araport11) |
| AT2G32770 | purple acid phosphatase 13;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT2G32810 | putative beta-galactosidase |
| AT2G32820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT2G32835 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT2G32860 | beta glucosidase 33;(source:Araport11) |
| AT2G32870 | TRAF-like family protein;(source:Araport11) |
| AT2G32880 | TRAF-like family protein;(source:Araport11) |
| AT2G32905 | B3 domain protein, putative (DUF313);(source:Araport11) |
| AT2G32930 | Encodes a zinc finger protein. |
| AT2G32950 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile. |
| AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
| AT2G33000 | ubiquitin-associated (UBA)/TS-N domain-containing protein-like protein;(source:Araport11) |
| AT2G33010 | Ubiquitin-associated (UBA) protein;(source:Araport11) |
| AT2G33020 | receptor like protein 24;(source:Araport11) |
| AT2G33051 | Natural antisense transcript overlaps with AT2G33050;(source:Araport11) |
| AT2G33060 | receptor like protein 27;(source:Araport11) |
| AT2G33070 | Encodes a nitrile-specifier protein NSP2. NSP2 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT2G33090 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT2G33100 | encodes a gene similar to cellulose synthase |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT2G33180 | hypothetical protein;(source:Araport11) |
| AT2G33190 | F-box only protein (DUF295);(source:Araport11) |
| AT2G33200 | F-box family protein;(source:Araport11) |
| AT2G33205 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT2G33210 | Involved in the RNA splicing of rpl2 and ccmFC introns in mitochondria. |
| AT2G33230 | Encodes a flavin monooxygenase gene which belongs to the tryptophan-dependent auxin biosynthetic pathway and enhances drought resistance. |
| AT2G33233 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G33270 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
| AT2G33300 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G33350 | CCT motif family protein;(source:Araport11) |
| AT2G33385 | actin-related protein C2B;(source:Araport11) |
| AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
| AT2G33430 | Encodes a multiple organellar RNA editing factor, a chloroplast protein which is required for the maturation of the plastid ribosomal RNAs and is essential for chloroplast differentiation.Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT2G33470 | glycolipid transfer protein 1;(source:Araport11) |
| AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
| AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT2G33530 | serine carboxypeptidase-like 46;(source:Araport11) |
| AT2G33540 | C-terminal domain phosphatase-like 3;(source:Araport11) |
| AT2G33585 | subtilisin-like protease;(source:Araport11) |
| AT2G33600 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. Its expression pattern suggests that AtCRL2 is involved in the synthesis and/or maintenance of vascular tissue. |
| AT2G33670 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO5 belongs to the clade III, with AtMLO7, AtMLO8, AtMLO9, and AtMLO10. The gene is expressed during seedling growth, in cotyledon vascular system, and in stigma, anther and pollen grains; it was not expressed in rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G33680 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
| AT2G33720 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G33750 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT2G33780 | VQ motif-containing protein;(source:Araport11) |
| AT2G33796 | FBD-like domain family protein;(source:Araport11) |
| AT2G33845 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G33855 | transmembrane protein;(source:Araport11) |
| AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
| AT2G33880 | Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling. |
| AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G34030 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G34060 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT2G34080 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G34090 | maternal effect embryo arrest 18;(source:Araport11) |
| AT2G34123 | Encodes a defensin-like (DEFL) family protein. |
| AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT2G34170 | hypothetical protein (DUF688);(source:Araport11) |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT2G34200 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G34220 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT2G34224 | hypothetical protein;(source:Araport11) |
| AT2G34238 | hypothetical protein;(source:Araport11) |
| AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
| AT2G34270 | hypothetical protein;(source:Araport11) |
| AT2G34280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G34290 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G34315 | avirulence induced family protein;(source:Araport11) |
| AT2G34340 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G34360 | MATE efflux family protein;(source:Araport11) |
| AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
| AT2G34390 | aquaporin NIP2.1 |
| AT2G34430 | Photosystem II type I chlorophyll a/b-binding protein The mRNA is cell-to-cell mobile. |
| AT2G34460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G34490 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-epi-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH. |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G34530 | transmembrane protein;(source:Araport11) |
| AT2G34580 | cytomegalovirus UL139 protein;(source:Araport11) |
| AT2G34600 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT2G34610 | cotton fiber protein;(source:Araport11) |
| AT2G34640 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. |
| AT2G34655 | hypothetical protein;(source:Araport11) |
| AT2G34660 | encodes a multidrug resistance-associated protein that is MgATP-energized glutathione S-conjugate pump. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. The mRNA is cell-to-cell mobile. |
| AT2G34670 | benzoyl-CoA reductase subunit C, putative (DUF630 and DUF632);(source:Araport11) |
| AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
| AT2G34730 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT2G34750 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
| AT2G34810 | FAD-binding Berberine family protein;(source:Araport11) |
| AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G34835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-32 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G34850 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G34860 | DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development. |
| AT2G34880 | JMJ15 is a novel H3K4 demethylase that regulates genes involved in flowering and response to stress. It is also a maternally expressed, imprinted gene. |
| AT2G34890 | Cytidine triphosphate synthase. |
| AT2G34910 | root hair specific protein;(source:Araport11) |
| AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34960 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. Localized to the plasma membrane. |
| AT2G34980 | Encodes a putative phosphatidylinositol-glycan synthase subunit C gene. It is involved in the first step of the glycosylphosphatidylinositol (GPI) biosynthetic pathway. |
| AT2G35030 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G35050 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT2G35060 | potassium transporter |
| AT2G35080 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
| AT2G35110 | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs. Its ER localization is independent of upstream SPK1 activation signaling and the physical association with the WAVE/SCAR Regulatory complex binding partner SRA1. ER-localized NAP1 has little colocalization with actin and represent the inactive pool of NAP1 in these cell types. |
| AT2G35120 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT2G35150 | Encodes EXORDIUM LIKE 7. |
| AT2G35160 | Encodes SU(var)3-9 homologue 5 (SUVH5). SUVH5 has histone methyltransferase (MTase) activity in vitro and contributes to the maintenance of H3 mK9 (methylation of histone H3 at Lys-9) and CMT3-mediated non-CG methylation in vivo. This is a member of a subfamily of SET proteins that shares a conserved SRA domain. |
| AT2G35200 | DUF740 family protein;(source:Araport11) |
| AT2G35210 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT2G35215 | plant/protein;(source:Araport11) |
| AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
| AT2G35330 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35345 | hypothetical protein;(source:Araport11) |
| AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G35382 | snoRNA;(source:Araport11) |
| AT2G35387 | snoRNA;(source:Araport11) |
| AT2G35420 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35430 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G35480 | envelope glycoprotein;(source:Araport11) |
| AT2G35570 | pseudogene of Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
| AT2G35600 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT2G35605 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT2G35615 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G35650 | a member of Glycosyltransferase- Family 2 and encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. Mutants exhibit defects in pollen tube growth and embryo development. The defective embryonic development was associated with reduced proliferation and failed cellularization of the endosperm. |
| AT2G35670 | Encodes a negative regulator of seed development in the absence of pollination. In the ovule, the FIS2 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. |
| AT2G35720 | Encodes OWL1, a J-domain protein involved in perception of very low light fluences. |
| AT2G35750 | transmembrane protein;(source:Araport11) |
| AT2G35770 | serine carboxypeptidase-like 28;(source:Araport11) |
| AT2G35820 | ureidoglycolate hydrolase;(source:Araport11) |
| AT2G35880 | Microtubule-stabilizing protein. |
| AT2G35890 | member of Calcium Dependent Protein Kinase |
| AT2G35900 | Mal d 1-associated protein;(source:Araport11) |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT2G35990 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT2G36060 | MMZ3/UEV1C encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1C can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. It can also rescue an mms2 ubc13 double mutant in yeast in combination with UBC13A. MMZ3/UEV1C transcripts are found at moderate levels in most plant organs, but cannot be detected in the pollen or 2 days after germination. Transcript levels do not appear to be stress-inducible. |
| AT2G36070 | One of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP. |
| AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
| AT2G36100 | Encodes a membrane bound protein involved in formation of the casparian strip. Along with CASP 2 it is required for the localization of ESB1. |
| AT2G36130 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT2G36190 | cwINV4 appears to function as a cell wall-localized invertase (that can catalyze the hydrolysis of sucrose into fructose and glucose) based on the phenotype of cwinv4 mutants. cwINV4 transcripts are expressed at high levels in lateral and median nectaries and this enzyme plays an important role in nectar production. Also expressed in ovary placenta and appears to play a role linking sugar sensing to ovule intitiation. |
| AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G36240 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT2G36260 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
| AT2G36370 | ubiquitin-protein ligase;(source:Araport11) |
| AT2G36420 | nucleolin-like protein;(source:Araport11) |
| AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
| AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
| AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
| AT2G36490 | A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts. The ros1 mutant is more susceptible to biotrophic pathogens and is repressed in its responsiveness of salyclic acid-dependent defence genes. |
| AT2G36530 | Involved in light-dependent cold tolerance and encodes an enolase. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. Affects seed size and weight by adjusting cytokinin content and forming ENO2-bZIP75 complex. |
| AT2G36540 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G36550 | haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT2G36620 | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
| AT2G36640 | Encodes putative phosphotyrosine protein belonging to late embryogenesis abundant (LEA) protein in group 3 that might be involved in maturation and desiccation tolerance of seeds. RFLP and CAPS mapping place it on chromosome 4 but the nucleotide sequence maps it to chromosome 2. |
| AT2G36650 | CHUP1-like protein;(source:Araport11) |
| AT2G36660 | polyadenylate-binding protein, putative / PABP, putative. Member of the class III family of PABP proteins. |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT2G36695 | hypothetical protein;(source:Araport11) |
| AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G36740 | DNA binding protein SWC2;(source:Araport11) |
| AT2G36750 | UDP-glucosyl transferase 73C1;(source:Araport11) |
| AT2G36760 | UDP-glucosyl transferase 73C2;(source:Araport11) |
| AT2G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G36780 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G36790 | The At2g36790 gene encodes a UDP-glucose:flavonol-3-O-glycoside-7-O-glucosyltransferase (UGT73C6)attaching a glucosyl residue to the 7-O-position of the flavonols kaempferol, quercetin and their 3-O-glycoside derivatives. |
| AT2G36792 | Natural antisense transcript overlaps with AT2G36790;(source:Araport11) |
| AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
| AT2G36815 | mid region of cactin;(source:Araport11) |
| AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile. |
| AT2G36835 | hypothetical protein;(source:Araport11) |
| AT2G36854 | hypothetical protein;(source:Araport11) |
| AT2G36870 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1). By sequence similarity to XTH31 (At3g44990) and in vivo analysis, likely to exhibit predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
| AT2G36885 | translation initiation factor;(source:Araport11) |
| AT2G36920 | B3 domain protein;(source:Araport11) |
| AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G36970 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G36980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G36985 | Encodes ROTUNDIFOLIA4, a member of the seed plant-specific family of small peptides, RTFL (ROT FOUR LIKE), characterised by the presence of a 29-amino acid domain: RTF. Expressed in shoot apices, young leaves and flowers. Involved in controlling polarity-dependent cell proliferation. |
| AT2G36990 | Encodes a general sigma factor in chloroplasts and is probably responsible for the recognition of sigma 70 type standard bacteria-type multi-subunit RNA polymerase (PEP) promoters in young cotyledons. It is a substrate for regulatory phosphorylation by cpCK2, a nuclear-coded plastid-targeted casein kinase 2, that has been implicated as a key component in plant sigma factor phosphorylation and transcriptional regulation. |
| AT2G37010 | member of NAP subfamily |
| AT2G37025 | TRF-like 8;(source:Araport11) |
| AT2G37070 | Encodes a microtubule-associated protein track growing microtubule plus ends. |
| AT2G37090 | The IRX9 gene encodes a putative family 43 glycosyl transferase. It was coordinately expressed with the cellulose synthase subunits during secondary cell wall formation. Cell wall analysis revealed a decrease in the abundance of xylan in the irx9 mutant, indicating that IRX9 is required for xylan synthesis. Mutants have irregular xylem phenotype suggesting a role in secondary cell wall biosynthesis.IRX9 was identified as MUCI65 in a reverse genetic screen for MUCILAGE-RELATED genes. Despite producing only a few seeds, the irx9-1 mutant displays normal mucilage properties. |
| AT2G37110 | PLAC8 family protein;(source:Araport11) |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT2G37270 | One of two genes encoding the ribosomal protein S5. Expressed at a lower level compared to ATRPS5A. |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT2G37290 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT2G37300 | transmembrane protein;(source:Araport11) |
| AT2G37310 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G37320 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G37330 | Encodes an ABC transporter-like protein, without an ATPase domain, required for aluminum (Al) resistance/tolerance and may function to redistribute accumulated Al away from sensitive tissues in order to protect the growing root from the toxic effects of Al. |
| AT2G37360 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT2G37370 | centrosomal protein of 135 kDa-like protein;(source:Araport11) |
| AT2G37380 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT2G37390 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT2G37410 | Mitochondrial inner membrane translocase. Together with AtTIM17-1, TIM17-2 has a long C-terminal extension not present in other TIMs. The extension is located in the outer membrane and so TIM17-2 links the inner and outer mitochondrial membranes. The C-terminal region is essential for protein import into mitochondria via the general import pathway but is not necessary for import via the carrier pathway. |
| AT2G37420 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
| AT2G37450 | nodulin MtN21-like transporter family protein |
| AT2G37470 | Histone superfamily protein;(source:Araport11) |
| AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G37630 | Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP. Also functions as a regulator of the plant immune response. |
| AT2G37650 | GRAS family transcription factor;(source:Araport11) |
| AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
| AT2G37700 | Fatty acid hydroxylase superfamily;(source:Araport11) |
| AT2G37710 | Induced in response to Salicylic acid. The mRNA is cell-to-cell mobile. |
| AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G37730 | glycosyltransferase (DUF604);(source:Araport11) |
| AT2G37750 | hypothetical protein;(source:Araport11) |
| AT2G37770 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including saturated and unsaturated aldehydes, steroids, and sugars. GFP-tagged AKR4C9 localizes to the chloroplast where it may play a role in detoxifying reactive carbonyl compounds that threaten to impair the photosynthetic process. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
| AT2G37800 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G37910 | cation/hydrogen exchanger, putative (CHX21);(source:Araport11) |
| AT2G37940 | Inositol phosphorylceramide synthase 2;(source:Araport11) |
| AT2G37950 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G38020 | necessary for proper vacuole formation and morphogenesis in Arabidopsis |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT2G38060 | Encodes an inorganic phosphate transporter (PHT4;2). |
| AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
| AT2G38100 | Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos. |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT2G38150 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT2G38170 | Encodes a high affinity vacuolar calcium antiporter. The residue His 338 is critical to Ca2+ transport activity. Disruption of CAX1 reduces manganese and zinc of shoot tissue and results in a decrease in the activity of vacuolar V-type proton ATPase. |
| AT2G38195 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G38270 | Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4. |
| AT2G38280 | Encodes a protein with in vitro AMP deaminase activity that is involved in embryogenesis. Homozygous mutant embryos fail to develop past the zygote stage. |
| AT2G38290 | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
| AT2G38300 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT2G38320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL34 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. This biochemical phenotype can be observed in tbl34 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
| AT2G38350 | hypothetical protein;(source:Araport11) |
| AT2G38360 | prenylated RAB acceptor 1.B4;(source:Araport11) |
| AT2G38365 | endonuclease/glycosyl hydrolase;(source:Araport11) |
| AT2G38380 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT2G38440 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. Mutations cause defects in both the actin and microtubule cytoskeletons that result in aberrant epidermal cell expansion. itb1 mutants showed irregularities in trichome branch positioning and expansion. The SHD domain of this protein binds to BRK1 and overexpression of the SHD domain results in a dominant negative phenotype. The mRNA is cell-to-cell mobile. |
| AT2G38480 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G38490 | member of AtCIPKs |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G38510 | MATE efflux family protein;(source:Araport11) |
| AT2G38570 | hypothetical protein;(source:Araport11) |
| AT2G38590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G38646 | hypothetical protein;(source:Araport11) |
| AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
| AT2G38720 | microtubule-associated protein 65-5;(source:Araport11) |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT2G38790 | hypothetical protein;(source:Araport11) |
| AT2G38800 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT2G38823 | hypothetical protein;(source:Araport11) |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT2G38905 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G38910 | member of Calcium Dependent Protein Kinase |
| AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT2G38950 | Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein;(source:Araport11) |
| AT2G38970 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G39000 | Encodes a chloroplast localized n-acetyltransfefase involved in N-terminal protein amino acid acetylation. |
| AT2G39010 | plasma membrane intrinsic protein 2E;(source:Araport11) |
| AT2G39020 | Although this locus shares considerable sequence similarity with the adjacent NATA1 gene (At2g39030), they appear to encode genes with different functions. NATA1 is involved in the production of N-delta-acetylornithine, but, overexpression of At2g39020 in tobacco does not lead to the formation of this defense compound. The mRNA is cell-to-cell mobile. |
| AT2G39050 | Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae. |
| AT2G39170 | MEF2BNB-like protein;(source:Araport11) |
| AT2G39175 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160a (converted to TAIR10 based on PMID19304749): Chr2: 16339853-16341886 (forward), length: 2034 bp; exon coordinates: exon 1: 16339853 to 16340469, exon 2: 16341621 to 16341886; mature miRNA and miRNA* are located on exon 1. |
| AT2G39180 | CRINKLY4 related 2;(source:Araport11) |
| AT2G39190 | member of ATH subfamily |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G39220 | Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus. |
| AT2G39230 | Encodes a pentatricopeptide protein (LOJ) that is specifically expressed in lateral organ junctions. |
| AT2G39250 | Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT2G39260 | Nonsense mediated decay (NMD)factor. |
| AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
| AT2G39300 | CAP-gly domain linker;(source:Araport11) |
| AT2G39310 | jacalin-related lectin 22;(source:Araport11) |
| AT2G39320 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G39330 | jacalin-related lectin 23;(source:Araport11) |
| AT2G39360 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G39370 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT2G39470 | PsbP-like protein 2;(source:Araport11) |
| AT2G39480 | P-glycoprotein 6;(source:Araport11) |
| AT2G39490 | F-box family protein;(source:Araport11) |
| AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT2G39570 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
| AT2G39630 | Encodes a putative dolichyl-phosphate β-glucosyltransferase. |
| AT2G39650 | cruciferin (DUF506);(source:Araport11) |
| AT2G39660 | Encodes a plasma membrane-localized ser/thr protein kinase that is a crucial component of host response signaling required to activate the resistance responses to Botrytis and A. brassicicola infection. It is likely a negative regulator of salicylic acid accumulation and basal defense against virulent bacterial pathogens. Together with ER plays opposing roles in leaf morphogenesis and inflorescence architecture. Required to maintain appropriate auxin response during leaf margin morphogenesis. Interacts with ER-family proteins and directly phosphorylates ER. |
| AT2G39670 | Radical SAM superfamily protein;(source:Araport11) |
| AT2G39690 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT2G39700 | putative expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT2G39730 | Rubisco activase, a nuclear-encoded chloroplast protein that consists of two isoforms arising from alternative splicing in most plants. Required for the light activation of rubisco. Involved in jasmonate-induced leaf senescence. |
| AT2G39750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G39760 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
| AT2G39780 | Encodes the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. It is essential for normal ribosomal RNA recycling. The mRNA is cell-to-cell mobile. |
| AT2G39790 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
| AT2G39820 | Translation initiation factor IF6;(source:Araport11) |
| AT2G39850 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT2G39851 | Proteinase inhibitor, propeptide;(source:Araport11) |
| AT2G39855 | plant/protein;(source:Araport11) |
| AT2G39860 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT2G39870 | hypothetical protein;(source:Araport11) |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT2G39975 | hypothetical protein;(source:Araport11) |
| AT2G40030 | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB1 and the E. coli RNA polymerase beta prime subunit. Required for normal RNA-directed DNA methylation at non-CG methylation sites and transgene silencing. The nrpe1 mutant is more resistant to biotrophic pathogens and is primed to activate salicylic acid-dependent defence genes. |
| AT2G40070 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
| AT2G40085 | hypothetical protein;(source:Araport11) |
| AT2G40130 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
| AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
| AT2G40210 | AGAMOUS-like 48;(source:Araport11) |
| AT2G40220 | Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings. |
| AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G40240 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G40270 | Protein kinase family protein;(source:Araport11) |
| AT2G40316 | autophagy-like protein;(source:Araport11) |
| AT2G40320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be only observed in double or triple mutant with esk1. |
| AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
| AT2G40380 | prenylated RAB acceptor 1.B2;(source:Araport11) |
| AT2G40390 | neuronal PAS domain protein;(source:Araport11) |
| AT2G40400 | Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development. |
| AT2G40410 | Encodes a Ca(2+)-dependent nuclease that can degrade both DNA and RNA. |
| AT2G40420 | Encodes a putative amino acid transporter. |
| AT2G40430 | Encodes a homolog of yeast NOP53 that is an important regulator of cell division during organ growth. |
| AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G40470 | LOB-domain containing protein. Involved in regulation of xylem differentiation- acts as a regulator of VND7 which is a master regulator of xylem cell differentiation. |
| AT2G40530 | transmembrane protein;(source:Araport11) |
| AT2G40560 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G40620 | Basic leucine zipper transcription factor. Localizes from cytoplasm to the nucleus under heat stress. |
| AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G40670 | response regulator 16 |
| AT2G40710 | hemolysin-III related integral membrane protein;(source:Araport11) |
| AT2G40740 | member of WRKY Transcription Factor; Group III |
| AT2G40745 | hypothetical protein;(source:Araport11) |
| AT2G40770 | RING-finger, DEAD-like helicase, PHD and SNF2 domain-containing protein;(source:Araport11) |
| AT2G40815 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G40840 | Encodes a cytosolic protein with transglucosidase and amylomaltase activity. It is an essential component of the pathway from starch to sucrose and cellular metabolism in leaves at night. The protein binds to heteroglycans and utilizes glucose, mannose and xylose as acceptors. Fucose and galactose can also act as acceptors but less efficiently than the previous three. It was also was also recently reported to act on maltodextrins. On the other hand, arabinose and fructose were not efficiently used. Its role probably includes metabolizing maltose exported from the chloroplast. Studies using maltose extracted from the double mutant be2-1 be3-2 showed that this enzyme is preferentially active of β-maltose. The mRNA is cell-to-cell mobile. |
| AT2G40850 | phosphoinositide 4-kinase gamma 1;(source:Araport11) |
| AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
| AT2G40890 | encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level. |
| AT2G40900 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G40925 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G40930 | Encodes ubiquitin-specific protease with nuclear localization signals that is likely to be involved in ubiquitin-mediated protein degradation. |
| AT2G40990 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G40995 | Encodes a defensin-like (DEFL) family protein. |
| AT2G41140 | Encodes CDPK-related kinase 1 (CRK1). |
| AT2G41150 | plant/protein;(source:Araport11) |
| AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT2G41170 | F-box family protein;(source:Araport11) |
| AT2G41178 | Natural antisense transcript overlaps with AT2G41180;(source:Araport11) |
| AT2G41180 | VQ motif-containing protein;(source:Araport11) |
| AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
| AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G41250 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G41260 | Late-embryogenesis-abundant gene. Involved in the acquisition of desiccation tolerance during late phase of embryogenesis. |
| AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT2G41300 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G41360 | galactose oxidase/kelch repeat protein;(source:Araport11) |
| AT2G41370 | Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP2 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP2 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP3 expression is restricted to pedicel axils by BP and PNY; promotes KNAT6 (At1g23380) expression. |
| AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G41390 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT2G41415 | Encodes a Maternally expressed gene (MEG) family protein |
| AT2G41445 | agamous-like MADS-box protein;(source:Araport11) |
| AT2G41451 | glycosyltransferase-like protein;(source:Araport11) |
| AT2G41460 | Apurinic endonuclease-redox protein. It functions as an apurinic/apyrimidinic class II endonuclease, and is involved in DNA repair. |
| AT2G41473 | F-box family protein;(source:Araport11) |
| AT2G41475 | Embryo-specific protein 3, (ATS3);(source:Araport11) |
| AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT2G41500 | Encodes LACHESIS (LIS), a protein with seven WD40 repeats. LIS is homologous to the yeast splicing factor PRP4 which is associated with the U4/U6 complex of the spliceosome. LIS is involved in a mechanism that prevents accessory cells from adopting gametic cell fate: lis mutant forms supernumerary egg cells. |
| AT2G41600 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT2G41670 | Encodes SIN2 (SHORT INTEGUMENTS 2), a mitochondrial DAR GTPase. SIN2 is hypothesized to function in mitochondrial ribosome assembly. sin2 mutants produce ovules with short integuments due to early cessation of cell division in these structures. |
| AT2G41680 | Encodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage. |
| AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
| AT2G41705 | Encodes a fluoride export protein. |
| AT2G41730 | Expression in rosette leaves is activated by high concentration of boron. |
| AT2G41740 | Encodes a protein with high homology to animal villin. |
| AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
| AT2G41770 | Regulates the assembly and trafficking of cellulose synthase complexes. |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT2G41790 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
| AT2G41800 | Encodes a DUF642 cell wall protein that is highly induced during the M/G1 phases of the cell cycle and is involved in hypocotyl cell elongation. |
| AT2G41810 | imidazolonepropionase (Protein of unknown function, DUF642);(source:Araport11) |
| AT2G41820 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G41840 | Ribosomal protein S5 family protein;(source:Araport11) |
| AT2G41850 | ADPG2. |
| AT2G41860 | member of Calcium Dependent Protein Kinase |
| AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein;(source:Araport11) |
| AT2G41910 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G41930 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT2G41945 | Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture. |
| AT2G41970 | Encodes MRI, a plasma membrane-localized member of the RLCK-VIII subfamily. Preferentially expressed in both pollen tubes and root hairs. mri-knockout mutants display spontaneous pollen tube and root-hair bursting. |
| AT2G41990 | late embryogenesis abundant protein;(source:Araport11) |
| AT2G42000 | AtMT4a is a member of Type 4 metallothionein (MT) genes. It is involved in the early develoment of the embryo and in the accumulation of metal ions especially Zn in the seeds. |
| AT2G42070 | Encodes a plastid-localized Nudix hydrolase that has FAD pyrophosphohydrolase activity. Negative feedback regulation of the metabolism of flavins through the hydrolysis of FAD by AtNUDX23 in plastids is involved in the flavin homeostasis in plant cells. |
| AT2G42090 | actin related gene or pseudogene, based on sequence divergence and lack of expression |
| AT2G42110 | hypothetical protein;(source:Araport11) |
| AT2G42150 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT2G42170 | Actin family protein;(source:Araport11) |
| AT2G42180 | cotton fiber protein;(source:Araport11) |
| AT2G42220 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G42247 | Natural antisense transcript overlaps with AT2G42250;(source:Araport11) |
| AT2G42270 | Similar to yeast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
| AT2G42280 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G42290 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G42300 | Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT2G42330 | Transmembrane kinase involved in auxin signaling. Phosphorylates T101 of TAA1 to inactive the transaminase and block auxin biosynthesis. |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42370 | hypothetical protein;(source:Araport11) |
| AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
| AT2G42440 | Lateral organ boundaries (LOB) domain family protein;(source:Araport11) |
| AT2G42450 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT2G42470 | TRAF-like family protein;(source:Araport11) |
| AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G42560 | Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress. |
| AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. The mRNA is cell-to-cell mobile. |
| AT2G42640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
| AT2G42680 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated. The mRNA is cell-to-cell mobile. |
| AT2G42730 | F-box/FBD/LRR protein;(source:Araport11) |
| AT2G42750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT2G42760 | DUF1685 family protein;(source:Araport11) |
| AT2G42835 | Natural antisense transcript overlaps with AT2G42830;(source:Araport11) |
| AT2G42840 | Encodes a putative extracellular proline-rich protein is exclusively expressed in the L1 layer of vegetative, inflorescence and floral meristems and the protoderm of organ primordia. |
| AT2G42850 | cytochrome P450, family 718;(source:Araport11) |
| AT2G42860 | hypothetical protein;(source:Araport11) |
| AT2G42880 | member of MAP Kinase |
| AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT2G42920 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT2G42930 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT2G42955 | F-box/LRR protein;(source:Araport11) |
| AT2G42960 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G42970 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT2G42980 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G42990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
| AT2G43070 | SIGNAL PEPTIDE PEPTIDASE-LIKE 3;(source:Araport11) |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
| AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT2G43160 | Involved in plant trans-Golgi network (TGN) transport. |
| AT2G43180 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G43220 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G43230 | Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA. |
| AT2G43235 | phosphoribosylformylglycinamidine synthase;(source:Araport11) |
| AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G43255 | O-acyltransferase WSD1-like protein;(source:Araport11) |
| AT2G43261 | transmembrane protein;(source:Araport11) |
| AT2G43270 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G43290 | Calmodulin-like MSS3.Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT2G43320 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G43350 | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. |
| AT2G43400 | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. |
| AT2G43410 | FPA is a gene that regulates flowering time in Arabidopsis via a pathway that is independent of daylength (the autonomous pathway). Mutations in FPA result in extremely delayed flowering. Double mutants with FCA have reduced fertility and single/double mutants have defects in siRNA mediated chromatin silencing. |
| AT2G43440 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G43480 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G43500 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT2G43535 | Encodes a defensin-like (DEFL) family protein. |
| AT2G43550 | Encodes a defensin-like (DEFL) family protein. |
| AT2G43570 | chitinase;(source:Araport11) |
| AT2G43590 | Chitinase family protein;(source:Araport11) |
| AT2G43620 | Chitinase family protein;(source:Araport11) |
| AT2G43630 | nucleusenvelope protein;(source:Araport11) |
| AT2G43680 | Member of IQ67 (CaM binding) domain containing family. |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43710 | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. Redundant Δ9 stearoyl-ACP desaturase gene which together with AAD1 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with AAD1, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT2G43720 | FAM136A-like protein (DUF842);(source:Araport11) |
| AT2G43745 | jacalin lectin-like protein;(source:Araport11) |
| AT2G43795 | corepressor;(source:Araport11) |
| AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
| AT2G43840 | UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside), benzoic acid, quercetin, and athranilate in vitro. UGT74F1 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. The true biological substrate(s) of UGT74F1 are not known, but mutant plants lacking UGT74F1 have a decreased level of salicylate glucoside. |
| AT2G43860 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43880 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
| AT2G43930 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT2G44070 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT2G44090 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G44100 | GDP dissociation inhibitor involved in vesicular membrane traffic |
| AT2G44110 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G44120 | Ribosomal protein L30/L7 family protein;(source:Araport11) |
| AT2G44170 | pseudogene of myristoyl-CoA:protein N-myristoyltransferase;(source:Araport11) |
| AT2G44175 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
| AT2G44230 | hypothetical protein (DUF946);(source:Araport11) |
| AT2G44255 | Natural antisense transcript overlaps with AT2G44260;(source:Araport11) |
| AT2G44290 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G44330 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44450 | beta glucosidase 15;(source:Araport11) |
| AT2G44480 | beta glucosidase 17;(source:Araport11) |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G44520 | cytochrome c oxidase 10;(source:Araport11) |
| AT2G44540 | glycosyl hydrolase 9B9;(source:Araport11) |
| AT2G44550 | glycosyl hydrolase 9B10;(source:Araport11) |
| AT2G44560 | glycosyl hydrolase 9B11;(source:Araport11) |
| AT2G44570 | glycosyl hydrolase 9B12;(source:Araport11) |
| AT2G44580 | zinc ion binding protein;(source:Araport11) |
| AT2G44590 | DYNAMIN-like 1D;(source:Araport11) |
| AT2G44670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT2G44710 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G44735 | transmembrane protein;(source:Araport11) |
| AT2G44740 | cyclin p4;(source:Araport11) |
| AT2G44750 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
| AT2G44780 | Encodes a Uclacyanin/Basic blue family protein [pseudogene] |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT2G44798 | Natural antisense transcript overlaps with AT2G44800;(source:Araport11) |
| AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
| AT2G44830 | AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux. |
| AT2G44880 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT2G44890 | member of CYP704A |
| AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G44990 | More Axillary Branching; carotenoid cleavage dioxygenases. |
| AT2G44995 | other_RNA;(source:Araport11) |
| AT2G45030 | Translation elongation factor EFG/EF2 protein;(source:Araport11) |
| AT2G45040 | Matrixin family protein;(source:Araport11) |
| AT2G45110 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G45120 | C2H2-like zinc finger protein;(source:Araport11) |
| AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
| AT2G45180 | nsLTP family-related gene. Expression is strongly suppressed by bacterial pathogens. Mutants are more susceptible to pathogens and abiotic stressors suggesting a function in basal stress response. |
| AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
| AT2G45290 | Transketolase;(source:Araport11) |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
| AT2G45350 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-E subfamily) with 11 pentatricopeptide (PPR) repeats. The protein is involved in RNA editing of the initiation codon of ndhD in the chloroplast. |
| AT2G45360 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
| AT2G45406 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G45410 | LOB domain-containing protein 19;(source:Araport11) |
| AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
| AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT2G45480 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development. |
| AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G45550 | Member of CYP76C family of cytochrome P450 enzymes.Has geraniol 9- or 8-hydroxylase activity. |
| AT2G45560 | cytochrome P450 monooxygenase |
| AT2G45570 | member of CYP76C |
| AT2G45580 | cytochrome P450, family 76, subfamily C, polypeptide 3;(source:Araport11) |
| AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G45620 | Nucleotidyltransferase family protein involved in transcript polyadenylation. TUTase which connects decapping activators and prevents the accumulation of excessively deadenylated mRNAs to avoid siRNA biogenesis. |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680;(source:Araport11) |
| AT2G45700 | sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
| AT2G45900 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT2G45920 | U-box domain-containing protein;(source:Araport11) |
| AT2G45940 | hypothetical protein (DUF295);(source:Araport11) |
| AT2G45960 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. Involved redundantly with PIP1;1/3/4/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT2G46030 | Ubiquitin conjugating enzyme E2 |
| AT2G46140 | Late embryogenesis abundant protein;(source:Araport11) |
| AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT2G46180 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein. |
| AT2G46280 | Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT2G46308 | transmembrane protein;(source:Araport11) |
| AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT2G46420 | helicase with zinc finger protein;(source:Araport11) |
| AT2G46450 | Member of Cyclic nucleotide gated channel family.Positive regulator of resistance against avirulent fungal pathogen.Suppresses the phenotype conferred by cpr22 in a dosage-dependent manner. |
| AT2G46455 | OxaA/YidC-like membrane insertion protein;(source:Araport11) |
| AT2G46480 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT2G46493 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46494 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46495 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46500 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. Phosphorylates PUFD1 and RPN10 in vitro. |
| AT2G46510 | Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses. |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT2G46600 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G46610 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT2G46630 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT2G46650 | member of Cytochromes b5 The mRNA is cell-to-cell mobile. |
| AT2G46660 | Encodes a member of CYP78A cytochrome P450 monooxygenase protein family that is required in the sporophytic tissue of the mother plant to promote seed growth. |
| AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
| AT2G46690 | Regulates ABA-mediated responses to drought stress. |
| AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT2G46740 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT2G46760 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
| AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G46850 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G46860 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11) |
| AT2G46960 | member of CYP709B |
| AT2G46970 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT2G46995 | hypothetical protein;(source:Araport11) |
| AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
| AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11) |
| AT2G47070 | member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA. |
| AT2G47090 | zinc ion binding/nucleic acid binding protein;(source:Araport11) |
| AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
| AT2G47200 | hypothetical protein;(source:Araport11) |
| AT2G47210 | myb-like transcription factor family protein;(source:Araport11) |
| AT2G47240 | Encodes an acyl-CoA synthetase that acts on long-chain and very-long-chain fatty acids, involved in cuticular wax and cutin biosynthesis The mRNA is cell-to-cell mobile. |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression. |
| AT2G47300 | Encodes a protein involved in rRNA but not tRNA maturation. |
| AT2G47330 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G47360 | transmembrane protein;(source:Araport11) |
| AT2G47420 | Encodes a putative rRNA dimethyltransferase. |
| AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
| AT2G47450 | A component of the chloroplast signal recognition particle pathway that is involved in LHCP targeting. It is downregulated in response to high light. It recognizes the DPLG motif in Lhcb1. The mRNA is cell-to-cell mobile. |
| AT2G47470 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. The mRNA is cell-to-cell mobile. |
| AT2G47520 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. It plays a role in hypoxia-induced root slanting. |
| AT2G47550 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G47560 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47570 | 60S ribosomal protein L18;(source:Araport11) |
| AT2G47580 | encodes spliceosomal protein U1A |
| AT2G47585 | Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA. The miR164a pri-mRNA also encodes a regulatory peptide miPEP164a (AT2G47584) that regulates accumulation of its own miRNA. |
| AT2G47590 | photolyase/blue light photoreceptor PHR2 (PHR2) mRNA, |
| AT2G47720 | hypothetical protein;(source:Araport11) |
| AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT2G47870 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT2G47890 | Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T |
| AT2G47895 | Natural antisense transcript overlaps with AT2G47900;(source:Araport11) |
| AT2G47920 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT2G48020 | Encodes a zinc transporter ZIF2. Expression of ZIF2 is regulated by alternative splicing. |
| AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
| AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
| AT2G48090 | hypothetical protein;(source:Araport11) |
| AT2G48120 | The pale cress (pac) mutant affects chloroplast and leaf development; mutants are ABA-deficient and accumulate lower levels of carotenoids and chlorophyll compared to wild type. PAC binds 23srRNA and appears to be required for 50s ribosome assembly. Three alternative transcripts of this gene exist.PAC is essential for photoautotrophic growth and associates with psbK-psbI, ndhF, ndhD, and 23S ribosomal RNA in vivo(PMID:28805278) |
| AT3G01020 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
| AT3G01030 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G01040 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G01050 | membrane-anchored ubiquitin-fold protein 1 precursor;(source:Araport11) |
| AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G01130 | ATP synthase E chain;(source:Araport11) |
| AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G01200 | Encodes a PPDK regulatory protein that has protein kinase activity but lacks protein phosphatase activity towards PPDK (pyruvate orthophosphate dikinase). |
| AT3G01240 | splicing regulatory glutamine/lysine-rich-like protein;(source:Araport11) |
| AT3G01260 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT3G01270 | Pectate lyase family protein;(source:Araport11) |
| AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT3G01300 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G01310 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion, producing the InsP8 cofactor of the ASK1-COI1-JAZ-jasmonate co-receptor complex. It is the major isoform in plants, is required for jasmonate-dependent defenses, and plays an important role in plant defenses against necrotrophic fungi and insect herbivores. |
| AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT3G01322 | Encodes a ECA1 gametogenesis related family protein |
| AT3G01360 | plant viral-response family protein (DUF716);(source:Araport11) |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
| AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
| AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
| AT3G01513 | hypothetical protein;(source:Araport11) |
| AT3G01520 | Encodes a universal stress protein (USP)-like protein that has been crystallized in complex with AMP, suggesting that it belongs to the ATP-binding USP subfamily. The mRNA is cell-to-cell mobile. |
| AT3G01540 | RNA HELICASE DRH1 |
| AT3G01600 | NAC domain containing protein 44;(source:Araport11) |
| AT3G01660 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G01670 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G01710 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT3G01750 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G01760 | Encodes an amino acid transporter expressed in the root that is involved in the uptake of acidic amino acids, glutamine and alanine, and probably phenylalanine. |
| AT3G01820 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
| AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G01870 | hypothetical protein (DUF946);(source:Araport11) |
| AT3G01880 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT3G01890 | Encodes SWP73A, a subunit of the SWI/SNF chromatin remodeling complex. While undergoing normal vegetative development, swp73a mutants display reduced expression of FLOWERING LOCUS C and early flowering in short days. |
| AT3G01900 | member of CYP94B |
| AT3G01950 | peroxidase (DUF 3339);(source:Araport11) |
| AT3G02010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G02020 | encodes a monofunctional aspartate kinase |
| AT3G02060 | DEAD/DEAH box helicase;(source:Araport11) |
| AT3G02100 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G02110 | serine carboxypeptidase-like 25;(source:Araport11) |
| AT3G02125 | pinin-like protein;(source:Araport11) |
| AT3G02130 | Encodes a receptor-like kinase RPK2 (also known as TOADSTOOL 2/TOAD2). Functions as a regulator of meristem maintenance. Mutants are insensitive to synthetic CLV3 peptide. Mutations in the RPK2 also result in stem cell expansion and increased number of floral organs, as seen in the other clv mutants. Forms homo-oligomers. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G02170 | Encodes LONGIFOLIA2 (LNG2). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG2 homologue LNG1 (At5g15580) has similar function. |
| AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT3G02250 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G02260 | Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance. |
| AT3G02280 | Flavoenzyme-encoding gene. |
| AT3G02290 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G02300 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G02360 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT3G02370 | tRNA-splicing endonuclease subunit;(source:Araport11) |
| AT3G02410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G02440 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G02450 | Proteolytically inactive member of the FtsH (filamentation-temperature-sensitive protein H) protease family due to mutations in the protease domain. |
| AT3G02470 | Encodes a S-adenosylmethionine decarboxylase involved in polyamine biosynthesis. |
| AT3G02480 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G02500 | mental retardation GTPase activating protein;(source:Araport11) |
| AT3G02510 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G02520 | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). |
| AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT3G02560 | Ribosomal protein S7e family protein;(source:Araport11) |
| AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
| AT3G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G02670 | Glycine-rich protein family;(source:Araport11) |
| AT3G02800 | Encodes an atypical dual-specificity phosphatase. |
| AT3G02810 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
| AT3G02830 | Encodes a zinc finger protein that binds to PORA mRNA in vivo and recruits the Pfr form of phytochrome to the 5′-UTR of PORA mRNA to regulate translation of the mRNA. |
| AT3G02840 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G02850 | Encodes SKOR, a member of Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mediates the delivery of K+ from stelar cells to the xylem in the roots towards the shoot. mRNA accumulation is modulated by abscisic acid. K+ gating activity is modulated by external and internal K+. Involved in response to low potassium. |
| AT3G02900 | Low-density receptor-like protein;(source:Araport11) |
| AT3G02920 | Replication protein A, subunit RPA32;(source:Araport11) |
| AT3G02970 | EXORDIUM like 6;(source:Araport11) |
| AT3G02980 | Encodes MEIOTIC CONTROL OF CROSSOVERS1 (MCC1), a GCN5-related histone N-acetyltransferase. MCC1 appeared to be required in meiosis for normal chiasma number and distribution and for chromosome segregation. Activation tagging line has increased level of histone H3 acetylation. |
| AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
| AT3G03060 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G03070 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
| AT3G03080 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
| AT3G03240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT3G03260 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
| AT3G03280 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT3G03320 | RNA-binding ASCH domain protein;(source:Araport11) |
| AT3G03330 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G03370 | hypothetical protein;(source:Araport11) |
| AT3G03405 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G03450 | Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development. |
| AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
| AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G03530 | PHOSPHOESTERASE FAMILY PROTEIN, NPC4 is significantly induced upon phosphate starvation and plays an important role in the supply of inorganic phosphate and diacylglycerol from membrane-phospholipids during phosphate deprivation.Has a preference for glycosylinositolphosphorylceramide (GIPC) as a substrate. |
| AT3G03570 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
| AT3G03580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G03650 | Exostosin family protein;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT3G03760 | LOB domain-containing protein 20;(source:Araport11) |
| AT3G03770 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G03800 | member of SYP13 Gene Family |
| AT3G03810 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G03820 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03826 | transmembrane protein;(source:Araport11) |
| AT3G03830 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03850 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G03870 | transmembrane protein;(source:Araport11) |
| AT3G03880 | sterol O-acyltransferase, putative (DUF1639);(source:Araport11) |
| AT3G03890 | Dimeric β-barrel protein that is structurally related to the putative non-canonical heme oxygenase (HO) and is located in chloroplasts. May function additionally in the tetrapyrrole biosynthetic pathway. |
| AT3G03910 | GDH3 encodes a member of the glutamate dehydrogenease family. Its expression is upregulated in response to cytokinin and it may play a role in the control of nitrogen metabolism in leaf development. |
| AT3G03920 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
| AT3G03930 | kinase-like protein;(source:Araport11) |
| AT3G03970 | At3G03970 encodes the plant KASH protein SINE2; SINE2 interacts with SUN1 and SUN2 and is localized at the nuclear envelope. |
| AT3G04030 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G04050 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
| AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT3G04120 | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS. The mRNA is cell-to-cell mobile. |
| AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G04150 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04170 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04200 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04220 | Target of miR825/825. Mutants have decreased resistance to fungal pathogens. |
| AT3G04240 | Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene. |
| AT3G04270 | two-component response regulator ARR22-like protein;(source:Araport11) |
| AT3G04280 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family. ARR22 is more similar to the receiver domains of hybrid kinases than other response regulators. It acts as a phosphohistidine phosphatase when tested with phospho-AHP5 in vitro suggesting that it might be involved in a two-component phosphorelay. Expression of ARR22 transcripts appears to be localized to the chalaza and to be induced by wounding. Ectopic expression of ARR in other parts of the plant leads to reduced cytokinin-related responses and impaired root, shoot, and flower development. Overexpression of wild-type ARR22 in an arr22 mutant background causes variable defects in plant growth and fertility. But, in the same ar22 background, over-expression of versions of ARR22 that should act as dominant-negative or constitutively active proteins, based on mutations to the conserved Asp residue, do not show any phenotypic abnormalities, raising the possibility that these may not act as canonical response regulators. |
| AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
| AT3G04340 | Functions in maintaining the cellular redox balance and regulates photorespiratory metabolism.Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
| AT3G04360 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT3G04430 | NAC domain containing protein 49;(source:Araport11) |
| AT3G04440 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT3G04470 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G04490 | Ran effector. XPO4 coordinates the nuclear accumulation of TOPLESS and TOPLESS-Related transcription corepressors, which plays a role in regulating salicylic acid-mediated defense feedback and modulating the strength of immunity induced by cpr5, a nucleoporin mutant. |
| AT3G04510 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT3G04520 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Expressed in vascular tissue through out the plant. |
| AT3G04540 | Encodes a defensin-like (DEFL) family protein. |
| AT3G04550 | Encodes an ancillary chaperone protein that functions in Rubisco biogenesis. RAF1 dimers function in the assembly of the large subunit of Rubisco. Co-expression of RAF1 and rbcL in tobacco cells results in increased photosynthesis and plant growth. The mRNA is cell-to-cell mobile. |
| AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
| AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT3G04610 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G04650 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G04660 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT3G04690 | Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip. |
| AT3G04715 | Based on qRT-PCR data, this annotated pseudogene is expressed and upregulated in response to infection with the yellow strain of Cucumber mosaic virus in C24 and Col-0. Exhibited higher levels of H3K27me3; H3K27me3 was significantly decreased (fourfold) in response to infection with CMV(Y). |
| AT3G04730 | early auxin-induced (IAA16) |
| AT3G04750 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G04770 | 40s ribosomal protein SA B;(source:Araport11) |
| AT3G04840 | Ribosomal protein S3Ae;(source:Araport11) |
| AT3G04890 | adenine phosphoribosyltransferase-like protein, putative (DUF2358);(source:Araport11) |
| AT3G04900 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G04940 | Encodes cysteine synthase CysD1. |
| AT3G04960 | trichohyalin, putative (DUF3444);(source:Araport11) |
| AT3G04970 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G04980 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT3G05060 | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein |
| AT3G05110 | early endosome antigen-like protein, putative (DUF3444);(source:Araport11) |
| AT3G05130 | paramyosin-like protein;(source:Araport11) |
| AT3G05140 | ROP binding protein kinases 2;(source:Araport11) |
| AT3G05155 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05160 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05170 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G05260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT3G05327 | Cyclin family protein;(source:Araport11) |
| AT3G05340 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
| AT3G05440 | C2 domain-containing protein;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT3G05470 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT3G05480 | Involved in the regulation of DNA damage repair and homologous recombination. |
| AT3G05540 | Encodes TCTP2, a homolog of Translationally Controlled Tumor Protein. Enhances in vitro plant regeneration. |
| AT3G05570 | dipeptide transport ATP-binding protein;(source:Araport11) |
| AT3G05600 | Encodes a cytosolic epoxide hydrolase capable of acting on 9,10-epoxystearic acid and on 12,13- epoxyoctadec-9-enoic acid that is involved in the synthesis of poly-hydroxylated cutin monomers. |
| AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT3G05650 | receptor like protein 32;(source:Araport11) |
| AT3G05680 | Encodes a splicing/methylation factor that is a homologue to the mammalian VIRILIZER, is member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. Analysis of transcriptional profiles of the vir-1 mutant suggests that VIR is likely involved in regulation of gene expression, but the function of VIR is rather general than specific and knock-down of VIR does not affect overall splicing rates. |
| AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT3G05700 | Encodes a DNA binding protein with transcription activation activity. It is expressed in response to osmotic, drought and ABA stress. |
| AT3G05720 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT3G05741 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G05746 | hypothetical protein;(source:Araport11) |
| AT3G05770 | hypothetical protein;(source:Araport11) |
| AT3G05780 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT3G05858 | hypothetical protein;(source:Araport11) |
| AT3G05937 | hypothetical protein;(source:Araport11) |
| AT3G05950 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
| AT3G06050 | Encodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions. |
| AT3G06070 | hypothetical protein;(source:Araport11) |
| AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G06090 | homolog of prePIP1 |
| AT3G06170 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G06230 | member of MAP Kinase Kinase |
| AT3G06240 | F-box family protein;(source:Araport11) |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G06320 | Ribosomal protein L33 family protein;(source:Araport11) |
| AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
| AT3G06370 | member of Sodium proton exchanger family |
| AT3G06380 | Member of plant TLP family which differs in having an F box domain. Interacts with ASK proteins.Plasma membrane tethering is mediated by PIP2 binding domain. Mutants are insensitive to ABA. May act redundantly with its paralog TPL3. |
| AT3G06390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G06420 | Autophagy protein. |
| AT3G06450 | HCO3- transporter family;(source:Araport11) |
| AT3G06460 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1 |
| AT3G06470 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1. Together with AtCb5-B interacts with KCR1, PAS2, and CER10, which are essential for the synthesis of VLCFAs. |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT3G06510 | Encodes a protein with beta-glucosidase and galactosyltransferase activity, mutants show increased sensitivity to freezing. Though it is classified as a family I glycosyl hydrolase, it has no hydrolase activity in vitro. |
| AT3G06520 | agenet domain-containing protein;(source:Araport11) |
| AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT3G06640 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT3G06720 | Encodes importin alpha involved in nuclear import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT3G06780 | glycine-rich protein;(source:Araport11) |
| AT3G06790 | Encodes a protein involved in RNA editing in mitochondria. Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G06920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G07000 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G07025 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT3G07030 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT3G07070 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G07120 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G07150 | amino acid-ligase;(source:Araport11) |
| AT3G07195 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT3G07273 | hypothetical protein;(source:Araport11) |
| AT3G07310 | phosphoserine aminotransferase, putative (DUF760);(source:Araport11) |
| AT3G07320 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G07420 | Encodes an asparaginyl-tRNA synthetase. |
| AT3G07430 | YLMG is located in thylakoid membranes. It is involved in chloroplast division and more specifically the proper distribution of nucleoids. The function is conserved between cyanobacteria and chloroplasts.The mRNA is cell-to-cell mobile. |
| AT3G07450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G07470 | DUF538 protein |
| AT3G07490 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT3G07500 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. |
| AT3G07565 | histone H2A deubiquitinase (DUF3755);(source:Araport11) |
| AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT3G07710 | hypothetical protein;(source:Araport11) |
| AT3G07760 | Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. However in Arabidopsis no morphological branching defect has been observed in mutant lines. |
| AT3G07820 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G07830 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G07840 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G07850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G07870 | FBX92 is an F-box containing protein. Overexpression produces plants with smaller leaves while reduced expression is correlated with increased leaf size and increased rates of cell proliferation. |
| AT3G07890 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G07910 | reactive oxygen species modulator-like protein;(source:Araport11) |
| AT3G07940 | Calcium-dependent ARF-type GTPase activating protein family;(source:Araport11) |
| AT3G07960 | Encodes phosphatidylinositol-4-phosphate 5-kinase 6 (PIP5K6). Regulates clathrin-dependent endocytosis in pollen tubes. |
| AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
| AT3G07980 | MAP3K epsilon protein kinase 2 is functionally redundant with MAP3Ke1. Required for pollen development but not essential. |
| AT3G07990 | serine carboxypeptidase-like 27;(source:Araport11) |
| AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
| AT3G08490 | delta-latroinsectotoxin-Lt1a protein;(source:Araport11) |
| AT3G08500 | Encodes a putative R2R3-type MYB transcription factor (MYB83). |
| AT3G08560 | vacuolar H+-ATPase subunit E isoform 2;(source:Araport11) |
| AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT3G08600 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT3G08630 | alphavirus core family protein (DUF3411);(source:Araport11) |
| AT3G08640 | alphavirus core family protein (DUF3411);(source:Araport11) |
| AT3G08680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT3G08740 | elongation factor P (EF-P) family protein;(source:Araport11) |
| AT3G08780 | BRISC complex subunit Abro1-like protein;(source:Araport11) |
| AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
| AT3G08860 | Encodes a protein that is predicted to have beta-alanine aminotransferase activity. |
| AT3G08870 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
| AT3G08940 | Lhcb4.2 protein (Lhcb4.2, protein involved in the light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT3G08943 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G08950 | Encodes HCC1, homologue of the copper chaperone SCO1 (synthesis of cytochrome c oxidase 1) from the yeast Saccharomyces cerevisiae. SCO1 encodes a mitochondrial protein that is essential for the correct assembly of complex IV in the respiratory chain. HCC1 is localized in the mitochondrion. A chimeric yeast Sco1-Arabidopsis HCC1 protein complements yeast Sco1 activity. Embryos of hcc1 mutants became arrested at various developmental stages, mostly at the heart stage. |
| AT3G08960 | Ran effector. |
| AT3G08990 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT3G09020 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT3G09040 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G09050 | 8-amino-7-oxononanoate synthase;(source:Araport11) |
| AT3G09100 | mRNA capping enzyme family protein;(source:Araport11) |
| AT3G09110 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G09130 | hypothetical protein;(source:Araport11) |
| AT3G09160 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G09180 | Mediator complex subunit. |
| AT3G09210 | plastid transcriptionally active 13;(source:Araport11) |
| AT3G09220 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
| AT3G09300 | OSBP(oxysterol binding protein)-related protein 3B;(source:Araport11) |
| AT3G09320 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G09330 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G09340 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT3G09405 | Pectinacetylesterase family protein;(source:Araport11) |
| AT3G09430 | peptide transporter family protein;(source:Araport11) |
| AT3G09440 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT3G09510 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G09520 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G09560 | The PAH1 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
| AT3G09570 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT3G09620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G09630 | Ribosomal protein L4/L1 family;(source:Araport11) |
| AT3G09660 | Encodes a minichromosome maintenance protein that is involved with RAD51 in a backup pathway that repairs meiotic double strand breaks without giving meiotic crossovers when the major pathway, which relies on DMC1, fails. |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT3G09790 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. |
| AT3G09810 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase |
| AT3G09820 | Involved in the salvage synthesis of adenylates and methyl recycling |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT3G09850 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT3G09870 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G09880 | Encodes B' regulatory subunit of PP2A (AtB'beta). Functions redundantly with the alpha subunit do maintain sister chromatid cohesion during meiosis. |
| AT3G09900 | RAB GTPase homolog E1E;(source:Araport11) |
| AT3G09915 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
| AT3G09930 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT3G09960 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT3G10000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
| AT3G10030 | aspartate/glutamate/uridylate kinase family protein;(source:Araport11) |
| AT3G10060 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT3G10116 | COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family;(source:Araport11) |
| AT3G10120 | PADRE protein down-regulated after infection by S. sclerotiorum. |
| AT3G10130 | Cholorplast plastoglobule localized heme binding protein. |
| AT3G10185 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
| AT3G10240 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G10290 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
| AT3G10340 | Encodes PAL4, a putative a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT3G10350 | One of 3 GET paralogs in Arabidopsis. GET3b is a chloroplast localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
| AT3G10370 | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion. |
| AT3G10380 | Subunit of the Putative Arabidopsis Exocyst Complex |
| AT3G10405 | vacuolar acid trehalase;(source:Araport11) |
| AT3G10450 | serine carboxypeptidase-like 7;(source:Araport11) |
| AT3G10470 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
| AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
| AT3G10520 | Encodes a class 2 non-symbiotic hemoglobin. Over-expression of AHb2 in seeds led to a 40% increase in the total fatty acid content of developing and mature seeds in three subsequent generations. This was mainly due to an increase in the poly-unsaturated C18:2 (omega-6) linoleic and C18:3 (omega-3) alpha-linolenic acids. |
| AT3G10540 | master regulator of AGC kinases |
| AT3G10585 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G10650 | Encodes a nucleoporin involved in mRNA export from the nucleus. It is also involved in the regulation of nuclear morphology. |
| AT3G10670 | Plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Involved in the biogenesis and/or repair of oxidatively damaged Fe?S clusters. Expressed in embryos and meristems. |
| AT3G10680 | SLI1 is a heat shock like protein that is found in sieve elements, sieve plates and spherical bodies peripheral to the mitochondria. Mutants show increased phloem feeding by aphids and decreased heat tolerance. |
| AT3G10690 | Encodes a protein that when expressed together with GYRB2 generates an active supercoiling DNA gyrase enzyme that shares similar properties to its bacterial counterpart, including sensitivity to gyrase-specific antibiotics. |
| AT3G10710 | root hair specific 12;(source:Araport11) |
| AT3G10720 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G10770 | Single-stranded nucleic acid binding R3H protein;(source:Araport11) |
| AT3G10820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT3G10840 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G10845 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
| AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G10930 | Encodes a small secreted signaling peptide that processed both N- and C-terminally after translation and is rapidly induced in response to ROS and flg22-induced stress and may act as a negative modulator of stress-induced ROS signalling. |
| AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G10990 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G11020 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A. |
| AT3G11050 | ferritin 2;(source:Araport11) |
| AT3G11130 | CHC1 heavy chain subunit of clathrin. Involved in vesicle mediated trafficking. Mutants show reduced rates of endocytosis and defects clathrin mediated exocytosis. Mutants also have increased dehydration tolerance which may be related to the overall slower stomatal aperture dynamics. Overall growth is affected. |
| AT3G11210 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT3G11270 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
| AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT3G11300 | hypothetical protein;(source:Araport11) |
| AT3G11310 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT3G11350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G11370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G11380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G11385 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G11390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
| AT3G11402 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G11405 | hypothetical protein;(source:Araport11) |
| AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
| AT3G11415 | other_RNA;(source:Araport11) |
| AT3G11430 | sn-glycerol-3-phosphate 2-O-acyltransferas, involved in the biosynthesis of suberin polyester. |
| AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
| AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT3G11510 | Ribosomal protein S11 family protein;(source:Araport11) |
| AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT3G11600 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations. |
| AT3G11640 | transmembrane protein;(source:Araport11) |
| AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
| AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G11720 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G11773 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT3G11960 | Cleavage and polyadenylation specificity factor (CPSF) A subunit protein;(source:Araport11) |
| AT3G12090 | TET6 encodes a member of the TETRASPANIN gene family that is expressed in the vascular system and is involved in organ growth redundantly with TET5. |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT3G12200 | Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT3G12210 | DNA binding protein;(source:Araport11) |
| AT3G12220 | serine carboxypeptidase-like 16;(source:Araport11) |
| AT3G12260 | LYR family of Fe/S cluster biogenesis protein;(source:Araport11) |
| AT3G12360 | Encodes a protein with an ankyrin motif and transmembrane domains that is involved in salt tolerance. Expressed throughout the plant and localized to the plasma membrane. Loss of function mutations show an increased tolerance to salt based on assaying seedling growth in the presence of salt. In the mutants, induction of genes required for production of reactive oxygen species is reduced suggesting that itn1 promotes ROS production. It interacts with RCN1 in vivo and may regulate its subcellular localization. The mRNA is cell-to-cell mobile. |
| AT3G12410 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G12540 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G12550 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
| AT3G12560 | Encodes a telomeric DNA-binding protein. |
| AT3G12585 | pre-tRNA tRNA-Arg (anticodon: CCG);(source:Araport11, TAIR10) |
| AT3G12587 | Oligosaccaryltransferase;(source:Araport11) |
| AT3G12600 | nudix hydrolase homolog 16;(source:Araport11) |
| AT3G12670 | Cytidine triphosphate synthase; essential for CTP supply in developing embryos. |
| AT3G12690 | Encodes a putative serine/threonine kinase It is expressed specifically in pollen and appears to function redundantly with AGC1.7 to regulate polarized growth of pollen tubes. |
| AT3G12700 | Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression. |
| AT3G12710 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT3G12720 | Member of the R2R3 factor gene family. |
| AT3G12770 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
| AT3G12775 | ubiquitin-conjugating enzyme family protein;(source:Araport11) |
| AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
| AT3G12870 | transmembrane protein;(source:Araport11) |
| AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
| AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
| AT3G12930 | Encodes a novel conserved chloroplast protein that interacts with components of the PEP complex. Mutants show delayed greening and reduced photosynthetic capcity. |
| AT3G12955 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G12960 | seed maturation protein;(source:Araport11) |
| AT3G12980 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14. The mRNA is cell-to-cell mobile. |
| AT3G12981 | pseudogene of F-box family protein |
| AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
| AT3G13061 | Natural antisense transcript overlaps with AT3G13060;(source:Araport11) |
| AT3G13065 | STRUBBELIG-receptor family 4;(source:Araport11) |
| AT3G13080 | encodes an ATP-dependent MRP-like ABC transporter able to transport glutathione-conjugates as well as chlorophyll catabolites. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT3G13090 | member of MRP subfamily |
| AT3G13100 | member of MRP subfamily |
| AT3G13130 | transmembrane protein;(source:Araport11) |
| AT3G13175 | transmembrane protein;(source:Araport11) |
| AT3G13220 | Encodes a ATP-binding cassette transporter G26 (ABCG26) involved in tapetal cell and pollen development. Required for male fertility and pollen exine formation. |
| AT3G13227 | serine-rich protein-like protein;(source:Araport11) |
| AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G13229 | kinesin-like protein (DUF868);(source:Araport11) |
| AT3G13235 | ubiquitin family protein;(source:Araport11) |
| AT3G13275 | transmembrane protein;(source:Araport11) |
| AT3G13277 | other_RNA;(source:Araport11) |
| AT3G13280 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT3G13290 | varicose-like protein;(source:Araport11) |
| AT3G13300 | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G13320 | low affinity calcium antiporter CAX2 The mRNA is cell-to-cell mobile. |
| AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
| AT3G13370 | formin-like protein;(source:Araport11) |
| AT3G13380 | Similar to BRI, brassinosteroid receptor protein. |
| AT3G13390 | SKU5 similar 11;(source:Araport11) |
| AT3G13400 | SKU5 similar 13;(source:Araport11) |
| AT3G13403 | Encodes a defensin-like (DEFL) family protein. |
| AT3G13432 | transmembrane protein;(source:Araport11) |
| AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
| AT3G13480 | nuclear polyadenylated RNA-binding protein;(source:Araport11) |
| AT3G13500 | hypothetical protein;(source:Araport11) |
| AT3G13525 | snoRNA;(source:Araport11) |
| AT3G13530 | MAP3K epsilon protein kinase 1 is functionally redundant with MAP3Ke2. Required for pollen development but not essential. map3ke1;map3ke2 double-mutant pollen grains develop plasma membrane irregularities following pollen mitosis I. Localized primarily in the plasma membrane. Expressed in leaf trichomes, root columella cells and developing ovules. |
| AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G13600 | calmodulin-binding family protein;(source:Araport11) |
| AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT3G13630 | hypothetical protein;(source:Araport11) |
| AT3G13680 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT3G13730 | Encodes a cytochrome P-450 gene that is involved in brassinosteroid biosynthesis, most likely in the conversion step of teasterone (TE) to 3-dehydroteasterone (3DT), and/or 6-deoxoteasterone (6-deoxoTE) to 6-deoxo-3-dehydroteasterone (6-deoxo3DT); or the conversion of cathasterone (CT) to TE, and/or 6-deoxocathasterone (6-deoxoCT) to 6-deoxoTE. Recently, CYP90D1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). Member of the CYP90C CYP450 family. Similar to Cytochrome P450 90C1 (ROT3). |
| AT3G13782 | Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT3G13784 | cell wall invertase 5;(source:Araport11) |
| AT3G13790 | Encodes a protein with invertase activity. |
| AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT3G13820 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G13840 | GRAS family transcription factor;(source:Araport11) |
| AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
| AT3G13882 | Ribosomal protein L34;(source:Araport11) |
| AT3G13900 | Encodes a member of the P4 subfamily of P-type ATPases expressed in the pollen plasma membrane. Double mutants with ALA6 display pollen and pollen tube defects. |
| AT3G13910 | hypothetical protein (DUF3511);(source:Araport11) |
| AT3G13950 | ankyrin;(source:Araport11) |
| AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
| AT3G14020 | nuclear factor Y, subunit A6;(source:Araport11) |
| AT3G14040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G14060 | hypothetical protein;(source:Araport11) |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT3G14100 | Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes. |
| AT3G14120 | nuclear pore complex protein;(source:Araport11) |
| AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G14150 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G14170 | CORD1 is a member of a novel and plant specific family of microtubule associated proteins. CORD1 binds microtubules via a conserved protein domain shared among family members. CORD functions may overlap;cord1 / cord2 mutants have defects in secondary cell wall pit morphology. |
| AT3G14172 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT3G14190 | Encodes a 193 amino acid protein of unknown function. Contains a DEN-box (aa 14?16), a KEN-box, and the D-box (aa 46?54)and a third, unknown domain (aa 81?97). Loss of function alleles are defective in meiosis and have reduced fertility. pans1 mutants show premature loss of cohesion of sister chromatids during meioisis I and meiosis II resulting in abnormal chromosome segregation and unbalanced tetrads. |
| AT3G14200 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G14210 | A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni. |
| AT3G14225 | Contains lipase signature motif and GDSL domain. |
| AT3G14230 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT3G14240 | Subtilase family protein;(source:Araport11) |
| AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G14260 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT3G14300 | pectinesterase family protein;(source:Araport11) |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
| AT3G14362 | ROTUNDIFOLIA like 10;(source:Araport11) |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G14385 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAGCCAAGGAUGACUUGCCG. Pri-mRNA coordinates for MIR169f (converted to TAIR10 based on PMID19304749): Chr3: 4805948-4805214 (reverse), length: 735 bp; exon coordinates: exon 1: 4805948 to 4805214; mature miRNA and miRNA* are located on exon 1. |
| AT3G14395 | Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones. |
| AT3G14400 | Encodes a ubiquitin-specific protease. |
| AT3G14415 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
| AT3G14420 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
| AT3G14452 | transmembrane protein;(source:Araport11) |
| AT3G14480 | glycine/proline-rich protein;(source:Araport11) |
| AT3G14515 | pseudogene of Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G14517 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-38 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G14520 | Encodes a sesterterpene synthase responsible for the biosynthesis of the tricyclic sesterterpene (+)-thalianatriene with a 11-6-5 fused ring system. |
| AT3G14560 | Its transcript is targeted by miR824. |
| AT3G14580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G14590 | Ca2+-dependent lipid-binding protein |
| AT3G14630 | putative cytochrome P450 |
| AT3G14690 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G14700 | SART-1 family;(source:Araport11) |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT3G14720 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
| AT3G14760 | transmembrane protein;(source:Araport11) |
| AT3G14780 | callose synthase;(source:Araport11) |
| AT3G14800 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.1e-83 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT3G14810 | mechanosensitive channel of small conductance-like 5;(source:Araport11) |
| AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G14855 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT3G14940 | Encodes a cytosolic phosphoenolpyruvate carboxylase (PEPC) that has activity when expressed in E.coli. Its mRNA is most abundantly expressed in roots and siliques. PPC3 belongs to the plant-type PEPC family. It can form an enzymatically active complex with a castor bean ortholog of PPC4, which encodes a bacterial-type PEPC. The mRNA is cell-to-cell mobile. |
| AT3G14960 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G14970 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
| AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT3G15050 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G15060 | RAB GTPase homolog A1G;(source:Araport11) |
| AT3G15110 | transmembrane protein;(source:Araport11) |
| AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT3G15130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G15180 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. The mRNA is cell-to-cell mobile. |
| AT3G15220 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G15240 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT3G15270 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
| AT3G15280 | hypothetical protein;(source:Araport11) |
| AT3G15300 | VQ motif-containing protein;(source:Araport11) |
| AT3G15310 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32621.1);(source:TAIR10) |
| AT3G15330 | pseudogene of the NLI interacting factor (NIF) protein family |
| AT3G15340 | Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. |
| AT3G15350 | G14 enzyme |
| AT3G15370 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G15430 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G15440 | RING/U-box protein;(source:Araport11) |
| AT3G15460 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
| AT3G15480 | fiber (DUF1218);(source:Araport11) |
| AT3G15490 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT3G15518 | hypothetical protein;(source:Araport11) |
| AT3G15536 | Unknown gene The mRNA is cell-to-cell mobile. |
| AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
| AT3G15570 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G15604 | hypothetical protein;(source:Araport11) |
| AT3G15690 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G15720 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G15730 | Encodes phospholipase D alpha 1 (PLD alpha 1). Positive regulator of abscisic acid (ABA) mediated stomatal movements. PLD alpha 1 plays an important role in seed deterioration and aging in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT3G15770 | hypothetical protein;(source:Araport11) |
| AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
| AT3G15830 | phosphatidic acid phosphatase-related / PAP2-like protein;(source:Araport11) |
| AT3G15840 | Encodes a chloroplast-targeted protein localized in the stroma that is a novel component essential for NDH-mediated non-photochemical reduction of the plastoquinone pool in chlororespiratory electron transport. |
| AT3G15860 | plant self-incompatibility protein S1 family protein;(source:Araport11) |
| AT3G15870 | Fatty acid desaturase family protein;(source:Araport11) |
| AT3G15935 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G15940 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G15950 | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
| AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
| AT3G15990 | Vascular cambium-localized sulfate transporter, mediates xylem-to-phloem transfer of phosphorus. 2 for its preferential distribution |
| AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
| AT3G16100 | RAB GTPase homolog G3C;(source:Araport11) |
| AT3G16130 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT3G16200 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT3G16210 | F-box family protein;(source:Araport11) |
| AT3G16220 | Putative eukaryotic LigT;(source:Araport11) |
| AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G16320 | Subunit in the anaphase-promoting complex. Role in gametogenesis, control of mitotic progression and cell differentiation during the entire life cycle. |
| AT3G16330 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT3G16370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT3G16415 | pseudogene of myrosinase-binding protein 2;(source:Araport11) |
| AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. The mRNA is cell-to-cell mobile. |
| AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
| AT3G16440 | myrosinase-binding protein-like protein (AtMLP-300B) mRNA, |
| AT3G16460 | Mannose-binding protein |
| AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G16550 | Encodes a putative DegP protease. |
| AT3G16555 | F-box and associated interaction domains-containing protein;(source:Araport11).SON1 paralog. |
| AT3G16560 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT3G16600 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
| AT3G16620 | component of TOC complex, plastid protein import machinery. |
| AT3G16650 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
| AT3G16770 | Encodes a member of the ERF (ethylene response factor) subfamily B-2 of the plant specific ERF/AP2 transcription factor family (RAP2.3). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.It is localized to the nucleus and acts as a transcriptional activator through the GCC-box. It has been identified as a suppressor of Bax-induced cell death by functional screening in yeast and can also suppress Bax-induced cell death in tobacco plants. Overexpression of this gene in tobacco BY-2 cells confers resistance to H2O2 and heat stresses. Overexpression in Arabidopsis causes upregulation of PDF1.2 and GST6. It is part of the ethylene signaling pathway and is predicted to act downstream of EIN2 and CTR1, but not under EIN3. The mRNA is cell-to-cell mobile. |
| AT3G16800 | EGR3 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress, EGR3 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT3G16830 | TOPLESS family member which directly binds the N-terminal domain of SNC1 and interacts with TPR1. |
| AT3G16840 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G16850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G16857 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT3G16860 | COBRA-like protein 8 precursor;(source:Araport11) |
| AT3G16880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G16950 | encodes a plastid lipoamide dehydrogenase, subunit of the pyruvate dehydrogenase complex which provides acetyl-CoA for de novo fatty acid biosynthesis. The gene is highly expressed in developing seeds. |
| AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
| AT3G17010 | transcriptional factor B3 family protein, contains Pfam profile PF02362: B3 DNA binding domain. Activated by AGAMOUS ina a cal-1, ap1-1 background. Expressed in stamen primordia, the placental region of developing carpels and the ovary. |
| AT3G17070 | Peroxidase family protein;(source:Araport11) |
| AT3G17080 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
| AT3G17205 | ubiquitin protein ligase 6;(source:Araport11) |
| AT3G17265 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17270 | F-box/associated interaction domain protein;(source:Araport11) |
| AT3G17280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17320 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17390 | S-adenosylmethionine synthetase |
| AT3G17410 | Positively regulates ABA-mediated physiological responses via phosphorylation on RCAR3/ RCAR11. |
| AT3G17450 | hAT dimerization domain-containing protein;(source:Araport11) |
| AT3G17500 | F-box family protein;(source:Araport11) |
| AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G17540 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17550 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G17570 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17611 | RHOMBOID-like protein 14;(source:Araport11) |
| AT3G17620 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17668 | DnaJ/Hsp40 cysteine-rich domain superfamily protein;(source:Araport11) |
| AT3G17690 | member of Cyclic nucleotide gated channel family |
| AT3G17700 | cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile. |
| AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT3G17770 | Dihydroxyacetone kinase;(source:Araport11) |
| AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile. |
| AT3G17890 | hypothetical protein;(source:Araport11) |
| AT3G17910 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in embryo lethality. |
| AT3G17980 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT3G18070 | beta glucosidase 43;(source:Araport11) |
| AT3G18080 | B-S glucosidase 44;(source:Araport11) |
| AT3G18120 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G18130 | Encodes a protein with similarity to mammalian RACKs. RACKs function to shuttle activated protein kinase C to different subcellular sites and may also function as a scaffold through physical interactions with other proteins. RACK1C has no phenotype on its own and probably acts redundantly with RACK1A and RACK1B. |
| AT3G18165 | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT3G18180 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT3G18220 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
| AT3G18270 | a cytochrome P450 pseudogene. the second half of the gene overlaps perfectly with the other gene model. |
| AT3G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G18282 | hypothetical protein;(source:Araport11) |
| AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
| AT3G18310 | TATA box-binding protein associated factor RNA polymerase I subunit C;(source:Araport11) |
| AT3G18380 | DNA-BINDING TRANSCRIPTION FACTOR 2;(source:Araport11) |
| AT3G18400 | NAC domain containing protein 58;(source:Araport11) |
| AT3G18410 | NADH dehydrogenase ubiquinone 1 beta subcomplex subunit 10-B-like protein (Complex I subunit NDUFS6);(source:Araport11) |
| AT3G18420 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT3G18450 | PLAC8 family protein;(source:Araport11) |
| AT3G18480 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component, known as a golgin in mammals and yeast. A fluorescently-tagged version of CASP co-localizes with Golgi markers, and this localization appears to require the C-terminal (565?689aa) portion of the protein. The protein is inserted into a membrane in a type II orientation. |
| AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
| AT3G18510 | ATP-dependent helicase/nuclease subunit;(source:Araport11) |
| AT3G18535 | |
| AT3G18560 | hypothetical protein;(source:Araport11) |
| AT3G18600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G18610 | Encodes ATNUC-L2 (NUCLEOLIN LIKE 2). |
| AT3G18620 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G18640 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT3G18650 | AGAMOUS-like 103;(source:Araport11) |
| AT3G18660 | Plants expressing an RNAi construct specifically targeting PGSIP1 was shown to have a dramatically reduced amount of starch. Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT3G18670 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G18720 | F-box family protein;(source:Araport11) |
| AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G18820 | RAB7 homolog, forms retromer complex with VPS35; ES17 prevents the retromer complex to endosome anchoring, resulting in retention of RABG3f. The interaction of RABG3f?VPS35 functinons as a checkpoint in the control of traffic toward the vacuole. |
| AT3G18827 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CUUCUUAAGUGCUGAUAAUGC |
| AT3G18840 | LOW protein: PPR containing-like protein;(source:Araport11) |
| AT3G18845 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G18870 | Mitochondrial transcription termination factor family member. |
| AT3G18900 | ternary complex factor MIP1 leucine-zipper protein;(source:Araport11) |
| AT3G18910 | EIN2 targeting protein2;(source:Araport11) |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G18957 | hypothetical protein;(source:Araport11) |
| AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G19040 | Encodes a protein similar to TATA-binding protein-associated factor TAF1 (a.k.a. TAFII250) with histone acetyltransferase activity. It is required in integrating light signals to regulate gene expression and growth. |
| AT3G19050 | PHRAGMOPLAST ORIENTING KINESIN 2 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK2 constructs were broader than those for POK1; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls. |
| AT3G19055 | hypothetical protein;(source:Araport11) |
| AT3G19090 | RNA-binding protein;(source:Araport11) |
| AT3G19130 | RBP47B, is a component of the stress granule proteome and interacts with 2',3'-cAMP. |
| AT3G19170 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers |
| AT3G19200 | hypothetical protein;(source:Araport11) |
| AT3G19230 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G19270 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. |
| AT3G19274 | hypothetical protein;(source:Araport11) |
| AT3G19320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
| AT3G19410 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT3G19440 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G19460 | Reticulon family protein;(source:Araport11) |
| AT3G19470 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G19500 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT3G19595 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G19600 | Encodes a Ser-2-specific RNAPII CTD phosphatase with two tandem-repeated CTD phosphatase domains that belongs to the group III CTD phosphatase-like (CPL) family. It positively regulates ABA and drought responses. |
| AT3G19610 | Member of a novel, plant specific family of microtubule associated proteins. |
| AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
| AT3G19620 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G19700 | Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments. |
| AT3G19740 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
| AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G19870 | AP-5 complex subunit beta-like protein;(source:Araport11) |
| AT3G19920 | BTB/POZ domain protein;(source:Araport11) |
| AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
| AT3G19940 | Encodes a hexose-H(+) symporter that catalyzes the high-affinity uptake of glucose, galactose and mannose that is induced under low-glucose conditions in pollen tubes. |
| AT3G19960 | member of Myosin-like proteins |
| AT3G19970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G19990 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT3G20020 | protein arginine methyltransferase 6;(source:Araport11) |
| AT3G20030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G20050 | Encodes a putative cytoplasmic chaperonin that is similar to mouse Tcp-1 (t complex polypeptide 1). |
| AT3G20090 | cytochrome P450, family 705, subfamily A, polypeptide 18;(source:Araport11) |
| AT3G20110 | member of CYP705A |
| AT3G20120 | cytochrome P450, family 705, subfamily A, polypeptide 21;(source:Araport11) |
| AT3G20140 | member of CYP705A |
| AT3G20155 | hypothetical protein;(source:Araport11) |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT3G20180 | Copper transport protein family;(source:Araport11) |
| AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G20220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G20240 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G20280 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT3G20320 | Encodes a permease-like component of an ABC transporter involved in lipid transfer from ER to chloroplast. A phosphatidic acid-binding protein with a predicted mycobacterial cell entry domain. It is tethered to the inner chloroplast envelope membrane facing the outer envelope membrane. Presumed bacterial orthologs of TGD1 and TGD2 in Gram-negative bacteria are typically organized in transcriptional units, suggesting their involvement in a common biological process. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT3G20330 | encodes aspartate carbamoyltransferase catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis |
| AT3G20360 | TRAF-like family protein;(source:Araport11) |
| AT3G20362 | hypothetical protein;(source:Araport11) |
| AT3G20420 | double-stranded RNA binding / ribonuclease III. Required for 3' external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo. Localizes in the nucleus and cytoplasm. |
| AT3G20470 | encodes a glycine-rich protein that is expressed more abundantly in immature seed pods than in stems and leaves. Expression is not detected in roots or flowers. |
| AT3G20510 | Encodes a member of the Tmemb_14 family that is predicted to be localized to the membranes of the secretory pathway. The mRNA is cell-to-cell mobile. |
| AT3G20540 | Encodes an organellar DNA polymerase I that is also involved in double strand break repair. |
| AT3G20541 | pseudogene of Ankyrin repeat family protein;(source:Araport11) |
| AT3G20555 | hypothetical protein;(source:Araport11) |
| AT3G20570 | early nodulin-like protein 9;(source:Araport11) |
| AT3G20580 | COBRA-like protein 10 precursor;(source:Araport11) |
| AT3G20610 | non-race specific disease resistance protein;(source:Araport11) |
| AT3G20620 | F-box family protein-like protein;(source:Araport11) |
| AT3G20630 | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. Also involved in root responses to phosphate deficiency. |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT3G20650 | mRNA capping enzyme family protein;(source:Araport11) |
| AT3G20655 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT3G20700 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G20720 | amino-terminal region of chorein;(source:Araport11) |
| AT3G20780 | Encodes putative eukaryotic homolog of archaebacterial topoisomerase VI subunit B, TOP6B. Is essential for endoreduplication and is involved in cell expansion and cell proliferation. The hlq (harlequin) dwarf mutant has fewer root hair and leaf trichome. It has abnormal epidermal cell and accumulates callose. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G20850 | proline-rich family protein;(source:Araport11) |
| AT3G20910 | nuclear factor Y, subunit A9;(source:Araport11) |
| AT3G20935 | cytochrome P450, family 705, subfamily A, polypeptide 28;(source:Araport11) |
| AT3G20960 | cytochrome P450, family 705, subfamily A, polypeptide 33;(source:Araport11) |
| AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT3G20990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G20993 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G21000 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT3G21010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-15 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G21040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-20 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G21080 | ABC transporter-like protein;(source:Araport11) |
| AT3G21090 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G21120 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G21130 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
| AT3G21180 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT3G21190 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G21200 | Encodes a soluble glutamyl-tRNA reductase (GluTR) binding protein that forms a ternary complex with FLU and GluTR. |
| AT3G21210 | zinc ion binding protein;(source:Araport11) |
| AT3G21220 | Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggesting a role for both proteins in mediating floral organ abscission.MKK5 is part of a positive feedback loop that regulates HAE expression in floral receptacles. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
| AT3G21270 | Encodes Dof zinc finger protein adof2. |
| AT3G21280 | Encodes a ubiquitin-specific protease. |
| AT3G21300 | RNA methyltransferase family protein;(source:Araport11) |
| AT3G21310 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
| AT3G21330 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G21380 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G21420 | LATERAL BRANCHING OXIDOREDUCTASE (LBO), encodes an oxidoreductase-like enzyme of the 2-oxoglutarate and Fe(II)-dependent dioxygenase superfamily. It is involved in the biosynthesis of strigolactones. |
| AT3G21430 | DNA binding protein;(source:Araport11) |
| AT3G21460 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT3G21470 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT3G21500 | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity. |
| AT3G21570 | proline-rich nuclear receptor coactivator;(source:Araport11) |
| AT3G21610 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT3G21620 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
| AT3G21650 | Encodes protein phosphatase 2A (PP2A) B'zeta subunit. Targeted to mitochondria. |
| AT3G21660 | UBX domain-containing protein;(source:Araport11) |
| AT3G21670 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G21680 | hypothetical protein;(source:Araport11) |
| AT3G21700 | Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip. |
| AT3G21710 | transmembrane protein;(source:Araport11) |
| AT3G21740 | ACCUMULATION OF PHOTOSYSTEM ONE 4 |
| AT3G21750 | Encodes a glucosyltransferase that can attach glucose to a number of hydroxylated phenolic compounds as well as quercetins in vitro |
| AT3G21755 | Natural antisense transcript overlaps with AT3G21760;(source:Araport11) |
| AT3G21760 | Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside. |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT3G21791 | Pseudogene of AT3G21790; UDP-glucoronosyl/UDP-glucosyl transferase family protein |
| AT3G21800 | UDP-glucosyl transferase 71B8;(source:Araport11) |
| AT3G21850 | one of Arabidopsis SKP1 homologues |
| AT3G21860 | SKP1-like 10;(source:Araport11) |
| AT3G21865 | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. |
| AT3G21880 | Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570). |
| AT3G21945 | cysteine-rich repeat secretory protein;(source:Araport11) |
| AT3G21950 | SABATH family methyltransferase. |
| AT3G21960 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT3G22010 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT3G22030 | Receptor protein kinase-like protein;(source:Araport11) |
| AT3G22040 | cysteine-rich repeat secretory-like protein (DUF26);(source:Araport11) |
| AT3G22057 | cysteine-rich repeat secretory protein;(source:Araport11) |
| AT3G22072 | Natural antisense transcript overlaps with AT3G22070;(source:Araport11) |
| AT3G22080 | ubiquitin carboxyl-terminal hydrolase-like protein;(source:Araport11) |
| AT3G22104 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G22133 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10) |
| AT3G22270 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
| AT3G22310 | Sequence similarity ot DEAD-box RNA helicases. Binds RNA and DNA. Involved in drought, salt and cold stress responses. The mRNA is cell-to-cell mobile. |
| AT3G22340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-60 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G22360 | encodes an alternative oxidase whose expression is limited to flowers and floral buds. |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G22415 | hypothetical protein;(source:Araport11) |
| AT3G22420 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G22425 | Encodes imidazoleglycerolphosphate dehydratase. |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT3G22490 | Atrab28 plays a role in the ion cell balance during late embryogenesis and germination. |
| AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
| AT3G22560 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT3G22630 | Encodes 20S proteasome beta subunit PBD1 (PBD1). |
| AT3G22640 | cupin family protein;(source:Araport11) |
| AT3G22723 | hypothetical protein;(source:Araport11) |
| AT3G22730 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G22770 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G22790 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It binds filamentous actin and is localized to the plasma membrane and plasmodesmata. |
| AT3G22800 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G22840 | Encodes an early light-inducible protein. |
| AT3G22850 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT3G22860 | member of eIF3c - eukaryotic initiation factor 3c |
| AT3G22870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G22900 | Non-catalytic subunit specific to DNA-directed RNA polymerase IV; homologous to budding yeast RPB7 |
| AT3G22930 | Encodes a calmodulin-like protein. |
| AT3G22945 | pseudogene of rotamase CYP 3;(source:Araport11) |
| AT3G22961 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT3G22990 | Armadillo-repeat containing protein. Involved in leaf and flower development. Located in nucleus. Broadly expressed throughout vegetative and floral tissues. LFR is functionally associated with AS2 to mediate leaf development. |
| AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile. |
| AT3G23010 | receptor like protein 36;(source:Araport11) |
| AT3G23020 | Encodes a chloroplast nucleoid-localized protein whose absence leads to broadly impaired plastid gene expression and chloroplast development. |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT3G23070 | Encodes a CRM domain protein CFM3a, involved in group IIB intron splicing in chloroplasts. |
| AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
| AT3G23110 | receptor like protein 37;(source:Araport11) |
| AT3G23120 | receptor like protein 38;(source:Araport11) |
| AT3G23125 | Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC |
| AT3G23130 | Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants. |
| AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
| AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT3G23190 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT3G23230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G23270 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT3G23280 | Encodes a ubiquitin ligase that is a novel player in ethylene signaling involved in negatively regulating apical hook curvature, with alternative splicing controlling dual targeting to the nuclear and cytoplasmic compartments. |
| AT3G23326 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCCCCUCUUUAGCUUGGAGAAG |
| AT3G23350 | ENTH/VHS family protein;(source:Araport11) |
| AT3G23360 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G23370 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G23380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Gene is expressed predominantly in inflorescence and flower tissue. |
| AT3G23390 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT3G23420 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G23430 | Encodes a protein with the mainly hydrophilic N-terminal and the C-terminal containing 6 potential membrane-spanning domains. The mutant is deficient in the transfer of phosphate from root epidermal and cortical cells to the xylem. Its expression is repressed by phosphate (Pi) in shoots, and transiently induced by phosphite (Phi) in roots and shoots. PHO is expressed in developing ovules and plays a role in the transfer of Ph from maternal tissues to filial tissues. |
| AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
| AT3G23460 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G23470 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23480 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23490 | Encodes a cyanase that catalyzes the bicarbonate-dependent breakdown of cyanate to ammonia and bicarbonate. CYN forms a hexadecamer and is believed to be a cytosolic protein. Long-term exposure to NaCl increases CYN transcript levels. It is also expressed at higher levels in flowers relative to stems, roots, and seedlings. |
| AT3G23510 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23580 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes (RNR2A). Functionally redundant with the ribonucleotide reductase TSO2. mRNA was shown to specifically accumulate during the S-phase of the cell cycle in synchronized tobacco BY2 cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT3G23590 | Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex. |
| AT3G23620 | BRIX domain containing protein, similar to RNA biogenesis factors in yeast. Binds rRNA and likely also functions in RNA biogenesis in Arabidopsis. Essential gene, mutants are embryo lethal and does not transmit well through the gametophyte. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT3G23633 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G23637 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
| AT3G23680 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G23730 | xyloglucan endotransglucosylase/hydrolase 16;(source:Araport11) |
| AT3G23740 | hypothetical protein;(source:Araport11) |
| AT3G23770 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G23800 | selenium-binding protein 3;(source:Araport11) |
| AT3G23805 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT3G23860 | Encodes a GTP-binding related protein that acts as a negative regulator of pollen germination, pollen tube growth, and gametophyte senescence. |
| AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G23890 | Encodes a topoisomerase II that is highly expressed in young seedlings. The protein is localized in the nucleus and gene expression levels are increased in proliferative tissues. |
| AT3G23930 | troponin T, skeletal protein;(source:Araport11) |
| AT3G23950 | F-box protein family gene. |
| AT3G23960 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G23990 | mitochondrial chaperonin HSP. assist in rapid assembly of the oligomeric protein structures in the mitochondria. |
| AT3G24030 | hydroxyethylthiazole kinase family protein;(source:Araport11) |
| AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G24060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G24093 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT3G24100 | Encodes a secreted peptide that enhances stress indued cell death. |
| AT3G24170 | Encodes a cytosolic glutathione reductase. |
| AT3G24200 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G24210 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G24230 | Pectate lyase family protein;(source:Araport11) |
| AT3G24240 | RGFR1 is a leucine--rich repeat receptor kinase that, together with RGFR2 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT3G24250 | glycine-rich protein;(source:Araport11) |
| AT3G24290 | ammonium transporter 1;(source:Araport11) |
| AT3G24300 | Encodes a plasma membrane localized ammonium transporter. |
| AT3G24310 | snapdragon myb protein 305 homolog (myb) |
| AT3G24332 | Natural antisense transcript overlaps with AT3G24330;(source:Araport11) |
| AT3G24360 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT3G24420 | DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism. |
| AT3G24440 | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
| AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT3G24465 | Encodes a Plant thionin family protein |
| AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT3G24500 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
| AT3G24510 | Encodes a defensin-like (DEFL) family protein. |
| AT3G24530 | AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11) |
| AT3G24542 | Beta-galactosidase related protein;(source:Araport11) |
| AT3G24560 | novel gene involved in embryogenesis |
| AT3G24580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G24600 | late embryogenesis abundant protein, group 2;(source:Araport11) |
| AT3G24615 | Encodes a Z43 snoRNA. Gb: AJ240080 |
| AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G24640 | lyase;(source:Araport11) |
| AT3G24690 | hypothetical protein;(source:Araport11) |
| AT3G24710 | NADPH-dependent diflavin oxidoreductase;(source:Araport11) |
| AT3G24750 | Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root |
| AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT3G24790 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G24810 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT3G24850 | B3 domain protein (DUF313);(source:Araport11) |
| AT3G24860 | Trihelix transcription factor induced by osmotic and salt stress. Binds to a conserved AGAG-box sequence in the promoter of genes it regulates. Regulates the expression of stress tolerance genes, resulting in reduced reactive oxygen species, Na+ accumulation, stomatal apertures, lipid peroxidation, cell death and water loss rate, and increased proline content and reactive oxygen species scavenging capability. |
| AT3G24900 | receptor like protein 39;(source:Araport11) |
| AT3G25014 | hypothetical protein;(source:Araport11) |
| AT3G25030 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G25040 | Encodes ERD2b. a homolog of the yeast endoplasmic reticulum retention receptor ERD2. Mutations in ERD2b compromise EFR but not FLS2 signaling. The mRNA is cell-to-cell mobile. |
| AT3G25050 | Encodes an endotransglucosylase that cleaves the beta-1,4-glucosidic linkage in amorphous cellulose and ligates the nascent reducing end to a non-reducing terminus of either cellulosic or xyloglucan oligosaccharide. Higher expression in flowers and in response to IAA treatment. |
| AT3G25100 | Required for normal meiosis, may act in the last round of DNA replication prior to meiosis, sequence similar to yeast CDC45 |
| AT3G25130 | acidic leucine-rich nuclear phosphoprotein 32 family B protein;(source:Araport11) |
| AT3G25140 | Quasimodo1, encodes a glycosyltransferase, involved in homogalacturonan biosynthesis; mutant shows cell adhesion defect and lower wall uronic acid content. The mRNA is cell-to-cell mobile. |
| AT3G25180 | Encodes a cytochrome P450 monooxygenase (CYP82G1) that catalyzes the production of two volatile homoterpenes, TMTT and DMNT, although it is only likely to produce TMTT in planta. TMTT can be involved in attracting predatory insects to protect Arabidopsis plants from herbivorous pests. Homoterpene synthesis is also stimulated by fungal elicitors which increase the transcript levels of CYP82G1. |
| AT3G25182 | Pseudogene of AT5G24050; DNA binding protein |
| AT3G25200 | hypothetical protein;(source:Araport11) |
| AT3G25225 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G25250 | Arabidopsis protein kinase The mRNA is cell-to-cell mobile. |
| AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
| AT3G25450 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.7e-211 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G25470 | bacterial hemolysin-like protein;(source:Araport11) |
| AT3G25495 | pseudogene of leucine-rich repeat protein |
| AT3G25500 | Poly-L-proline-containing (PLP) protein that form part of the signal-transduction cascade that leads to rearrangement of the actin cytoskeleton. AFH1 is a nonprocessive formin that moves from the barbered end to the side of an actin filament after the nucleation event. |
| AT3G25510 | disease resistance protein (TIR-NBS-LRR class) family protein;(source:Araport11) |
| AT3G25545 | trigger factor;(source:Araport11) |
| AT3G25550 | F-box family protein;(source:Araport11) |
| AT3G25570 | S-adenosylmethionine decarboxylase family member. |
| AT3G25573 | transmembrane protein;(source:Araport11) |
| AT3G25577 | hypothetical protein;(source:Araport11) |
| AT3G25580 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G25597 | transmembrane protein;(source:Araport11) |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT3G25630 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G25650 | SKP1-like 15;(source:Araport11) |
| AT3G25655 | Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission. |
| AT3G25670 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G25710 | Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT3G25717 | ROTUNDIFOLIA like 16;(source:Araport11) |
| AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
| AT3G25760 | encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. The mRNA is cell-to-cell mobile. |
| AT3G25770 | Encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. Note: Nomenclature for Arabidopsis allene oxide cyclase 2 (AOC2, AT3G25770) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC2 (AT3G25770) is also referred to as AOC3 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile. |
| AT3G25780 | Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis that encode this enzyme. mRNA expression is upregulated in senescing leaves. Note: Nomenclature for Arabidopsis allene oxide cyclase 3 (AOC3, AT3G25780) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC3 (AT3G25780) is also referred to as AOC2 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile. |
| AT3G25800 | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT3G25815 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.7e-34 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
| AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
| AT3G25960 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G26050 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT3G26115 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT3G26120 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT3G26130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT3G26140 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT3G26150 | putative cytochrome P450 |
| AT3G26160 | putative cytochrome P450 |
| AT3G26190 | putative cytochrome P450 |
| AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26220 | cytochrome P450 monooxygenase |
| AT3G26230 | putative cytochrome P450 |
| AT3G26235 | hypothetical protein;(source:Araport11) |
| AT3G26250 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G26270 | putative cytochrome P450 |
| AT3G26280 | cytochrome P450 monooxygenase |
| AT3G26290 | putative cytochrome P450 |
| AT3G26295 | putative cytochrome P450. |
| AT3G26320 | putative cytochrome P450 |
| AT3G26330 | putative cytochrome P450 |
| AT3G26470 | Powdery mildew resistance protein, RPW8 domain-containing protein;(source:Araport11) |
| AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
| AT3G26550 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G26570 | low affinity phosphate transporter |
| AT3G26580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G26590 | MATE efflux family protein;(source:Araport11) |
| AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
| AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G26730 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT3G26780 | Encodes MEF14 (mitochondrial editing factor 14), a PPR (pentatricopeptide repeat proteins) protein required for RNA editing at site matR-1895 in mitochondria. The mRNA is cell-to-cell mobile. |
| AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT3G26805 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G26812 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
| AT3G26820 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile. |
| AT3G26840 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT3G26880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G26900 | Encodes a protein with some sequence similarity to shikimate kinases, but a truncated form of this protein (lacking a putative N-terminal chloroplast transit peptide) does not have shikimate kinase activity in vitro. skl1-3 mutants have a variegated phenotype and skl1-8 mutants have an albino phenotype consistent with the observation of chloroplast defects in these mutants. |
| AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
| AT3G26960 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G26980 | membrane-anchored ubiquitin-fold protein 4 precursor;(source:Araport11) |
| AT3G26990 | ENTH/VHS family protein;(source:Araport11) |
| AT3G27000 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. its transcript level is down regulated by light and is expressed in very low levels in all organs examined. |
| AT3G27010 | Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes. |
| AT3G27025 | Encodes a member of the LAZY gene family that is expressed in the shoot apex. |
| AT3G27027 | GPI-anchored-like protein (DUF 3339);(source:Araport11) |
| AT3G27030 | transmembrane protein;(source:Araport11) |
| AT3G27060 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT3G27095 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G27150 | Target gene of MIR2111-5p. |
| AT3G27170 | member of Anion channel protein family The mRNA is cell-to-cell mobile. |
| AT3G27180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G27230 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G27280 | Part of protein complexes that are necessary for proficient mitochondrial function or biogenesis, thereby supporting cell division and differentiation in apical tissues |
| AT3G27321 | Pseudogene of AT1G08985; DNA-binding protein |
| AT3G27325 | hydrolases, acting on ester bond;(source:Araport11) |
| AT3G27327 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-320 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
| AT3G27400 | Encodes a pectate lyase involved in response to nematodes. |
| AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT3G27473 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G27620 | encodes an isoform of alternate oxidase. expressed in all tissues examined and expression is not induced by antimycin A, an inhibitor of complex III in the mitochondrial respiratory chain. |
| AT3G27650 | LOB domain-containing protein 25;(source:Araport11) |
| AT3G27670 | A novel protein, did not show high similarity to any protein of known function; reveals a novel genetic connection between lipid synthesis and embryo development. Expressed in all tissues examined including leaves, flowers, roots, stems, and siliques, but accumulation levels were not correlated with the degree to which different organs appeared affected by the mutation. Mutant plants showed alterations in the cuticular wax profiles and embryo development. The mRNA is cell-to-cell mobile. |
| AT3G27690 | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. The mRNA is cell-to-cell mobile. |
| AT3G27710 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G27720 | IBR domain containing protein;(source:Araport11) |
| AT3G27750 | Encodes a pentatricopeptide repeat (PPR) protein required for the splicing of specific group II introns. Null alleles are embryo lethal. |
| AT3G27770 | plant/protein;(source:Araport11) |
| AT3G27840 | 50S ribosomal protein L12-B |
| AT3G27865 | snoRNA;(source:Araport11) |
| AT3G27870 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT3G27880 | hypothetical protein (DUF1645);(source:Araport11) |
| AT3G27884 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G27900 | hypothetical protein (DUF1184);(source:Araport11) |
| AT3G27925 | Encodes a DegP protease; nuclear gene encoding chloroplast-targeted protease that can degrade two lumenal proteins, plastocyanin and OE33, suggesting a role as a general-purpose protease in the thylakoid lumen. Involved in the degradation of D1 protein of PS II, hence participating in the repair of PS II damages caused by photoinhibition. The mRNA is cell-to-cell mobile. |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT3G28010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10) |
| AT3G28040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G28050 | nodulin MtN21-like transporter family protein |
| AT3G28060 | nodulin MtN21-like transporter family protein |
| AT3G28070 | nodulin MtN21-like transporter family protein |
| AT3G28080 | nodulin MtN21-like transporter family protein |
| AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G28160 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-06 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G28170 | hypothetical protein;(source:Araport11) |
| AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT3G28190 | transmembrane protein;(source:Araport11) |
| AT3G28200 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G28210 | Encodes a putative zinc finger protein (PMZ). |
| AT3G28223 | F-box family protein;(source:Araport11) |
| AT3G28310 | hypothetical protein (DUF677);(source:Araport11) |
| AT3G28330 | F-box family protein-like protein;(source:Araport11) |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G28345 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT3G28350 | Pseudogene of AT3G28350; unknown protein |
| AT3G28360 | P-glycoprotein 16;(source:Araport11) |
| AT3G28380 | P-glycoprotein 17;(source:Araport11) |
| AT3G28390 | P-glycoprotein 18;(source:Araport11) |
| AT3G28412 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
| AT3G28420 | Putative membrane lipoprotein;(source:Araport11) |
| AT3G28455 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo.CLE25 participates in long distance signaling in response to dehydration. It produces a graft transmissible signal from root to shoot that induces ABA synthesis and results in stomatal closure. The BAM1 and BAM3 receptor-kinases are likely receptors for CLE25 as they are required for this signaling. |
| AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28550 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT3G28560 | BCS1 AAA-type ATPase;(source:Araport11) |
| AT3G28570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28705 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.8e-25 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G28715 | Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes, which plays an important role in plant growth. VHA-d2 is one of the two subunit isoforms. Plays a role in response to oxidative stress by affecting H+ flux and AHA gene expression. |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT3G28770 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28790 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28830 | mucin-like protein, putative (DUF1216);(source:Araport11) |
| AT3G28850 | Glutaredoxin family protein;(source:Araport11) |
| AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
| AT3G28890 | receptor like protein 43;(source:Araport11) |
| AT3G28900 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT3G28918 | hypothetical protein;(source:Araport11) |
| AT3G28920 | homeobox protein 34;(source:Araport11) |
| AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
| AT3G28940 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G28980 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
| AT3G29034 | transmembrane protein;(source:Araport11) |
| AT3G29035 | Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile. |
| AT3G29040 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT3G29050 | receptor-like protein kinase-like protein;(source:Araport11) |
| AT3G29153 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-238 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G29156 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-175 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G29255 | Putative pentacyclic triterpene synthase 7;(source:Araport11) |
| AT3G29260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G29290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G29300 | transmembrane protein;(source:Araport11) |
| AT3G29330 | zinc finger RNA-binding-like protein;(source:Araport11) |
| AT3G29340 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
| AT3G29365 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G29400 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G29410 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G29515 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.6e-11 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G29560 | hypothetical protein;(source:Araport11) |
| AT3G29572 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT3G29577 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.0e-133 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
| AT3G29615 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.2e-313 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G29630 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G29635 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
| AT3G29720 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G29727 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.9e-09 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G29760 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G29769 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.5e-252 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G29776 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-178 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G29779 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 33%25 identity and 2.8e-14 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
| AT3G29783 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-193 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G29786 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G43320.1);(source:TAIR10) |
| AT3G29788 | pseudogene of transmembrane protein;(source:Araport11) |
| AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G29830 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G30145 | transposable_element_gene;(source:Araport11);pseudogene, putative helicase protein, blastp match of 39%25 identity and 7.7e-124 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT3G30160 | transmembrane protein;(source:Araport11) |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT3G30210 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB121). |
| AT3G30212 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-19 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G30214 | pseudogene of transmembrane protein;(source:Araport11) |
| AT3G30216 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains some similarity to polyproteins;(source:TAIR10) |
| AT3G30220 | hypothetical protein;(source:Araport11) |
| AT3G30250 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G31150.1);(source:TAIR10) |
| AT3G30280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G30290 | a member of cytochrome P450 gene family |
| AT3G30335 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.2e-129 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT3G30440 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G47260.1);(source:TAIR10) |
| AT3G30530 | basic leucine-zipper 42;(source:Araport11) |
| AT3G30582 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-156 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G30630 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-300 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G30705 | transmembrane protein;(source:Araport11) |
| AT3G30714 | Pseudogene of AT3G26870; self-incompatibility protein-related |
| AT3G30717 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.6e-176 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G30721 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 6.7e-134 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT3G30747 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
| AT3G30805 | Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11) |
| AT3G30813 | pseudogene of lysyl-tRNA synthetase 1;(source:Araport11) |
| AT3G30840 | hypothetical protein;(source:Araport11) |
| AT3G30841 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
| AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
| AT3G30852 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative non-LTR retroelement reverse transcriptase, blastp match of 22%25 identity and 7.8e-07 P-value to GP|10140689|gb|AAG13524.1|AC068924_29|AC068924 putative non-LTR retroelement reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT3G30875 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G31023 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-152 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G31314 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-23 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G31317 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-32 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G31365 | transposable_element_gene;(source:Araport11);pseudogene, putative helicase, similar to putative helicase GB:AAD15468 GI:4263825 from (Arabidopsis thaliana);(source:TAIR10) |
| AT3G31425 | pseudogene of Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G31915 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G31370.1);(source:TAIR10) |
| AT3G31950 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
| AT3G31970 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.3e-294 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G32035 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-16 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G32040 | Chloroplast localized GFDP synthase. |
| AT3G32047 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G32050 | hypothetical protein;(source:Araport11) |
| AT3G32110 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-52 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT3G32112 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-135 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G32160 | hypothetical protein;(source:Araport11) |
| AT3G32383 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G32387 | pseudogene of casein lytic proteinase B3;(source:Araport11) |
| AT3G32465 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 0.00075 P-value blast match to GB:AAA29366 ORF1 (LINE-element) (Anopheles gambiae);(source:TAIR10) |
| AT3G32897 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G32925 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33070 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-191 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G33131 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32610.1);(source:TAIR10) |
| AT3G33154 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-36 P-value blast match to GB:CAB39733 rotease, reverse transcriptase, ribonuclease H, integrase (Gypsy_Ty3-element) (Drosophila buzzatii);(source:TAIR10) |
| AT3G33163 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G33193 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.4e-232 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT3G33293 | myosin heavy chain-like protein;(source:Araport11) |
| AT3G33520 | Encodes ACTIN-RELATED PROTEIN6 (ARP6), a putative component of a chromatin-remodeling complex. Required for both histone acetylation and methylation of the FLC chromatin in Arabidopsis. Along with PIE1 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). Incorporation of this variant histone into chromatin mediates the ambient temperature response. Located at specific regions of the nuclear periphery. Expression throughout plants shown by in-situ and immunolocalization methods. Mutants show defects in fertility, leaf, flower and inflorescence development and shorter flowering times. ARP6 also is involved in globally controlling developmental responses to ambient temperature through incorporation of variant histone H2A.Z into chromatin. |
| AT3G33565 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.0e-22 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G36659 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G39230 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.1e-251 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT3G41345 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.6e-18 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G41761 | other_RNA;(source:Araport11) |
| AT3G41979 | 5.8SrRNA |
| AT3G42047 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT3G42052 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.0e-162 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G42083 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), contains Pfam profile PF03078: ATHILA ORF-1 family;(source:TAIR10) |
| AT3G42110 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G35920.1);(source:TAIR10) |
| AT3G42150 | transmembrane protein;(source:Araport11) |
| AT3G42178 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-197 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G42181 | transposable_element_gene;(source:Araport11) |
| AT3G42186 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-118 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G42233 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-82 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G42240 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43940.1);(source:TAIR10) |
| AT3G42256 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.8e-238 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G42270 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.1e-62 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G42313 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.2e-227 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G42360 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative 22 kDa kafirin cluster;(source:TAIR10) |
| AT3G42386 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-116 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT3G42420 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, various predicted proteins, including predicted Helicases.;(source:TAIR10) |
| AT3G42430 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37045.1);(source:TAIR10) |
| AT3G42473 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G42540 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43940.1);(source:TAIR10) |
| AT3G42570 | peroxidase family protein;(source:Araport11) |
| AT3G42622 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0. P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G42640 | H[+]-ATPase 8;(source:Araport11) |
| AT3G42656 | transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1029_F04.11, similar to Ac-like transposase;(source:TAIR10) |
| AT3G42711 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.7e-08 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT3G42713 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT3G42780 | hypothetical protein;(source:Araport11) |
| AT3G42798 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, similar to En/Spm-like transposon protein;(source:TAIR10) |
| AT3G42800 | AF-like protein;(source:Araport11) |
| AT3G42850 | Mevalonate/galactokinase family protein;(source:Araport11)arabinokinase activity |
| AT3G42880 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G42886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-89 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G42890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-10 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G42900 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.7e-44 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G42927 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.2e-94 P-value blast match to F18P9 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G42960 | Arabidopsis homolog of TASSELSEED2. Expressed specifically in tapetal cells. |
| AT3G43090 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.4e-12 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G43110 | transmembrane protein;(source:Araport11) |
| AT3G43170 | hypothetical protein;(source:Araport11) |
| AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G43190 | Encodes a protein with sucrose synthase activity (SUS4). |
| AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
| AT3G43220 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G43230 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
| AT3G43320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37050.1);(source:TAIR10) |
| AT3G43358 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-69 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT3G43580 | Beta-galactosidase related protein;(source:Araport11) |
| AT3G43590 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT3G43600 | Encodes an aldehyde oxidase. AAO2 does not appear to act on abscisic aldehyde in vitro but it is possible that it may function in abscisic acid biosynthesis when the activity of At2g27150 (AAO3), the primary abscisic aldehyde oxidase, is lost. |
| AT3G43622 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G43625 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-32 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G43650 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.0e-43 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
| AT3G43710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G43760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT3G43800 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
| AT3G43820 | pseudogene of Copper amine oxidase family protein;(source:Araport11) |
| AT3G43826 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G43835 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.4e-26 P-value blast match to GB:NP_038604 L1 repeat, Tf subfamily, member 26 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G43840 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein;(source:Araport11) |
| AT3G43850 | hypothetical protein;(source:Araport11) |
| AT3G43910 | MutS2;(source:Araport11) |
| AT3G43920 | Encodes a ribonuclease III family protein that is required for endogenous RDR2-dependent siRNA (but not miRNA) formation. |
| AT3G43930 | BRCT domain-containing DNA repair protein;(source:Araport11) |
| AT3G43950 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G43970 | hypothetical protein;(source:Araport11) |
| AT3G43980 | Ribosomal protein S14p/S29e family protein;(source:Araport11) |
| AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT3G44006 | This gene encodes a small protein and has either evidence of transcription or purifying selection. Putative OXS2-binding DEGs were constitutively activated by OXS2. |
| AT3G44060 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G44090 | F-box family protein;(source:Araport11) |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT3G44117 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT3G44180 | syntaxin-related family protein;(source:Araport11) |
| AT3G44190 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT3G44215 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-150 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G44220 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G44250 | putative cytochrome P450 |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT3G44262 | pseudogene of subtilisin-like serine protease 2;(source:Araport11) |
| AT3G44264 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-99 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G44267 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-114 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G44274 | pseudogene of Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile. |
| AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT3G44330 | M28 Zn-peptidase nicastrin;(source:Araport11) |
| AT3G44370 | Member of the Oxa1 super family protein insertases. Involved in biogenesis of mitochondrial respiratory chain complex IV, specifically via membrane insertion of COX2. |
| AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G44410 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G44425 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-41 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G44430 | transmembrane protein;(source:Araport11) |
| AT3G44510 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G44560 | fatty acid reductase 8;(source:Araport11) |
| AT3G44605 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-38 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G44640 | transposable_element_gene;(source:Araport11);transposase IS4 family protein, contains Pfam profile: PF01609 transposase DDE domain;(source:TAIR10) |
| AT3G44704 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G44705 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-46 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G44713 | hypothetical protein;(source:Araport11) |
| AT3G44717 | Pseudogene of AT5G03495; nucleotide binding protein |
| AT3G44740 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT3G44755 | hypothetical protein;(source:Araport11) |
| AT3G44757 | pseudogene of transmembrane protein;(source:Araport11) |
| AT3G44760 | transmembrane protein;(source:Araport11) |
| AT3G44765 | other_RNA;(source:Araport11) |
| AT3G44780 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G44805 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G44810 | F-box family protein;(source:Araport11) |
| AT3G44830 | Lecithin:cholesterol acyltransferase family protein;(source:Araport11) |
| AT3G44840 | SABATH methyltransferase |
| AT3G44900 | member of Putative Na+/H+ antiporter family |
| AT3G44910 | member of Putative Na+/H+ antiporter family |
| AT3G44920 | member of Putative Na+/H+ antiporter family |
| AT3G44930 | member of Putative Na+/H+ antiporter family |
| AT3G44935 | hypothetical protein;(source:Araport11) |
| AT3G44960 | shugoshin;(source:Araport11) |
| AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G44980 | hypothetical protein;(source:Araport11) |
| AT3G44990 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1).Enzyme kinetic analysis indicates predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
| AT3G45000 | SNF7 family protein;(source:Araport11) |
| AT3G45070 | Encodes a sulfotransferase with sulfating activity toward flavonoids. |
| AT3G45120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10) |
| AT3G45130 | lanosterol synthase 1;(source:Araport11) |
| AT3G45150 | TCP domain protein 16;(source:Araport11) |
| AT3G45230 | Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains. |
| AT3G45253 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-48 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT3G45280 | syntaxin of plants 72 (SYP72) |
| AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G45330 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
| AT3G45400 | exostosin family protein;(source:Araport11) |
| AT3G45410 | encodes a receptor-like kinase that has serine/threonine kinase activity whose expression is induced by high salt stress. This induction is inhibited by tobacco ethylene receptor. |
| AT3G45430 | Extracellular ATP transmembrane receptor involved in innate immunity. |
| AT3G45450 | Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G45460 | IBR domain containing protein;(source:Araport11) |
| AT3G45470 | IBR domain containing protein;(source:Araport11) |
| AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT3G45490 | reverse transcriptase-like protein;(source:Araport11) |
| AT3G45500 | hypothetical protein;(source:Araport11) |
| AT3G45510 | RING/U-box protein;(source:Araport11) |
| AT3G45525 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
| AT3G45540 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT3G45560 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G45570 | RING/U-box protein with C6HC-type zinc finger domain-containing protein;(source:Araport11) |
| AT3G45577 | tRNA-intron endonuclease;(source:Araport11) |
| AT3G45610 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT3G45620 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT3G45660 | Encodes a member of the NAXT NPF subfamily. |
| AT3G45670 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45680 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G45690 | Encodes a member of the NAXT NPF subfamily. |
| AT3G45700 | NPF2.4 is a member of the NAXT NPF subfamily. It encodes a plasmamembrane localized chloride transporter that is expressed in the root and is down regulated in response to ABA and salt treatment. NPF2.3 miRNA induced knockdowns have less Cl in the shoots when grown on low NaCl concentrations. |
| AT3G45710 | Encodes a chloride permeable transporter. Modulates chloride efflux from roots. |
| AT3G45730 | hypothetical protein;(source:Araport11) |
| AT3G45760 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45800 | Plant protein 1589 of unknown function;(source:Araport11) |
| AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT3G45840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G45850 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G45930 | Histone superfamily protein;(source:Araport11) |
| AT3G45935 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT3G45940 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
| AT3G45950 | Pre-mRNA splicing Prp18-interacting factor;(source:Araport11) |
| AT3G45960 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G45965 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT3G45970 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile. |
| AT3G45990 | Cofilin/tropomyosin-type actin-binding protein family;(source:Araport11) |
| AT3G46050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G46080 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G46090 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G46100 | histidyl-tRNA synthetase |
| AT3G46130 | Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons. |
| AT3G46160 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G46210 | Ribosomal protein S5 domain 2-like superfamily protein;(source:Araport11) |
| AT3G46230 | Member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds.Induced by heat, cold, salt, drought and high-light. |
| AT3G46240 | ER protein carbohydrate-binding protein;(source:Araport11) |
| AT3G46260 | kinase-like protein;(source:Araport11) |
| AT3G46280 | kinase-like protein;(source:Araport11) |
| AT3G46300 | hypothetical protein;(source:Araport11) |
| AT3G46340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G46360 | transmembrane protein;(source:Araport11) |
| AT3G46400 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G46420 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G46482 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT3G46510 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. Can be phosphorylated in vitro by MLPK, ARK1, and ARK2 but not by SD1-29. Involved in ubiquitination of pattern recognition receptor FLS2. |
| AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
| AT3G46550 | Isolated in a screen for salt hypersensitive mutants. Mutants have thinner cell walls, abnormal siliques and root growth is inhibited under salt stress. The gene has similarity to arabinogalactan proteins and domains associated with cell adhesion.SOS5 is required for normal mucilage adherence to seeds. |
| AT3G46600 | GRAS family transcription factor;(source:Araport11) |
| AT3G46630 | DCL protein (DUF3223);(source:Araport11) |
| AT3G46650 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46710 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G46720 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46730 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT3G46790 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-H subfamily) with 9 pentatricopeptide (PPR) repeats. The protein is involved the intergenic processing of chloroplast RNA between rps7 and ndhB, which is essential for ndhB translation. |
| AT3G46800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G46840 | Subtilase family protein;(source:Araport11) |
| AT3G46850 | Subtilase family protein;(source:Araport11) |
| AT3G46860 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT3G46870 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G46880 | hypothetical protein;(source:Araport11) |
| AT3G46890 | maternal effect embryo arrest protein;(source:Araport11) |
| AT3G46910 | Cullin family protein;(source:Araport11) |
| AT3G47030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G47040 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G47110 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G47130 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G47150 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G47170 | Encodes enzymes that can efficiently convert putrescine and caffeoyl-CoA to di-caffeoyl putrescine. Has a preference for caffeoyl CoA and putrescine. |
| AT3G47180 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G47200 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G47210 | hypothetical protein (DUF247);(source:Araport11) |
| AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
| AT3G47230 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10) |
| AT3G47250 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G47330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
| AT3G47350 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
| AT3G47380 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. |
| AT3G47400 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G47410 | hypothetical protein;(source:Araport11) |
| AT3G47420 | Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G47440 | Encodes AtTIP5;1, functions as water and urea channels in pollen. Target promoter of the male germline-specific transcription factor DUO1. Essential target of gibberellins, promotes hypocotyl cell elongation under excess boron stress. |
| AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
| AT3G47490 | HNH endonuclease;(source:Araport11) |
| AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT3G47530 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G47580 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G47600 | Encodes a putative transcription factor (MYB94). |
| AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
| AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
| AT3G47660 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G47720 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
| AT3G47730 | member of ATH subfamily |
| AT3G47740 | member of ATH subfamily |
| AT3G47750 | member of ATH subfamily |
| AT3G47760 | ABC2 homolog 4;(source:Araport11) |
| AT3G47770 | ABC2 homolog 5;(source:Araport11) |
| AT3G47780 | member of ATH subfamily The mRNA is cell-to-cell mobile. |
| AT3G47790 | ABC2 homolog 7;(source:Araport11) |
| AT3G47860 | Encodes a chloroplastic lipocalin AtCHL. Located in thylakoid lumen. Involved in the protection of thylakoidal membrane lipids against reactive oxygen species, especially singlet oxygen, produced upon excess light. LCNP is required for sustained photoprotective energy dissipation or NPQ (qH) to occur (PMID:29233855). |
| AT3G47870 | Required for normal cell division during pollen development. Mutant has extra cell in pollen of vegetative cell identity. Male gametophytic mutation. |
| AT3G47930 | L-Galactono-1,4-lactone dehydrogenase, catalyzes the final step of ascorbate biosynthesis. |
| AT3G47990 | SUGAR-INSENSITIVE 3;(source:Araport11) |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT3G48010 | member of Cyclic nucleotide gated channel family |
| AT3G48020 | hypothetical protein;(source:Araport11) |
| AT3G48080 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G48110 | glycine-tRNA ligase |
| AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT3G48201 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: GAUGGAUAUGUCUUCAAGGAC |
| AT3G48220 | F-box protein;(source:Araport11) |
| AT3G48231 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G48250 | Encodes a pentatricopeptide repeat protein implicated in splicing of intron 1 of mitochondrial nad7 transcripts. |
| AT3G48260 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT3G48280 | putative cytochrome P450 |
| AT3G48390 | MA3 domain-containing protein;(source:Araport11) |
| AT3G48425 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT3G48460 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G48470 | embryo defective 2423;(source:Araport11) |
| AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
| AT3G48550 | SHOOT GRAVITROPISM-like protein;(source:Araport11) |
| AT3G48580 | xyloglucan endotransglucosylase/hydrolase 11;(source:Araport11) |
| AT3G48650 | pseudogene of pectinesterase;(source:Araport11) |
| AT3G48720 | Encodes a hydroxycinnamoyl-CoA: v-hydroxy fatty acid transferase involved in cutin synthesis. Mutants are almost devoid of ferulic acid. |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
| AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G48840 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT3G48860 | coiled-coil protein;(source:Araport11) |
| AT3G48920 | Member of the R2R3 factor gene family. |
| AT3G48950 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT3G49020 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT3G49055 | ATP-binding protein;(source:Araport11) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G49150 | F-box/FBD/LRR protein;(source:Araport11) |
| AT3G49190 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT3G49200 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT3G49210 | WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT3G49260 | IQ-domain 21;(source:Araport11) |
| AT3G49270 | extensin-like protein;(source:Araport11) |
| AT3G49280 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G13655.1);(source:TAIR10) |
| AT3G49300 | proline-rich family protein;(source:Araport11) |
| AT3G49305 | transmembrane protein;(source:Araport11) |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G49410 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT3G49440 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G49450 | F-box protein involved in protein binding and ubiquitination; involved in male fertility. |
| AT3G49480 | F-Box Gene regulated by Agrobacterium virulence protein VirD5 and essential for Agrobacterium-mediated plant transformation. |
| AT3G49490 | hypothetical protein;(source:Araport11) |
| AT3G49500 | Encodes RNA-dependent RNA polymerase. Involved in trans-acting siRNA and other siRNA biogenesis. Required for post-transcriptional gene silencing and natural virus resistance.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
| AT3G49510 | F-box family protein;(source:Araport11) |
| AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G49540 | hypothetical protein;(source:Araport11) |
| AT3G49590 | Autophagy protein. |
| AT3G49601 | pre-mRNA-splicing factor;(source:Araport11) |
| AT3G49630 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G49668 | Natural antisense transcript overlaps with AT3G49670;(source:Araport11) |
| AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
| AT3G49725 | GTP-binding protein, HflX;(source:Araport11) |
| AT3G49832 | pseudogene of kelch repeat-containing F-box family |
| AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT3G49860 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Possible pseudogene because it lacks an N-terminal part that is conserved among the other ARL8 proteins. |
| AT3G49870 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
| AT3G49950 | GRAS family transcription factor;(source:Araport11) |
| AT3G49960 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
| AT3G49970 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G50010 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G50030 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
| AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
| AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G50160 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G50180 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G50220 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G50240 | Encodes a kinesin-related protein. |
| AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50290 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50295 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
| AT3G50350 | membrane insertase, putative (DUF1685);(source:Araport11) |
| AT3G50370 | hypothetical protein;(source:Araport11) |
| AT3G50376 | pseudogene of NLI interacting factor (NIF) family protein |
| AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
| AT3G50400 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G50420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G50440 | Encodes a protein shown to have methyl jasmonate esterase activity in vitro. This protein does not act on methyl IAA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT3G50450 | Homolog of RPW8 |
| AT3G50460 | Homolog of RPW8 |
| AT3G50470 | Homolog of RPW8 |
| AT3G50590 | WD40/YVTN repeat protein. |
| AT3G50610 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
| AT3G50640 | hypothetical protein;(source:Araport11) |
| AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT3G50710 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G50730 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT3G50755 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.3e-35 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G50760 | Encodes a protein with putative galacturonosyltransferase activity. The mRNA is cell-to-cell mobile. |
| AT3G50800 | PADRE protein. |
| AT3G50810 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT3G50835 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT3G50890 | homeobox protein 28;(source:Araport11) |
| AT3G50910 | netrin receptor DCC;(source:Araport11) |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT3G50940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G50950 | Encodes a canonical CC-type NLR protein that is required for the recognition of the T3SE HopZ1a as well as several other Hop effectors from the pathogenic bacteria P. syringae. |
| AT3G50980 | dehydrin xero 1;(source:Araport11) |
| AT3G51050 | NERD1 is a single copy locus encoding a protein of unknown function that is localized to the nucleus. Single mutants show defects in root hair growth, root meristem function, cell elongation. NERD1 appears to act synergistically with the exocyst in root development. |
| AT3G51060 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC) |
| AT3G51075 | Natural antisense transcript overlaps with AT3G51070;(source:Araport11) |
| AT3G51080 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G51110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G51120 | zinc finger CCCH domain-containing protein 44;(source:Araport11) |
| AT3G51150 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G51160 | Catalyzes the first step in the de novo synthesis of GDP-L-fucose. Loss of function mutations result in reduced levels of fucosylation and decreased freezing tolerance. |
| AT3G51190 | Ribosomal protein L2 family;(source:Araport11) |
| AT3G51200 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G51220 | WEB family protein (DUF827);(source:Araport11) |
| AT3G51260 | 20S proteosomal alpha subunits. Interacts with SnRK, SKP1/ASK1 during proteasomal binding of an SCF ubiquitin ligase. |
| AT3G51280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G51300 | Encodes a pollen-specific Rop GTPase, member of the Rho family of small GTP binding proteins that interacts with RIC3 and RIC4 to control tip growth in pollen tubes. These three proteins promote the proper targeting of exocytic vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1 GTPase activator protein. |
| AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G51375 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGCGCCAAUAUC |
| AT3G51400 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G51420 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT3G51490 | tonoplast monosaccharide transporter3;(source:Araport11) |
| AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
| AT3G51570 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G51590 | Encodes a member of the lipid transfer protein family. Proteins of this family are generally small (~9 kD), basic, expressed abundantly and contain eight Cys residues. The proteins can bind fatty acids and acylCoA esters and can transfer several different phospholipids. They are localized to the cell wall. The LTP12 promoter is active exclusively in the tapetum during the uninucleate microspore and bicellular pollen stages. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT3G51680 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G51700 | PIF1 helicase;(source:Araport11) |
| AT3G51740 | encodes a leucine-repeat receptor kinase expressed in inflorescence meristem. Locus association was made from performing sequence analysis with IMK3 (MRLK) whose locus association was provided by the authors. The mRNA is cell-to-cell mobile. |
| AT3G51760 | hypothetical protein (DUF688);(source:Araport11) |
| AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT3G51850 | member of Calcium Dependent Protein Kinase The mRNA is cell-to-cell mobile. |
| AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT3G51930 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G51940 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT3G51950 | Contains single CCCH domain. |
| AT3G51970 | acyl-CoA sterol acyl transferase 1;(source:Araport11) |
| AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G52030 | F-box family protein with WD40/YVTN repeat doamin;(source:Araport11) |
| AT3G52080 | encodes a cation:proton exchanger expressed in pollen |
| AT3G52110 | interferon-activable protein;(source:Araport11) |
| AT3G52155 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G52220 | leukocyte immunoglobulin-like receptor family A protein;(source:Araport11) |
| AT3G52250 | Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile. |
| AT3G52260 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G52270 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
| AT3G52320 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G52350 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
| AT3G52440 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G52460 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G52490 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT3G52500 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G52510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G52520 | hypothetical protein;(source:Araport11) |
| AT3G52525 | ovate family protein 6;(source:Araport11) |
| AT3G52530 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G52560 | MMZ4/UEV1D encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1D-4, a predicted splice variant, can interact relatively weakly with UBC35/UBC13A and UBC36/UBC13B in a yeast-2-hybrid UEV1D-4 can also significantly, but not totally, functionally complement an mms2 mutation in budding yeast by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS. uev1d-1 mutants are more sensitive than wild type plants to the DNA damaging agent MMS in seed germination and pollen germination assays. |
| AT3G52580 | Ribosomal protein S11 family protein;(source:Araport11) |
| AT3G52590 | Ubiquitin extension protein The mRNA is cell-to-cell mobile. |
| AT3G52600 | Cell wall invertase expressed in flowers and ovary placental tissues. Reduced expression is correlated with decreased ovule production suggesting a link between sugar sensing and ovule initiation. |
| AT3G52620 | transmembrane protein;(source:Araport11) |
| AT3G52690 | RNI-like superfamily protein;(source:Araport11) |
| AT3G52700 | hypothetical protein;(source:Araport11) |
| AT3G52730 | ubiquinol-cytochrome C reductase UQCRX/QCR9-like family protein;(source:Araport11) |
| AT3G52742 | other_RNA;(source:Araport11) |
| AT3G52840 | beta-galactosidase 2;(source:Araport11) |
| AT3G52850 | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles. The mRNA is cell-to-cell mobile. |
| AT3G52870 | IQ calmodulin-binding motif family protein;(source:Araport11) |
| AT3G52910 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower. |
| AT3G52930 | Aldolase superfamily protein;(source:Araport11) |
| AT3G52957 | Pseudogene of AT2G33200; F-box family protein |
| AT3G52970 | member of CYP76G |
| AT3G52990 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT3G53060 | SKP1-like 6;(source:Araport11) |
| AT3G53065 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
| AT3G53090 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. |
| AT3G53100 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G53150 | UDP-glucosyl transferase 73D1;(source:Araport11) |
| AT3G53160 | UGT73C7 is induced by pathogen infection. It glycosylates p-coumaric acid and ferulic acid to modulate phenylpropanoid metabolism and induce innate immune response. |
| AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
| AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G53200 | Member of the R2R3 factor gene family. |
| AT3G53210 | nodulin MtN21-like transporter family protein |
| AT3G53232 | ROTUNDIFOLIA like 1;(source:Araport11) |
| AT3G53250 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
| AT3G53280 | cytochrome P450 monooxygenase The mRNA is cell-to-cell mobile. |
| AT3G53290 | missing N-term 80 AA not found between end of 71B5 and start of this sequence probably a pseudogene, from http://drnelson.utmem.edu/biblioD.html |
| AT3G53300 | putative cytochrome P450 |
| AT3G53305 | putative cytochrome P450 |
| AT3G53310 | B3 domain transcription factor that binds to and regulates the expression of SOC1 and FT. |
| AT3G53330 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
| AT3G53400 | peptide upstream protein;(source:Araport11) |
| AT3G53410 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
| AT3G53420 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev. When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT3G53450 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT3G53460 | Encodes a nuclear gene with a consensus RNA-binding domain that is localized to the chloroplast. |
| AT3G53490 | valine-tRNA ligase;(source:Araport11) |
| AT3G53500 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT3G53510 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). Phloem-expressed and plasma membrane-localized jasmonate transporter which together with JAT3 and GLR3.3 involved in regulating long-distance translocation of JA, which is important for driving the loading, translocation of JA in the phloem pathway by a self-propagation mode, contributing to wound-induced systemic response/resistance. |
| AT3G53520 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT3G53530 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT3G53550 | FBD-like domain family protein;(source:Araport11) |
| AT3G53680 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT3G53690 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
| AT3G53750 | Member of the Actin gene family. Expressed in mature pollen. |
| AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
| AT3G53790 | Arabidopsis thaliana telomere-binding protein, putative (At3g53790) |
| AT3G53800 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). |
| AT3G53810 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G53900 | Encodes UPP, a plastidial uracil phosphoribosyltransferase (UPRT) involved in uracil salvage. Loss-of-function mutation causes dramatic growth retardation, a pale-green to albino phenotype, abnormal root morphology and chloroplastic disorders. |
| AT3G53920 | Encodes a sigma-like transcription factor, Sigma 3 (SIG3 or SIGC). As a subunit of chloroplast RNA polymerase, SIG3 confers the ability to recognize promoter sequences on the core enzyme. SIG3 transcribes specifically the psbN gene in plastids. |
| AT3G53940 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT3G53960 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G53980 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT3G54010 | Immunophilin-like protein similar to the p59 FK506-binding protein (FKBP52). Shows rotamase activity and contains an FKBP-like domain and three tetratricopeptide repeat units. Members of this class of mutation show ectopic cell proliferation in cotyledons. Gene may be alternatively spliced. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G54020 | Inositol phosphorylceramide synthase |
| AT3G54030 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
| AT3G54080 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G54130 | Josephin family protein;(source:Araport11) |
| AT3G54230 | Encodes a splicing factor SUA (suppressor of abi3-5), homologous to the human protein RBM5. Controls alternative splicing of the developmental regulator ABI3. |
| AT3G54290 | hemerythrin HHE cation-binding domain protein;(source:Araport11) |
| AT3G54300 | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
| AT3G54350 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT3G54360 | Encodes a catalase chaperon that is essential for catalase activity. Required for multiple stress responses. |
| AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G54410 | hypothetical protein (DUF1163);(source:Araport11) |
| AT3G54430 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT3G54440 | glycoside hydrolase family 2 protein;(source:Araport11) |
| AT3G54450 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G54490 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT3G54510 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT3G54520 | hypothetical protein;(source:Araport11) |
| AT3G54530 | hypothetical protein;(source:Araport11) |
| AT3G54570 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT3G54590 | Encodes a hydroxyproline-rich glycoprotein. The mRNA is cell-to-cell mobile. |
| AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
| AT3G54690 | Sugar isomerase (SIS) family protein;(source:Araport11) |
| AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT3G54820 | plasma membrane intrinsic protein 2;(source:Araport11) |
| AT3G54826 | Zim17-type zinc finger protein;(source:Araport11) |
| AT3G54860 | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. |
| AT3G54925 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
| AT3G55020 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G55080 | SET domain-containing protein;(source:Araport11) |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G55100 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55120 | Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems. Co-expressed with CHS. |
| AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin. |
| AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G55180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G55190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G55252 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
| AT3G55310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G55370 | Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots. |
| AT3G55400 | methionyl-tRNA synthetase / methionine-tRNA ligase / MetRS (cpMetRS);(source:Araport11) |
| AT3G55420 | hypothetical protein;(source:Araport11) |
| AT3G55440 | Encodes triosephosphate isomerase. |
| AT3G55450 | PBS1-like 1;(source:Araport11) |
| AT3G55500 | expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G55510 | Encodes a regulator of floral determinacy in that interacts with both nucleolar and nucleoplasmic proteins. |
| AT3G55512 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
| AT3G55550 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G55590 | Glucose-1-phosphate adenylyltransferase family protein;(source:Araport11) |
| AT3G55600 | Membrane fusion protein Use1;(source:Araport11) |
| AT3G55620 | Translation initiation factor IF6;(source:Araport11) |
| AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G55710 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G55720 | replication factor C subunit, putative (DUF620);(source:Araport11) |
| AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile. |
| AT3G55810 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G55840 | Hs1pro-1 protein;(source:Araport11) |
| AT3G55860 | hypothetical protein;(source:Araport11) |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT3G55920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
| AT3G55960 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
| AT3G56010 | transmembrane protein;(source:Araport11) |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
| AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
| AT3G56130 | biotin/lipoyl attachment domain-containing protein;(source:Araport11) |
| AT3G56150 | member of eIF3c - eukaryotic initiation factor 3c |
| AT3G56170 | Encodes a calcium-dependent nuclease with similarity to staphylococcal nuclease. |
| AT3G56180 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G56220 | transcription regulator;(source:Araport11) |
| AT3G56230 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT3G56280 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
| AT3G56360 | hypothetical protein;(source:Araport11) |
| AT3G56380 | response regulator 17 |
| AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
| AT3G56520 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT3G56530 | NAC domain containing protein 64;(source:Araport11) |
| AT3G56560 | NAC domain containing protein 65;(source:Araport11) |
| AT3G56600 | phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11) |
| AT3G56610 | prolamin-like protein;(source:Araport11) |
| AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT3G56660 | basic region/leucine zipper motif protein 49;(source:Araport11) |
| AT3G56700 | Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding. |
| AT3G56705 | U2-6;(source:Araport11) |
| AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. |
| AT3G56740 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with an important role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT3G56760 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G56770 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G56790 | RNA splicing factor-like protein;(source:Araport11) |
| AT3G56800 | encodes a calmodulin |
| AT3G56830 | Similar in sequence to NPQ6 and NPQ7, but loss of function mutant does not exhibit a nonphotochemical quenching phenotype. |
| AT3G56870 | hypothetical protein;(source:Araport11) |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
| AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
| AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein. |
| AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
| AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT3G57060 | Similar to mamalian condensin. Mutants have reduced fertility. |
| AT3G57072 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
| AT3G57100 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
| AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
| AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
| AT3G57250 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
| AT3G57260 | beta 1,3-glucanase |
| AT3G57270 | encodes a member of glycosyl hydrolase family 17 |
| AT3G57280 | Encodes a chloroplast inner envelope localized member of the Tmemb_14 gene family. FAX1 is involved in fatty acid and lipid homeostasis and likely functions as a fatty acid transporter that exports fatty acids from the plastid. The mRNA is cell-to-cell mobile. |
| AT3G57290 | Encodes a protein that is found in not only the eif3 complex but also in association with subunits of the COP9 signalosome. eIF3e appears to be subjected to proteasome-dependent degradation that requires the PCI domain of eIF3e. The level of eIF3e present in cells appears to affect the rate of translation. |
| AT3G57310 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
| AT3G57340 | DnaJ heat shock amino-terminal domain protein (DUF1977);(source:Araport11) |
| AT3G57350 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
| AT3G57380 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT3G57390 | encodes a MADS-box containing protein likely to be a transcription factor that is expressed in endosperm and developing gametophytes. The protein sequence is most similar to that of AGL15, which is expressed in developing embryos. |
| AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
| AT3G57420 | Regulates the assembly and trafficking of cellulose synthase complexes. |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
| AT3G57470 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
| AT3G57480 | SAP1 is a protein of unknown function whose expression is responsive to abiotic stressors including metals, salt, and ABA. Over expression confers increased tolerance to a variety of abiotic stressors. |
| AT3G57510 | Encodes ADPG1, a polygalacturonase protein involved in silique and anther dihiscence. Loss of function mutations have reduced seed set, indehiscent fruit and reduced pollen shedding. Required for release of cell wall-derived PR elicitors. |
| AT3G57540 | Remorin family protein;(source:Araport11) |
| AT3G57550 | guanylate kinase |
| AT3G57620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT3G57660 | Encodes a subunit of RNA polymerase I (aka RNA polymerase A). The mRNA is cell-to-cell mobile. |
| AT3G57700 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57710 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57765 | encodes a small nuclear RNA, which is a part of small nuclear ribonuclear particle (snRNP) and is involved in RNA processing such as splicing and polyadenylation. |
| AT3G57780 | nucleolar-like protein;(source:Araport11) |
| AT3G57790 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT3G57840 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G57850 | transmembrane protein;(source:Araport11) |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT3G57890 | Tubulin binding cofactor C domain-containing protein;(source:Araport11) |
| AT3G57950 | cotton fiber protein;(source:Araport11) |
| AT3G57965 | Natural antisense transcript overlaps with AT3G57970;(source:Araport11) |
| AT3G58010 | plastoglobulin 34kD;(source:Araport11) |
| AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G58050 | hypothetical protein;(source:Araport11) |
| AT3G58070 | Putative transcription factor, contains C2H2 domain, regulates aspects of shoot maturation in Arabidopsis thaliana. GIS loss-of-function mutations affect the epidermal differentiation of inflorescence organs, causing a premature decrease in trichome production on successive leaves, stem internodes, and branches. Overexpression has the opposite effect on trichome initiation and causes other heterochronic phenotypes, affecting flowering and juvenile?adult leaf transition and inducing the formation of rosette leaves on inflorescence stems. |
| AT3G58110 | Encodes an adaptor protein that connects JAZ repressors with the TPR2 co-repressor to suppress jasmonate-responsive anthocyanin accumulation. |
| AT3G58140 | phenylalanyl-tRNA synthetase class IIc family protein;(source:Araport11) |
| AT3G58150 | Optic atrophy 3 protein (OPA3);(source:Araport11) |
| AT3G58160 | Class XI myosin gene expressed in flowers from 4-6 week old plants and leaves from 3 week old plants |
| AT3G58165 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT3G58210 | TRAF-like family protein;(source:Araport11) |
| AT3G58230 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT3G58240 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G58250 | TRAF-like family protein;(source:Araport11) |
| AT3G58260 | TRAF-like family protein;(source:Araport11) |
| AT3G58270 | phospholipase-like protein (PEARLI 4) with TRAF-like domain protein;(source:Araport11) |
| AT3G58290 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G58300 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT3G58320 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT3G58330 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT3G58347 | Pseudogene of AT3G58330 |
| AT3G58350 | Encodes RTM3 (Restricted Tobacco etch potyvirus Movement), a protein belonging to a protein family of 29 members which has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end. There are at least three RTMs in Arabidopsis. RTM proteins might form a multiprotein complex in the resistance mechanism to block the long distance movement of potyviruses. |
| AT3G58360 | TRAF-like family protein;(source:Araport11) |
| AT3G58390 | Represses the RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. Impairs NSD likely by sequestering the HBS1 components of the NSD complex. |
| AT3G58400 | TRAF-like family protein;(source:Araport11) |
| AT3G58410 | TRAF-like family protein;(source:Araport11) |
| AT3G58420 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G58490 | Encodes a long-chain base 1-phosphate (LCBP) phosphatase that is expressed in the endoplasmic reticulum. |
| AT3G58520 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT3G58570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G58600 | Adaptin ear-binding coat-associated protein 1 NECAP-1;(source:Araport11) |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT3G58720 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT3G58740 | Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds. |
| AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
| AT3G58820 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G58850 | Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT3G58860 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G58877 | hypothetical protein;(source:Araport11) |
| AT3G58920 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G58960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G58990 | Small subunit, which together with IPMI SSU1, IPMISSU2 and IPMI LSU1, is a member of heterodimeric isopropylmalate isomerase (IPMI). Together with IPMI SSU3 participates in the Met chain elongation pathway. |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT3G59020 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT3G59068 | Natural antisense transcript overlaps with AT3G59070;(source:Araport11) |
| AT3G59070 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT3G59100 | encodes a protein similar to callose synthase |
| AT3G59120 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G59130 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G59140 | member of MRP subfamily |
| AT3G59160 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G59170 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT3G59230 | RNI-like superfamily protein;(source:Araport11) |
| AT3G59240 | RNI-like superfamily protein;(source:Araport11) |
| AT3G59250 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G59260 | pirin;(source:Araport11) |
| AT3G59330 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT3G59340 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT3G59450 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G59455 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT3G59510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G59530 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT3G59540 | Ribosomal L38e protein family;(source:Araport11) |
| AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT3G59590 | jacalin lectin family protein;(source:Araport11) |
| AT3G59620 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G59700 | Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000. |
| AT3G59710 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G59740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G59760 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization. |
| AT3G59780 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT3G59790 | Encodes a member of the MAP Kinase family. Thought to be a pseuedogene, MAPK10 is expressed very transiently during germination and in the leaf tips/hydathodes. Loss of function mutations are late flowering in long days and exhibit abnormal patterning of cotyledon veins. MPK10 interacts with and may be regulated by MPKK2 another map kinase. |
| AT3G59820 | LETM1-like protein;(source:Araport11) |
| AT3G59840 | allyl alcohol dehydrogenase-like protein;(source:Araport11) |
| AT3G59845 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT3G59920 | RAB GDP DISSOCIATION INHIBITOR 2 The mRNA is cell-to-cell mobile. |
| AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT3G59990 | Encodes a MAP2 like methionine aminopeptidase |
| AT3G60000 | QWRF motif protein (DUF566);(source:Araport11) |
| AT3G60020 | SKP1-like 5;(source:Araport11) |
| AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
| AT3G60060 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G60080 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G60100 | citrate synthase 5;(source:Araport11) |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G60130 | beta glucosidase 16;(source:Araport11) |
| AT3G60238 | other_RNA;(source:Araport11) |
| AT3G60250 | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
| AT3G60270 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G60280 | Encodes blue copper-binding protein III. |
| AT3G60290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G60328 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G60330 | H[+]-ATPase 7;(source:Araport11) |
| AT3G60340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G60360 | embryo sac development arrest 14;(source:Araport11) |
| AT3G60380 | cotton fiber protein;(source:Araport11) |
| AT3G60390 | Encodes homeobox protein HAT3. |
| AT3G60400 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT3G60410 | hypothetical protein (DUF1639);(source:Araport11) |
| AT3G60450 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G60470 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G60480 | StAR lipid transfer-like protein;(source:Araport11) |
| AT3G60500 | Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis. |
| AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT3G60520 | zinc ion-binding protein;(source:Araport11) |
| AT3G60580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G60590 | cytochrome P450 family protein;(source:Araport11) |
| AT3G60600 | Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2. |
| AT3G60680 | DUF641 family protein (DUF641);(source:Araport11) |
| AT3G60690 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G60710 | F-box family protein. |
| AT3G60750 | Transketolase;(source:Araport11) |
| AT3G60760 | hypothetical protein;(source:Araport11) |
| AT3G60770 | Ribosomal protein S13/S15;(source:Araport11) |
| AT3G60790 | F-box family protein;(source:Araport11) |
| AT3G60820 | Encodes 20S proteasome beta subunit PBF1 (PBF1). |
| AT3G60850 | hypothetical protein;(source:Araport11) |
| AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
| AT3G60910 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G60920 | beige/BEACH domain protein;(source:Araport11) |
| AT3G60955 | a cytochrome P450 pseudogene. overlaps with a real gene on the other strand. |
| AT3G60960 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G60961 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G60965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-146 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT3G60970 | member of MRP subfamily |
| AT3G61028 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT3G61035 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G61040 | encodes a protein with cytochrome P450 domain |
| AT3G61111 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
| AT3G61220 | CytADR/SDR1 is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. It can also act on menthone and neomenthol in vitro, but these do not represent likely endogenous activities of this enzyme in planta. GFP-tagged CytADR appears to localize to the cytosol where it likely plays a role in detoxifying reactive carbonyls. sdr1 mutants have altered responses to pathogens. The mRNA is cell-to-cell mobile. |
| AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
| AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
| AT3G61280 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G61340 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G61350 | Encodes an SKP1 interacting partner (SKIP4). |
| AT3G61360 | Encodes SLO3 (SLOW GROWTH3), a pentatricopeptide repeat protein required for the splicing of mitochondrial NADH dehydrogenase subunit7 intron 2. Mutants have smaller RAMs are slower growing than wild type. |
| AT3G61390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G61400 | 1-aminocyclopropane-1-carboxylate oxidase-like protein |
| AT3G61410 | U-box kinase family protein;(source:Araport11) |
| AT3G61415 | SKP1-like 21;(source:Araport11) |
| AT3G61420 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
| AT3G61450 | syntaxin of plants 73 (SYP73) |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT3G61490 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G61500 | BPS1-like protein;(source:Araport11) |
| AT3G61510 | Encodes a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. The gene is transcriptionally active but enzymatically inactive. The predicted amino-acid sequence of ACS1 is missing the highly conserved tripeptide, Thr-Asn-Pro (TNP), between Ile204 and Ser205. Introduction of TNP into ACS1 restores the ACS activity. |
| AT3G61560 | Reticulon family protein;(source:Araport11) |
| AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT3G61620 | exonuclease RRP41 (RRP41) |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT3G61710 | Encodes autophagy protein 6 (ATG6), required for pollen germination and plant development. |
| AT3G61720 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G61750 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT3G61755 | pre-tRNA tRNA-Ala (anticodon: CGC);(source:Araport11, TAIR10) |
| AT3G61820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
| AT3G61920 | PADRE protein. |
| AT3G61930 | hypothetical protein;(source:Araport11) |
| AT3G61940 | Member of Zinc transporter (ZAT) family. Expressed in roots under low zinc conditions. |
| AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
| AT3G62020 | germin-like protein (GLP10) |
| AT3G62030 | nuclear-encoded chloroplast stromal cyclophilin CYP20-3 (also known as ROC4). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT3G62070 | hypothetical protein;(source:Araport11) |
| AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT3G62270 | BOR2 is involved in efficient borate crosslinking of rhamnogalacturonan II in cell walls under boron limitation. |
| AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
| AT3G62310 | RNA helicase family protein;(source:Araport11) |
| AT3G62340 | member of WRKY Transcription Factor; Group II-c |
| AT3G62450 | DNA mismatch repair protein;(source:Araport11) |
| AT3G62455 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-232 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G62460 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT3G62529 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT3G62620 | Encodes a protein of unknown function. Previously this protein has been annotated computationally as a sucrose-phosphatase-related protein. However, the source of this annotation can not be verified. This annotation (sucrose-phosphatase-related) has been removed. |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT3G62650 | hypothetical protein;(source:Araport11) |
| AT3G62670 | member of Response Regulator: B- Type |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT3G62700 | member of MRP subfamily |
| AT3G62710 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G62720 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. |
| AT3G62740 | beta glucosidase 7;(source:Araport11) |
| AT3G62760 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT3G62770 | Required for autophagosome formation during nutrient deprivation and senescence, promotes pexophagy during seedling development. |
| AT3G62810 | complex 1 family protein / LVR family protein;(source:Araport11) |
| AT3G62840 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
| AT3G62890 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G63003 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
| AT3G63020 | hypothetical protein (DUF3049);(source:Araport11) |
| AT3G63040 | hypothetical protein;(source:Araport11) |
| AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
| AT3G63080 | Encodes glutathione peroxidase. |
| AT3G63120 | cyclin p1;(source:Araport11) |
| AT3G63140 | Encodes a protein with ribonuclease activity that is involved in plastid rRNA maturation. |
| AT3G63150 | Encodes a calcium binding GTPases that is localized to the mitochondrion and is involved in salt stress response. |
| AT3G63170 | Encodes a plastid stroma localized fatty acid binding protein involved in fatty acid metabolism. |
| AT3G63190 | The gene encodes a chloroplast ribosome recycling factor homologue. Analysis of mutants revealed its role in the chloroplast development and eary stages of embryo development. |
| AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
| AT3G63250 | Encodes a homocysteine methyltransferase (HMT). Among the three HMT coding genes in the genome, HMT2 is responsible for a significant proportion of HMT activity in the flower stalks and silique hulls. However, HMT2 does not significantly contribute to the total HMT activity in seeds. |
| AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
| AT3G63370 | Encodes a chloroplast RNA editing factor. |
| AT3G63380 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT3G63470 | serine carboxypeptidase-like 40;(source:Araport11) |
| AT3G63500 | Encodes a PHD-finger protein that, with TTA2, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT3G63510 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT4G00020 | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development and defense gene transcription during plant immune responses. |
| AT4G00026 | Encodes SD3 (Segregation Distortion 3), a protein with high similarity to yeast translocase on the inner mitochondrial membrane 21 (TIM21). sd3 mutants show seedling-lethal phenotype in light-grown seedlings and shorter hypocotyls in dark-grown seedlings. SD3 overexpression plants show increase in cell number and cell size, as well as elevated ATP level. |
| AT4G00060 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT4G00100 | Encodes a cytoplasmic ribosomal protein S13 homologue involved in early leaf development The mRNA is cell-to-cell mobile. |
| AT4G00110 | Encodes a putative membrane-anchored UDP-D-glucuronate 4-epimerase. |
| AT4G00140 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G00160 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G00165 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
| AT4G00232 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT4G00236 | pseudogene of Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT4G00240 | member of C2-PLD subfamily |
| AT4G00260 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G00290 | Encodes a non-selective mechanosensitive ion channel localized to the inner mitochondrial membrane. |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT4G00310 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G00315 | Member of a family of F-Box proteins. May function redundantly with FOF2 to negatively regulate FLC and flowering. |
| AT4G00330 | high overall homology to CRCK1 |
| AT4G00342 | hypothetical protein;(source:Araport11) |
| AT4G00355 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. |
| AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
| AT4G00390 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT4G00400 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT4. |
| AT4G00416 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT4G00430 | a member of the plasma membrane intrinsic protein subfamily PIP1. involved redundantly with PIP1;1/2/3/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT4G00440 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
| AT4G00460 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G00467 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT4G00530 | UvrABC system protein A;(source:Araport11) |
| AT4G00580 | COP1-interacting protein-like protein;(source:Araport11) |
| AT4G00600 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT4G00610 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT4G00650 | Encodes a major determinant of natural variation in Arabidopsis flowering time. Dominant alleles of FRI confer a vernalization requirement causing plants to overwinter vegetatively. Many early flowering accessions carry loss-of-function fri alleles .Twenty distinct haplotypes that contain non-functional FRI alleles have been identified and the distribution analyzed in over 190 accessions. The common lab strains- Col and Ler each carry loss of function mutations in FRI. |
| AT4G00651 | Fe superoxide dismutase;(source:Araport11) |
| AT4G00660 | RNAhelicase-like 8;(source:Araport11) |
| AT4G00695 | Spc97/Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G00780 | TRAF-like family protein;(source:Araport11) |
| AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT4G00820 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G00870 | bHLH14 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH17 to negatively regulate jasmonate responses. |
| AT4G00895 | ATPase, F1 complex, OSCP/delta subunit protein;(source:Araport11) |
| AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
| AT4G00920 | COP1-interacting protein-like protein;(source:Araport11) |
| AT4G00930 | Encodes COP1-interacting protein CIP4.1. |
| AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G00990 | jJumonji-domain-containing H3K9 histone demethylase. Loss of function mutants are susceptible to bacterial infection and early flowering. |
| AT4G01000 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G01010 | member of Cyclic nucleotide gated channel family |
| AT4G01023 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G01040 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT4G01080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT4G01160 | Encodes a member of LRB BTB family. It does not appear to participate in red light responses like LRB1 and LRB2. NO-interacting protein. |
| AT4G01170 | hypothetical protein;(source:Araport11) |
| AT4G01220 | Encodes MGP4 (MALE GAMETOPHYTE DEFECTIVE 4), a rhamnogalacturonan II xylosyltransferase important for growth of pollen tubes and roots. |
| AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
| AT4G01265 | Pseudogene of AT4G01265; raffinose synthase family protein |
| AT4G01280 | RVE5 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT4G01290 | Protein with evolutionarily conserved eIF4E-binding motif in its N-terminal domain that can form mRNA cap?binding complexes and has the potential for regulating gene expression as a translation factor associated plant-specific cell cycle regulator. |
| AT4G01320 | CAAX protease with broad substrate specificity. Localized exclusively to the endoplasmic reticulum. |
| AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT4G01420 | Encodes calcineurin B-like protein 5 (CBL5). Overexpression confers tolerance to drought and salt stress. |
| AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
| AT4G01480 | Encodes a protein that might have inorganic pyrophosphatase activity. |
| AT4G01510 | Arv1-like protein;(source:Araport11) |
| AT4G01515 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-18 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT4G01530 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G26860.1);(source:TAIR10) |
| AT4G01533 | other_RNA;(source:Araport11) |
| AT4G01535 | hypothetical protein;(source:Araport11) |
| AT4G01560 | Ribosomal RNA processing Brix domain protein;(source:Araport11) |
| AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G01640 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G01660 | Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant The mRNA is cell-to-cell mobile. |
| AT4G01670 | hypothetical protein;(source:Araport11) |
| AT4G01680 | Encodes a putative transcription factor (MYB55). |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G01750 | Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT2 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. The mRNA is cell-to-cell mobile. |
| AT4G01760 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G01800 | Encodes the ATPase subunit of the chloroplast Sec translocation machinery which plays an essential role in chloroplast biogenesis and the regulation of photosynthesis, the absence of which triggers a retrograde signal, eventually leading to a reprogramming of chloroplast and mitochondrial gene expression. |
| AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT4G01820 | member of MDR subfamily |
| AT4G01830 | P-glycoprotein 5;(source:Araport11) |
| AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G01900 | encodes a PII protein that may function as part of a signal transduction network involved in perceiving the status of carbon and organic nitrogen. Forms a protein complex with N-acetylglutamate kinase and regulates the kinase activity by relieving the feedback inhibition of the kinase by arginine. Regulates acetyl-CoA carboxylase activity. |
| AT4G01935 | insulin-induced protein;(source:Araport11) |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT4G01985 | hypothetical protein;(source:Araport11) |
| AT4G02030 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT4G02055 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G02090 | PADRE protein. |
| AT4G02100 | Heat shock protein DnaJ with tetratricopeptide repeat-containing protein;(source:Araport11) |
| AT4G02110 | transcription coactivator;(source:Araport11) |
| AT4G02130 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G02170 | cotton fiber protein;(source:Araport11) |
| AT4G02190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G02195 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP43, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT4G02235 | AGAMOUS-like 51;(source:Araport11) |
| AT4G02250 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G02270 | root hair specific 13;(source:Araport11) |
| AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
| AT4G02290 | glycosyl hydrolase 9B13;(source:Araport11) |
| AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G02420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G02430 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT4G02465 | hypothetical protein;(source:Araport11) |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT4G02530 | MPH2 is a green lineage-specific thylakoid lumen protein required for photosynthetic acclimation of PSII to stressful light conditions (PMID:28874535). |
| AT4G02560 | Encodes a nuclear localized protein with similarity to transcriptional regulators. Recessive mutants are late flowering. Expression of LFY is reduced in LD mutants. LD has been reported to exhibit prion like behavior in yeast but it remains to be determined if such activity exists during normal plant development. |
| AT4G02570 | Encodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. |
| AT4G02600 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO1 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and in papillae, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT4G02630 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT4G02670 | indeterminate(ID)-domain 12;(source:Araport11) |
| AT4G02700 | sulfate transporter 3;(source:Araport11) |
| AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G02740 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G02770 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD1) |
| AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
| AT4G02800 | GRIP/coiled-coil protein;(source:Araport11) |
| AT4G02810 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT4G02820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G02870 | B3 domain protein;(source:Araport11) |
| AT4G02880 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT4G02930 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
| AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
| AT4G02950 | Ubiquitin family protein;(source:Araport11) |
| AT4G03050 | The transcribed allele in ecotype Ler encodes a 2-oxoglutarate-dependent dioxygenase which is involved in glucosinolate biosynthesis. AOP3 is transcriptionally silent in leaf tissues of ecotype Col.The natural variation in this locus explains the diversification of hydroxyalkyl glucosinolates among different ecotypes of Arabidopsis. |
| AT4G03060 | Encodes a truncated and null function protein, due to a 5-bp deletion in cDNA. The functional allele in ecotype Cvi, AOP2, encodes a 2-oxoglutarate-dependent dioxygenase which is involved in glucosinolate biosynthesis. The natural variation in this locus explains the diversification of alkenyl glucosinolate among different ecotypes of Arabidopsis. |
| AT4G03100 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT4G03115 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT4G03190 | Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression. |
| AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
| AT4G03220 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT4G03280 | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT4G03290 | EF hand calcium-binding protein family;(source:Araport11) |
| AT4G03320 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
| AT4G03364 | Pseudogene of AT4G05230; ubiquitin family protein |
| AT4G03370 | Ubiquitin family protein;(source:Araport11) |
| AT4G03380 | hypothetical protein;(source:Araport11) |
| AT4G03390 | STRUBBELIG-receptor family 3;(source:Araport11) |
| AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
| AT4G03430 | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G03435 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT4G03445 | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG |
| AT4G03450 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G03460 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G03470 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G03505 | hypothetical protein;(source:Araport11) |
| AT4G03566 | ribonuclease H;(source:Araport11) |
| AT4G03620 | myosin heavy chain-like protein;(source:Araport11) |
| AT4G03630 | RNI-like superfamily protein;(source:Araport11) |
| AT4G03811 | other_RNA;(source:Araport11) |
| AT4G03816 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-22 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT4G03830 | hypothetical protein (Protein of unknown function, DUF601);(source:Araport11) |
| AT4G03873 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.5e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G03930 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G03975 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G36060.1);(source:TAIR10) |
| AT4G04090 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT4G04120 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.8e-19 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT4G04145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-189 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G04170 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-87 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G04260 | Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
| AT4G04290 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-94 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT4G04296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-13 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G04313 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-52 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT4G04350 | tRNA synthetase class I (I, L, M and V) family protein;(source:Araport11) |
| AT4G04404 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT4G04410 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-176 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT4G04423 | hypothetical protein;(source:Araport11) |
| AT4G04440 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-215 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
| AT4G04460 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT4G04480 | F-box protein with a domain protein;(source:Araport11) |
| AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04500 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04545 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G09170.1);(source:TAIR10) |
| AT4G04547 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-68 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G04635 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43722.1);(source:TAIR10) |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT4G04680 | Rix1 complex component;(source:Araport11) |
| AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G04693 | pseudogene of F-box family protein;(source:Araport11) |
| AT4G04695 | member of Calcium Dependent Protein Kinase. Involved in response to salicylic acid. |
| AT4G04700 | member of Calcium Dependent Protein Kinase |
| AT4G04710 | member of Calcium Dependent Protein Kinase |
| AT4G04770 | Encodes an iron-stimulated ATPase. A member of the NAP subfamily of ABC transporters. Involved in Fe-S cluster assembly. Similar to SufB. Involved in the regulation of iron homeostasis. Able to form homodimers. Interacts with AtNAP7 inside the chloroplast. |
| AT4G04830 | methionine sulfoxide reductase B5;(source:Araport11) |
| AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
| AT4G04885 | Encodes PCFS4 (Pcf11p-similar protein 4), a homolog of yeast polyadenylation factor Protein 1 of Cleavage Factor (Pcf11p). Regulates FCA (AT4G16280) mRNA polyadenylation. Promotes flowering time. |
| AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
| AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
| AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
| AT4G04940 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G04950 | Encodes a monothiol glutaredoxin that is a critical component involved in ROS accumulation, auxin signaling, and temperature-dependent postembryonic growth in plants. It has been shown to associate with the cytosolic Fe-S assembly (CIA) complex and contributes to, but is not essential for, the correct functioning of client Fe-S proteins in unchallenged conditions. |
| AT4G04955 | Encodes an allantoinase which is involved in allantoin degradation and assimilation. Gene expression was induced when allantoin was added to the medium. The insertion mutant, ataln m2-1, did not grow well on the MS medium where allantoin, instead of ammonium nitrate, was supplied. |
| AT4G04972 | hypothetical protein;(source:Araport11) |
| AT4G04980 | hypothetical protein;(source:Araport11) |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT4G05030 | Copper transport protein family;(source:Araport11) |
| AT4G05040 | ankyrin repeat family protein;(source:Araport11) |
| AT4G05048 | Encodes a C/D box snoRNA (U49.1). Gb: AJ300655 |
| AT4G05050 | polyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. |
| AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G05095 | non-LTR retrolelement reverse transcriptase;(source:Araport11) |
| AT4G05100 | Member of the R2R3 factor gene family. |
| AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
| AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
| AT4G05160 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At4g05160 preferentially activates fatty acids with medium chain length (C6:0 and C7:0) as well as even-numbered long-chain fatty acids (C14:0, C16:0 and C18:0). At4g05160 was also able to catalyze the conversion of OPC-6:0 to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT4G05170 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G05230 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05240 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05260 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT4G05340 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G05380 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT4G05430 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G05460 | Encodes a SKP1/ASK-Interacting protein. |
| AT4G05475 | RNI-like superfamily protein;(source:Araport11) |
| AT4G05495 | pseudogene of temperature sensing protein-like protein;(source:Araport11) |
| AT4G05497 | RNI-like superfamily protein;(source:Araport11) |
| AT4G05520 | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290). |
| AT4G05530 | Encodes a peroxisomal member of the short-chain dehydrogenase/reductase (SDR) family of enzymes. Loss of IBR1 function causes increased resistance to indole-3-butyric acid without affecting plant responses to IAA, NAA, and 2,4-D. This enzyme may be responsible for catalyzing a dehydrogenation step in the beta-oxidation-like conversion of IBA to IAA. The mRNA is cell-to-cell mobile. |
| AT4G05540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G05583 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-48 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G05590 | Encodes NRGA1, a putative mitochondrial pyruvate carrier that mediates ABA regulation of guard cell ion channels and drought stress responses. |
| AT4G05592 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT4G06474 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein;(source:TAIR10) |
| AT4G06477 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.1e-112 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G06479 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT4G06481 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam domain PF03078: ATHILA ORF-1 family;(source:TAIR10) |
| AT4G06496 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06510 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.3e-15 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT4G06518 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06525 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-68 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G06526 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT4G06539 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.6e-174 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06547 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-14 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06548 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G06551 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06557 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 6.5e-16 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT4G06558 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 1.4e-83 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT4G06565 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06572 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-68 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G06598 | basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT4G06629 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.6e-12 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06635 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06636 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-74 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G06646 | transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1081_B12.13, blastp match of 33%25 identity and 9.8e-51 P-value to GP|27817864|dbj|BAC55632.1||AP003865 OJ1081_B12.13 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT4G06654 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.2e-88 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT4G06658 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-182 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT4G06676 | etoposide-induced protein;(source:Araport11) |
| AT4G06692 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.8e-160 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT4G06708 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-289 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06750 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.0e-60 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT4G07340 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G05090.1);(source:TAIR10) |
| AT4G07460 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42430.1);(source:TAIR10) |
| AT4G07475 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to En/Spm-like transposon protein;(source:TAIR10) |
| AT4G07498 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-42 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G07516 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
| AT4G07583 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G07720 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
| AT4G07736 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.6e-114 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G07780 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.1e-225 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G07795 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10) |
| AT4G07803 | transposable_element_gene;(source:Araport11);pseudogene, helicase -related, similar to putative helicase;(source:TAIR10) |
| AT4G07825 | transmembrane protein;(source:Araport11) |
| AT4G07850 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.2e-135 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G07896 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to contains similarity to Arabidopsis thaliana hypothetical protein (GB:AC004483);(source:TAIR10) |
| AT4G07932 | hypothetical protein;(source:Araport11) |
| AT4G07950 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
| AT4G07960 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT4G08032 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, similar to transposase, putative;(source:TAIR10) |
| AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
| AT4G08053 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.4e-89 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT4G08054 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.0e-70 P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
| AT4G08056 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
| AT4G08076 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-64 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08090 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.4e-12 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08106 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.7e-28 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08108 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08110 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-66 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08135 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-10 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08136 | pseudogene of purple acid phosphatase 10;(source:Araport11) |
| AT4G08160 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT4G08230 | glycine-rich protein;(source:Araport11) |
| AT4G08262 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.5e-30 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G08264 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, similar to transposase, putative;(source:TAIR10) |
| AT4G08290 | nodulin MtN21-like transporter family protein |
| AT4G08330 | hypothetical protein;(source:Araport11) |
| AT4G08340 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT4G08360 | KOW domain-containing protein;(source:Araport11) |
| AT4G08406 | transmembrane protein;(source:Araport11) |
| AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G08460 | hypothetical protein (DUF1644);(source:Araport11) |
| AT4G08470 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. |
| AT4G08480 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. |
| AT4G08555 | hypothetical protein;(source:Araport11) |
| AT4G08560 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT4G08596 | transposable_element_gene;(source:Araport11);pseudogene, FAR1 -related protein, temporary automated functional assignment;(source:TAIR10) |
| AT4G08599 | Pseudogene of AT5G28720; unknown protein |
| AT4G08740 | hypothetical protein;(source:Araport11) |
| AT4G08770 | Encodes a putative apoplastic peroxidase Prx37. Primarily expressed in the vascular bundles. Overexpression renders a dwarf phenotype with smaller plants and delayed development. Plants overexpressing Prx37 also shows an increase in the amount of esterified phenolic material associated with their walls. |
| AT4G08840 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT4G08867 | hypothetical protein;(source:Araport11) |
| AT4G08895 | inorganic phosphate transporter family protein;(source:Araport11) |
| AT4G08900 | Encodes an arginase, likely to be involved in polyamine biosynthesis in pollen. |
| AT4G08910 | homeobox protein;(source:Araport11) |
| AT4G08945 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.2e-16 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT4G08990 | DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
| AT4G09040 | Encodes a protein that binds to the chloroplast psbA RNA. Has little effect on chloroplast gene expression under laboratory growth conditions. |
| AT4G09090 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09143 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G09450 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT4G09540 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
| AT4G09550 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT4G09570 | Encodes a member of Calcium Dependent Protein Kinase (CDPK) gene family.Positive regulator of ABA signaling. Phosphorylates ABA responsive transcription factors ABF1 and ABF4. |
| AT4G09630 | transmembrane protein (DUF616);(source:Araport11) |
| AT4G09690 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G09760 | encodes a choline synthase whose gene expression is induced by high salt and mannitol. |
| AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G09920 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT4G09930 | Avirulence induced gene (AIG1) family protein;(source:Araport11) |
| AT4G09940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT4G10000 | Thioredoxin family protein;(source:Araport11) |
| AT4G10010 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G10020 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
| AT4G10040 | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. Double mutants with CYTC-1 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
| AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
| AT4G10070 | KH domain-containing protein;(source:Araport11) |
| AT4G10120 | Encodes a sucrose-phosphate synthase. |
| AT4G10180 | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling. The mRNA is cell-to-cell mobile. |
| AT4G10200 | TTF-type zinc finger protein with HAT dimerization domain-containing protein;(source:Araport11) |
| AT4G10290 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G10300 | RmlC-like cupins superfamily protein. Overexpression leads to trehalose resistance, drought and stress tolerance. |
| AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
| AT4G10370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
| AT4G10390 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G10400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G10430 | TMPIT-like protein;(source:Araport11) |
| AT4G10440 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G10480 | Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11) |
| AT4G10490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT4G10510 | Subtilase family protein;(source:Araport11) |
| AT4G10520 | Subtilase family protein;(source:Araport11) |
| AT4G10530 | Subtilase family protein;(source:Araport11) |
| AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
| AT4G10595 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G10610 | RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). |
| AT4G10613 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT4G10660 | CDC68-like protein;(source:Araport11) |
| AT4G10680 | transcription factor IIB (TFIIB) family protein;(source:Araport11) |
| AT4G10690 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-256 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT4G10710 | encodes a component of the FAcilitates Chromatin Transcription (FACT) complex, SPT16.Along with SSRP1 binds to the promoter of FLC. |
| AT4G10720 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G10740 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G10770 | oligopeptide transporter |
| AT4G10820 | F-box family protein;(source:Araport11) |
| AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT4G10850 | Nodulin MtN3 family protein;(source:Araport11) |
| AT4G10910 | hypothetical protein;(source:Araport11) |
| AT4G11040 | Encodes a nuclear localized protein with sequence similarity to PP2C phosphatases that is involved in seed dormancy. Loss of function mutations have reduced seed dormancy but does not act through ABA or DOG1 pathways. Lacks several conserved key residues and does not possess any appreciable phosphatase activity in in vitro assays. QTL allele with a nonsynonymous amino acid change confers seed dormancy phenotype. |
| AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
| AT4G11080 | Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes. |
| AT4G11160 | Translation initiation factor 2, small GTP-binding protein;(source:Araport11) |
| AT4G11170 | Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1. |
| AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G11250 | AGAMOUS-like 52;(source:Araport11) |
| AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
| AT4G11330 | MAP kinase |
| AT4G11340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G11350 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT4G11375 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-183 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G11380 | Adaptin family protein;(source:Araport11) |
| AT4G11400 | ARID/BRIGHT DNA-binding , ELM2 domain and myb-like DNA-binding domain-containing protein;(source:Araport11) |
| AT4G11460 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11470 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11485 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G11550 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G11580 | RNI-like superfamily protein;(source:Araport11) |
| AT4G11600 | Encodes glutathione peroxidase. Exhibits moderate binding affinity with dinotefuran. |
| AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G11650 | osmotin-like protein |
| AT4G11670 | DNA topoisomerase 4 subunit B (DUF810);(source:Araport11) |
| AT4G11690 | Encodes ABO8, a pentatricopeptide repeat (PPR) protein responsible for the splicing of NAD4 intron 3 in mitochondrial complex I. Abo8 mutants accumulate more reactive oxygen species (ROS) in root tips than the wild type. |
| AT4G11700 | hypothetical protein (DUF626);(source:Araport11) |
| AT4G11720 | Encodes HAP2 with the following predicted motifs: an N-terminal secretion signal, a single transmembrane domain and a C-terminal histidine-rich domain. HAP2 is expressed only in the haploid sperm and is required for pollen tube guidance and fertilization. Predominantly localized to sperm endoplasmic reticulum membranes. May also reside in other endomembranes, including the plasma membrane. Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
| AT4G11745 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G11760 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G11770 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G11780 | GAR2-like protein;(source:Araport11) |
| AT4G11810 | Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT4G11845 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
| AT4G11900 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G11920 | Encodes a putative activator of the anaphase-promoting complex/cyclosome. Promotes exit from the cell cycle and entry into the endocycle leading to endoreduplication. Mutation of this gene results in abnormal shoot apical meristem development. It likely regulates the development of meristems by indirectly interacting with WUS and CLV3. |
| AT4G11930 | hypothetical protein;(source:Araport11) |
| AT4G11940 | Encodes a nuclear localized dosage sensitive paternally expressed imprinted gene. It is a member of a family of molecular chaperones called J-domain. Loss of ADM function suppresses seed abortion of triploid embryos and also partially rescues the effect of mea mutations. |
| AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G12020 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002,7(7):301. Co-regulates with DSC1 basal levels of immunity to root-knot nematodes. |
| AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
| AT4G12060 | Double Clp-N motif protein;(source:Araport11) |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G12080 | AT-hook motif nuclear-localized protein 1;(source:Araport11) |
| AT4G12090 | Cornichon family protein;(source:Araport11) |
| AT4G12100 | Cullin family protein;(source:Araport11) |
| AT4G12120 | member of KEULE Gene Family |
| AT4G12150 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
| AT4G12180 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-28 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G12190 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G12220 | hypothetical protein;(source:Araport11) |
| AT4G12270 | Copper amine oxidase family protein;(source:Araport11) |
| AT4G12310 | member of CYP706A |
| AT4G12320 | member of CYP706A |
| AT4G12370 | F-box/kelch-repeat protein;(source:Araport11) |
| AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT4G12423 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G12440 | adenine phosphoribosyl transferase 4;(source:Araport11) |
| AT4G12460 | OSBP(oxysterol binding protein)-related protein 2B;(source:Araport11) |
| AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
| AT4G12490 | Encodes a member of the AZI family of lipid transfer proteins. Contains a PRR domain that appears to be required for localization to the chloroplast. |
| AT4G12520 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G12600 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT4G12617 | B3 domain protein;(source:Araport11) |
| AT4G12640 | Encodes a member of the Split ends (Spen) protein family that is characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. Knockout and overexpression mutants show no apparent changes in growth, development and flowering time under standard growth conditions. |
| AT4G12650 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT4G12731 | hypothetical protein;(source:Araport11) |
| AT4G12735 | Encodes a peroxisomal protein. |
| AT4G12740 | HhH-GPD base excision DNA repair family protein;(source:Araport11) |
| AT4G12760 | RPA-interacting protein A;(source:Araport11) |
| AT4G12790 | GPN GTPase involved in selective nuclear import of RNA polymerase II. |
| AT4G12860 | EF hand calcium-binding protein family;(source:Araport11) |
| AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
| AT4G12930 | hypothetical protein;(source:Araport11) |
| AT4G12940 | hypothetical protein;(source:Araport11) |
| AT4G13000 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT4G13020 | Encodes a member of the cdc2+ family of protein kinases MHK. Similar to the mak genes of rats. mak encodes a protein kinase that may play a role in spermatogenesis. |
| AT4G13100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G13110 | BSD domain-containing protein;(source:Araport11) |
| AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G13200 | Plastoglobular protein which is involved in chloroplast function and thylakoid formation. |
| AT4G13230 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G13245 | snoRNA;(source:Araport11) |
| AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
| AT4G13265 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT4G13266 | PGG domain containing transmembrane protein.Functions in the stigma to prevent interspecies pollen from forming pollen tubes. |
| AT4G13345 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT4G13370 | Member of a novel, plant specific family of microtubule associated proteins. |
| AT4G13410 | encodes a gene similar to cellulose synthase |
| AT4G13420 | Encodes a protein of the KUP/HAK/KT potassium channel class that is upregulated in the roots by K levels. |
| AT4G13440 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G13470 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G24255.1);(source:TAIR10) |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT4G13490 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G13494 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU |
| AT4G13500 | transmembrane protein;(source:Araport11) |
| AT4G13505 | Natural antisense transcript overlaps with AT4G13510;(source:Araport11) |
| AT4G13510 | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile. |
| AT4G13530 | transmembrane protein;(source:Araport11) |
| AT4G13580 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT4G13590 | Chloroplast manganese transporter required for chloroplast manganese homeostasis and photosynthetic function. |
| AT4G13600 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G13610 | DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
| AT4G13611 | Pseudogene of AT3G56530; ANAC064 (Arabidopsis NAC domain containing protein 64); transcription factor |
| AT4G13615 | Uncharacterized protein family SERF;(source:Araport11) |
| AT4G13620 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. The mRNA is cell-to-cell mobile. |
| AT4G13680 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G13720 | Inosine triphosphate pyrophosphatase family protein;(source:Araport11) |
| AT4G13750 | Encodes NO VEIN (NOV), a plant-specific nuclear factor required for leaf vascular development, cellular patterning and stem cell maintenance in the root meristem, as well as for cotyledon outgrowth and separation. nov mutations affect many aspects of auxin-dependent development without directly affecting auxin perception. |
| AT4G13760 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
| AT4G13780 | methionine-tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS;(source:Araport11) |
| AT4G13810 | receptor like protein 47;(source:Araport11) |
| AT4G13820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G13830 | DnaJ-like protein (J20); nuclear gene |
| AT4G13840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G13870 | Encodes a protein with homology to the exonuclease domain of hWRN-p of human protein Werner Syndrome Exonuclease (WEX). Forms a complex with the heterodimeric factor Ku. The interaction with KU stimulates WEX exonuclease activity. |
| AT4G13880 | receptor like protein 48;(source:Araport11) |
| AT4G13885 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT4G13890 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
| AT4G13918 | Natural antisense transcript overlaps with AT4G13920;(source:Araport11) |
| AT4G13920 | receptor like protein 50;(source:Araport11) |
| AT4G13930 | Encodes a serine hydroxymethyltransferase maximally expressed in root |
| AT4G13965 | F-box/FBD/LRR protein;(source:Araport11) |
| AT4G13990 | Exostosin family protein;(source:Araport11) |
| AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G14040 | selenium-binding protein 2;(source:Araport11) |
| AT4G14060 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G14070 | Plastidic acyl activating enzyme involved in the elongation of exogenous medium-chain fatty acids to 16- and 18-carbon fatty acids. |
| AT4G14096 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G14100 | transferases, transferring glycosyl groups;(source:Araport11) |
| AT4G14103 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G14130 | xyloglucan endotransglycosylase-related protein (XTR7) |
| AT4G14140 | This gene is predicted to encode a DNA methyltransferase. A plant line expressing an RNAi construct directed against DMT2 has reduced agrobacterium-mediated tumor formation. |
| AT4G14145 | cytochrome C oxidase assembly protein;(source:Araport11) |
| AT4G14225 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT4G14226 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G14230 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT4G14250 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is split into two UBX domain-containing pseudogenes: one retains the original name: AT4G14250 (Chr4:8213237..8211984), one given a new locus identifier AT4G14245 (Chr4:8210231..8208985). Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT4G14260 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G14276 | Encodes a defensin-like (DEFL) family protein. |
| AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G14320 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT4G14340 | Phosphorylates serine or threonine residues that are near and C-terminal to acidic side chains on a variety of target proteins. Member of CKL gene family (CKL-C group). |
| AT4G14365 | hypothetical protein;(source:Araport11) |
| AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT4G14370 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G14380 | cotton fiber protein;(source:Araport11) |
| AT4G14390 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G14430 | Encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation. This enzyme might also be involved in the conversion of indole-3-butyric acid to indole-3-acetic acid via a beta-oxidation-like pathway. |
| AT4G14440 | encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT4G14455 | Encodes a Bet1/Sft1-like SNARE protein, which can only partially suppresses the temperature-sensitive growth defect in sft1-1 yeast cells; however, it cannot support the deletion of the yeast BET1 gene (bet1Δ). In yeast, Bet1p is the v-SNARE (soluble N-ethylmaleimide-sensitive factor adaptor protein receptor, V-type) involved in trafficking between the ER and Golgi. |
| AT4G14480 | Encodes a putative Ser/Thr protein kinase, BLUS1 (BLUE LIGHT SIGNALING1). BLUS1 functions as a phototropin substrate and primary regulator of stomatal control to enhance photosynthetic CO2 assimilation under natural light conditions. |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
| AT4G14560 | auxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein. The mRNA is cell-to-cell mobile. |
| AT4G14580 | CBL-interacting protein kinase |
| AT4G14610 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
| AT4G14630 | germin-like protein with N-terminal signal sequence that may target it to the vacuole, plasma membrane and/or outside the cell. The mRNA is cell-to-cell mobile. |
| AT4G14650 | hypothetical protein;(source:Araport11) |
| AT4G14660 | Non-catalytic subunit specific to DNA-directed RNA polymerase V; homologous to budding yeast RPB7 |
| AT4G14670 | This locus was originally annotated as encoding ClpB2 (also referred to as Hsp92.7), which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. However, according to Lee et al. (2007, Plant Journal, 49:115-127), there is no evidence for expression of an appropriate-sized mRNA from this locus. Re-annotation of the genome indicates that this locus potentially encodes a 68.8-kDa protein, containing only the N-terminal two thirds of the originally predicted open reading frame. This locus contains a 626-bp deletion in WS ecotype compared with the Col ecotype, which eliminates residues 1-86 of the predicted protein. |
| AT4G14710 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G14713 | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter. |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14743 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G14760 | kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT4G14785 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G14815 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G14860 | ovate family protein 11;(source:Araport11) |
| AT4G14870 | Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. The mRNA is cell-to-cell mobile. |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT4G14950 | KMS1 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT4G14980 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G14990 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
| AT4G15000 | Ribosomal L27e protein family;(source:Araport11) |
| AT4G15020 | hAT transposon superfamily;(source:Araport11) |
| AT4G15030 | folate-sensitive fragile site protein;(source:Araport11) |
| AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G15050 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT4G15060 | FBD, F-box/LRR protein;(source:Araport11) |
| AT4G15070 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G15075 | FBD-like domain family protein;(source:Araport11) |
| AT4G15093 | catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11) |
| AT4G15100 | serine carboxypeptidase-like 30;(source:Araport11) |
| AT4G15110 | member of CYP97B |
| AT4G15150 | glycine-rich protein;(source:Araport11) |
| AT4G15180 | Encodes SET domain containing protein that acts redundantly with ATX4/5 to regulate histone H3-K4 methylation. |
| AT4G15200 | Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes. |
| AT4G15210 | cytosolic beta-amylase expressed in rosette leaves and inducible by sugar. RAM1 mutants have reduced beta amylase in leaves and stems. |
| AT4G15215 | pleiotropic drug resistance 13;(source:Araport11) |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT4G15248 | B-box type zinc finger family protein;(source:Araport11) |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
| AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
| AT4G15300 | cytochrome P450, family 702, subfamily A, polypeptide 2;(source:Araport11) |
| AT4G15310 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT4G15320 | encodes a gene similar to cellulose synthase |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT4G15350 | member of CYP705A |
| AT4G15360 | member of CYP705A |
| AT4G15380 | member of CYP705A |
| AT4G15390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G15393 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT4G15396 | cytochrome P450, family 702, subfamily A, polypeptide 6;(source:Araport11) |
| AT4G15417 | RNAse II-like 1;(source:Araport11) |
| AT4G15420 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT4G15440 | Encodes a hydroperoxide lyase. Also a member of the CYP74B cytochrome p450 family. In the ecotype Columbia (Col) the gene contains a 10-nucleotide deletion in its first exon that causes it to code for a truncated protein that results in a non-functional hydroperoxide lyase. |
| AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT4G15475 | Contributes to UV tolerance through nucleotide excision repair. |
| AT4G15480 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15520 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
| AT4G15545 | NAI1 interacting protein, involved in ER body formation. |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15630 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15650 | kinase-like protein;(source:Araport11) |
| AT4G15715 | Proteinase inhibitor I25, cystatin, conserved region;(source:Araport11) |
| AT4G15720 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G15733 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G15755 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
| AT4G15802 | Encodes a protein with similarity to heat shock factor binding proteins. Involved in negative regulation of heat shock response. Becomes nuclear localized upon heat treatment. |
| AT4G15810 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G15850 | plant DEAD box-like RNA helicase. |
| AT4G15860 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-43 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT4G15910 | encodes a gene whose transcript level in root and leaves increases to progressive drought stress. The transcript level is also affected by changes of endogenous or exogenous abscisic acid level. It appears to be a member of plant-specific gene family that includes late embryo-abundant and zinc- IAA-induced proteins in other plants. The mRNA is cell-to-cell mobile. |
| AT4G15953 | Encodes a Maternally expressed gene (MEG) family protein |
| AT4G15980 | ProPME pectin methylesterase |
| AT4G15990 | hypothetical protein;(source:Araport11) |
| AT4G16030 | Ribosomal protein L19e family protein;(source:Araport11) |
| AT4G16060 | hypothetical protein;(source:Araport11) |
| AT4G16070 | lipase class 3 family protein;(source:Araport11) |
| AT4G16095 | RNI-like superfamily protein;(source:Araport11) |
| AT4G16141 | GATA type zinc finger transcription factor family protein;(source:Araport11) |
| AT4G16150 | CATMA5 is a transcriptional activator. It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT4G16190 | Papain family cysteine protease;(source:Araport11) |
| AT4G16200 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT4G16230 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G16235 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT4G16240 | hypothetical protein;(source:Araport11) |
| AT4G16250 | Encodes a phytochrome photoreceptor with a function similar to that of phyB that absorbs the red/far-red part of the light spectrum and is involved in light responses. It cannot compensate for phyB loss in Arabidopsis but can substitute for tobacco phyB in vivo. |
| AT4G16330 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G16350 | Calcium sensor protein. Binds CIPK14. |
| AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
| AT4G16430 | bHLH3 interacts with JAZ proteins, and functions redundantly with bHLH13, bHLH14 and bHLH17 to negatively regulate jasmonate responses. |
| AT4G16442 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G16447 | hypothetical protein;(source:Araport11) |
| AT4G16450 | NADH-ubiquinone oxidoreductase;(source:Araport11) |
| AT4G16460 | zinc finger CCCH domain protein;(source:Araport11) |
| AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G16550 | HSP20-like chaperone, expression is induced by stress. |
| AT4G16563 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G16580 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G16620 | nodulin MtN21-like transporter family protein |
| AT4G16660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G16680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G16700 | Encodes a mitochondrial phosphatidylserine decarboxylase. Expressed mainly in roots and flowers. |
| AT4G16720 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
| AT4G16740 | Encodes an (E,E)-alpha-farnesene synthase in the Col ecotype of Arabidopsis. This enzyme can also catalyze the formation of (E)-beta-ocimene as well as trace amounts of myrcene and other related compounds in vitro. The cytosolic localization of the protein may make it favor (E,E)-alpha-farnesene biosynthesis because the precursor of this product, FPP, is primarily cytosolic. Transcript levels for this gene increase in response to treatment with the jasmonic acid mimic coronalon or in response to the insect Plutella xylostella. TPS03 transcripts can also be detected in flowers. A similar protein from the C24 ecotype with one amino acid change (S267F) has a different substrate specificity. |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT4G16748 | other_RNA;(source:Araport11) |
| AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
| AT4G16790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT4G16830 | Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. The mRNA is cell-to-cell mobile. |
| AT4G16855 | hypothetical protein;(source:Araport11) |
| AT4G16890 | Encodes a Toll Interleukin1 receptor-nucleotide binding-Leu- rich repeat-type resistance gene (TIR-NB-LRR-type) involved in the salicylic acid-dependent defense response pathway. Mutant plants constitutively express pathogenesis-related (PR) genes and are pathogen resistant. Resistance signaling in snc1 requires EDS1, MOS3 and PAD4. |
| AT4G16900 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G16920 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G16935 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.3e-16 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G16990 | disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT4G17040 | HON5 (At4g17040) encodes the ClpR4 subunit of the chloroplast-localized Clp protease complex. hon mutations disturb plastid protein homeostasis, thereby activating plastid signaling and inducing stress acclimatization. |
| AT4G17080 | Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11) |
| AT4G17140 | pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
| AT4G17150 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G17160 | RAB GTPase homolog B1A;(source:Araport11) |
| AT4G17200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G17210 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
| AT4G17230 | Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family. Regulated by heat shock. |
| AT4G17245 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G17250 | transmembrane protein;(source:Araport11) |
| AT4G17260 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
| AT4G17420 | PAWH1 along with PAWH2 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
| AT4G17460 | Encodes a class II HD-ZIP protein that regulates meristematic activity in different tissues, and that it is necessary for the correct formation of the gynoecium. |
| AT4G17470 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G17520 | Hyaluronan / mRNA binding family;(source:Araport11) |
| AT4G17550 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT4G17565 | F-box protein (DUF295);(source:Araport11) |
| AT4G17600 | Encodes Lil3:1 (light-harvesting-like) protein. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. A generic LHC motif is present in Lil3:1. The mRNA is cell-to-cell mobile. |
| AT4G17610 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
| AT4G17616 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G17660 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G17700 | hypothetical protein;(source:Araport11) |
| AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT4G17713 | Encodes a defensin-like (DEFL) family protein. |
| AT4G17780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
| AT4G17800 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G17810 | C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4. |
| AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
| AT4G17905 | Putative RING-H2 finger protein ATL4H. |
| AT4G17908 | pseudogene of ubiquitin-specific protease |
| AT4G17914 | pseudogene of ubiquitin-specific protease |
| AT4G17920 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G17940 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G17990 | hypothetical protein;(source:Araport11) |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
| AT4G18050 | P-glycoprotein 9;(source:Araport11) |
| AT4G18060 | SH3 domain-containing protein;(source:Araport11) |
| AT4G18090 | hypothetical protein;(source:Araport11) |
| AT4G18110 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G18120 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML3 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML3 is the transcript with highest frequency of alternative splicing. Expression was detected during early embryo development (heart and torpedo stage); no accumulation was detected in vegetative and floral apices, as revealed by in situ hybridization. |
| AT4G18130 | member of Histidine Kinase |
| AT4G18180 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G18190 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT4G18195 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT4G18210 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT4G18240 | Encodes a starch synthase. In Arabidopsis leaves, the catalytic C-terminal region of STARCH SYNTHASE 4 promotes starch granule initiation while its non-catalytic N-terminal region determines starch granules morphology. |
| AT4G18330 | Translation elongation factor EF1A/initiation factor IF2gamma family protein;(source:Araport11) |
| AT4G18335 | hypothetical protein;(source:Araport11) |
| AT4G18340 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
| AT4G18372 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT4G18425 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT4G18450 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G18520 | Encodes a PPR (pentatricopeptide repeat) protein PDM1/SEL1. Involved in RNA editing and splicing of plastid genes. |
| AT4G18540 | transmembrane protein;(source:Araport11) |
| AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
| AT4G18570 | Microtubule associated protein involved in cortical microtubule organization. |
| AT4G18580 | hypothetical protein;(source:Araport11) |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT4G18650 | A maternally expressed imprinted gene in the endosperm. It's expression is positively regulated by ROS1. |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
| AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
| AT4G18800 | Encodes RabA1d, a member of the RabA subfamily of small Rab GTPases. |
| AT4G18810 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G18820 | AAA-type ATPase family protein;(source:Araport11) |
| AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
| AT4G18920 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
| AT4G18970 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
| AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
| AT4G19050 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT4G19110 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G19120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G19140 | exopolysaccharide production negative regulator;(source:Araport11) |
| AT4G19160 | transglutaminase family protein;(source:Araport11) |
| AT4G19170 | Encodes a chloroplast-targeted member of a family of enzymes similar to nine-cis-epoxycarotenoid dioxygenase that acts as a major regulator of carotenoid degradation during dark-induced leaf senescence.. The mRNA is cell-to-cell mobile. |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
| AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT4G19410 | Pectinacetylesterase family protein;(source:Araport11) |
| AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
| AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G19450 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G19500 | nucleoside-triphosphatase/transmembrane receptor/nucleotide binding/ATP binding protein;(source:Araport11) |
| AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G19540 | Encodes a iron-suflur protein required for NADH dehydrogenase. |
| AT4G19580 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT4G19610 | nucleotide/nucleic acid binding protein;(source:Araport11) |
| AT4G19633 | pseudogene of heat shock factor related protein |
| AT4G19645 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT4G19680 | encodes an iron transporter whose expression is induced by iron and zinc deficiency. Gene is specifically expressed in the external cell layers of the root subapical zone. |
| AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G19720 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19730 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G19740 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G19760 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19770 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
| AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19840 | encodes a phloem lectin, similar to phloem lectin in cucumber and celery. Gene is expressed in the phloem, predominantly in the companion cells. The mRNA is cell-to-cell mobile. |
| AT4G19850 | encodes a protein similar to phloem protein 2 in cucumber. a member of a large gene family. |
| AT4G19905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G19910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G19920 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G19950 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G19980 | hypothetical protein;(source:Araport11) |
| AT4G20030 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT4G20160 | golgin family A protein;(source:Araport11) |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G20190 | hypothetical protein;(source:Araport11) |
| AT4G20200 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT4G20210 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
| AT4G20270 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile. |
| AT4G20280 | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). |
| AT4G20290 | transmembrane protein;(source:Araport11) |
| AT4G20320 | Cytidine triphosphate synthase. |
| AT4G20362 | Natural antisense transcript overlaps with AT4G20360. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT4G20370 | Encodes a floral inducer that is a homolog of FT. Plants overexpressing this gene flower earlier than Col. Loss-of-function mutations flower later in short days. TSF and FT play overlapping roles in the promotion of flowering, with FT playing the dominant role and together playing an antagonistic role to TFL1 in the determination of inflorescence meristem identity. .TSF sequences show extensive variation in different accessions and may contribute to quantitative variation in flowering time in these accessions. TSF has a complex pattern of spatial expression; it is expressed mainly in phloem and expression is regulated by daylength and vernalization. |
| AT4G20410 | Encodes a member of the gamma-soluble NSF attachment protein (gSNAP) gene family. |
| AT4G20420 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
| AT4G20440 | small nuclear ribonucleoprotein associated protein B;(source:Araport11) |
| AT4G20690 | hypothetical protein;(source:Araport11) |
| AT4G20730 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
| AT4G20790 | Leucine-rich repeat protein kinase family protein |
| AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20840 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT4G20850 | Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant. |
| AT4G20860 | involved in the generation of H2O2 from reduced compounds |
| AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
| AT4G20940 | Encodes a plasma-membrane localized LRR receptor-like protein involved in both ABA and H202 mediated signaling involved in stomatal movement. TAIR10 annotation for this gene has a low confidence score (2-star). See Comments field for structural annotation by the community. |
| AT4G20970 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G21020 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT4G21065 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G21070 | Encodes AtBRCA1, an ortholog of the human breast cancer susceptibility gene 1. Contains one N-terminal RING finger, two C-terminal BRCT and the p300/CBP interacting domain. Strongly induced by gamma rays, consistent with a putative role in DNA repair and in cell cycle control. |
| AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
| AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
| AT4G21190 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G21192 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
| AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
| AT4G21230 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21240 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G21250 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT4G21260 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT4G21300 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G21323 | Subtilase family protein;(source:Araport11) |
| AT4G21330 | Encodes a bHLH transcription factor strongly expressed in the tapetum from late anther stage 5 to early stage 6, and at a lower level in meiocytes. dyt1 mutant exhibits abnormal anther morphology beginning at anther stage 4. DYT1 acts downstream of SPL/NZZ and EMS1/EXS , and regulates the expression of downstream genes like AMS, MS1 and other tapetum preferential genes for pollen development, primarily via TDF1. |
| AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
| AT4G21362 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAACAUGGUUUAUUAGGAA |
| AT4G21366 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G21420 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.9e-06 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT4G21437 | unknown pseudogene |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT4G21445 | CRR9 gene encodes a novel stromal protein without any known functional domains or motifs. It is highly conserved in cyanobacteria and land plants but not in green algae. |
| AT4G21490 | NAD(P)H dehydrogenase B3;(source:Araport11) |
| AT4G21510 | F-box family protein;(source:Araport11) |
| AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
| AT4G21550 | VP1/ABI3-like 3;(source:Araport11) |
| AT4G21590 | Encodes a putative endonuclease but no demonstrable endonuclease activity, either towards single stranded DNA or mismatches, has been seen in vitro. Activated by AGAMOUS in a cal-1, ap1-1 background. Expressed in the floral meristem and during stamen development. |
| AT4G21620 | glycine-rich protein;(source:Araport11) |
| AT4G21630 | Subtilase family protein;(source:Araport11) |
| AT4G21640 | Subtilase family protein;(source:Araport11) |
| AT4G21650 | Subtilase family protein;(source:Araport11) |
| AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
| AT4G21700 | DUF2921 family protein, putative (DUF2921);(source:Araport11) |
| AT4G21705 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G21760 | beta-glucosidase 47;(source:Araport11) |
| AT4G21770 | Pseudouridine synthase family protein;(source:Araport11) |
| AT4G21780 | hypothetical protein;(source:Araport11) |
| AT4G21830 | methionine sulfoxide reductase B7;(source:Araport11) |
| AT4G21840 | methionine sulfoxide reductase B8;(source:Araport11) |
| AT4G21870 | HSP20-like chaperone |
| AT4G21890 | zinc finger MYND domain protein;(source:Araport11) |
| AT4G21910 | MATE efflux family protein;(source:Araport11) |
| AT4G21926 | hypothetical protein;(source:Araport11) |
| AT4G21950 | hypothetical protein;(source:Araport11) |
| AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
| AT4G22066 | Pseudogene of AT5G66830; F-box family protein |
| AT4G22080 | root hair specific 14;(source:Araport11) |
| AT4G22090 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G22100 | beta glucosidase 2;(source:Araport11) |
| AT4G22185 | pseudogene of F-box protein (DUF295);(source:Araport11) |
| AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT4G22214 | Encodes a defensin-like (DEFL) family protein. |
| AT4G22233 | Natural antisense transcript overlaps with AT4G22235;(source:Araport11) |
| AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
| AT4G22250 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G22285 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
| AT4G22305 | Encodes SOBER1, a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis. SOBER1 was formerly linked to AT4G22300 but this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. AT4G22300 is now known as TIPSY1 and AT4G22305 corresponds to SOBER1. |
| AT4G22380 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT4G22460 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G22470 | Encodes a hybrid proline-rich protein that contains two tandem PRD-8CMs (proline-rich domain-eight cysteine motif) that is involved in systemic acquired resistance. |
| AT4G22485 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT4G22490 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G22505 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22600 | Encodes a protein involved in involved in the formation of the pollen surface apertures. It acts late in aperture formation by excluding specific membrane domains from exine deposition. |
| AT4G22650 | lipid transfer protein;(source:Araport11) |
| AT4G22660 | F-box protein (DUF295);(source:Araport11) |
| AT4G22690 | member of CYP706A The mRNA is cell-to-cell mobile. |
| AT4G22710 | member of CYP706A |
| AT4G22730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G22758 | PPR containing protein;(source:Araport11) |
| AT4G22760 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
| AT4G22785 | tRNA-Lys (anticodon: CTT) |
| AT4G22790 | Encodes a plasma membrane localized MATE type transporter that is involved in CO2 signaling during stomatal aperture regulation. RHC1 regulates HT1 which phosphorylates OST1, a kinase that regulates the SLAC1 anion channel and thus stomatal closing. |
| AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
| AT4G22870 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G22900 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G22940 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
| AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
| AT4G23000 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
| AT4G23020 | hypothetical protein;(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT4G23040 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G23080 | transmembrane protein, putative (DUF239);(source:Araport11) |
| AT4G23130 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23150 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23170 | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. The mRNA is cell-to-cell mobile. |
| AT4G23200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
| AT4G23230 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23240 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
| AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23310 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23340 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G23364 | Pseudogene of AT4G23340; oxidoreductase, 2OG-Fe(II) oxygenase family protein |
| AT4G23387 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CGGCUCUGAUACCAAUUGAUG |
| AT4G23450 | AtAIRP1 gene encodes a C3H2C3-type RING E3 Ub ligase. It has been shown to be a positive regulator in the Arabidopsis ABA-dependent drought response. |
| AT4G23470 | PLAC8 family protein;(source:Araport11) |
| AT4G23490 | fringe-like protein (DUF604);(source:Araport11) |
| AT4G23496 | Belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
| AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
| AT4G23570 | Closely related to SGT1B, may function in SCF(TIR1) mediated protein degradation. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. AtSGT1a is induced upon pathogen infection and can function in R gene-mediated resistance. |
| AT4G23580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G23590 | Tyrosine transaminase family protein;(source:Araport11) |
| AT4G23610 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G23630 | VIRB2-interacting protein 1;(source:Araport11) |
| AT4G23650 | Encodes calcium dependent protein kinase 3 (CPK3), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK3 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK6 is also a member of the Arabidopsis CDPK family. |
| AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G23800 | Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes. |
| AT4G23882 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G23920 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis. |
| AT4G23950 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins. It is involved in early seed development and nuclear morphology. |
| AT4G23960 | F-box family protein;(source:Araport11) |
| AT4G23980 | Encodes auxin response factor 9 (ARF9). The mRNA is cell-to-cell mobile. |
| AT4G24000 | encodes a protein similar to cellulose synthase |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G24015 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT4G24070 | carbon-carbon lyase;(source:Araport11) |
| AT4G24090 | homer protein;(source:Araport11) |
| AT4G24100 | Protein kinase superfamily protein |
| AT4G24110 | NADP-specific glutamate dehydrogenase;(source:Araport11) |
| AT4G24120 | Member of a small family of oligopeptide transporters similar to the yellow stripe locus of maize (ZmYS1). |
| AT4G24130 | ABA responsive SVB family gene. |
| AT4G24140 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
| AT4G24170 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT4G24175 | kinesin-like protein;(source:Araport11) |
| AT4G24220 | encodes a progesterone-5beta-reductase-like protein. It has enone reductase activity against a wide range of substrates, including 3-oxo-Δ-4,5-steroids in vitro. The in vivo substrates and product of this enzyme have not yet been elucidated but it is likely to participate in steroid metabolism. The protein contains a mammalian death domain involved in programmed cell death. The gene is expressed in the vascular system and mutants carrying a dominant mutation in the gene have defective vascular patterning. VEP1 gene expression is induced specifically by wounding. |
| AT4G24250 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO13 belongs to the clade II, with ATMLO1 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and also in placenta of developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT4G24265 | homeobox protein;(source:Araport11) |
| AT4G24280 | Involved in protein import into chloroplasts during early developmental stages. The mRNA is cell-to-cell mobile. |
| AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT4G24300 | Peptidase C50, separase;(source:Araport11) |
| AT4G24310 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT4G24320 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT4G24415 | Encodes a microRNA that targets AGL16. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCAUUUGUGAGAAGGGA |
| AT4G24430 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT4G24450 | phosphoglucan, water dikinase;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT4G24570 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile. |
| AT4G24580 | Encodes a Rho GTPase-activating protein that interacts with ROP1 (a Rho GTPase) and regulates pollen tube development. This protein can be observed at the apical tip of growing pollen tubes and on endocytic vesicles traveling to this region of the pollen tube. |
| AT4G24660 | homeobox protein 22;(source:Araport11) |
| AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
| AT4G24700 | hypothetical protein;(source:Araport11) |
| AT4G24770 | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Required for editing and stability of specific chloroplast mRNAs. |
| AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
| AT4G24830 | arginosuccinate synthase family;(source:Araport11) |
| AT4G24860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G24910 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT4G24973 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G24977 | Pseudogene of AT4G24972; TPD1 (TAPETUM DETERMINANT 1) |
| AT4G24980 | nodulin MtN21-like transporter family protein |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT4G25040 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G25050 | encodes an acyl carrier protein predominantly expressed in leaves. Gene expression is upregulated by light. |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G25110 | Encodes a type I metacaspase. Two Arabidopsis metacaspases, AT1G02170 (MC1) and AT4G25110 (MC2) antagonistically control programmed cell death in Arabidopsis. MC1 is a positive regulator of cell death and requires conserved caspase-like putative catalytic residues for its function. MC2 negatively regulates cell death. This function is independent of the putative catalytic residues. A third type I Arabidopsis metacaspase is MC3 (AT5g64240). |
| AT4G25130 | Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress. |
| AT4G25170 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
| AT4G25180 | RNA polymerase III RPC4;(source:Araport11) |
| AT4G25200 | AtHSP23.6-mito mRNA, nuclear gene encoding mitochondrial |
| AT4G25220 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
| AT4G25300 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G25310 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G25320 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G25330 | SAWADEE protein;(source:Araport11) |
| AT4G25340 | Encodes a member of the FKBP-type immunophilin family that functions as a histone chaparone. Binds to 18S rDNA and represses its expression. The N-terminal nucleoplasmin domain interacts with H2A/H2B and H3/H4 histone oligomers, individually, as well as simultaneously, suggesting two different binding sites for H2A/H2B and H3/H4. |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT4G25370 | Double Clp-N motif protein;(source:Araport11) |
| AT4G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G25420 | Encodes gibberellin 20-oxidase that is involved in the later steps of the gibberellin biosynthetic pathway. Regulated by a circadian clock. Weak expression response to far red light. |
| AT4G25433 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT4G25434 | nudix hydrolase homolog 10;(source:Araport11) |
| AT4G25440 | zinc finger WD40 repeat protein 1;(source:Araport11) |
| AT4G25450 | member of NAP subfamily |
| AT4G25550 | Cleavage/polyadenylation specificity factor, 25kDa subunit;(source:Araport11) |
| AT4G25560 | LAF1 is a R2R3-MYB transcription factor and positive regulator of the phyA photoresponse. Interaction of LAF1 with HFR1 stabilize the proteins against ubiquitination by COP1(AT2G32950) and subsequent degrations. Mutants have an elongated hypocotyl specifically under far-red light but retain wild-type responses to other light wavelengths. |
| AT4G25570 | Encodes cytochrome b561. |
| AT4G25740 | RNA binding Plectin/S10 domain-containing protein;(source:Araport11) |
| AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
| AT4G25800 | Calmodulin-binding protein;(source:Araport11) |
| AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
| AT4G25820 | Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. The mRNA is cell-to-cell mobile. |
| AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
| AT4G25890 | 60S acidic ribosomal protein family;(source:Araport11) |
| AT4G25920 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G25930 | DUF295 domain containing protein. |
| AT4G25940 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G25960 | P-glycoprotein 2;(source:Araport11) |
| AT4G25970 | Encodes the major form of the two non-mitochondrail phosphatidylserine decarboxylase. Located at the ER. The mRNA is cell-to-cell mobile. |
| AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
| AT4G26010 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G26055 | transmembrane protein;(source:Araport11) |
| AT4G26060 | Ribosomal protein L18ae family;(source:Araport11) |
| AT4G26080 | Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure. |
| AT4G26110 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. The mRNA is cell-to-cell mobile. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT4G26130 | cotton fiber protein;(source:Araport11) |
| AT4G26160 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT4G26170 | ET1 is a DNA and Zinc binding domain containing protein involved in DNA methylation. |
| AT4G26180 | Encodes a mitochondrial CoA transporter. |
| AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
| AT4G26240 | histone-lysine N-methyltransferase;(source:Araport11) |
| AT4G26250 | Predicted to encode a galactinol synthase. |
| AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
| AT4G26320 | arabinogalactan protein 13;(source:Araport11) |
| AT4G26330 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G26340 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G26350 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G26375 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT4G26385 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G26483 | nicotianamine synthase;(source:Araport11) |
| AT4G26490 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT4G26550 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
| AT4G26570 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins) |
| AT4G26580 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G26590 | oligopeptide transporter |
| AT4G26640 | member of WRKY Transcription Factor; Group I |
| AT4G26740 | Encodes caleosin, a 27-kDa protein found within seed lipid bodies. Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27. Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
| AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
| AT4G26920 | START (StAR-related lipid-transfer) lipid-binding domain-containing protein;(source:Araport11) |
| AT4G26930 | Encodes a putative transcription factor (MYB97). |
| AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
| AT4G26980 | RNI-like superfamily protein;(source:Araport11) |
| AT4G27050 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G27052 | unknown pseudogene |
| AT4G27060 | Encodes a novel, plant-specific microtubule-associated protein that regulates the orientation of cortical microtubules and the direction of organ growth. The protein plays a role in control of microtubule dependent anisotropic cell elongation. spr2 mutant rosette leaves, cauline leaves, roots, petioles and petals curl in an anticlockwise direction. |
| AT4G27110 | COBRA-like protein 11 precursor;(source:Araport11) |
| AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile. |
| AT4G27290 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G27300 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G27360 | Dynein light chain type 1 family protein;(source:Araport11) |
| AT4G27400 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT4G27420 | ABC-2 type transporter family protein;(source:Araport11) |
| AT4G27430 | Positive regulator of light-regulated genes. Novel nuclear protein which requires light for its high level expression. The mRNA is cell-to-cell mobile. |
| AT4G27435 | fiber (DUF1218);(source:Araport11) |
| AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
| AT4G27480 | GT14 enzyme |
| AT4G27550 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
| AT4G27570 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
| AT4G27585 | Encodes a stomatin-like protein that is present in a mitochondrial membrane-bound 3 MDa protein complex and is involved in the assembly of mitochondrial respiratory supercomplexes. There is an observed increase in abundance of respiratory complex III2 in SLP1 single and double knockout mutants. The protein is not redundant with Arabidopsis SLP2 (At5g54100). |
| AT4G27590 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G27595 | Encodes a microtubule-associated protein. |
| AT4G27630 | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG2 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG2 and may act to down-regulate GTG2 binding to ABA. GTG2 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG2 transcript levels do not appear to change in response to ABA or abiotic stresses. |
| AT4G27660 | hypothetical protein;(source:Araport11) |
| AT4G27680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G27700 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT4G27710 | member of CYP709B The mRNA is cell-to-cell mobile. |
| AT4G27720 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G27730 | oligopeptide transporter |
| AT4G27780 | Encodes acyl-CoA-binding protein with ankyrin repeats The mRNA is cell-to-cell mobile. |
| AT4G27790 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT4G27820 | beta glucosidase 9;(source:Araport11) |
| AT4G27860 | vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT4G27890 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT4G27920 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
| AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G27960 | ubiquitin conjugating enzyme |
| AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT4G28010 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G28090 | SKU5 similar 10;(source:Araport11) |
| AT4G28110 | Member of the R2R3 factor gene family. Expression is induced in response to desiccation, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion. |
| AT4G28130 | diacylglycerol kinase 6;(source:Araport11) |
| AT4G28140 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock. |
| AT4G28170 | transmembrane protein;(source:Araport11) |
| AT4G28210 | embryo defective 1923;(source:Araport11) |
| AT4G28220 | Encodes an external type II NADPH dehydrogenase in the plant mitochondrial electron transport chain that modulates NADP(H) reduction levels, which in turn affect central metabolism and growth, and interact with defense signaling. |
| AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
| AT4G28300 | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. The mRNA is cell-to-cell mobile. |
| AT4G28320 | Encodes a endo-beta-mannanase involved in seed germination. |
| AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT4G28370 | Encodes an E3 ubiquitin ligase that is involved in plant cell wall modification, seed mucilage extrusion, and controls the degree of pectin methylesterification in seed mucilage. fly1 mutant seeds release more compact mucilage capsules and detached outer tangential primary walls when hydrated in water. Fly1 is located in the endomembrane system, likely localized in late endosome/multivesicular bodies/prevacular compartment. It has been shown to ubiquitinate proteins in conjunction with UBA1 and UBC8. |
| AT4G28380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G28395 | related to lipid transfer proteins |
| AT4G28397 | non-specific lipid-transfer-like protein;(source:Araport11) |
| AT4G28410 | Tyrosine transaminase family protein;(source:Araport11) |
| AT4G28420 | Tyrosine transaminase family protein;(source:Araport11) |
| AT4G28430 | Reticulon family protein;(source:Araport11) |
| AT4G28450 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT4G28460 | Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1. |
| AT4G28485 | The structure of this gene is mis-annotated in TAIR10. Please refer to PMID:20712629 and the Comment field on the TAIR locus page for revised annotation. |
| AT4G28510 | prohibitin 1 (Atphb1) |
| AT4G28570 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT4G28580 | Transmembrane magnesium transporter that induces Mg transport from tapetum cell to locule. One of nine family members. Functions in pollen development. |
| AT4G28670 | cysteine-rich RECEPTOR-like kinase, putative (DUF26);(source:Araport11) |
| AT4G28690 | hypothetical protein;(source:Araport11) |
| AT4G28700 | ammonium transporter 1;(source:Araport11) |
| AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
| AT4G28740 | LOW PSII ACCUMULATION-like protein;(source:Araport11) |
| AT4G28780 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G28790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G28811 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G28815 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G28850 | xyloglucan endotransglucosylase/hydrolase 26;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G28930 | hypothetical protein;(source:Araport11) |
| AT4G29020 | glycine-rich protein;(source:Araport11) |
| AT4G29030 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G29050 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G29070 | Phospholipase A2 family protein;(source:Araport11) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT4G29120 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
| AT4G29140 | Encodes Activated Disease Susceptibility 1 (ADS1), a putative MATE (multidrug and toxic compound extrusion) transport protein that negatively regulates plant disease resistance. |
| AT4G29160 | SNF7 family protein;(source:Araport11) |
| AT4G29180 | root hair specific 16;(source:Araport11) |
| AT4G29210 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the vacuole and is most active in roots. The encoded enzyme is involved in the initial degradation of glutathione conjugates in this cell compartment. It is also induced by xenobiotics and contributes to xenobiotics metabolism. Note that conflicting nomenclature exists in the literature: At4g29210 is named as GGT3 in Plant J. 2007 Mar 49(5):878-88; At4g29210 is named as GGT4 and At1g69820 as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT4G29230 | NAC domain protein involved in negative regulation of flowering. |
| AT4G29250 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G29260 | VSP3 is a secreted acid phosphatase. |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT4G29340 | Profilin is a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton in eukaryotes, including higher plants. PRF4 and PRF5 are late pollen-specific and are not detectable in other cell types of the plant body including microspores and root hairs. Immunocytochemical studies at the subcellular level reveal that both the constitutive and pollen-specific profilins are abundant in the cytoplasm. In vegetative cell types, such as root apical cells, profilins showed localization to nuclei in addition to the cytoplasmic staining. |
| AT4G29400 | oxidoreductase/transition metal ion-binding protein (DUF3531);(source:Araport11) |
| AT4G29440 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G29540 | Encodes a UDP-N-acetylglucosamine acyltransferase. |
| AT4G29548 | hypothetical protein;(source:Araport11) |
| AT4G29560 | fanconi anemia group E protein FANCE protein;(source:Araport11) |
| AT4G29600 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G29610 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G29620 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G29630 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G29690 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G29700 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G29710 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G29720 | polyamine oxidase 5;(source:Araport11) |
| AT4G29750 | CRS1 / YhbY (CRM) domain-containing protein;(source:Araport11) |
| AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
| AT4G29810 | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29840 | threonine synthase |
| AT4G29900 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT4G29905 | hypothetical protein;(source:Araport11) |
| AT4G29930 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G29970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G30040 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G30050 | transmembrane protein;(source:Araport11) |
| AT4G30067 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30074 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30080 | Involved in root cap cell differentiation. Gene expression is regulated by mir160.Located in the nucleus. |
| AT4G30090 | golgin family A protein;(source:Araport11) |
| AT4G30110 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
| AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
| AT4G30170 | Peroxidase family protein;(source:Araport11) |
| AT4G30180 | hypothetical protein;(source:Araport11) |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT4G30210 | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. The mRNA is cell-to-cell mobile. |
| AT4G30220 | small nuclear ribonucleoprotein F;(source:Araport11) |
| AT4G30230 | hypothetical protein;(source:Araport11) |
| AT4G30240 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT4G30250 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30300 | member of NAP subfamily |
| AT4G30330 | Differs from PCP only in two amino acids, expression is regulated in a manner opposite to that of PCP in that it was upregulated in response to increasing ambient temperature. |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT4G30370 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30420 | nodulin MtN21-like transporter family protein |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT4G30480 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
| AT4G30490 | AFG1-like ATPase family protein;(source:Araport11) |
| AT4G30510 | yeast autophagy 18 B-like protein;(source:Araport11) |
| AT4G30550 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT4G30560 | member of Cyclic nucleotide gated channel family. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT4G30620 | Homolog of STIC2, recent duplication. |
| AT4G30640 | RNI-like superfamily protein;(source:Araport11) |
| AT4G30662 | hypothetical protein;(source:Araport11) |
| AT4G30700 | Encodes a pentatricopeptide repeat protein involved in mitochondrial RNA editing. |
| AT4G30760 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT4G30770 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G30840 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G30860 | Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. |
| AT4G30872 | other_RNA;(source:Araport11) |
| AT4G30880 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G30900 | DNAse I-like superfamily protein;(source:Araport11) |
| AT4G30910 | Cytosol aminopeptidase family protein;(source:Araport11) |
| AT4G30950 | Chloroplastic enzyme responsible for the synthesis of 16:2 and 18:2 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation resulted in reduced level of unsaturated fatty acids leading to susceptibility to photoinhibition. |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT4G30993 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT4G31000 | Calmodulin-binding protein;(source:Araport11) |
| AT4G31020 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G31050 | Redundant octanoyltransferase. |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT4G31110 | Wall-associated kinase family protein;(source:Araport11) |
| AT4G31120 | Involved in vernalization. Required for epigenetic silencing of FLC, and for vernalization-mediated histone modification. |
| AT4G31130 | keratin-associated protein (DUF1218);(source:Araport11) |
| AT4G31160 | Encodes a DCAF/DWD protein capable of interacting with DDB1 and associating with CUL4, likely as part of a nuclear ubiquitin ligase complex. DCAF1 appears to be required for plant embryogenesis and to affect several other developmental processes including leaf, shoot, and flower development. |
| AT4G31280 | hypothetical protein;(source:Araport11) |
| AT4G31320 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT4G31350 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G31355 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G31398 | Natural antisense transcript overlaps with AT4G31400;(source:Araport11) |
| AT4G31410 | E3 ubiquitin-protein ligase, putative (DUF1644);(source:Araport11) |
| AT4G31430 | Encodes a plant-specific protein that physically interacts with CRWN1 and its homolog CRWN4 and localizes at the inner nuclear membrane. KAKU4 deforms the nuclear envelope in a dose-dependent manner, in association with nuclear membrane invagination and stack formation. |
| AT4G31440 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
| AT4G31470 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT4G31520 | SDA1 family protein;(source:Araport11) |
| AT4G31530 | Atypical short-chain dehydrogenase-reductase that functions as a qH-relaxation factor. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G31580 | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT4G31615 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT4G31620 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT4G31630 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31640 | transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31650 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT4G31670 | ubiquitin-specific protease 18;(source:Araport11) |
| AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31690 | transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31700 | Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis. |
| AT4G31730 | Glutamine dumper1 is a putative transmembrane protein. It is involved in glutamine secretion The mRNA is cell-to-cell mobile. |
| AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
| AT4G31805 | Encodes POLAR, a scaffold protein associated with cellular asymmetry of meristemoids. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT4G31810 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT4G31830 | transmembrane protein;(source:Araport11) |
| AT4G31875 | hypothetical protein;(source:Araport11) |
| AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G31900 | chromatin remodeling factor;(source:Araport11) |
| AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
| AT4G31920 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT4G31940 | The gene encodes a cytochrome P450 enzyme, CYP82C. It is involved in the early Fe deficiency response.CYP82C4 hydroxylates fraxetin to generate sideretin (5-hydroxyfraxetin). Fraxetin and sideretin are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.The mRNA is cell-to-cell mobile. |
| AT4G31950 | member of CYP82C |
| AT4G31960 | hypothetical protein;(source:Araport11) |
| AT4G31970 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. CYP82C2 acts as a hydroxylase on indole-3-carbonyl nitrile to generate 4-OH-ICN. |
| AT4G31980 | PPPDE thiol peptidase family protein;(source:Araport11) |
| AT4G31990 | Encodes a plastid-localized aspartate aminotransferase. Does not display any PAT (glutamate/aspartate-prephenate aminotransferase) activity even in the presence of a high concentration of prephenate. |
| AT4G32040 | A member of Class II KN1-like homeodomain transcription factors factors (together with KNAT3 and KNAT4), with greatest homology to the maize knox1 homeobox protein. Regulates photomorphogenic responses and represses late steps in gibberellin biosynthesis. KNAT5 promoter activity showed cell-type specific pattern along longitudinal root axis, primarily in the epidermis of the distal end of primary root elongation zone. |
| AT4G32050 | neurochondrin family protein;(source:Araport11) |
| AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
| AT4G32080 | hypothetical protein;(source:Araport11) |
| AT4G32090 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G32170 | member of CYP96A |
| AT4G32190 | Encodes a plastid-located coiled coil-containing protein that is required for normal starch granule initiation in Arabidopsis chloroplasts. Mutants lacking MRC have fewer starch granules per chloroplast than the wild type. Interacts with PTST2 (At1g27070), which is also required for normal starch granule initiation (DOI:10.1105/tpc.18.00219). |
| AT4G32208 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT4G32250 | Encodes a component of the TOC machinery that phosphorylates import receptors, supports pre-protein import, and contributes to efficient chloroplast biogenesis. |
| AT4G32272 | Golgi-localized nucleotide sugar (UDP-GlcNAc) transporter that delivers an essential substrate for the maturation of N-glycans and the GIPC class of sphingolipids. |
| AT4G32290 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G32295 | histone acetyltransferase;(source:Araport11) |
| AT4G32320 | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT4G32450 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G32500 | Encodes AKT5, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32510 | HCO3- transporter family;(source:Araport11) |
| AT4G32540 | Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis |
| AT4G32560 | paramyosin-like protein;(source:Araport11) |
| AT4G32580 | Thioredoxin superfamily protein;(source:Araport11) |
| AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32660 | Encodes protein kinase AME3. |
| AT4G32670 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G32800 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
| AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G33010 | glycine decarboxylase P-protein 1;(source:Araport11) |
| AT4G33020 | member of Fe(II) transporter isolog family |
| AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
| AT4G33070 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT4G33160 | F-box family protein;(source:Araport11) |
| AT4G33170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G33180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G33200 | member of Myosin-like proteins |
| AT4G33230 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT4G33370 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT4G33390 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
| AT4G33420 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT4G33450 | Member of the R2R3 factor gene family. |
| AT4G33467 | hypothetical protein;(source:Araport11) |
| AT4G33490 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G33495 | A member of the RPD gene family - there are13 annotated genes and one EST encoding RPD1-like proteins in Arabidopsis. Shows no homology to any protein of known function. Abundant expression found in the shoot apex and the root. rpd1 mutant is a temperature-sensitive mutant isolated on the basis of the impairment in adventitious roots formation in hypocotyl region. Also, disruption of the RPD1 gene by a T-DNA insertion caused embryogenesis arrest at the globular to transition stages. This phenotype is consistent with the hypothesized function of RPD1 in the maintenance of active cell proliferation. |
| AT4G33530 | potassium transporter |
| AT4G33590 | transmembrane protein;(source:Araport11) |
| AT4G33600 | transmembrane protein;(source:Araport11) |
| AT4G33625 | vacuole protein;(source:Araport11) |
| AT4G33650 | Encodes a protein with high sequence similarity to the dynamin superfamily. Among those members ADL2 was most closely related to Dnm1p of yeast and likely a member of the Vps1p subfamily. Widely expressed in various tissues with highest expression in flower tissues. Localizes to the chloroplast, mitochondrion and peroxisome. Involved in peroxisome and mitochondria fission in combination with DRP3B. |
| AT4G33666 | hypothetical protein;(source:Araport11) |
| AT4G33700 | CBS domain protein (DUF21);(source:Araport11) |
| AT4G33770 | Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT4G33810 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G33820 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT4G33840 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT4G33850 | Pseudogene of AT4G33850; glycosyl hydrolase family 10 protein |
| AT4G33860 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT4G33900 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G33920 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G33970 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT4G33985 | membrane insertase, putative (DUF1685);(source:Araport11) |
| AT4G33990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G34020 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. |
| AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
| AT4G34120 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile. |
| AT4G34131 | UDP-glucosyl transferase 73B3;(source:Araport11) |
| AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT4G34138 | UDP-glucosyl transferase 73B1;(source:Araport11) |
| AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
| AT4G34215 | Encodes a member of the SGNH-hydrolase superfamily of enzymes. The enzymes of the SGNH-hydrolase superfamily facilitate the hydrolysis of ester, thioester and amide bonds in a range of substrates including complex polysaccharides, lysophospholipids, acyl-CoA esters and other compounds. |
| AT4G34220 | Encodes a receptor like kinase involved in ABA-mediated seedling development and drought tolerance.RDK1 is an atypical or pseudokinase and has no phosphorylation activity. Its expression is upregulated in response to ABA.interacts with ABI1 and other PP2C phosphatases. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G34260 | 1,2-alpha-L-fucosidase;(source:Araport11) |
| AT4G34320 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G34330 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
| AT4G34419 | hypothetical protein;(source:Araport11) |
| AT4G34440 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
| AT4G34520 | Encodes KCS18, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT4G34555 | Ribosomal protein S25 family protein;(source:Araport11) |
| AT4G34580 | Encodes COW1 (can of worms1), a phosphatidylinositol transfer protein essential for root hair tip growth. The N-terminus of the COW1 protein is 32% identical to an essential phosphatidylinositol transfer protein (PITP), the yeast Sec14 protein (sec14p) while the C-terminus is 34.5% identical to a late nodulin of Lotus japonicus, Nlj16. Expression of COW1 complements the growth defect associated with Sec14p dysfunction in yeast. GFP fused to the COW1 protein specifically accumulates at the site of root hair outgrowth. |
| AT4G34600 | CAF2 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF1 it is required for formation of the casparian band. |
| AT4G34630 | prostatic spermine-binding-like protein;(source:Araport11) |
| AT4G34650 | Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function. |
| AT4G34670 | Ribosomal protein S3Ae;(source:Araport11) |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT4G34760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34850 | Chalcone and stilbene synthase family protein;(source:Araport11) |
| AT4G34880 | Amidase family protein;(source:Araport11) |
| AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
| AT4G34900 | xanthine dehydrogenase 2;(source:Araport11) |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G34940 | Armadillo repeat protein. One of a family of four in Arabidopsis. Located in the nucleus and cytoplasm of pollen vegetative cells, and in the cytoplasm of egg cells. Involved in the signaling network controlling tip growth and actin organization in the pollen tube. |
| AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G34970 | A member of actin polymerizing factors (ADFs)family, ADF9 primarily functions as an actin bundling protein. |
| AT4G34980 | Serine protease similar to subtilisin. |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G35025 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G35070 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT4G35080 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
| AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT4G35120 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G35150 | O-methyltransferase family protein;(source:Araport11) |
| AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
| AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
| AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT4G35220 | Cyclase family protein;(source:Araport11) |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
| AT4G35270 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35295 | homoserine kinase, putative / HSK;(source:Araport11) |
| AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
| AT4G35350 | tracheary element vacuolar protein |
| AT4G35360 | pantothenate kinase;(source:Araport11) |
| AT4G35380 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
| AT4G35410 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
| AT4G35440 | Enclodes a choride channel protein that is localized to the thlakoid membrane. |
| AT4G35460 | NADPH-dependent thioredoxin reductase 1 (NTR1. Similar to E.coli NTR and has conserved NADPH binding domains. |
| AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
| AT4G35570 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha. |
| AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
| AT4G35630 | Encodes a phosphoserine aminotransferase which is involved in serine biosynthesis in the chloroplast which operates via the phosphorylated pathway. The mRNA is cell-to-cell mobile. |
| AT4G35655 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT4G35660 | selection/upkeep of intraepithelial T-cells protein, putative (DUF241);(source:Araport11) |
| AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
| AT4G35720 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT4G35733 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT4G35740 | Encodes RECQ3, an ATP-dependent helicase. |
| AT4G35770 | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
| AT4G35810 | 2-oxoglutarate-dependent dioxygenase |
| AT4G35820 | 2-oxoglutarate-dependent dioxygenase |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G35905 | Trm112p-like protein;(source:Araport11) |
| AT4G35980 | hypothetical protein;(source:Araport11) |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G36040 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G36050 | Encodes a base excision repair protein with 3'-phosphatase activity and strong 3'-5' exonuclease activity. Together with ZDP, it plays overlapping roles in the maintenance of epigenome and genome stability in plants. |
| AT4G36060 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G36070 | member of Calcium Dependent Protein Kinase |
| AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G36150 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT4G36170 | hypothetical protein;(source:Araport11) |
| AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
| AT4G36230 | transmembrane protein;(source:Araport11) |
| AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT4G36260 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Encodes protein with a single zinc finger motif and a members of a small gene family of putative transcription factors in which the SHORT INTERNODES (SHI) gene is found. STY2/STY1 double mutants showed defective style, stigma as well as serrated leaves. |
| AT4G36350 | purple acid phosphatase 25;(source:Araport11) |
| AT4G36390 | Methylthiotransferase;(source:Araport11) |
| AT4G36420 | Ribosomal protein L12 family protein;(source:Araport11) |
| AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G36460 | transmembrane protein;(source:Araport11) |
| AT4G36490 | SEC14-like 12;(source:Araport11) |
| AT4G36500 | hypothetical protein;(source:Araport11) |
| AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G36530 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G36570 | RAD-like 3;(source:Araport11) |
| AT4G36580 | AAA-type ATPase family protein;(source:Araport11) |
| AT4G36590 | MADS-box transcription factor family protein;(source:Araport11) |
| AT4G36600 | Late embryogenesis abundant (LEA) protein;(source:Araport11) |
| AT4G36620 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G36640 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G36690 | Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65b. |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
| AT4G36840 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G36850 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. Regulates together with BLH4 demethylesterification of homogalacturonan in seed mucilage. |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
| AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
| AT4G36920 | Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. |
| AT4G36925 | transmembrane protein;(source:Araport11) |
| AT4G36930 | Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy. |
| AT4G36940 | nicotinate phosphoribosyltransferase 1;(source:Araport11) |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT4G37030 | membrane protein;(source:Araport11) |
| AT4G37040 | encodes a methionine aminopeptidase |
| AT4G37050 | Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid (ABA) or phosphate deficiency in roots. |
| AT4G37060 | Patatin-related phospholipase A. Expressed weakly in roots, cotyledons, and leaves but is transcriptionally induced by auxin. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
| AT4G37070 | Patatin-related phospholipase A. Expressed strongly and exclusively in roots. AtplaIVA-null mutants have reduced lateral root development. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
| AT4G37150 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES9 appears to be involved in MeSA hydrolysis in planta. Expression of MES9 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
| AT4G37160 | SKU5 similar 15;(source:Araport11) |
| AT4G37200 | Encodes thioredoxin-like protein with disulfide reductase activity that is involved in the biogenesis of the plastid cytochrome b6f complex. Protein is located in the thylakoid membrane with the C-terminal hydrophilic portion, containing the thioredoxin like domain, extending into the thylakoid lumen. |
| AT4G37235 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
| AT4G37270 | Encodes a P1B-type ATPases that is localized to the chloroplast envelope and is involved in the transport of Cu into chloroplasts. It is essential for growth under high light conditions. |
| AT4G37290 | Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. |
| AT4G37300 | maternal effect embryo arrest 59;(source:Araport11) |
| AT4G37310 | member of CYP81H |
| AT4G37320 | member of CYP81D |
| AT4G37330 | member of CYP81D |
| AT4G37340 | member of CYP81D |
| AT4G37360 | member of CYP81D |
| AT4G37370 | member of CYP81D |
| AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
| AT4G37460 | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity. |
| AT4G37530 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
| AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
| AT4G37705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G37710 | VQ motif-containing protein;(source:Araport11) |
| AT4G37730 | basic leucine-zipper 7;(source:Araport11) |
| AT4G37750 | ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis. |
| AT4G37760 | squalene epoxidase 3;(source:Araport11) |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT4G37780 | encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family. |
| AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile. |
| AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
| AT4G37820 | transmembrane protein;(source:Araport11) |
| AT4G37840 | Encodes a putative hexokinase. |
| AT4G37850 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G37895 | Natural antisense transcript overlaps with AT4G37890;(source:Araport11) |
| AT4G37900 | Protein of unknown function that contains DUF1399 domain and putative RNA binding motif. Expressed in many plant tissues and is involved in many aspects of plant growth and development as well as response to salt stress. |
| AT4G37910 | mitochondrial heat shock protein 70-1;(source:Araport11) |
| AT4G37925 | Encodes subunit NDH-M of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly. |
| AT4G37930 | Encodes a protein with mitochondrial serine hydroxymethyltransferase activity, which functions in the photorespiratory pathway, catalyzes the conversion of serine and tetrahydrofolate to glycine and 5,10-methylene tetrahydrofolate. Involved in controlling cell damage caused by abiotic stress, such as high light and salt and the hypersensitive defense response of plants. |
| AT4G38060 | hypothetical protein;(source:Araport11) |
| AT4G38120 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G38150 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G38180 | FAR1-related sequence 5;(source:Araport11) |
| AT4G38190 | encodes a gene similar to cellulose synthase |
| AT4G38220 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT4G38225 | glycerol kinase;(source:Araport11) |
| AT4G38230 | member of Calcium Dependent Protein Kinase |
| AT4G38340 | Chip-seq data indicates bZIP1 binds to the NLP3 promoter. |
| AT4G38370 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT4G38400 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G38420 | SKU5 similar 9;(source:Araport11) |
| AT4G38495 | Subunit if INO80 chromatin remodeling complex. Along with EIN6 (REF6), redundantly controls the level and the localization of the repressive histone modification H3K27me3 and the histone variant H2A. |
| AT4G38530 | Encodes a putative phosphoinositide-specific phospholipase C. There are two genes called ATPLC1, one corresponding to AT4g38530 (this one) and one corresponding to AT5g58670. |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
| AT4G38600 | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. |
| AT4G38630 | Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
| AT4G38690 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G38710 | glycine-rich protein;(source:Araport11) |
| AT4G38730 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT4G38770 | Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant. |
| AT4G38780 | pre-mRNA-processing-splicing factor-like protein;(source:Araport11) |
| AT4G38825 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38850 | mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants. |
| AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38880 | GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2 |
| AT4G38940 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT4G38970 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
| AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
| AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
| AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
| AT4G39040 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT4G39050 | Kinesin motor family protein;(source:Araport11) |
| AT4G39060 | LOW protein: coatomer subunit alpha-1-like protein;(source:Araport11) |
| AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
| AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
| AT4G39180 | encodes a protein that complements the function of a sec14(ts) mutant of S. cerevisiae |
| AT4G39220 | Key player of retrieval of ER membrane proteins |
| AT4G39235 | hypothetical protein;(source:Araport11) |
| AT4G39240 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39290 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39320 | microtubule-associated protein-like protein;(source:Araport11) |
| AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT4G39360 | hypothetical protein;(source:Araport11) |
| AT4G39380 | TSL-kinase interacting-like protein;(source:Araport11) |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT4G39403 | Encodes a 36 amino acid polypeptide that is necessary for correct responses to cytokinins and auxins, correct cell expansion in the root, and for vascular patterning in the leaf. Mutation of PLS results in an enhanced ethylene-response phenotype, defective auxin transport and homeostasis, and altered microtubule sensitivity to inhibitors. |
| AT4G39404 | other_RNA;(source:Araport11) |
| AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
| AT4G39460 | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
| AT4G39490 | member of CYP96A |
| AT4G39530 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
| AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
| AT4G39675 | hypothetical protein;(source:Araport11) |
| AT4G39690 | Encodes a homolog of the yeast mic60 protein that is localized in the inner membrane of the mitochondrion, interacts with Tom40 as part of a large lipid-enriched complex called the mitochondrial transmembrane lipoprotein complex (MTL) and is involved in mitochondrial lipid trafficking. |
| AT4G39740 | Encodes HCC2, one of the two Arabidopsis genes (HCC1 and HCC2) resulting from a duplication with homology to the SCO proteins involved in copper insertion during cytochrome c oxidase (COX) assembly in other organisms. HCC2, which lacks the cysteines and histidine putatively involved in copper binding, functions in copper sensing and redox homeostasis. |
| AT4G39760 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
| AT4G39838 | Natural antisense transcript overlaps with AT4G39840;(source:Araport11) |
| AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
| AT4G39850 | Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. |
| AT4G39860 | hematological/neurological-like protein;(source:Araport11) |
| AT4G39890 | RAB GTPase homolog H1C;(source:Araport11) |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT4G39985 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
| AT4G40000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G40020 | Myosin heavy chain-related protein;(source:Araport11) |
| AT4G40040 | Histone superfamily protein;(source:Araport11) |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40080 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G40090 | arabinogalactan protein 3;(source:Araport11) |
| AT5G01010 | retinal-binding protein;(source:Araport11) |
| AT5G01030 | enolase, putative (DUF3527);(source:Araport11) |
| AT5G01040 | putative laccase, knockout mutant showed early flowering |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G01075 | Encodes a small ER-localized protein that is strongly expressed in seeds and regulates both embryo development and accumulation of storage compounds. At the cellular level, TWS1 is responsible for cuticle deposition on epidermal cells and organization of the endomembrane system. |
| AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G01110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G01140 | hypothetical protein (DUF674);(source:Araport11) |
| AT5G01150 | hypothetical protein (DUF674);(source:Araport11) |
| AT5G01175 | Natural antisense transcript overlaps with AT5G01180;(source:Araport11) |
| AT5G01180 | Encodes a dipeptide transporter expressed in pollen and ovules during early seed development. GFP-tagged PTR5 localizes to the plasma membrane. |
| AT5G01220 | Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
| AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT5G01280 | Encodes a microtubule-associated protein. |
| AT5G01310 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT5G01320 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT5G01330 | pyruvate decarboxylase |
| AT5G01360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
| AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G01390 | DNAJ heat shock family protein;(source:Araport11) |
| AT5G01400 | Encodes a Symplekin/Pta1 homologue which would have the potential to interact with either ESP1 or AtCstF64. |
| AT5G01440 | hypothetical protein;(source:Araport11) |
| AT5G01445 | hypothetical protein;(source:Araport11) |
| AT5G01450 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G01480 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
| AT5G01510 | root UVB sensitive protein (Protein of unknown function, DUF647);(source:Araport11) |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
| AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT5G01580 | thiol reductase in OAS metabolism |
| AT5G01590 | histone-lysine N-methyltransferase ATXR3-like protein;(source:Araport11) |
| AT5G01610 | hypothetical protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G01650 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
| AT5G01660 | influenza virus NS1A-binding protein;(source:Araport11) |
| AT5G01690 | member of Putative Na+/H+ antiporter family |
| AT5G01720 | RAE1 is an F-box protein component of a SCF-type E3 ligase complex. It is part of an alumium induced regulatory loop: its activity is induced by STOP1 and it in turn ubiquitinates STOP1 which is then targeted for degradation. |
| AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
| AT5G01750 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT5G01760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT5G01790 | hypothetical protein;(source:Araport11) |
| AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
| AT5G01880 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G01881 | transmembrane protein;(source:Araport11) |
| AT5G01890 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G01930 | Encodes a endo-beta-mannanase involved in seed germination. |
| AT5G01950 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G02010 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Required for periodic formation of secondary cell wall pits. |
| AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
| AT5G02035 | microRNA ath-MIR2111b precursor;(source:Araport11) |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT5G02110 | Encodes CYCLIN D7;1. Overexpression of CYCD7;1 induces cell proliferation and cell enlargement in the embryo and endosperm leading to overgrowth. |
| AT5G02130 | SSR1 encodes a tetratricopeptide repeat- containing protein localized in mitochondria. It is involved in root development, possibly by through effects on auxin transport. In ssr1 mutants, the expression PIN genes and trafficking of PIN2 is altered which in turn affects distribution of auxin in the roots. |
| AT5G02140 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G02170 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G02180 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G02190 | encodes an aspartic protease, has an important role in determining cell fate during embryonic development and in reproduction processes. The loss-of-function mutation of PCS1 causes degeneration of both male and female gametophytes and excessive cell death of developing embryos during torpedo stage. |
| AT5G02210 | GCK domain-containing protein;(source:Araport11) |
| AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
| AT5G02250 | Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis. |
| AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G02340 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G02350 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G02380 | cysteine-rich protein with copper-binding activity |
| AT5G02385 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT5G02390 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
| AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT5G02450 | Ribosomal protein L36e family protein;(source:Araport11) |
| AT5G02490 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G02580 | argininosuccinate lyase;(source:Araport11) |
| AT5G02600 | Encodes a phloem mobile metal binding protein necessary for phloem function and root meristem maintenance. |
| AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT5G02730 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
| AT5G02800 | Encodes CDL1, a homolog of CDG1. CDL1 positively regulates brassinosteroid signaling and plant growth. |
| AT5G02870 | Ribosomal protein L4/L1 family;(source:Araport11) |
| AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
| AT5G02920 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
| AT5G02950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT5G02980 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G02990 | galactose oxidase/kelch repeat protein;(source:Araport11) |
| AT5G03000 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G03020 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G03030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G03080 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene, LPPgamma appears to be more important for diacylglycerol formation than LPPepsilon1 and LPPepsilon2 in the plastids. Heterozygous lppgamma mutants produce pollen that have defects in pollen tube germination and no homozygous mutants have been recovered. The mRNA is cell-to-cell mobile. |
| AT5G03130 | hypothetical protein;(source:Araport11) |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G03170 | Encodes FLA11, a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. |
| AT5G03180 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03250 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G03260 | LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G03285 | other_RNA;(source:Araport11) |
| AT5G03370 | acylphosphatase family;(source:Araport11) |
| AT5G03377 | pseudogene of acylphosphatase family protein |
| AT5G03415 | Encodes a homolog of the animal DP protein. DP, in animals, forms a heterodimer with E2F and plays a central role in G1/S transition in the cell division cycle. DPB has been shown to interact with non phosphorylated E2Fc; when E2Fc is phosphorylated, the formation of the E2Fc/DPB heterodimer is lost. |
| AT5G03420 | Encodes a chloroplast-localized CBM48-containing protein that is involved in starch granule initiation. Mutants lacking PTST3 have fewer starch granules in leaf chloroplasts than the wild type. PTST3 interacts with PTST2, which is also involved in granule initiation. |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03455 | Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance. |
| AT5G03470 | Encodes B' regulatory subunit of PP2A (AtB'alpha), putative size of 57 kDa.Functions redundantly with the beta subunit do maintain sister chromatid cohesion during meiosis. |
| AT5G03480 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G03500 | Encodes together with its paralog MED7A a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
| AT5G03510 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G03530 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes. |
| AT5G03550 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT5G03552 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGCGGGAAGCAUUUGCACAUG |
| AT5G03555 | Encodes PLUTO (plastidic nucleobase transporter), a member of the Nucleobase:Cation-Symporter1 protein family, capable of transporting purine and pyrimidine nucleobases. |
| AT5G03560 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G03570 | Encodes FPN2, a tonoplast localized nickel transport protein. FPN2 is one of the Arabidopsis orthologs (AT2G38460/IREG1/FPN1 and AT5G03570/IREG2/FPN2) the iron efflux transporter ferroportin (FPN) identified in animals. |
| AT5G03580 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
| AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
| AT5G03668 | Natural antisense transcript overlaps with AT5G03670;(source:Araport11) |
| AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11) |
| AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
| AT5G03690 | Aldolase superfamily protein;(source:Araport11) |
| AT5G03750 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
| AT5G03800 | Encodes a protein with a large central domain of 14 internal pentatricopeptide motifs (some degenerate) arranged in tandem. Mutations in this locus result in embryo lethality. |
| AT5G03810 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G03858 | Pseudogene of AT5G03960; IQD12 (IQ-domain 12); calmodulin binding protein |
| AT5G03870 | Glutaredoxin family protein;(source:Araport11) |
| AT5G03880 | Thioredoxin family protein;(source:Araport11) |
| AT5G03905 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT5G03920 | F-box protein;(source:Araport11) |
| AT5G03960 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G03980 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT5G03990 | FK506-binding-like protein;(source:Araport11) |
| AT5G04000 | hypothetical protein;(source:Araport11) |
| AT5G04010 | F-box family protein;(source:Araport11) |
| AT5G04090 | histidine-tRNA ligase;(source:Araport11) |
| AT5G04140 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. The mRNA is cell-to-cell mobile. |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT5G04190 | Encodes phytochrome kinase substrate 4, a phytochrome signaling component involved in phototropism. It is phosphorylated in a phot1-dependent manner in vitro. Phosphorylation is transient and regulated by a type 2- protein phosphatase. |
| AT5G04200 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT5G04240 | Early Flowering 6 (ELF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a repressor in the photoperiod pathway. ELF6 interacts with BES1 in a Y2H assay, in vitro, and in Arabidosis protoplasts (based on BiFC). ELF6 may play a role in brassinosteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. |
| AT5G04267 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G04275 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172b (converted to TAIR10 based on PMID19304749): Chr5: 1188916-1187500 (reverse), length: 1417 bp; exon coordinates: exon 1: 1188916 to 1188742, exon 2: 1188623 to 1188583, exon 3: 1188383 to 1188133, exon 4: 1187852 to 1187500; mature miRNA and miRNA* are located on exon 3. |
| AT5G04280 | Encodes one of the zinc finger-containing glycine-rich RNA-binding proteins involved in cold tolerance: AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b), AT5G04280 (AtRZ-1c). It also, along with AtRZ-1b, plays important roles in plant development, pre- mRNA splicing, and general gene expression. |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G04330 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT5G04347 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G04350 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G04370 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes NAMT1, a methyltransferase that methylates nicotinic acid to yield methyl nicotinate. |
| AT5G04390 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G04400 | NAC domain protein;(source:Araport11) |
| AT5G04440 | RAP release 2, galactose-binding-like domain protein, putative (DUF1997);(source:Araport11) |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT5G04480 | Encodes a protein with sequence similarity to glycosyltransferases that is localized to the golgi apparatus and is involved in pollen tube development. |
| AT5G04500 | Encodes a member of the CAZy Glycosyltransferase Family 64 that is involved in glycosylinositolphosphorylceramide and sphingolipid glycosylation. In mutants, seed germination was less sensitive to salt stress than in wild-type plants. [The protein was expected to be Golgi-localized based on function as well as the Golgi localization of its homolog GMT1. However, GFP-fusion proteins localized both to the ER and Golgi, and especially to ER when co-expressed with Golgi markers. Therefore, localization cannot confidently be defined. (pers. communication, J. Mortimer)] |
| AT5G04510 | Encodes 3-phosphoinositide-dependent protein kinase that contains pleckstrin homology domain and binds 3-phosphoinositides. It activates the protein kinase AGC2-1 in a phosphatidic acid dependent manner. Phosphorylates S6K1. Interacts with PID, and transphosphorylation by PDK1 increases PID autophosphorylation. The mRNA is cell-to-cell mobile. |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
| AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668);(source:Araport11) |
| AT5G04590 | A.thaliana gene encoding sulfite reductase. |
| AT5G04640 | AGAMOUS-like 99;(source:Araport11) |
| AT5G04650 | transposable_element_gene;(source:Araport11) |
| AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT5G04680 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G04690 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G04700 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G04720 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. The mRNA is cell-to-cell mobile. |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
| AT5G04830 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT5G04840 | bZIP protein;(source:Araport11) |
| AT5G04890 | Specifically restricts the long-distance movement of tobacco etch potyvirus (TEV) without involving either hypersensitive cell death or systemic acquired resistance. Multidomain protein containing an N-terminal region with high similarity to plant small heat shock proteins (HSPs). |
| AT5G04895 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G04910 | DNA repair REX1-B protein;(source:Araport11) |
| AT5G04950 | Encodes a nicotianamide synthase. |
| AT5G04980 | DNAse I-like superfamily protein;(source:Araport11) |
| AT5G04990 | Encodes a member of the Sad1/UNC-84 (SUN)-domain proteins: AtSUN1(At5g04990), AtSUN2(AT3G10730). SUN domain proteins are part of the cytoskeletal-nucleoskeletal bridging complexes. AtSUN1 and AtSUN2 are localized to the nuclear envelope and are present as homomers and heteromers in vivo.Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with WPP domain interacting-proteins (WIPs). It is involved in maintaining the elongated nuclear shape of epidermal cells. |
| AT5G05020 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
| AT5G05070 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G05150 | autophagy-related protein 18E;(source:Araport11) |
| AT5G05160 | Encodes a receptor-like kinase that activates secondary growth, the production of secondary vascular tissues. |
| AT5G05190 | hypothetical protein (DUF3133);(source:Araport11) |
| AT5G05220 | hypothetical protein;(source:Araport11) |
| AT5G05250 | hypothetical protein;(source:Araport11) |
| AT5G05280 | Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway. |
| AT5G05300 | IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens. |
| AT5G05320 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
| AT5G05350 | PLAC8 family protein;(source:Araport11) |
| AT5G05360 | hypothetical protein;(source:Araport11) |
| AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G05410 | Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress?inducible genes. The mRNA is cell-to-cell mobile. |
| AT5G05420 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G05470 | Encodes an eIF2alpha homolog that can be phosphorylated by GCN2 in vitro. |
| AT5G05480 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
| AT5G05500 | Encodes Proline-rich protein-like PRPL1, controls elongation of root hairs. |
| AT5G05520 | Outer membrane OMP85 family protein;(source:Araport11) |
| AT5G05540 | small RNA degrading nuclease 2;(source:Araport11) |
| AT5G05560 | Encodes a subunit of the Arabidopsis thaliana E3 ubiquitin ligase complex that plays a synergistic role with APC4 both in female gametogenesis and in embryogenesis. |
| AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT5G05640 | nucleoprotein-like protein;(source:Araport11) |
| AT5G05657 | late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G05730 | ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots. |
| AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT5G05760 | A SNARE protein (ortholog of syntaxin 5), a membrane fusion machine component involved in cytokinesis |
| AT5G05790 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT5G05810 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT5G05860 | Encodes a cytokinin N-glucosyltransferase that is involved in cytokinin homeostasis and cytokinin response in planta through cytokinin N-glucosylation. Expression is induced by ABA, mannitol and drought stress. Analysis of overexpressors and loss of function mutants indicate a role in response to osmotic and drought stress. |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G05890 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G05900 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G05910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05940 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G05965 | cell wall RBR3-like protein;(source:Araport11) |
| AT5G05990 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT5G06010 | hypothetical protein;(source:Araport11) |
| AT5G06050 | Putative methyltransferase family protein;(source:Araport11) |
| AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G06100 | Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity. |
| AT5G06140 | Homolog of yeast retromer subunit VPS5. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. In roots it co-localizes with the PIN2 auxin efflux carrier. Involved in endocytic sorting of membrane proteins including PIN2, BOR1 and BRI1. |
| AT5G06150 | Encodes a cyclin whose expression is reduced in response to high salt. |
| AT5G06165 | other_RNA;(source:Araport11) |
| AT5G06170 | sucrose symporter with hight affinity for sucrose (K0.5=0.066 +/- 0.025mM), that can also transport a wide range of glucosides. |
| AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
| AT5G06260 | TLD-domain containing nucleolar protein;(source:Araport11) |
| AT5G06270 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations |
| AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
| AT5G06310 | Encodes AtPOT1b. Note on nomenclature: different names have been given to Arabidopsis POT-like genes (Kuchar and Fajkus, 2004; Shakirov et al, 2005; Tani and Murata, 2005). According to a unifying nomenclature (Surovtseva et al, 2007), At2g05210 (previously named AtPOT1) is designated AtPOT1a, while At5g06310 (previously named AtPOT2) is designated AtPOT1b. |
| AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
| AT5G06440 | polyketide cyclase/dehydrase/lipid transport superfamily protein;(source:Araport11) |
| AT5G06460 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. The mRNA is cell-to-cell mobile. |
| AT5G06470 | Glutaredoxin family protein;(source:Araport11) |
| AT5G06510 | nuclear factor Y, subunit A10;(source:Araport11) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G06610 | DUF620 domain protein. In xylem cells BRD1 is expressed in the secondary wall pit boundaries. BRD1 interacts with and appears to be necessary to recruit WALLIN to the plasma membrane. |
| AT5G06690 | Encodes a thioredoxin (WCRKC1) localized in chloroplast stroma. Contains a WCRKC motif. Functions in redox cascade with 2CPA and 2CPB via the ferredoxin-thioredoxin reductase (FTR)/thioredoxin (Trx) pathway to mediate the light-responsive reductive control of target proteins. Oxidizes redox-regulated proteins. |
| AT5G06720 | Encodes a peroxidase with diverse roles in the wound response, flower development, and syncytium formation. |
| AT5G06730 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G06750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT5G06770 | KHZ2 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ1.Double mutants with khz1 are late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT5G06780 | Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein;(source:Araport11) |
| AT5G06790 | cotton fiber protein;(source:Araport11) |
| AT5G06820 | STRUBBELIG-receptor family 2;(source:Araport11) |
| AT5G06839 | bZIP transcription factor family protein;(source:Araport11) |
| AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
| AT5G06890 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G06900 | member of CYP93D |
| AT5G06905 | member of CYP712A |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06930 | nucleolar-like protein;(source:Araport11) |
| AT5G07030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G07060 | Encodes MAC5C, homologous to MAC5A. MAC5A is a component of the MOS4-associated complex (MAC) that contributes to snc1- mediated autoimmunity. Homologues include AT1G07360 (MAC5A), AT2G29580 (MAC5B) and AT5G07060 (MAC5C). MAC5A and MAC5B are more closely related to each other than to MAC5C. |
| AT5G07080 | Encodes enzymes that can efficiently convert putrescine and caffeoyl-CoA to di-caffeoyl putrescine. Can convert spermidine/spermine and feruloyl CoA to mono-feruloyl spermidine/spermine. Has a preference for feruloyl-CoA binding, but little acyl-acceptor specificity. |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
| AT5G07110 | Encodes PRA1.B6, an isoform of the PRA1 (Prenylated Rab acceptors) family. PRAs bind to prenylated Rab proteins and possibly aids in targeting Rabs to their respective compartments. PRA1.B6 localizes to the Golgi apparatus and its ER-to-Golgi trafficking and localization to the Golgi apparatus are regulated by multiple sequence motifs in both the C- and N-terminal cytoplasmic domains. |
| AT5G07120 | Encodes sorting nexin SNX2b. SNX2b is peripherally associated with membranes. Involved in vesicular trafficking from endosomes to the vacuole. |
| AT5G07135 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G07170 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
| AT5G07180 | Encodes a receptor-like kinase that, together with ER and ERL1 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is also important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. When heterozygous in an er/erl1 null background, plants are female sterile due to cell division defect in the integuments. |
| AT5G07240 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G07260 | START (StAR-related lipid-transfer) lipid-binding domain-containing protein;(source:Araport11) |
| AT5G07270 | hypothetical protein;(source:Araport11) |
| AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
| AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT5G07330 | NFU1 iron-sulfur cluster protein;(source:Araport11) |
| AT5G07380 | hypothetical protein;(source:Araport11) |
| AT5G07390 | respiratory burst oxidase homolog A;(source:Araport11) |
| AT5G07420 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G07440 | Encodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT5G07450 | cyclin p4;(source:Araport11) |
| AT5G07490 | transmembrane protein;(source:Araport11) |
| AT5G07540 | encodes a glycine-rich protein that is expressed only in flowers during a specific developmental stage (flower stages 11 and 12). |
| AT5G07550 | member of Oleosin-like protein family |
| AT5G07571 | Oleosin family protein;(source:Araport11) |
| AT5G07600 | Oleosin family protein;(source:Araport11) |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G07650 | Actin-binding FH2 protein;(source:Araport11) |
| AT5G07680 | NAC domain containing protein 80;(source:Araport11) |
| AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
| AT5G07700 | Encodes a putative transcription factor (MYB76). |
| AT5G07730 | transmembrane protein;(source:Araport11) |
| AT5G07760 | formin homology 2 domain-containing protein / FH2 domain-containing protein;(source:Araport11) |
| AT5G07780 | Encodes a class II formin that nucleates actin assembly, binds to the barbed-end of actin filaments and antagonizes the effect of FH1 on actin dynamics. The mRNA is cell-to-cell mobile. |
| AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G07840 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G07850 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G07870 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G07900 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT5G07940 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G07990 | Required for flavonoid 3' hydroxylase activity. Enzyme abundance relative to CHS determines Quercetin/Kaempferol metabolite ratio. The mRNA is cell-to-cell mobile. |
| AT5G08000 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. |
| AT5G08010 | hypothetical protein;(source:Araport11) |
| AT5G08050 | Encodes a grana core localized protein. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
| AT5G08060 | furry;(source:Araport11) |
| AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G08141 | Part of complex with ENO2 which mediates secondary metabolism, affecting seed size and weight. |
| AT5G08150 | Encodes SOB5. Activation tagging lines accumulated higher level of cytokinin. |
| AT5G08160 | Encodes a serine/threonine protein kinase. |
| AT5G08240 | transmembrane protein;(source:Araport11) |
| AT5G08250 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT5G08260 | serine carboxypeptidase-like 35;(source:Araport11) |
| AT5G08270 | C5orf35;(source:Araport11) |
| AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT5G08391 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT5G08400 | structural maintenance of chromosomes-like protein, putative (DUF3531);(source:Araport11) |
| AT5G08470 | an AAA-ATPase that is the probable Arabidopsis orthologue of one of the AAA-ATPases involved in peroxisome biogenesis in yeasts and mammals. |
| AT5G08505 | Encodes a defensin-like (DEFL) family protein. |
| AT5G08520 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT5G08540 | ribosomal RNA small subunit methyltransferase J;(source:Araport11) |
| AT5G08560 | WRDR26 is a WD-40 repeat containing protein initially identified as an interacting partner RanBPM. Its expression is induced by abiotic stress as well as various plant growth regulators including IAA, ABA and ethylene. Role as a novel modulator of redox homeostatis, responding to developmental and stress signals to regulate leaf senescence. |
| AT5G08600 | U3 ribonucleoprotein (Utp) family protein;(source:Araport11) |
| AT5G08610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G08620 | Similar in sequence to DEAD-box RNA helicases. Binds RNA. Involved in drought, salt and cold stress responses. |
| AT5G08630 | DDT domain-containing protein;(source:Araport11) |
| AT5G08660 | D-lactate dehydrogenase (DUF668);(source:Araport11) |
| AT5G08690 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT5G08695 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G08730 | IBR domain-containing protein;(source:Araport11) |
| AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT5G09220 | member of AAAP family The mRNA is cell-to-cell mobile. |
| AT5G09280 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G09290 | Inositol monophosphatase family protein;(source:Araport11) |
| AT5G09320 | vacuolar protein sorting-associated 9A-like protein;(source:Araport11) |
| AT5G09410 | calmodulin-binding protein, similar to another ethylene-upregulated calmodulin-binding protein ER1 GI:11612392 from (Nicotiana tabacum) |
| AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G09430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G09450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G09470 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
| AT5G09550 | GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11) |
| AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT5G09570 | Twin CX9C domain protein. Induced by low phosphate or iron, drought and heat stress. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
| AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G09660 | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09700 | pseudogene of glycosyl hydrolase family 3 protein |
| AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G09770 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G09820 | Encodes fibrillin 5 (FBN5). Located in chloroplast stroma. Essential for plastoquinone-9 biosynthesis. Stimulates enzymatic activity of solanesyl diphosphate synthases (SPS) 1 and 2 through binding to solanesyl moiety. Two splicing variants, named FBN5-A shorter one and FBN5-B longer one. FBN5-B is the protein detected in chloroplast stroma. Involved in plastoquinone biosynthesis. |
| AT5G09876 | hypothetical protein;(source:Araport11) |
| AT5G09930 | ABCF2 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein, GCN20. |
| AT5G09940 | hypothetical protein (DUF1635);(source:Araport11) |
| AT5G09970 | Member of CYP78A family. Paralog of CYP78A5 and appears to function in a shoot meristem maintainence pathway with LAMP1 that parallels AMP1/CYP87A5. |
| AT5G10020 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G10040 | transmembrane protein;(source:Araport11) |
| AT5G10060 | ENTH/VHS family protein;(source:Araport11) |
| AT5G10090 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G10100 | Trehalose-6-phosphate phosphatase which enhances drought tolerance by regulating stomatal apertures. |
| AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT5G10130 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G10150 | SOK2 is a DUF966 domain containing protein of unknown function. Expressed in discrete domains of the PM. In root endodermis and embryo, expression is in inner basal edges and in basal |
| AT5G10160 | Thioesterase superfamily protein;(source:Araport11) |
| AT5G10170 | myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G10180 | Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation. |
| AT5G10200 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT5G10210 | nitric oxide synthase-interacting protein;(source:Araport11) |
| AT5G10240 | Encodes asparagine synthetase (ASN3). |
| AT5G10260 | RAB GTPase homolog H1E;(source:Araport11) |
| AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT5G10280 | Encodes a putative transcription factor (MYB92). |
| AT5G10290 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT5G10340 | F-box family protein;(source:Araport11) |
| AT5G10380 | Encodes a RING finger domain protein with E3 ligase activity that is localized to the lipid rafts of the plasma membrane. Expression is increased in response to fungal pathogen. May be involved in regulation of programmed cell death by facilitating degredation of regulation of PDC activators. The mRNA is cell-to-cell mobile. |
| AT5G10455 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT5G10470 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells. |
| AT5G10480 | Protein tyrosine phosphatase-like involved in cell division and differentiation. Interacts with CDKA;1 only in its phosphorylated form, preventing dephosphorylation. Overexpression slowed down cell division in suspension cell cultures at the G2-to-M transition and early mitosis and inhibited Arabidopsis seedling growth. Localized in the cytoplasm of dividing cells but moved into the nucleus upon cell differentiation. Based on complementation of yeast mutant PAS2 has acyl-CoA dehydratase activity. It interacts with CER10, a component of the microsomal fatty acid elongase complex, suggesting a role in synthesis of VLCFAs (very long chain fatty acids). |
| AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
| AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
| AT5G10590 | hypothetical protein;(source:Araport11) |
| AT5G10620 | methyltransferase;(source:Araport11) |
| AT5G10630 | Transcripts of this gene are alternatively spliced to encode either HBS1, a decoding factor translational GTPase, or SKI7, a component of the cytosolic RNA exosome. |
| AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT5G10690 | pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein;(source:Araport11) |
| AT5G10730 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G10750 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G10790 | Encodes a ubiquitin-specific protease. |
| AT5G10890 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G10920 | L-Aspartase-like family protein;(source:Araport11) |
| AT5G11050 | Member of R2R3-MYB transcription factor gene family. |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT5G11070 | hypothetical protein;(source:Araport11) |
| AT5G11080 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G11130 | Exostosin family protein;(source:Araport11) |
| AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT5G11160 | adenine phosphoribosyltransferase 5;(source:Araport11) |
| AT5G11180 | member of Putative ligand-gated ion channel subunit family |
| AT5G11210 | member of Putative ligand-gated ion channel subunit family |
| AT5G11242 | pseudogene of ribosomal protein |
| AT5G11250 | Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET. |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT5G11320 | Belongs to the YUC gene family. Encodes a predicted flavin monooxygenase. YUC4 is part of a pathway linking auxin biosynthesis and gynoecium development. It is expressed in the stigma and the apical meristem and is ethylene inducible. |
| AT5G11325 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT5G11350 | Deadenylase. |
| AT5G11370 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
| AT5G11400 | Psuedokinase that appears to produce a truncated (42AA protein) in Col-0 reference genome. Full length transcripts have been identified in Hh-0, Västervik and Dju-1 ecotypes. |
| AT5G11410 | Similar to receptor like kinase but does not appear to have kinase activity (psuedokinase). It is involved in HopZ1a effector triggered immunity. Interacts with ZAR1 and ZED1.Localization to membrane is dependent on N-terminal myristoylation domain |
| AT5G11412 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G11420 | Encodes a DUF642 cell wall protein. |
| AT5G11440 | Interacts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain. |
| AT5G11490 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT5G11500 | coiled-coil protein;(source:Araport11) |
| AT5G11530 | Involved in regulating reproductive development |
| AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G11560 | catalytics;(source:Araport11) |
| AT5G11570 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G11620 | SWIM zinc finger family protein / mitogen-activated protein kinase kinase kinase (MAPKKK)-like protein;(source:Araport11) |
| AT5G11650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G11730 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
| AT5G11820 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G11830 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
| AT5G11890 | harpin-induced protein;(source:Araport11) |
| AT5G11920 | Encodes a protein with fructan exohydrolase (FEH) activity acting on both inulin and levan-type fructans (1- and 6-FEH). The enzyme does not have invertase activity. |
| AT5G11930 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT5G11940 | Subtilase family protein;(source:Araport11) |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
| AT5G11990 | proline-rich family protein;(source:Araport11) |
| AT5G12050 | rho GTPase-activating protein;(source:Araport11) |
| AT5G12100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT5G12140 | Encodes a cystatin. |
| AT5G12180 | member of Calcium Dependent Protein Kinase |
| AT5G12230 | mediator of RNA polymerase II transcription subunit 19a-like protein;(source:Araport11) |
| AT5G12270 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G12280 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
| AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G12330 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation. |
| AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G12360 | Encodes a protein that protects meiotic centromere cohesion. |
| AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT5G12860 | AtpOMT1 encodes dicarboxylate transporter functions both as as an oxaloacetate/malate transporter and as a 2-oxoglutarate/malate transporter. |
| AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
| AT5G12890 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G12900 | DNA double-strand break repair RAD50 ATPase;(source:Araport11) |
| AT5G12920 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G12980 | Component of the CCR4-NOT complex; acts as negative regulator of phyA-specific light signalling when bound to NOT1, the scaffold protein of the complex. Photoactivated phyA can displace NOT9B from the CCR4-NOT complex. |
| AT5G13000 | encodes a gene similar to callose synthase |
| AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
| AT5G13100 | Gap junction beta-4 protein;(source:Araport11) |
| AT5G13130 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. Possible role in the development of reproductive tissues. |
| AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G13170 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G13210 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT5G13230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
| AT5G13250 | RING finger protein;(source:Araport11) |
| AT5G13260 | myosin;(source:Araport11) |
| AT5G13270 | Encodes RARE1 (Required for accD RNA Editing 1), a trans-factor essential for C-to-U editing of the chloroplast accD transcript. RARE1 carries 15 PPR (pentatricopeptide repeat) motifs, an E/E+ and a DYW domain (C-terminal tripeptide). |
| AT5G13280 | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). |
| AT5G13350 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G13370 | IBA - specific acyl acid amido synthetase which conjugates glutamine to IBA. It is involved in generating inactive and/or storage forms of IBA in the seedling, root, and silique. May play a role in auxin homeostasis by modulating the levels of IBA for peroxisomal conversion to IAA. |
| AT5G13380 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G13390 | Required for normal pollen development and lipid accumulation within the tapetum |
| AT5G13500 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT5G13530 | Encodes KEEP ON GOING (KEG), a RING E3 ligase involved in abscisic acid signaling. KEG is essential for Arabidopsis growth and development. ABA promotes KEG degradation via the ubiquitin dependent 26S proteasome pathway. Associates with and ubiquitinates MKK4 and MKK5 to regulate plant immunity. |
| AT5G13548 | Pseudogene of AT3G12600; ATNUDT16 (Arabidopsis thaliana Nudix hydrolase homolog 16); hydrolase |
| AT5G13580 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). Phloem-expressed and plasma membrane-localized jasmonate transporter which together with JAT4 and GLR3.3 involved in regulating long-distance translocation of JA, which is important for driving the loading, translocation of JA in the phloem pathway by a self-propagation mode, contributing to wound-induced systemic response/resistance. |
| AT5G13610 | Encodes a mitochondria-localized protein involved in ABI4-mediated mitochondrial retrograde signalling. |
| AT5G13620 | hypothetical protein;(source:Araport11) |
| AT5G13630 | Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction. |
| AT5G13680 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. Mutants have no ncm5U (5-carbamoylmethyluridine). |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT5G13720 | Uncharacterized protein family (UPF0114);(source:Araport11) |
| AT5G13730 | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
| AT5G13770 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G13780 | Encodes the catalytic subunit of a N-terminal acetyltransferase. |
| AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G13840 | FIZZY-related 3;(source:Araport11) |
| AT5G13860 | ELCH-like protein;(source:Araport11) |
| AT5G13930 | Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism. The mRNA is cell-to-cell mobile. |
| AT5G13940 | aminopeptidase;(source:Araport11) |
| AT5G14000 | NAC domain containing protein 84;(source:Araport11) |
| AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT5G14060 | lysine-sensitive aspartate kinase |
| AT5G14080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G14090 | LAZY1 is required for gravitropic response. Mutants have abnormal shoot angles and abnormal root gravitropism. LZY1 affects the redistribution of auxin in response to gravity in shoots and roots via an unknown mechanism. |
| AT5G14105 | hypothetical protein;(source:Araport11) |
| AT5G14130 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G14160 | F-box family protein;(source:Araport11) |
| AT5G14180 | Myzus persicae-induced lipase 1;(source:Araport11) |
| AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G14240 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G14300 | prohibitin 5;(source:Araport11) |
| AT5G14340 | Member of the R2R3 factor gene family. |
| AT5G14430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G14460 | Pseudouridine synthase family protein;(source:Araport11) |
| AT5G14470 | GHMP kinase family protein;(source:Araport11) |
| AT5G14490 | NAC domain containing protein 85;(source:Araport11) |
| AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT5G14560 | hypothetical protein;(source:Araport11) |
| AT5G14580 | polyribonucleotide nucleotidyltransferase;(source:Araport11) |
| AT5G14590 | Isocitrate/isopropylmalate dehydrogenase family protein;(source:Araport11) |
| AT5G14602 | methyltransferase-like protein;(source:Araport11) |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT5G14690 | transmembrane protein;(source:Araport11) |
| AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
| AT5G14730 | Unknown protein, expression induced by IDL7 and stress. |
| AT5G14740 | Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform. |
| AT5G14750 | Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC). |
| AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
| AT5G14830 | transposable_element_gene;(source:Araport11);retrotransposon family;(source:TAIR10) |
| AT5G14860 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G14870 | Encodes a member of the cyclic nucleotide gated channel family that is asymmetrically localized to the plasma membrane at the growing tip of the pollen tube and is involved in pollen tube growth and pollen tube guidance to ovules. It likely directly transduces a cNMP signal into an ion flux that can produce a localized signal capable of regulating the pollen tip-growth machinery. Also functions as a Ca2+ permeable channel. |
| AT5G14890 | potassium transporter;(source:Araport11) |
| AT5G14900 | helicase associated (HA2) domain-containing protein;(source:Araport11) |
| AT5G14930 | encodes an acyl hydrolase involved in senescence . |
| AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G14990 | WPP domain associated protein;(source:Araport11) |
| AT5G14995 | Encodes a ECA1 gametogenesis related family protein |
| AT5G15000 | Encodes a ECA1 gametogenesis related family protein |
| AT5G15010 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G15070 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion. It is the minor isoform in plants and is expressed in pollen. |
| AT5G15080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G15090 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. Purified VDAC3 is shown to have voltage-dependent anion channel activity. |
| AT5G15100 | Encodes an auxin transporter with a strong expression in a male gametophyte. Mutant studies reveal a role for auxin transport in regulating pollen development and function. It acts together with PIN5. |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT5G15140 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT5G15190 | hypothetical protein;(source:Araport11) |
| AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
| AT5G15250 | Encodes an FtsH protease that is localized to the chloroplast. AtFtsH6 is involved in the degradation of both Lhcb3 and Lhcb1 during senescence and high-light acclimation. |
| AT5G15260 | ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT5G15265 | transmembrane protein;(source:Araport11) |
| AT5G15280 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G15290 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
| AT5G15340 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT5G15400 | Single copy gene encoding a putative ubiquitin conjugating E4 factor. Contains Ub elongating factor core domain and C-terminal U-box. Involved in ubiquitination of NLRs. |
| AT5G15480 | Cys2/His2 zinc finger protein involved in pollen wall development. |
| AT5G15510 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT5G15560 | hypothetical protein;(source:Araport11) |
| AT5G15670 | F-box family protein;(source:Araport11) |
| AT5G15700 | Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast. |
| AT5G15770 | Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum. |
| AT5G15845 | Natural antisense transcript overlaps with AT5G15850;(source:Araport11) |
| AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
| AT5G15860 | Encodes a protein with prenylcysteine methylesterase activity. |
| AT5G15900 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G15995 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-36 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G16000 | NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP). |
| AT5G16020 | Encodes GEX3, a plasma membrane localized protein expressed in the male gametophyte. Required for micropylar pollen tube guidance. Also plays a role during early embryogenesis. |
| AT5G16023 | Encodes a plant peptide that could be involved in the coordination of socket cell development in wild-type plants. |
| AT5G16030 | mental retardation GTPase activating protein;(source:Araport11) |
| AT5G16060 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
| AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
| AT5G16100 | RWP-RK domain protein;(source:Araport11) |
| AT5G16180 | Promotes the splicing of chloroplast group II introns. Splices atpF introns. |
| AT5G16190 | encodes a gene similar to cellulose synthase |
| AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
| AT5G16250 | transmembrane protein;(source:Araport11) |
| AT5G16280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT5G16300 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT5G16310 | Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1;(source:Araport11) |
| AT5G16330 | NC domain-containing protein-like protein;(source:Araport11) |
| AT5G16350 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G16390 | Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex. |
| AT5G16400 | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
| AT5G16410 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G16420 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G16430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G16453 | Encodes a defensin-like (DEFL) family protein. |
| AT5G16470 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT5G16500 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
| AT5G16520 | transmembrane protein;(source:Araport11) |
| AT5G16540 | Encodes a zinc finger protein. |
| AT5G16570 | Encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
| AT5G16580 | beta glucosidase 2;(source:Araport11) |
| AT5G16590 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G16640 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G16660 | Low-density receptor-like protein;(source:Araport11) |
| AT5G16710 | DHAR3 protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.Encodes 30-40% of extractable leaf GSH-dependent DHAR activity. Single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions.Makes a minor contribution to glutathione oxidation in response to increased intracellular hydrogen peroxide (catalase deficiency) (PMID:28381499). |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G16730 | Encodes a microtubule-associated protein. The mRNA is cell-to-cell mobile. |
| AT5G16740 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G16760 | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT5G16770 | Member of the R2R3 factor gene family. |
| AT5G16800 | Plasma membrane-anchored post-translationally acting N-acetyltransferase involved in high salt stress response. |
| AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
| AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G16930 | AAA-type ATPase family protein;(source:Araport11) |
| AT5G16960 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT5G17020 | Encodes a member of the exportin protein family (XPO1A) which functions as receptors for nuclear export. Binds to a variety of proteins having leucine rich export signals.Along with XPO1B involved with development of the male and female gametophytes. Sensitive to heat and oxidative stress. |
| AT5G17030 | UDP-glucosyl transferase 78D3;(source:Araport11) |
| AT5G17040 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G17130 | cysteine-type peptidase;(source:Araport11) |
| AT5G17160 | aspartic/glutamic acid-rich protein;(source:Araport11) |
| AT5G17200 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G17220 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts. |
| AT5G17250 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT5G17260 | NAC domain containing protein 86;(source:Araport11) |
| AT5G17270 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
| AT5G17310 | UDP-glucose pyrophosphorylase 2;(source:Araport11) |
| AT5G17340 | Putative membrane lipoprotein;(source:Araport11) |
| AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G17410 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT5G17420 | Encodes a xylem-specific cellulose synthase that is phosphorylated on one or more serine residues (on either S185 or one of S180 or S181). |
| AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11) |
| AT5G17470 | EF hand calcium-binding protein family;(source:Araport11) |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G17540 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G17580 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G17590 | Putative membrane lipoprotein;(source:Araport11) |
| AT5G17600 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G17650 | glycine/proline-rich protein;(source:Araport11) |
| AT5G17690 | Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state. |
| AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G17725 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-07 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT5G17730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G17740 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G17750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G17830 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
| AT5G17870 | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
| AT5G17880 | Encodes a TIR-NBS-LRR protein CSA1 that functions in photomorphogenic development. csa1 mutants display a constitutive shade-avoidance (CSA) phenotype (long stem) under high red:far-red rations (i.e. in the absence of a shade signal). csa1 mutation can be complemented by RPS4, a TIR-NBS-LRR protein that confers resistance against bacterium Pseudomonas syringae. |
| AT5G17900 | microfibrillar-associated protein-like protein;(source:Araport11) |
| AT5G17950 | disease resistance protein;(source:Araport11) |
| AT5G17960 | Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments. |
| AT5G17970 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G18000 | Encodes VERDANDI (VDD), a putative transcription factor belonging to the reproductive meristem (REM) family. VDD is a direct target of the MADS domain ovule identity complex. Mutation in VDD affects embryo sac differentiation. |
| AT5G18010 | Encodes SAUR19 (small auxin up RNA 19). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), At5g18010 is SAUR24. |
| AT5G18030 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G18040 | target of trans acting-siR480/255 protein;(source:Araport11) |
| AT5G18090 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G18130 | transmembrane protein;(source:Araport11) |
| AT5G18140 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G18150 | Methyltransferase-related protein;(source:Araport11) |
| AT5G18160 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT5G18220 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G18230 | transcription regulator NOT2/NOT3/NOT5 family protein;(source:Araport11) |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT5G18300 | NAC domain containing protein 88;(source:Araport11) |
| AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
| AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
| AT5G18340 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress. E3 ligase which acts as a regulator in the heat response signaling pathway. Over-expressing AtPUB48 could induce the expression of the heat-related genes (HSP101, HSP70, HSP25.3, HSFA2, and ZAT12). Enhances plant resistance to heat stress during seed germination and seedling growth. |
| AT5G18350 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G18370 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. |
| AT5G18400 | Cytosolic Iron-sulfur cluster Assembly protein. |
| AT5G18407 | Encodes a defensin-like (DEFL) family protein. |
| AT5G18440 | Encodes NUFIP that directs assembly of C/D snoRNP (small nucleolar ribonucleoprotein). |
| AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT5G18490 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT5G18510 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
| AT5G18525 | Encodes a BEACH domain containing protein that is involved in targeting storage proteins to the protein storage vacuoles and effector triggered immunity to Psuedomonas syringae. |
| AT5G18540 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT5G18550 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT5G18560 | Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression. |
| AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
| AT5G18660 | Encodes a protein with 3,8-divinyl protochlorophyllide a 8-vinyl reductase activity. Mutants accumulate divinyl chlorophyll rather than monovinyl chlorophyll. |
| AT5G18661 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G18720 | DNAJ heat shock amino-terminal domain protein, putative (DUF3444);(source:Araport11) |
| AT5G18730 | DNAJ heat shock amino-terminal domain protein;(source:Araport11) |
| AT5G18755 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G18790 | Ribosomal protein L33 family protein;(source:Araport11) |
| AT5G18810 | encodes an SC35-like splicing factor of 28 kD localized to the nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G18830 | Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c. |
| AT5G18840 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT5G18890 | Inosine-uridine preferring nucleoside hydrolase family protein;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G18930 | S-adenosylmethionine decarboxylase family member. |
| AT5G18980 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G19020 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
| AT5G19030 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G19060 | cytochrome P450 family protein;(source:Araport11) |
| AT5G19080 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19097 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-284 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G19110 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G19140 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT5G19160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G19170 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G19190 | hypothetical protein;(source:Araport11) |
| AT5G19200 | Encodes one of the Arabidopsis proteins (At3g06060/TSC10A and At5g19200/TSC10B) with significant similarity to the yeast 3-ketodihydrosphinganine (3-KDS) reductase, Tsc10p. Both TSC10A and TSC10B are bona fide 3-KDS reductase as shown by complementation experiment in yeast. |
| AT5G19210 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G19260 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT5G19270 | reverse transcriptase-like protein;(source:Araport11) |
| AT5G19280 | kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region |
| AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
| AT5G19310 | Encodes CHR23. Overexpression results in increased variability of growth and gene expression. |
| AT5G19360 | member of Calcium Dependent Protein Kinase |
| AT5G19390 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
| AT5G19400 | Encodes SMG7, a protein that possesses an evolutionarily conserved EST1 domain and exhibits strong homology to human SMG6 (EST1A) and SMG7 (EST1C) proteins. SMG7 plays an evolutionarily conserved role in nonsense-mediated RNA decay (NMD). Required for exit from meiosis. Hypomorphic smg7 alleles render mutant plants sterile by causing an unusual cell-cycle arrest in anaphase II that is characterized by delayed chromosome decondensation and aberrant rearrangement of the meiotic spindle. Disruption of SMG7 causes embryonic lethality. |
| AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G19440 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
| AT5G19470 | nudix hydrolase homolog 24;(source:Araport11) |
| AT5G19485 | transferases/nucleotidyltransferase;(source:Araport11) |
| AT5G19510 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
| AT5G19520 | mechanosensitive channel of small conductance-like 9;(source:Araport11) |
| AT5G19530 | Encodes a spermine synthase. Required for internode elongation and vascular development, specifically in the mechanism that defines the boundaries between veins and nonvein regions. This mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function. |
| AT5G19540 | DY1 is a novel nuclear encoded protein that is imported into the chloroplast stroma. Mutants have reduced pigmentation and somewhat abnormal thylakoid membranes. |
| AT5G19550 | Nitrogen metabolism. Major cytosolic isoenzyme controlling aspartate biosynthesis in the light. The mRNA is cell-to-cell mobile. |
| AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G19590 | DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G19610 | GNOM-like 2;(source:Araport11) |
| AT5G19620 | AtOEP80 is paralog to the chloroplastic protein translocation channel Toc75. Mutations in this locus result in embryo lethality. |
| AT5G19630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G19640 | Influences leaf N export via sink-to-source feedback, perhaps via a role in sensing plant internal N-status. Necessary for normal leaf N export under low N. |
| AT5G19650 | Transcriptional repressor of KNOX family transcription factors. Encodes pluripotency and stemness, upregulated in LRP cells. |
| AT5G19700 | Encodes a MATE transporter involved in leaf senescence and iron homeostasis. |
| AT5G19730 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G19740 | LAMP is an AMP paralog that overlaps in expression within the vascular system. Along with LAMP it suppresses meristem activity within the peripheral zone of the shoot apical meristem. LAMP is localized to the endoplasmic reticulum. |
| AT5G19760 | Encodes a novel mitochondrial carrier capable of transporting both dicarboxylates (such as malate, oxaloacetate, oxoglutarate, and maleate) and tricarboxylates (such as citrate, isocitrate, cis-aconitate, and trans-aconitate). |
| AT5G19780 | Encodes an isoform of alpha tubulin. Closely related to adjacent gene TUA3 suggesting recent duplication. The mRNA is cell-to-cell mobile. |
| AT5G19820 | Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation. |
| AT5G19840 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G19850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G19860 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
| AT5G20030 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT5G20050 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G20060 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G20090 | MPC1 negatively regulates ABA enhanced slow anion channel function during stomatal closure. |
| AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G20200 | Atypical nuceloporin-like protein. |
| AT5G20230 | Encodes a Al-stress-induced gene. Along with TCF, it promotes lignin biosynthesis in response to cold stress. The mRNA is cell-to-cell mobile. |
| AT5G20240 | Floral homeotic gene encoding a MADS domain transcription factor. Required for the specification of petal and stamen identities. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT5G20260 | Exostosin family protein;(source:Araport11) |
| AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
| AT5G20300 | Encodes Toc90, part of the TOC (translocon at the outer chloroplast membrane) machinery involved in the import of nucleus-encoded proteins into the chloroplast. |
| AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G20370 | serine-rich protein-like protein;(source:Araport11) |
| AT5G20420 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
| AT5G20430 | Mob1/phocein family protein;(source:Araport11) |
| AT5G20440 | Mob1/phocein family protein;(source:Araport11) |
| AT5G20470 | Encodes a headless derivative of myosin XI-K, which likely arose from a partial duplication of the XI-K gene and is developmentally regulated. |
| AT5G20560 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G20650 | Encodes COPT5, a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast. Plays an important role in the plant response to environmental copper scarcity, probably by remobilizing copper from prevacuolar vesicles, which could act as internal stores or recycling vesicles to provide the metal cofactor to key copper-dependent processes such as photosynthesis. |
| AT5G20690 | PRK6 is pollen specific receptor kinase that functions as a receptor for the pollen attractant LURE1 in pollen tube guidance. It is localized to the tip the pollen tube and becomes asymmetrically distributed towards the source of the LURE1 signal prior to pollen tube growth reorientation. |
| AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
| AT5G20820 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
| AT5G20840 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT5G20860 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G20870 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G20910 | Encodes an E3 ligase that can interact with and polyubiquitinate ABI3 in vitro. AIP2 likely negatively regulates ABA signaling by targeting ABI3 for post-translational destruction. |
| AT5G20940 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT5G20960 | Encodes aldehyde oxidase AA01. |
| AT5G20970 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G20980 | Encodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast |
| AT5G21020 | transmembrane protein;(source:Araport11) |
| AT5G21030 | PAZ domain-containing protein / piwi domain-containing protein;(source:Araport11) |
| AT5G21050 | hyccin;(source:Araport11) |
| AT5G21070 | Fe(3+) dicitrate transport system permease;(source:Araport11) |
| AT5G21080 | Uncharacterized protein;(source:Araport11) |
| AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT5G21120 | ethylene-insensitive3-like2 (EIL2) |
| AT5G21125 | hypothetical protein;(source:Araport11) |
| AT5G21150 | AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
| AT5G21160 | Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover. |
| AT5G21222 | protein kinase family protein;(source:Araport11) |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT5G21326 | Ca2+regulated serine-threonine protein kinase family protein;(source:Araport11) |
| AT5G21430 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT5G21900 | Contributes to UV tolerance through nucleotide excision repair. |
| AT5G21910 | transmembrane protein;(source:Araport11) |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
| AT5G21950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G22010 | Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing. |
| AT5G22030 | ubiquitin-specific protease 8;(source:Araport11) |
| AT5G22040 | ubiquitin carboxyl-terminal hydrolase;(source:Araport11) |
| AT5G22080 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G22100 | RNA cyclase family protein;(source:Araport11) |
| AT5G22110 | Encodes a protein with similarity to DNA polymerase epsilon subunit B an essential gene that is required for DNA replication. Homozygous mutants are embryo lethal. Expressed in meristematic , rapidly dividing regions. |
| AT5G22180 | hypothetical protein;(source:Araport11) |
| AT5G22200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT5G22270 | hypothetical protein;(source:Araport11) |
| AT5G22290 | Encodes ANAC089, a membrane-tethered transcription factor that negatively regulates floral initiation. Also controls ER-stress-induced programmed cell death. |
| AT5G22310 | trichohyalin-like protein;(source:Araport11) |
| AT5G22320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
| AT5G22390 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
| AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT5G22410 | root hair specific 18;(source:Araport11) |
| AT5G22440 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT5G22490 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G22540 | Associated with a QTL for quantitative disease resistance. |
| AT5G22550 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G22560 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G22620 | encodes a putative 2-carboxy-D-arabinitol 1-phosphate phosphatase |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G22750 | DNA repair gene. gamma-radiation hypersensitive (RAD5) involved in stable transformation and T-DNA transfer |
| AT5G22770 | AP-2 complex subunit alpha-1. Part of endomembrane trafficking system. |
| AT5G22790 | reticulata-related 1;(source:Araport11) |
| AT5G22800 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT5G22830 | Transmembrane magnesium transporter that is essential for chloroplast development and photosynthesis. One of nine family members. |
| AT5G22840 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G22860 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT5G22870 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G22880 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases. |
| AT5G22900 | member of Putative Na+/H+ antiporter family |
| AT5G22910 | member of Putative Na+/H+ antiporter family |
| AT5G22930 | enabled-like protein (DUF1635);(source:Araport11) |
| AT5G22960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G22980 | serine carboxypeptidase-like 47;(source:Araport11) |
| AT5G23010 | Encodes a methylthioalkylmalate synthase, catalyzes the condensation reactions of the first two rounds of methionine chain elongation in the biosynthesis of methionine-derived glucosinolates. The mRNA is cell-to-cell mobile. |
| AT5G23050 | acyl-activating enzyme 17;(source:Araport11) |
| AT5G23060 | Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium. |
| AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
| AT5G23110 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
| AT5G23150 | Putative transcription factor. Member of the floral homeotic AGAMOUS pathway.Mutations in HUA enhance the phenotype of mild ag-4 allele. Single hua mutants are early flowering and have reduced levels of FLC mRNA. Other MADS box flowering time genes such as FLM and MAF2 also appear to be regulated by HUA2. HUA2 normally activates FLC expression and enhances AG function. HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile. |
| AT5G23190 | cytochrome P450 CYP86B1, nuclear gene for chloroplast product. CYP86B1 is a very long chain fatty acid hydroxylase specifically involved in polyester monomer biosynthesis during the course of plant development. |
| AT5G23212 | Encodes a defensin-like (DEFL) family protein. |
| AT5G23230 | nicotinamidase 2;(source:Araport11) |
| AT5G23270 | Membrane localized sucrose transporter. |
| AT5G23280 | Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication. |
| AT5G23300 | dihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis |
| AT5G23320 | Encodes a prenylcysteine alpha-carboxyl methyltransferase involved in methylation of isoprenylated proteins. This protein appears to have lower catalytic activity and a lower transcript expression level than the other ICMT present in Arabidopsis (At5g08335). Analysis of ICMT RNAi lines suggests that this protein may be involved in flower and stem development. |
| AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
| AT5G23360 | GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11) |
| AT5G23390 | polygalacturonase inhibitor (DUF639);(source:Araport11) |
| AT5G23400 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G23413 | pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT5G23420 | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. |
| AT5G23470 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G23510 | hypothetical protein;(source:Araport11) |
| AT5G23630 | A member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. MIA is also named PDR2 and was shown to be required for proper expression of SCARECROW (SCR), a key regulator of root patterning, and for stem-cell maintenance in Pi-deprived roots. |
| AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G23665 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
| AT5G23740 | Encodes a putative ribosomal protein S11 (RPS11-beta). |
| AT5G23780 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
| AT5G23900 | Ribosomal protein L13e family protein;(source:Araport11) |
| AT5G23920 | transmembrane protein;(source:Araport11) |
| AT5G23930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
| AT5G23955 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G23960 | Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in the stigma. |
| AT5G23970 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
| AT5G24010 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G24050 | plant-specific B3-DNA-binding domain protein (DUF313);(source:Araport11) |
| AT5G24070 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G24080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
| AT5G24100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G24105 | Encodes a putative arabinogalactan-protein (AGP41). |
| AT5G24160 | squalene monooxygenase 6;(source:Araport11) |
| AT5G24180 | Lipase class 3-related protein;(source:Araport11) |
| AT5G24190 | Lipase class 3-related protein;(source:Araport11) |
| AT5G24200 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G24205 | other_RNA;(source:Araport11) |
| AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G24220 | Lipase class 3-related protein;(source:Araport11) |
| AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
| AT5G24280 | Encodes GMI1, a structural-maintenance-of-chromosomes-hinge domain-containing protein. Involved in somatic homologous recombination. |
| AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT5G24320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G24330 | Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR6 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. |
| AT5G24370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
| AT5G24390 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G24420 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT5G24440 | RNA-binding protein, putative. Contains PAM2, PABC binding domain. |
| AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT5G24520 | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. Auxin and ethylene responsiveness of TTG1 transcription is lost in myb12 mutants. |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT5G24550 | beta glucosidase 32;(source:Araport11) |
| AT5G24570 | hypothetical protein;(source:Araport11) |
| AT5G24580 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G24620 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G24640 | hypothetical protein;(source:Araport11) |
| AT5G24650 | HP30/Tric1 is a component of the mitochondrial protein translocation complex and is involved in tRNA transport along with HP30-2/Tric2.It interacts with several members of the TOM complex such as TOM40 and this interaction is mediated by the SAM domain. Role in protein import into chloroplasts. |
| AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G24820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G24825 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGG |
| AT5G24850 | Binds flavin adenine dinucleotide and DNA. It does not have photolyase activity, and it is likely to act as photoreceptor. Closely related to Synechocystis cryptochrome. |
| AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G24890 | stress response NST1-like protein;(source:Araport11) |
| AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT5G24930 | Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). |
| AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G24950 | putative cytochrome P450 |
| AT5G24970 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G25010 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G25050 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G25110 | salt- and anoxia-induced member of AtCIPK family. |
| AT5G25120 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT5G25140 | putative cytochrome P450 |
| AT5G25160 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G25220 | A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia |
| AT5G25260 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking. |
| AT5G25265 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT5G25305 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.2e-51 P-value blast match to Tat4-1 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family)T24H24-Lys reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
| AT5G25330 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G25360 | hypothetical protein;(source:Araport11) |
| AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
| AT5G25400 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G25410 | transmembrane protein, putative (DUF239);(source:Araport11) |
| AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
| AT5G25451 | Pseudogene of AT5G25440; protein kinase family protein |
| AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G25475 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G25500 | exosome complex exonuclease;(source:Araport11) |
| AT5G25530 | DNAJ heat shock family protein;(source:Araport11) |
| AT5G25620 | Encodes a member of a family of flavin monooxygenases with an important role in auxin biosynthesis. YUC6 possesses an additional thiol-reductase activity that confers drought resistance independently of auxin biosynthesis. |
| AT5G25752 | Chloroplast-localized rhomboid-like protein. |
| AT5G25754 | RNA polymerase I-associated factor PAF67;(source:Araport11) |
| AT5G25790 | Tesmin/TSO1-like CXC domain-containing protein;(source:Araport11) |
| AT5G25840 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT5G25850 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G25880 | The malic enzyme (EC 1.1.1.40) encoded by the ATNADP-ME3 is presumably cytosolic and restricted in its expression by both developmental and cell-specific signals. |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT5G25955 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-17 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G25980 | Myrosinase (thioglucoside glucohydrolase) gene involved in glucosinoloate metabolism. The mRNA is cell-to-cell mobile. |
| AT5G25990 | core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G26000 | member of Glycoside Hydrolase Family 1. encodes one of two known functional myrosinase enzymes in Arabidopsis. The enzyme catalyzes the hydrolysis of glucosinolates into compounds that are toxic to various microbes and herbivores. |
| AT5G26010 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G26040 | Class III RPD3 type protein. Encodes HDA2, a member of the histone deacetylase family proteins. |
| AT5G26050 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G26080 | proline-rich family protein;(source:Araport11) |
| AT5G26090 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G26100 | hypothetical protein;(source:Araport11) |
| AT5G26130 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT5G26147 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. miR156 limits plastochron length in developing leaf primordia. |
| AT5G26150 | protein kinase family protein;(source:Araport11) |
| AT5G26170 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT5G26200 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT5G26260 | TRAF-like family protein;(source:Araport11) |
| AT5G26300 | TRAF-like family protein;(source:Araport11) |
| AT5G26330 | Cupredoxin superfamily protein;(source:Araport11) |
| AT5G26570 | chloroplastidic phosphoglucan, water dikinase (PWD) which is required for normal degradation of leaf starch in Arabidopsis. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C3 position. |
| AT5G26582 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-42 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G26620 | hypothetical protein;(source:Araport11) |
| AT5G26660 | myb domain protein 86;(source:Araport11) |
| AT5G26673 | Encodes a Plant thionin family protein |
| AT5G26692 | Encodes a Plant thionin family protein |
| AT5G26710 | Glutamyl/glutaminyl-tRNA synthetase, class Ic;(source:Araport11) |
| AT5G26717 | Encodes a Plant thionin family protein |
| AT5G26731 | hypothetical protein;(source:Araport11) |
| AT5G26760 | Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation. |
| AT5G26810 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G26930 | Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification. |
| AT5G26950 | AGAMOUS-like 93;(source:Araport11) |
| AT5G26990 | Drought-responsive family protein;(source:Araport11) |
| AT5G27010 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G27043 | pseudogene of cell division cycle 20.2;(source:Araport11) |
| AT5G27070 | AGAMOUS-like 53;(source:Araport11) |
| AT5G27095 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G27130 | AGAMOUS-like 39;(source:Araport11) |
| AT5G27140 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
| AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
| AT5G27210 | Protein of unknown function, transmembrane-40;(source:Araport11) |
| AT5G27220 | Frigida-like protein;(source:Araport11) |
| AT5G27230 | Frigida-like protein;(source:Araport11) |
| AT5G27270 | P-type PPR chloroplast localized protein required for group II intron splicing in chloroplasts. |
| AT5G27310 | Transcription factor IIS family protein;(source:Araport11) |
| AT5G27345 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.0e-48 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G27380 | Encodes a protein with similarity to glutathione synthetases, which catalyzes one of the early steps in glutathione biosynthesis. Two transcripts have been detected; the longer transcript is less abundant and the protein is localized to the chloroplast. The smaller transcript, in which the transit peptide is truncated, is localized to the cytosol. Increased glutathione accumulation in response to cesium stress. |
| AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT5G27430 | Signal peptidase subunit;(source:Araport11) |
| AT5G27460 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G27470 | seryl-tRNA synthetase / serine-tRNA ligase;(source:Araport11) |
| AT5G27480 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, putative replication proteins - Arabidopsis thaliana;(source:TAIR10) |
| AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G27550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G27570 | No expression of gene detected yet. |
| AT5G27600 | Encode peroxisomal long-chain acyl-CoA synthetase. Activates fatty acids for further metabolism. Interacts with PEX5. |
| AT5G27620 | core cell cycle genes The mRNA is cell-to-cell mobile. |
| AT5G27670 | Encodes HTA7, a histone H2A protein. |
| AT5G27771 | pseudogene of (SAUR) auxin-responsive family protein |
| AT5G27800 | Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11) |
| AT5G27830 | Folate receptor family protein;(source:Araport11).Expression correlates with increase in bound folate in planta. |
| AT5G27840 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580). |
| AT5G27870 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G27889 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G27900 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-26 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G27910 | nuclear factor Y, subunit C8;(source:Araport11) |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT5G27925 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.0e-249 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G27940 | WPP domain protein 3;(source:Araport11) |
| AT5G27945 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G27970 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G27990 | Pre-rRNA-processing protein TSR2, conserved region;(source:Araport11) |
| AT5G28000 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT5G28060 | Ribosomal protein S24e family protein;(source:Araport11) |
| AT5G28080 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT5G28145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.1e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G28165 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.1e-142 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT5G28190 | transmembrane protein;(source:Araport11) |
| AT5G28210 | mRNA capping enzyme family protein;(source:Araport11) |
| AT5G28220 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT5G28235 | Ulp1 protease family protein;(source:Araport11) |
| AT5G28237 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT5G28262 | other_RNA;(source:Araport11) |
| AT5G28285 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT5G28295 | hypothetical protein;(source:Araport11) |
| AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G28405 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.9e-30 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G28463 | transmembrane protein;(source:Araport11) |
| AT5G28470 | Encodes a member of the nitrate/peptide NTR/PTR family of transporters is required for accumulation and transport of pollen-specific flavonol 3-O-sophorosides, characterized by a glycosidic β-1,2-linkage, to the pollen surface of Arabidopsis. |
| AT5G28480 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G28270.1);(source:TAIR10) |
| AT5G28497 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT5G28510 | beta glucosidase 24;(source:Araport11) |
| AT5G28520 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G28545 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-08 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G28570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G12725.1);(source:TAIR10) |
| AT5G28605 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.3e-44 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G28620 | kinase C-like protein;(source:Araport11) |
| AT5G28635 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-162 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G28637 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-23 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
| AT5G28680 | Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip. |
| AT5G28690 | carboxylate clamp-TPR protein (DUF1685);(source:Araport11) |
| AT5G28776 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-199 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G28865 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-80 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G28885 | hypothetical protein;(source:Araport11) |
| AT5G28894 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G28927 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT5G28935 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-48 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G28960 | alpha-(1,6)-fucosyltransferase;(source:Araport11) |
| AT5G28996 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
| AT5G29015 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.3e-121 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT5G29020 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G60930.1);(source:TAIR10) |
| AT5G29024 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G29029 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 46%25 identity and 3.0e-30 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
| AT5G29050 | hypothetical protein (DUF3287);(source:Araport11) |
| AT5G29058 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G29060 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G29090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G33131.1);(source:TAIR10) |
| AT5G29210 | hypothetical protein;(source:Araport11) |
| AT5G29560 | caleosin-related family protein;(source:Araport11) |
| AT5G29562 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.8e-228 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G29629 | pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G30269 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-141 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G30450 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.3e-19 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G30500 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT5G31032 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-35 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT5G31122 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 56%25 identity and 1.5e-39 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
| AT5G31355 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.8e-153 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G31412 | hAT transposon superfamily protein;(source:Araport11) |
| AT5G31702 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G31821 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G32112 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1 -related, similar to putative replication protein A1;(source:TAIR10) |
| AT5G32433 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.6e-155 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G32520 | transposable_element_gene;(source:Araport11);pseudogene, expressed protein, predicted proteins, Arabidopsis thaliana and others;(source:TAIR10) |
| AT5G32605 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06140.1);(source:TAIR10) |
| AT5G32619 | Encodes a defensin-like (DEFL) family protein. |
| AT5G32850 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.5e-178 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G32900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.6e-05 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G32925 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-105 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
| AT5G32975 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposase, similar to En/Spm-like transposon protein, putative;(source:TAIR10) |
| AT5G33070 | Encodes a defensin-like (DEFL) family protein. |
| AT5G33175 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.0e-31 P-value blast match to GB:BAA01703 ORF (Ty1_Copia-element) (Drosophila simulans);(source:TAIR10) |
| AT5G33240 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42980.1);(source:TAIR10) |
| AT5G33285 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
| AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
| AT5G33310 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
| AT5G33340 | Encodes a protein with aspartic protease activity (also known as aspartate-type endopeptidase activity). Overexpression of the gene was shown to lead to salicylic acid (SA)-mediated disease resistance upon exposure to the pathogen Pseudomonas syringae. Moreover, overexpression of this gene led to the upregulation of two pathogenesis-related genes PR1 and PR2. This upregulation was no longer observed in transgenic lines expressing the bacterial NahG gene encoding a hydroxylase suppressing SA accumulation. |
| AT5G33350 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G33355 | Encodes a defensin-like (DEFL) family protein. |
| AT5G33370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. Mutants are defective in cuticle formation with reduced sepal cuticle ridge formation. |
| AT5G33399 | other_RNA;(source:Araport11) |
| AT5G33441 | pseudogene of cytochrome P450;(source:Araport11) |
| AT5G33533 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-112 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G33898 | hypothetical protein (DUF3287);(source:Araport11) |
| AT5G34431 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G34832 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G34839 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-09 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G34841 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0.00011 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G34850 | Encodes a root-secreted purple acid phosphatase precursor involved in extracellular phosphate-scavenging. |
| AT5G34864 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.3e-143 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G34865 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.5e-16 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
| AT5G34867 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.7e-279 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT5G34868 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-131 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G34869 | hypothetical protein;(source:Araport11) |
| AT5G34870 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT5G34880 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-11 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G34920 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.2e-40 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G35052 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.1e-94 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G35070 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G35110 | hypothetical protein;(source:Araport11) |
| AT5G35111 | pseudogene of Peroxidase superfamily protein;(source:Araport11) |
| AT5G35140 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.4e-23 P-value blast match to At1g36190.1/92-340 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G35160 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT5G35170 | adenylate kinase family protein;(source:Araport11) |
| AT5G35200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G35338 | Protein containing a putative methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G35400 | Pseudouridine synthase family protein;(source:Araport11) |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT5G35416 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-16 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G35450 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT5G35460 | membrane protein;(source:Araport11) |
| AT5G35555 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-177 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G35570 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G35580 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G35600 | Encodes a histone deacetylase that is crucial for female gametophyte development and embryogenesis. |
| AT5G35601 | pseudogene of aconitase 3;(source:Araport11) |
| AT5G35605 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT5G35640 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G35660 | Glycine-rich protein family;(source:Araport11) |
| AT5G35688 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G35715 | encodes a protein with cytochrome P450 domain |
| AT5G35720 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-12 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G35736 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G35738 | pseudogene of zinc-dependent activator protein-1;(source:Araport11) |
| AT5G35750 | Encodes histidine kinase AHK2. |
| AT5G35760 | Beta-galactosidase related protein;(source:Araport11) |
| AT5G35777 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-67 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G35780 | pseudogene of B3 domain protein (DUF313);(source:Araport11) |
| AT5G35800 | transposable_element_gene;(source:Araport11);pseudogene, similar to simiar to ribosomal protein, similar to unknown protein (gb|AAD32760.1);(source:TAIR10) |
| AT5G35805 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
| AT5G35840 | Encodes the apoprotein of phytochrome;one of a family of photoreceptors that modulate plant growth and development. The mRNA is cell-to-cell mobile. |
| AT5G35926 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G35950 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G35960 | Protein kinase family protein;(source:Araport11) |
| AT5G36110 | Encodes a member of the CYP716A subfamily of cytochrome P450 monooxygenases with triterpene oxidizing activity catalyzing C-28 hydroxylation of alpha-amyrin, beta-amyrin, and lupeol, producing uvaol, erythrodiol, and betulin, respectively. Additionally, it shows carboxylation activity for the C-28 position of alpha- and beta-amyrin. |
| AT5G36125 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G36140 | Encodes a member of the CYP716A subfamily of cytochrome P450 monooxygenases with triterpene oxidizing activity catalyzing C-28 hydroxylation of alpha-amyrin, beta-amyrin, and lupeol, producing uvaol, erythrodiol, and betulin, respectively.In particular, 22alpha-hydroxylation activity has been observed against alpha-amyrin. Should be merged with At5g36130. |
| AT5G36150 | putative pentacyclic triterpene synthase 3;(source:Araport11) |
| AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
| AT5G36180 | serine carboxypeptidase-like 1;(source:Araport11) |
| AT5G36190 | F-box protein interaction domain protein;(source:Araport11) |
| AT5G36200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G36210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G36270 | Annotated as pseudogene of dehydroascorbate reductase. Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT5G36275 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.9e-34 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G36296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-14 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G36297 | pseudogene of aspartyl protease family protein |
| AT5G36870 | encodes a gene similar to callose synthase |
| AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
| AT5G36900 | hypothetical protein;(source:Araport11) |
| AT5G36935 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.5e-51 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G36960 | hypothetical protein;(source:Araport11) |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT5G36990 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.5e-61 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G37000 | glycosyltransferase family exostosin protein;(source:Araport11) |
| AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
| AT5G37080 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G05090.1);(source:TAIR10) |
| AT5G37130 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT5G37140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G37145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-29 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT5G37170 | O-methyltransferase family protein;(source:Araport11) |
| AT5G37175 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G15750.1);(source:TAIR10) |
| AT5G37200 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37250 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
| AT5G37280 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37310 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT5G37320 | hypothetical protein (DUF674);(source:Araport11) |
| AT5G37330 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G37340 | ZPR1 zinc-finger domain protein;(source:Araport11) |
| AT5G37400 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G37430 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G37445 | pseudogene of hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G37450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G37460 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G37478 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37500 | Encodes a guard cell outward potassium channel. Belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutants have increased water consumption and limited stomatal closure in response to abscisic and jasmonic acids. It forms a heteromeric K(out) channels with SKOR. The gene is expressed ubiquitously in root and the vasculature and guard cells of leaves. Expression is suppressed during agrobacterium-induced tumor formation and increased in response to water deprivation and cold. |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G37550 | hypothetical protein;(source:Araport11) |
| AT5G37590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G37650 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G37660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT5G37710 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G37730 | hypothetical protein;(source:Araport11) |
| AT5G37732 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G37760 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G37770 | Encodes a protein with 40% similarity to calmodulin. Binds Ca(2+) and, as a consequence, undergoes conformational changes. CML24 expression occurs in all major organs, and transcript levels are increased from 2- to 15-fold in plants subjected to touch, darkness, heat, cold, hydrogen peroxide, abscisic acid (ABA), and indole-3-acetic acid. However, CML24 protein accumulation changes were not detectable. The putative CML24 regulatory region confers reporter expression at sites of predicted mechanical stress; in regions undergoing growth; in vascular tissues and various floral organs; and in stomata, trichomes, and hydathodes. CML24-underexpressing transgenics are resistant to ABA inhibition of germination and seedling growth, are defective in long-day induction of flowering, and have enhanced tolerance to CoCl(2), molybdic acid, ZnSO(4), and MgCl(2). Also regulates nitric oxide levels. |
| AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G37820 | NOD26-like intrinsic protein 4;(source:Araport11) |
| AT5G37830 | Encodes a 5-oxoprolinase that acts in the glutathione degradation pathway and in 5-oxoproline metabolism. |
| AT5G37860 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G37875 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.0e-38 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G37910 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT5G37920 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G37930 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT5G37950 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G37970 | SABATH family methyltransferase. |
| AT5G38005 | other_RNA;(source:Araport11) |
| AT5G38010 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G38020 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus). SABATH family methyltransferase. |
| AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
| AT5G38100 | SABATH family methyltransferase. |
| AT5G38120 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G38210 | Protein kinase family protein;(source:Araport11) |
| AT5G38212 | Natural antisense transcript overlaps with AT5G38210;(source:Araport11) |
| AT5G38230 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 8.5e-53 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT5G38240 | Protein kinase family protein;(source:Araport11) |
| AT5G38250 | Protein kinase family protein;(source:Araport11) |
| AT5G38270 | F-box family protein;(source:Araport11) |
| AT5G38310 | hypothetical protein;(source:Araport11) |
| AT5G38344 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT5G38350 | Disease resistance protein (NBS-LRR class) family;(source:Araport11) |
| AT5G38380 | zinc transporter;(source:Araport11) |
| AT5G38393 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G38396 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G38437 | transposable_element_gene;(source:Araport11) |
| AT5G38450 | cytochrome P450, family 735, subfamily A, polypeptide 1;(source:Araport11) |
| AT5G38460 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT5G38490 | B3 domain protein (DUF313);(source:Araport11) |
| AT5G38500 | B3 domain protein (DUF313);(source:Araport11) |
| AT5G38520 | CLD1 is involved in steady-state chlorophyll turnover; CLD1 dephytylates chlorophyll a, chlorophyll b, and pheophytin a in vitro; CLD1 and CHLG form a salvage cycle in recycling chlorophyll. Suppression of CLD1 expression results in reduced tolerance to moderately high temperature. |
| AT5G38540 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G38550 | Jacalin lectin family protein gene |
| AT5G38570 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G38620 | MADS-box transcription factor family protein;(source:Araport11) |
| AT5G38670 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G38690 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT5G38700 | cotton fiber protein;(source:Araport11) |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
| AT5G38740 | AGAMOUS-like 77;(source:Araport11) |
| AT5G38780 | SABATH methyltransferase. |
| AT5G38800 | basic leucine-zipper 43;(source:Araport11) |
| AT5G38810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G38850 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT5G38860 | Encodes BES1-INTERACTING MYC-LIKE 3 (BIM3), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT5G38870 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G38900 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G38960 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G38970 | Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized. |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39010 | hypothetical protein;(source:Araport11) |
| AT5G39030 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT5G39060 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.3e-252 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G39090 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G39095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-250 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G39100 | germin-like protein (GLP6) |
| AT5G39230 | TFIIB zinc-binding protein;(source:Araport11) |
| AT5G39320 | UDP-glucose 6-dehydrogenase family protein;(source:Araport11) |
| AT5G39330 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT5G39390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G39400 | Calcium/lipid-binding (CaLB) phosphatase;(source:Araport11) |
| AT5G39420 | CDC2C;(source:Araport11) |
| AT5G39460 | F-box family protein;(source:Araport11) |
| AT5G39470 | F-box family protein;(source:Araport11) |
| AT5G39520 | Plastid localized transmembrane protein involved in ABA mediated leaf senescence and stomatal movement. |
| AT5G39540 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
| AT5G39620 | RAB GTPase homolog G1;(source:Araport11) |
| AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT5G39690 | NAC domain containing protein 93;(source:Araport11) |
| AT5G39693 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUGGUGUUGAGAUAGUUGAC |
| AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
| AT5G39785 | hypothetical protein (DUF1666);(source:Araport11) |
| AT5G39810 | AGAMOUS-like 98;(source:Araport11) |
| AT5G39820 | NAC domain containing protein 94;(source:Araport11) |
| AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT5G39863 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT5G39880 | transmembrane protein;(source:Araport11) |
| AT5G39910 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G39930 | Encodes a protein with similarity to the CLP1 polyadenylation factor. |
| AT5G39995 | pseudogene of myb domain protein 110;(source:Araport11) |
| AT5G40010 | Encodes a mitochondrial ATPase involved in seed and silique development. |
| AT5G40020 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G40040 | cytosolic ribosomal protein gene, part of bL12 family |
| AT5G40050 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT5G40060 | Disease resistance protein (NBS-LRR class) family;(source:Araport11) |
| AT5G40070 | MADS-box family protein;(source:Araport11) |
| AT5G40100 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G40150 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G40170 | receptor like protein 54;(source:Araport11) |
| AT5G40190 | Identified in a screen for calmodulin-binding proteins obtained from an auxin treated cDNA library. |
| AT5G40212 | Pseudogene of AT5G40240; nodulin MtN21 family protein |
| AT5G40250 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT5G40270 | VEN4 is homologous to human SAMHD1 and functions in chloroplast biogenesis. |
| AT5G40280 | encodes a beta subunit of farnesyl-trans-transferase, which is involved in meristem organization and ABA-mediated signal transduction pathway. Mutant phenotypes have been observed in meristem organization, and response to abscisic acid and drought. The mRNA is cell-to-cell mobile. |
| AT5G40310 | Exonuclease family protein;(source:Araport11) |
| AT5G40370 | Glutaredoxin family protein;(source:Araport11) |
| AT5G40380 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT5G40382 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
| AT5G40384 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACAAAAUCCGUCUUUGAAGA |
| AT5G40395 | U6acat;(source:Araport11) |
| AT5G40410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G40450 | Encodes a member of a plant gene family, APK_ORTHOMCL5144,of unknown function. RBB1 is localized to the cytosol and involved in vacuolar biogenesis and organization. RBB1 mutants have increased number of vacuolar bulbs and fewer trans-vacuolar strands. |
| AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT5G40470 | RNI-like superfamily protein;(source:Araport11) |
| AT5G40480 | embryo defective 3012;(source:Araport11) |
| AT5G40490 | HLP1 is a member of the conserved hnRNP A/B family and contains RNA Recognition Motifs (RRM).It binds mRNA and appears to be involved in targeting alternative polyadenylation (APA). APA targets include genes involved in flowering. Loss of HLP1 function results causes late flowering under long and short day conditions. This phenotype is suppressed by loss of FLC. |
| AT5G40520 | DNA double-strand break repair protein;(source:Araport11) |
| AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
| AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
| AT5G40730 | Encodes an arabinogalactan-protein (AGP24). |
| AT5G40770 | prohibitin 3 |
| AT5G40780 | Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. |
| AT5G40830 | Encodes an SAM‐dependent methyltransferase superfamily protein that has an N‐terminal transmembrane domain and a putative methyltransferase domain, DUF248, and is strongly expressed in the vasculature. Overexpression results in increased phloem and xylem in the plant. |
| AT5G40880 | Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1. |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT5G40981 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G41000 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
| AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT5G41090 | NAC domain containing protein 95;(source:Araport11) |
| AT5G41109 | hypothetical protein;(source:Araport11) |
| AT5G41110 | meiosis chromosome segregation family protein;(source:Araport11) |
| AT5G41120 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT5G41140 | Myosin heavy chain-related protein;(source:Araport11) |
| AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G41200 | AGAMOUS-like 75;(source:Araport11) |
| AT5G41210 | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G41240 | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G41250 | Exostosin family protein;(source:Araport11) |
| AT5G41280 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G41290 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G41300 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT5G41320 | stress response NST1-like protein;(source:Araport11) |
| AT5G41370 | Encodes XPB1, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies. The mRNA is cell-to-cell mobile. |
| AT5G41401 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT5G41460 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G41471 | predicted to encode a C/D box type of snoRNA, also known as Ath-350 (GB: AJ505636). But, the submitted sequence of 110 nucleotides is only part of the 160 nucleotide sequence predicted by Northern blotting. It is assumed that a 5' portion of the gene is missing and its 5' end has not been conclusively mapped. Sequence analysis of this snoRNA suggests that it may not function like other C/D box family members that modify rRNAs or snRNAs. Its true biological target remains unknown. The promoter of this snoRNA has hallmarks of the snRNA promoters targeted by RNA polymerase II, indicating that it might also have a TMG (2,2,7 trimethyguanosine) cap. SnoRNA108 may also play a novel role in ribosome biogenesis (Marker 2002). |
| AT5G41500 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G41505 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G13655.1);(source:TAIR10) |
| AT5G41530 | transmembrane protein;(source:Araport11) |
| AT5G41540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G41550 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G41590 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT5G41600 | VIRB2-interacting protein 3;(source:Araport11) |
| AT5G41620 | intracellular protein transporter USO1-like protein;(source:Araport11) |
| AT5G41660 | transmembrane protein;(source:Araport11) |
| AT5G41685 | Mitochondrial outer membrane translocase complex, subunit Tom7;(source:Araport11) |
| AT5G41690 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G41710 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.2e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G41740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G41765 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11) |
| AT5G41840 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G41960 | zinc finger matrin-type protein;(source:Araport11) |
| AT5G42030 | ABL interactor-like protein 4;(source:Araport11) |
| AT5G42053 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G42092 | Natural antisense transcript overlaps with AT5G42090;(source:Araport11) |
| AT5G42120 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT5G42200 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G42210 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G42232 | Encodes a defensin-like (DEFL) family protein. |
| AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT5G42280 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G42290 | transcription activator-like protein;(source:Araport11) |
| AT5G42323 | Pseudogene of AT1G06390; GSK1 (GSK3/SHAGGY-LIKE PROTEIN KINASE 1); kinase |
| AT5G42340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G42360 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G42410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G42470 | BRCA1-A complex subunit BRE-like protein;(source:Araport11) |
| AT5G42490 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G42505 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-23 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT5G42510 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G42520 | Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development. |
| AT5G42530 | hypothetical protein;(source:Araport11) |
| AT5G42568 | Pseudogene of AT1G47830; clathrin coat assembly protein, putative |
| AT5G42580 | a member of the cytochrome P450 family |
| AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
| AT5G42610 | calcium uniporter (DUF607);(source:Araport11) |
| AT5G42620 | metalloendopeptidase / zinc ion binding protein;(source:Araport11) |
| AT5G42635 | glycine-rich protein;(source:Araport11) |
| AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
| AT5G42670 | Agenet domain-containing protein;(source:Araport11) |
| AT5G42680 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G42690 | transcription factor, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G42710 | hypothetical protein;(source:Araport11) |
| AT5G42750 | Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment. |
| AT5G42780 | Zinc finger and homeobox domain protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
| AT5G42785 | transmembrane protein;(source:Araport11) |
| AT5G42810 | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level. |
| AT5G42850 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G42860 | CC2 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT5G42870 | The PAH2 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
| AT5G42920 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G42950 | EXA1 is a GYF domain-containing gene of the SMY2 subgroup. Mutants exhibit resistance to potexviruses. |
| AT5G43015 | Mutator-like transposase family, has a 2.3e-39 P-value blast match to GB:AAA21566 mudrA of transposon= MuDR (MuDr-element) (Zea mays) |
| AT5G43040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
| AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43120 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT5G43140 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT5G43150 | elongation factor;(source:Araport11) |
| AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G43175 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G43196 | Pseudogene of AT5G43210; endo/excinuclease amino terminal domain-containing protein |
| AT5G43211 | hypothetical protein;(source:Araport11) |
| AT5G43300 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT5G43330 | predicted to encode a cytosolic malate dehydrogenase. The mRNA is cell-to-cell mobile. |
| AT5G43340 | Encodes Pht1;6, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT5G43360 | Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT5G43380 | encodes a type I serine/threonine protein phosphatase expressed in expressed in roots, rosettes and flowers. |
| AT5G43390 | plant/protein;(source:Araport11) |
| AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G43440 | encodes a protein whose sequence is similar to ACC oxidase |
| AT5G43450 | encodes a protein whose sequence is similar to ACC oxidase |
| AT5G43455 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G43520 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G43540 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT5G43580 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
| AT5G43610 | sucrose-proton symporter 6;(source:Araport11) |
| AT5G43660 | Belongs to the 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily proteins and contains an oxoglutarate/iron-dependent oxygenase domain (InterPro:IPR005123) of the prolyl 4-hydroxylase, alpha subunit subtype (P4Hc; InterPro:IPR006620). |
| AT5G43700 | Auxin inducible protein similar to transcription factors. |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT5G43755 | non-LTR retrolelement reverse transcriptase-like protein;(source:Araport11) |
| AT5G43770 | proline-rich family protein;(source:Araport11) |
| AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
| AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G43800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G43860 | Encodes a chlorophyllase, the first enzyme in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to chlorophyllide and phytol. AtCLH2 has a typical signal sequence for the chloroplast. Gene expression does not respond to methyljasmonate, a known promoter of senescence and chlorophyll degradation. |
| AT5G43870 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
| AT5G43920 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT5G43935 | flavonol synthase 6;(source:Araport11) |
| AT5G43940 | Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility. |
| AT5G43970 | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
| AT5G44030 | Encodes a cellulose synthase involved in secondary cell wall biosynthesis. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. The mRNA is cell-to-cell mobile. |
| AT5G44040 | eisosome SEG2-like protein;(source:Araport11) |
| AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
| AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
| AT5G44100 | Member of CKL gene family. Expression up-regulated under high temperature in anthers. Transcription activated by MYB24. |
| AT5G44110 | Encodes a member of the NAP subfamily of ABC transporters whose expression pattern is regulated by light and sucrose. |
| AT5G44130 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G44140 | prohibitin 7;(source:Araport11) |
| AT5G44160 | NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis. |
| AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
| AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G44220 | F-box family protein;(source:Araport11) |
| AT5G44230 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G44240 | Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
| AT5G44255 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-09 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT5G44300 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT5G44310 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G44316 | Stabilizer of iron transporter SufD superfamily protein;(source:Araport11) |
| AT5G44330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT5G44380 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44416 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.6e-75 P-value blast match to Q9SI25 /181-349 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G44417 | pseudogene of FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44420 | Encodes an ethylene- and jasmonate-responsive plant defensin. mRNA levels are not responsive to salicylic acid treatment; although jasmonate and salicylic acid can act synergistically to enhance the expression of this gene. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of PDF. |
| AT5G44430 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT5G44440 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44490 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G44500 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT5G44510 | Encodes TAO1 (Target of AvrB Operation), a TIR-NB-LRR protein that contributes to disease resistance induced by the Pseudomonas syringae effector AvrB. |
| AT5G44540 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
| AT5G44550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G44562 | Natural antisense transcript overlaps with AT5G44560;(source:Araport11) |
| AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT5G44620 | member of CYP706A |
| AT5G44660 | hypothetical protein;(source:Araport11) |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
| AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT5G44740 | Y-family DNA polymerase. Catalyses translesion synthesis in response to UV damage. Functionally interacts with PCNA2. Has a ubiquitin binding motif. |
| AT5G44760 | C2 domain-containing protein;(source:Araport11) |
| AT5G44780 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT5G44785 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
| AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
| AT5G44800 | Interacts with transcription factors involved in floral meristem identity and affects the expression of key floral regulators. Affects H3K27me3 and H3K4me3 levels at a subset of loci in the genome. |
| AT5G44820 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G44850 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G44870 | Encodes LAZ5, a TIR-class NB-LRR R protein of unknown pathogen specificity with sequence similarity to RPS4, an R protein conferring resistance to Pseudomonas syringae expressing the effector AvrRPS4. Overexpression of LAZ5 results in hypersensitive cell death (plants did not survive to set seeds). |
| AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
| AT5G44940 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G44950 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G44960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G44973 | Encodes a defensin-like (DEFL) family protein. |
| AT5G44980 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G44990 | Glutathione S-transferase family protein;(source:Araport11) |
| AT5G45000 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G45085 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT5G45090 | phloem protein 2-A7;(source:Araport11) |
| AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT5G45116 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-227 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G45130 | small GTP binding protein The mRNA is cell-to-cell mobile. |
| AT5G45160 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
| AT5G45170 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G45210 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G45220 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G45240 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT5G45275 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G45276 | pseudogene of Frigida-like protein;(source:Araport11) |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT5G45300 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
| AT5G45320 | late embryogenesis abundant protein;(source:Araport11) |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT5G45360 | Encodes a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT5G45475 | other_RNA;(source:Araport11) |
| AT5G45510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G45520 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G45530 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT5G45550 | Encodes a gene product involved in both sporogenesis and gametogenesis and is required for the normal progression of megasporogenesis and microsporogenesis. Additional alleles were isolated in a screen for enhancers of PID and genetic analysis indicates a role for MOB1A in auxin mediated signaling. |
| AT5G45570 | Ulp1 protease family protein;(source:Araport11) |
| AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G45650 | subtilase family protein;(source:Araport11) |
| AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
| AT5G45680 | Peptidyl-Prolyl Isomerase located in chloroplast thylakoid lumen The mRNA is cell-to-cell mobile. |
| AT5G45710 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G45715 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT5G45770 | receptor like protein 55;(source:Araport11) |
| AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
| AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
| AT5G45830 | Encodes DOG1 (DELAY OF GERMINATION 1). A quantitative trait locus involved in the control of seed dormancy. Belongs to a novel plant-specific gene family whose members include: DOG1-like 1-4 (DOGL1-4, At4g18660, At4g18680, At4g18690, At4g18650 respectively) and DOG1. DOG1 expression is seed-specific. |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT5G45850 | hypothetical protein (DUF688);(source:Araport11) |
| AT5G45970 | Encodes a Rac-like protein ARAC2. A member of ROP GTPase gene family. |
| AT5G45990 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT5G46040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
| AT5G46060 | spastin, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G46080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G46090 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT5G46105 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G46110 | Encodes a chloroplast triose phosphate / 3-phosphoglycerate translocator that transports triose phosphates derived from the Calvin cycle in the stroma to the cytosol for use in sucrose synthesis and other biosynthetic processes. A tpt mutant has altered acclimation responses. The mRNA is cell-to-cell mobile. |
| AT5G46115 | hypothetical protein;(source:Araport11) |
| AT5G46130 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G46160 | Ribosomal protein L14p/L23e family protein;(source:Araport11) |
| AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
| AT5G46200 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT5G46240 | Encodes a potassium channel protein (KAT1). ABA triggers KAT1 endocytosis both in epidermal cells as well as guard cells. Upon removal of ABA, KAT1 is recycled back to the plasma membrane. KAT1 is localized within 0.5?0.6 μm diameter microdomains at the plasma membrane surface. KAT1 belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT5G46270 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G46315 | U6-29;(source:Araport11) |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT5G46350 | member of WRKY Transcription Factor; Group II-c |
| AT5G46370 | Encodes AtTPK2 (KCO2), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK2 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT5G46460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G46500 | protein VARIATION IN COMPOUND TRIGGERED ROOT growth protein;(source:Araport11) |
| AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G46520 | VICTR (VARIATION IN COMPOUND TRIGGERED ROOT growth response) encodes a TIR-NB-LRR (for Toll-Interleukin1 Receptor-nucleotide binding-Leucine-rich repeat) protein. VICTR is necessary for DFPM-induced root growth arrest and inhibition of abscisic acid-induced stomatal closing (DFPM is [5-(3,4-dichlorophenyl)furan-2-yl]-piperidine-1-ylmethanethione)(PMID:21620700). DFPM-mediated root growth arrest is accession-specific and depends on EDS1 and PAD4; Col-0 has a functional copy of VICTR. Induction of the VICTR gene by DFPM treatment requires functional VICTR (Col). A close homolog to VICTR, named VICTL (At5g46510) lies in tandem with VICTR. The mRNA is cell-to-cell mobile. |
| AT5G46530 | AWPM-19-like family protein;(source:Araport11) |
| AT5G46540 | P-glycoprotein 7;(source:Araport11) |
| AT5G46600 | aluminum activated malate transporter family protein;(source:Araport11) |
| AT5G46680 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G46690 | beta HLH protein 71;(source:Araport11) |
| AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G46780 | VQ motif-containing protein;(source:Araport11) |
| AT5G46795 | microspore-specific promoter 2;(source:Araport11) |
| AT5G46830 | Calcium-binding transcription factor involved in salt stress signaling. |
| AT5G46880 | homeobox-7;(source:Araport11) |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G46950 | One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo. |
| AT5G47000 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G47010 | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. The mRNA is cell-to-cell mobile. |
| AT5G47030 | Encodes the mitochondrial ATP synthase subunit delta. |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT5G47060 | hypothetical protein (DUF581);(source:Araport11) |
| AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
| AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
| AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
| AT5G47140 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
| AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT5G47229 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G47240 | nudix hydrolase homolog 8;(source:Araport11) |
| AT5G47300 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G47340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G47360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT5G47440 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G47460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G47470 | nodulin MtN21-like transporter family protein |
| AT5G47490 | RGPR-like protein;(source:Araport11) |
| AT5G47500 | predicted to encode a pectin methylesterase |
| AT5G47510 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT5G47520 | RAB GTPase homolog A5A;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT5G47550 | Putative phytocystatin expressed in seedlings and induced by heat stress and abscisic acid. Overexpression increases germination rate and heat stress tolerance. CYS5 is a target of ABF1 and ABF3 transcriptional regulators which bind to its promoter. |
| AT5G47630 | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. |
| AT5G47640 | Involved in the regulation of response to nutrient levels. |
| AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
| AT5G47870 | cobalt ion-binding protein;(source:Araport11) |
| AT5G47900 | heparan-alpha-glucosaminide N-acetyltransferase-like protein (DUF1624);(source:Araport11) |
| AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile. |
| AT5G47950 | BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. BIA2 may function in BR homeostasis by regulating the pool of bioactive BR. |
| AT5G47980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G47990 | Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses. |
| AT5G48000 | Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation. |
| AT5G48010 | Encodes an oxidosqualene cyclase involved in the biosynthesis of thalianol, a tricyclic triterpenoid of unknown function. Overexpression of THAS leads to dwarfing in the aerial tissues of Arabidopsis plants, but increases their root length. THAS is part of a small operon-like cluster of genes (with At5g48000 (THAH) and At5g47990 (THAD)) involved in thalianol metabolism. |
| AT5G48020 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G48030 | encodes a mitochondrially targeted DNAJ protein involved in female gametophyte development. |
| AT5G48060 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
| AT5G48090 | EDM2-like protein1;(source:Araport11) |
| AT5G48100 | Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. |
| AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
| AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G48130 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G48140 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
| AT5G48205 | zinc ion binding protein;(source:Araport11) |
| AT5G48320 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G48360 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT5G48370 | Thioesterase/thiol ester dehydrase-isomerase superfamily protein;(source:Araport11) |
| AT5G48375 | Is a myrosinase pseudogene that codes for a truncated and frameshifted protein. Although TGG3 apparently is a pseudogene, its mRNA is expressed specifically in stamen and petal according to RT-PCR analysis. Western analysis shows no band of the size expected for a TGG3 protein. |
| AT5G48385 | FRIGIDA-like protein;(source:Araport11) |
| AT5G48410 | member of Putative ligand-gated ion channel subunit family |
| AT5G48412 | other_RNA;(source:Araport11) |
| AT5G48430 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G48450 | Encodes a protein with two DUF26 domains and a signal peptide for secretion. The protein is transported to the apoplast when it is expressed as a GFP fusion protein. |
| AT5G48480 | Lactoylglutathione lyase / glyoxalase I family protein;(source:Araport11) |
| AT5G48510 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G48520 | Encodes AUGMIN subunit3 (AUG3), a homolog of animal dim gamma-tubulin 3/human augmin-like complex, subunit 3. Plays a critical role in microtubule organization during plant cell division. |
| AT5G48530 | hypothetical protein;(source:Araport11) |
| AT5G48550 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G48570 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G48600 | member of SMC subfamily |
| AT5G48650 | Negative regulator of defense response to Pseudomonas syringae pv. tomato through altered stomatal and apoplastic immunity. |
| AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT5G48690 | ubiquitin-associated (UBA)/TS-N domain protein;(source:Araport11) |
| AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G48740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G48750 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT5G48770 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G48820 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT5G48840 | Encodes a pantothenate synthetase that appears to be located in the cytosol. This protein is expected to play a role in pantothenate (vitamin B5) biosynthesis. Analysis of the catalytic properties of this enzyme indicate that it might be able to synthesize adequate amounts of pantothenate even in the presence of low levels of pantoate. |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT5G48940 | RGFR2 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT5G49050 | universal stress A-like protein;(source:Araport11) |
| AT5G49060 | DnaJ heat shock amino-terminal domain protein (DUF1977);(source:Araport11) |
| AT5G49090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G54955.1);(source:TAIR10) |
| AT5G49100 | vitellogenin-like protein;(source:Araport11) |
| AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT5G49130 | MATE efflux family protein;(source:Araport11) |
| AT5G49138 | Natural antisense transcript overlaps with AT5G49130;(source:Araport11) |
| AT5G49160 | Encodes a cytosine methyltransferase MET1. Required for silencing of FWA paternal allele in endosperm. Two lines with RNAi constructs directed against DMT1 have reduced agrobacterium-mediated tumor formation. The mRNA is cell-to-cell mobile. |
| AT5G49200 | WD-40 repeat family protein / zfwd4 protein (ZFWD4);(source:Araport11) |
| AT5G49240 | member of Response Regulator: Pseudo |
| AT5G49260 | hypothetical protein;(source:Araport11) |
| AT5G49270 | Involved in successfully establishing tip growth in root hairs. |
| AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G49290 | receptor like protein 56;(source:Araport11) |
| AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G49301 | Pseudogene of AT5G49310; importin alpha-1 subunit, putative |
| AT5G49310 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G49340 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G49350 | Glycine-rich protein family;(source:Araport11) |
| AT5G49420 | MADS-box transcription factor family protein;(source:Araport11) |
| AT5G49430 | WD40/YVTN repeat and Bromo-WDR9-I-like domain-containing protein;(source:Araport11) |
| AT5G49440 | hypothetical protein;(source:Araport11) |
| AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
| AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
| AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
| AT5G49490 | AGAMOUS-like 83;(source:Araport11) |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G49525 | transmembrane protein;(source:Araport11) |
| AT5G49530 | SIN-like family protein;(source:Araport11) |
| AT5G49550 | Putative homolog of mammalian BLOC-1 Subunit 2. Protein - protein interaction with BLOS1. |
| AT5G49555 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT5G49580 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G49600 | ABA responsive SVB family gene. |
| AT5G49610 | F-box family protein;(source:Araport11) |
| AT5G49620 | Member of the R2R3 factor gene family. |
| AT5G49640 | hypothetical protein;(source:Araport11) |
| AT5G49660 | The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G49680 | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
| AT5G49690 | UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide. |
| AT5G49700 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT5G49710 | RING finger protein;(source:Araport11) |
| AT5G49740 | Encodes a chloroplast ferric chelate reductase. Shows differential splicing and has three different mRNA products. Expressed in the shoot, flower and cotyledon. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT5G49770 | Leucine rich receptor kinase. |
| AT5G49780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G49790 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G36010.1);(source:TAIR10) |
| AT5G49810 | Arabidopsis thaliana methionine S-methyltransferase, an enzyme that catalyzes S -methylmethionine formation. The mRNA is cell-to-cell mobile. |
| AT5G49850 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G49860 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G49870 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G49890 | member of Anion channel protein family |
| AT5G49900 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT5G49920 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G49970 | encodes the bifunctional pyridoxine (pyridoxamine) 5?-phosphate oxidase (PPOX)(EC 1.4.3.5) that is involved in the formation of pyridoxal 5'-phosphate (member of the vitamin B6 group). NAD(P)HX epimerase (AT5G49970) interconverts the two epimers of NAD(P)HX. |
| AT5G49980 | auxin F-box protein 5;(source:Araport11) |
| AT5G50020 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G50030 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G50080 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain and is phosphorylated in planta. There are 7 members in this subfamily. |
| AT5G50100 | Encodes a putative thioredoxin DCC1 involved in determining shoot regeneration capacity. It interacts directly with CARBONIC ANHYDRASE 2 (CA2), an essential subunit of respiratory chain NADH dehydrogenase complex (Complex I) and regulates Complex I activity via redox modification of CA2. |
| AT5G50115 | molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
| AT5G50120 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G50130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G50160 | Encodes a ferric chelate reductase that is expressed in shoots and flowers. |
| AT5G50175 | transmembrane protein;(source:Araport11) |
| AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
| AT5G50230 | autophagy-related (ATG) gene |
| AT5G50240 | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
| AT5G50260 | Encodes a papain-like cysteine protease involved in tapetal programmed cell death and pollen development.CEP1 is expressed specifically in the tapetum from stages 5 to 11 of anther development. The CEP1 protein first appears as a proenzyme in precursor protease vesicles, and is then transported to the vacuole and transformed into the mature enzyme before rupture of the vacuole. CEP1 was also released to the tapetal cell wall during late stage 6 and stage 7. After the tapetal cell wall degenerated, the CEP1 enzyme entered the callose wall from the degenerated tapetal cell wall and was probably involved in degeneration of the callose wall. |
| AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT5G50340 | DNA repair protein RadA-like protein;(source:Araport11) |
| AT5G50345 | Encodes a Maternally expressed gene (MEG) family protein |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G50375 | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
| AT5G50400 | purple acid phosphatase 27;(source:Araport11) |
| AT5G50420 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G50450 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT5G50720 | Encodes one of five HVA22 homologs in Arabidopsis. HVA22 is an ABA- and stress-inducible gene first isolated from barley. Members of this gene family have only been found in eukaryotes. AtHVA22e mRNA is upregulated to varying degrees in response to cold stress, salt stress, ABA treatment or dehydration. |
| AT5G50760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G50780 | MORC4 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC7, it appears to repress the expression |
| AT5G50790 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Transcriptionally activated by long photoperiods; activation depends on FT and SOC1. The ectopic expression of SWEET10 causes early flowering and leads to higher levels of transcription of flowering-time related genes in the shoot apex. |
| AT5G50800 | Encodes a member of the SWEET sucrose efflux transporter family proteins, together with RPG1, it is involved in pollen development. Together with SWEET14, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
| AT5G50820 | NAC domain containing protein 97;(source:Araport11) |
| AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G50890 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G50915 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G50950 | Encodes a fumarase enzyme initially shown to be in the mitochondria through proteomic studies but later shown to be present in the cytosol using an RFP fluorescent protein tag. It appears to be important for the accumulation of fumarate from malate in leaves in the light, and helps to promote nitrogen assimilation under high nitrogen conditions. It does not appear to be necessary for lipid metabolism and seedling growth. Inhibition of fumarate accumulation results in an overall shift in the cold response of leaves, with a complete inhibition of cold acclimation of photosynthesis. |
| AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT5G51020 | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
| AT5G51050 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT5G51060 | RHD2 (along with RHD3 and RHD4) is required for normal root hair elongation. Has NADPH oxidase activity. Gene is expressed in the elongation and differention zone in trichoblasts and elongating root hairs. RDH2 is localized to the growing tips of root hair cells. It is required for the production of reactive oxygen species in response to extracellular ATP stimulus. The increase in ROS production stimulates Ca2+ influx. |
| AT5G51070 | ATP-dependent Clp protease regulatory subunit The mRNA is cell-to-cell mobile. |
| AT5G51105 | ECA1 gametogenesis family protein (DUF1278);(source:Araport11) |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT5G51170 | U6 snRNA phosphodiesterase-like protein;(source:Araport11) |
| AT5G51180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G51200 | Originally identified as EDS4, enhanced disease sensitive phenotype and subsequently cloned and identified as NUCLEOPORIN205. Affects circadian clock and downstream genes including those involved in defense response. |
| AT5G51210 | Encodes oleosin3, a protein found in oil bodies, involved in seed lipid accumulation. |
| AT5G51220 | ubiquinol-cytochrome C chaperone family protein;(source:Araport11) |
| AT5G51250 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT5G51320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42556.1);(source:TAIR10) |
| AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
| AT5G51360 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
| AT5G51390 | hypothetical protein;(source:Araport11) |
| AT5G51410 | LUC7 N terminus domain-containing protein;(source:Araport11) |
| AT5G51420 | long-chain-alcohol O-fatty-acyltransferase family protein / wax synthase family protein;(source:Araport11) |
| AT5G51440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G51451 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT5G51470 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G51490 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G51530 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT5G51590 | Member of the 29 AT-hook family TFs involved in the development of root xylem. |
| AT5G51650 | hypothetical protein;(source:Araport11) |
| AT5G51680 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G51760 | Encodes AHG1 (ABA-hypersensitive germination 1), a putative protein phosphatase 2C (PP2C). Expressed in seeds. AHG1 functions in seed development and germination. |
| AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G51810 | Encodes gibberellin 20-oxidase. Involved in gibberellin biosynthesis. Up-regulated by far red light in elongating petioles. Not regulated by a circadian clock. Mutation of GA20ox2 delays flowering. |
| AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
| AT5G51840 | junctophilin-like protein;(source:Araport11) |
| AT5G51850 | hypothetical protein;(source:Araport11) |
| AT5G51920 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G51950 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G52000 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G52050 | MATE efflux family protein;(source:Araport11) |
| AT5G52055 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-30 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G52170 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G52230 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G52260 | Member of the R2R3 factor gene family. |
| AT5G52270 | SNARE-like superfamily protein;(source:Araport11) |
| AT5G52280 | Myosin heavy chain-related protein;(source:Araport11) |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
| AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G52350 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G52355 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT5G52415 | pseudogene of TRAF-like family protein;(source:Araport11) |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT5G52440 | HCF106; nuclear gene for chloroplast. Thylakoid membrane delta pH translocation pathway component protein; related to Escherichia coli TatA and TatB The mRNA is cell-to-cell mobile. |
| AT5G52450 | MATE efflux family protein;(source:Araport11) |
| AT5G52480 | RNI-like superfamily protein;(source:Araport11) |
| AT5G52490 | Fibrillarin family protein;(source:Araport11) |
| AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
| AT5G52530 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G52540 | keratin-associated protein, putative (DUF819);(source:Araport11) |
| AT5G52560 | Encodes a protein with UTP:sugar 1-phosphate uridylyltransferase activity, which has been shown to use a wide range of substrates including glucose-1-P, galactose-1-P, xylose-1-P, arabinose-1-P and glucuronate-1-P. The enzyme was shown to require Mg2+ or Mn2+ for activity. Mutations in USP can lead to a complete loss of male fertility. |
| AT5G52605 | Encodes a defensin-like (DEFL) family protein. |
| AT5G52640 | Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile. |
| AT5G52680 | Copper transport protein family;(source:Araport11) |
| AT5G52690 | Copper transport protein family;(source:Araport11) |
| AT5G52710 | Copper transport protein family;(source:Araport11) |
| AT5G52780 | Chloroplast NAD(P)H dehydrogenase complex assembly factor. |
| AT5G52850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G52880 | F-box family protein;(source:Araport11) |
| AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
| AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52930 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G52940 | DUF295 domain protein. |
| AT5G52990 | SNARE-like superfamily protein;(source:Araport11) |
| AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
| AT5G53030 | hypothetical protein;(source:Araport11) |
| AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
| AT5G53100 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G53130 | member of Cyclic nucleotide gated channel family |
| AT5G53230 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53240 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
| AT5G53260 | Seed maturation protein;(source:Araport11) |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53300 | Encodes a ubiquitin conjugating enzyme. |
| AT5G53360 | RING‐finger E3 ubiquitin ligase (SINATT) member that lacks ubiquitin ligase activity due to the absence of the RING domain, functions as a protector protein which stabilizes FREE1. Involved in response to iron deficiency stress. |
| AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
| AT5G53380 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G53410 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
| AT5G53430 | Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
| AT5G53440 | LOW protein: zinc finger CCCH domain protein;(source:Araport11) |
| AT5G53470 | Encodes an acyl-CoA binding protein that is localized to vesicles,and plasma membrane especially in epidermal cells of heart, torpedo and cotyledon stage embryos, cell wall of the seed coat. Northern blot analysis showed that the 1.4 kb ACBP1 mRNA was expressed in silique, root, stem, leaf and flower. |
| AT5G53490 | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. |
| AT5G53510 | oligopeptide transporter |
| AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G53592 | FBD-like domain family protein;(source:Araport11) |
| AT5G53635 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G53660 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT5G53680 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G53700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G53720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G53742 | Encodes a ECA1 gametogenesis related family protein |
| AT5G53770 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT5G53775 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-39 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT5G53780 | F-box protein, putative (DUF295);(source:Araport11) |
| AT5G53800 | nucleic acid-binding protein;(source:Araport11) |
| AT5G53820 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G53830 | VQ motif-containing protein;(source:Araport11) |
| AT5G53840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G53870 | early nodulin-like protein 1;(source:Araport11) |
| AT5G53902 | U3 small nucleolar RNA |
| AT5G53910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53940 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
| AT5G53990 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G54000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G54010 | Encodes a flavonoid 3-O-glucoside:2″-O-glucosyltransferase that determines pollen-specific flavonol structure. |
| AT5G54045 | pseudogene of UF3GT |
| AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
| AT5G54070 | A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation. |
| AT5G54075 | U3 small nucleolar RNA |
| AT5G54100 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. The mRNA is cell-to-cell mobile. |
| AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT5G54145 | hypothetical protein;(source:Araport11) |
| AT5G54148 | sarcosine dehydrogenase-2C protein;(source:Araport11) |
| AT5G54180 | Encodes a member of the Mitochondrial Transcription Termination Factor Family and is involved in the transcription termination of the chloroplast gene psbJ1. pTAC15 specifically binds to the 3'-terminal region of psbJ. |
| AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
| AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT5G54270 | Lhcb3 protein is a component of the main light harvesting chlorophyll a/b-protein complex of Photosystem II (LHC II). |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT5G54320 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54330 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54340 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT5G54360 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G54370 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G54375 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT5G54390 | Encodes a 3'-phosphoadenosine-5'-phosphate (PAP) phosphatase that is sensitive to physiological concentrations of Na+. It does not also act as inositol polyphosphate 1-phosphatases, which other members of the HAL2-like family do. It is proposed that AHL acts in concert with sulphotransferases to prevent both the toxicity of PAP on RNA processing enzymes as well as the product inhibition of PAP on sulphate conjugation. The mRNA is cell-to-cell mobile. |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G54420 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54450 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
| AT5G54490 | Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. |
| AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
| AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
| AT5G54520 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G54540 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
| AT5G54550 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54560 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54569 | Natural antisense transcript overlaps with AT5G54570;(source:Araport11) |
| AT5G54585 | hypothetical protein;(source:Araport11) |
| AT5G54590 | Splice variant At5g54590.2 encodes CRLK1 (440-amino acid in length) calcium/calmodulin-regulated receptor-like kinase crucial for cold tolerance. CRLK1 is Primarily localized in the plasma membrane. |
| AT5G54640 | Isolated from T-DNA insertion line, the rat5 mutant is deficient in T-DNA integration. Encodes histone2A protein. |
| AT5G54661 | Pseudogene of AT5G54660; heat shock protein-related |
| AT5G54730 | yeast autophagy 18 F-like protein;(source:Araport11) |
| AT5G54770 | Encodes a thiamine biosynthetic gene that has a dual function in thiamine biosynthesis and mitochondrial DNA damage tolerance. It appears to be involved in producing the thiazole portion of thiamine (vitamin B1). A crystal structure of the protein reveals that it forms a 2-ring homo-octamer. The mRNA is cell-to-cell mobile. |
| AT5G54820 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G54910 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G54930 | AT hook motif-containing protein;(source:Araport11) |
| AT5G54990 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G55000 | FH protein interacting protein FIP2 |
| AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G55055 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT5G55070 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
| AT5G55090 | member of MEKK subfamily |
| AT5G55100 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT5G55132 | Encodes a defensin-like (DEFL) family protein. |
| AT5G55150 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G55200 | Co-chaperone GrpE family protein;(source:Araport11) |
| AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT5G55270 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G55280 | Encodes one of two FtsZ proteins, tubulin-like proteins, in Arabidopsis. It is involved in chloroplast division. |
| AT5G55290 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT5G55300 | Encodes a type-I DNA topoisomerase I. Disruptions in this gene affect phyllotaxis and plant architecture suggesting that the gene plays a critical role in the maintenance of a regular pattern of organ initiation. Isolated as a protein oxidized during seed germination; proteomics approach revealed differences in de novo synthesis levels of this protein in condition with vs. without salicylic acid in the period from 0 to 40 hrs. following seed imbibition. Functions in stem cell maintenance at all stages of shoot and floral meristems and in the regulation of gene silencing. |
| AT5G55320 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G55330 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G55340 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G55350 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G55410 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT5G55440 | F-box protein, putative (DUF295);(source:Araport11) |
| AT5G55450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G55490 | Encodes a transmembrane domain containing protein that is expressed in pollen germ cells. |
| AT5G55520 | kinesin-like protein;(source:Araport11) |
| AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G55590 | Encodes a protein with pectin methylesterase activity. No change in activity were detected in mutants defective in this gene, which was interpreted as a result of redundancy of product function with other pectin methylesterases. The gene product is required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
| AT5G55620 | hypothetical protein;(source:Araport11) |
| AT5G55630 | Encodes AtTPK1 (KCO1), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK1 is targeted to the vacuolar membrane. Forms homomeric ion channels in vivo. Voltage-independent and Ca2+-activated K+ channel. Activated by 14-3-3 proteins. Vacuolar K+-conducting TPC1 and TPK1/TPK3 channels act in concert to provide for Ca2+- and voltageinduced electrical excitability to the central organelle of plant cells. |
| AT5G55640 | Na-translocating NADH-quinone reductase subunit A;(source:Araport11) |
| AT5G55730 | Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development. |
| AT5G55740 | Encodes a member of the E+ subgroup of the PPR protein family, containing the E and E+ motifs following a tandem array of PPR motifs. It also contains an unknown motif consisting of 15 aa, which is highly conserved in some PPR proteins, including CRR4. CRR21 is involved in RNA editing of the site 2 of ndhD (ndhD-2),which encodes a subunit of the NDH complex. The RNA editing changes aa 128 from Ser to Leu. Mutants have impaired NDH complex activity. |
| AT5G55780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G55790 | hypothetical protein;(source:Araport11) |
| AT5G55810 | encodes a bi-functional enzyme that expresses both nicotinamide-nucleotide adenylyltransferase (2.7.7.1) and nicotinate-nucleotide adenylyltransferase (2.7.7.18)activity. |
| AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
| AT5G55850 | NOI protein |
| AT5G55890 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G55893 | hypothetical protein;(source:Araport11) |
| AT5G55900 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
| AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT5G55980 | serine-rich protein-like protein;(source:Araport11) |
| AT5G55990 | Encodes a member of the Arabidopsis CBL (Calcineurin B-like Calcium Sensor) protein family. |
| AT5G56040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G56050 | late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G56090 | Encodes a homolog of COX15. Microarray analysis show a 3.2 fold increase in transcription after treatment with rotenone, an electron transport chain inhibitor. |
| AT5G56110 | Encodes a member of the R2R3 MYB transcription factor gene family that is required for anther development by regulation tapetum development, callose dissolution and exine formation. It acts upstream of MS2. |
| AT5G56150 | ubiquitin-conjugating enzyme 30;(source:Araport11) |
| AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
| AT5G56200 | Encodes a transcription factor expressed in the female gametophyte. |
| AT5G56220 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
| AT5G56290 | Encodes the peroxisomal targeting signal type 1 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS1 consensus sequence (tripeptide SKL or a conserved variant) at the extreme C terminus. The protein has several domains, including C-terminal tetratricopeptide repeat motifs which act in binding the C-terminal "SKL" targeting signal. The mechanism of transport has been worked out in other organisms: The receptor recognizes and binds cytosolic PTS1-containing proteins. The PEX5-PTS1 complex binds a PEX14/PEX13 receptor complex at the peroxisome membrane and is translocated into the peroxisome matrix in a process dependent on PEX2,PEX10, and PEX12. In the peroxisome matrix, PEX5 releases its cargo and is recycled to the cytosol in a process dependent on PEX1, PEX4, PEX6 and PEX22. It is also involved, in conjunction with PEX7, in PTS1- and PTS2-dependent peroxisomal protein import. RNAi experiments suggest that PEX5 is necessary for the maintenance of both glyoxysomal and leaf peroxisomal functions. |
| AT5G56310 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G56350 | Pyruvate kinase family protein;(source:Araport11) |
| AT5G56370 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G56390 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G56452 | FBD-like domain family protein;(source:Araport11) |
| AT5G56460 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G56470 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT5G56510 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G56520 | hypothetical protein;(source:Araport11) |
| AT5G56530 | tRNA-splicing ligase (DUF239);(source:Araport11) |
| AT5G56540 | Encodes arabinogalactan protein (AGP14). Mutants exhibit longer root hairs. The mRNA is cell-to-cell mobile. |
| AT5G56560 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G56570 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G56620 | NAC domain containing protein 99;(source:Araport11) |
| AT5G56630 | phosphofructokinase 7;(source:Araport11) |
| AT5G56640 | Myo-Inositol Oxygenase gene family |
| AT5G56680 | Encodes a putative cytosolic asparaginyl-tRNA synthetase. The mRNA is cell-to-cell mobile. |
| AT5G56690 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G56720 | predicted to encode a cytosolic malate dehydrogenase. |
| AT5G56730 | Insulinase (Peptidase family M16) protein;(source:Araport11) |
| AT5G56760 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT5G56770 | transcription repressor-like protein;(source:Araport11) |
| AT5G56820 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G56830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.7e-14 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G56850 | hypothetical protein;(source:Araport11) |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT5G56890 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT5G56980 | Pathogen-associated molecular pattern-induced gene.Responsive to jasmonic acid and wounding. |
| AT5G56990 | proteinase inhibitor I25, cystatin, motif protein;(source:Araport11) |
| AT5G57000 | DEAD-box ATP-dependent RNA helicase;(source:Araport11) |
| AT5G57015 | Member of CKL gene family (member of CKL-B group). |
| AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
| AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
| AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
| AT5G57060 | 60S ribosomal L18a-like protein;(source:Araport11) |
| AT5G57070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G57080 | transmembrane protein;(source:Araport11) |
| AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
| AT5G57170 | Chemokine-like MDL protein; modulates flowering time and innate immunity. |
| AT5G57180 | Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. |
| AT5G57260 | putative cytochrome P450 |
| AT5G57320 | actin filament bundling protein P-115-ABP protein;(source:Araport11) |
| AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
| AT5G57360 | Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1. |
| AT5G57370 | U4/U6.U5 small nuclear ribonucleoprotein;(source:Araport11) |
| AT5G57420 | Belongs to auxin inducible gene family. |
| AT5G57460 | TPLATE complex subunit involved in clathirin mediated endocytosis. |
| AT5G57480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G57490 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT5G57510 | cotton fiber protein;(source:Araport11) |
| AT5G57520 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G57540 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. |
| AT5G57570 | GCK domain-containing protein;(source:Araport11) |
| AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
| AT5G57590 | Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis. |
| AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT5G57620 | MYB36 is a transcriptional regulator that acts to promote differentiation of the endodermis during root development. It promotes the development the Casparian band in part by regulating the expression of genes involved in localizing lignin biosynthetic machinery to the Casparian band. MYB36 binds to and regulates the expression of factors involved in producing the Casparian band including CASP1, PER64, and ESB1. |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT5G57670 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
| AT5G57720 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G57760 | hypothetical protein;(source:Araport11) |
| AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
| AT5G57820 | zinc ion binding protein;(source:Araport11) |
| AT5G57887 | transmembrane protein;(source:Araport11) |
| AT5G57960 | GTP-binding protein, HflX;(source:Araport11) |
| AT5G57980 | NRPB5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT5G58000 | Reticulon family protein;(source:Araport11) |
| AT5G58010 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT5G58050 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58060 | Constitutively expressed SNARE protein of the YKT6 family. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT5G58130 | Encodes ROS3 (repressor of silencing 3), a RNA-binding protein required for DNA demethylation. |
| AT5G58160 | Class II formin; modulator of pollen tube elongation. |
| AT5G58170 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58190 | evolutionarily conserved C-terminal region 10;(source:Araport11) |
| AT5G58210 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G58280 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G58320 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the tonoplast membrane. It is expressed in the epidermis of the root meristem and the early expansion zone. |
| AT5G58360 | ovate family protein 3;(source:Araport11) |
| AT5G58412 | Encodes a Plant thionin family protein |
| AT5G58440 | sorting nexin 2A;(source:Araport11) |
| AT5G58460 | member of Putative Na+/H+ antiporter family |
| AT5G58500 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT5G58510 | Rab3 GTPase-activating protein catalytic protein;(source:Araport11) |
| AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G58550 | Encodes a paralog of ETO1, which is a negative regulator of ACS5 (a key enzyme in ethylene biosynthesis pathway). EOL2 also interacts with and inhibits the activity of ACS5. |
| AT5G58580 | Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi. |
| AT5G58610 | PHD finger transcription factor;(source:Araport11) |
| AT5G58640 | Selenoprotein, Rdx type;(source:Araport11) |
| AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
| AT5G58670 | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). |
| AT5G58740 | Member of the family of NudC proteins. Over-expression improves free radical sacenving activity and antioxidant status, promotes root growth and branching under abiotic stress. |
| AT5G58750 | Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases). |
| AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
| AT5G58780 | Encodes a novel Z,E-mixed heptaprenyl diphosphate (Z,E-HepPP) synthase, which may be responsible for short-chain betulaprenols. It catalyzes the formation of C 35 short-chain polyisoprenoids in which the optimal allylic substrate was E,E-FPP. It may have a role in response to cold stress in root. |
| AT5G58782 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT5G58787 | Encodes a cytosolic protein with E3 ligase activity that is involved in positive regulation of ABA responses. |
| AT5G58810 | pseudogene of Subtilase family protein;(source:Araport11) |
| AT5G58820 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G58830 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G58840 | Subtilase family protein;(source:Araport11) |
| AT5G58850 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119). |
| AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
| AT5G58880 | LRR protein;(source:Araport11) |
| AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
| AT5G58900 | R-R-type MYB protein |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G58920 | homeobox prospero protein;(source:Araport11) |
| AT5G59000 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G59090 | subtilase 4.12;(source:Araport11) |
| AT5G59100 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G59110 | subtilisin-like serine protease-like protein;(source:Araport11) |
| AT5G59120 | SBT4.13 subtilase. Activity is inhibited by SPI-1. |
| AT5G59130 | Subtilase family protein;(source:Araport11) |
| AT5G59170 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT5G59190 | subtilase family protein;(source:Araport11) |
| AT5G59200 | Encodes a chloroplast RNA editing factor. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT5G59250 | Encodes a chloroplast localized H+/glucose antiporter. |
| AT5G59260 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G59280 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G59340 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain. |
| AT5G59370 | Encodes one of eight Arabidopsis actins. ACT4 belongs to the reproductive actin subclass which is predominantly expressed in developing and reproductive tissues, such as pollen, pollen tubes, ovules, and developing seeds. Expression of the ACT4/GUS fusion was restricted to young vascular tissues, tapetum, and developing and mature pollen. |
| AT5G59395 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT5G59420 | OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11) |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G59450 | GRAS family transcription factor;(source:Araport11) |
| AT5G59505 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: GAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172e (converted to TAIR10 based on PMID19304749): Chr5: 23988070-23988886 (forward), length: 817 bp; exon coordinates: exon 1: 23988070 to 23988886; mature miRNA and miRNA* are located on exon 1. |
| AT5G59530 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
| AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
| AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G59670 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59700 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G59750 | monofunctional riboflavin biosynthesis protein RIBA 3;(source:Araport11) |
| AT5G59760 | hypothetical protein (DUF1635);(source:Araport11) |
| AT5G59770 | Protein-tyrosine phosphatase-like, PTPLA;(source:Araport11) |
| AT5G59780 | Encodes a putative transcription factor (MYB59). In roots it is involved in K+/NO3- transport and expression of the NPF7.3 transporter. |
| AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
| AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile. |
| AT5G59845 | Member of a family of proteins named as being GA inducible but GASA10 does not appear to be GA induced. It is likely to be secreted as the protein is found in the cell wall. |
| AT5G59930 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G59940 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein;(source:Araport11) |
| AT5G59990 | CCT motif family protein;(source:Araport11) |
| AT5G60000 | transmembrane protein;(source:Araport11) |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
| AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G60070 | ankyrin repeat family protein;(source:Araport11) |
| AT5G60080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G60090 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G60110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G60160 | Vacuolar aspartyl aminopeptidase which also functions as a molecular chaperone. |
| AT5G60180 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G60190 | Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins. |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G60280 | Plasma membrane localized receptor kinase. Binds NAD+ and induces expression of disease resistance genes. |
| AT5G60285 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT5G60310 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60350 | hypothetical protein;(source:Araport11) |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT5G60380 | transmembrane protein, putative (DUF239);(source:Araport11) |
| AT5G60450 | Encodes a member of the ARF family of transcription factors which mediate auxin responses. ARF4 appears to have redundant function with ETT(ARF3) in specifying abaxial cell identity. |
| AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
| AT5G60510 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
| AT5G60570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G60660 | A member of the plasma membrane intrinsic protein subfamily PIP2.When expressed in yeast cells can conduct hydrogen peroxide into those cells. Mutants exhibit longer root hairs. |
| AT5G60670 | Ribosomal protein L11 family protein;(source:Araport11) |
| AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile. |
| AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G60740 | ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species. |
| AT5G60770 | member of High affinity nitrate transporter family |
| AT5G60780 | member of High affinity nitrate transporter family |
| AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT5G60870 | Encodes a mitochondrial protein RUG3 that is required for accumulation of mitochondrial respiratory chain complex I. RUG3 is related to human REGULATOR OF CHROMOSOME CONDENSATION 1 (RCC1) and Arabidopsis UV-B RESISTANCE 8 (UVR8). |
| AT5G60880 | Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. In asymmetrically dividing stomatal-lineage cells, BASL accumulates in a polarized crescent at the cell periphery before division, and then localizes differentially to the nucleus and a peripheral crescent in self-renewing cells and their sisters after division. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT5G60920 | Encodes a glycosylphosphatidylinositol-anchored protein localized primarily in the plasma membrane of the longitudinal sides of root cells. Necessary for oriented cell expansion in Arabidopsis. Cob mutants have abnormal roots that expand radially rather than longitudinally under certain growth conditions. |
| AT5G60930 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G60950 | COBRA-like protein 5 precursor;(source:Araport11) |
| AT5G61030 | Encodes a glycine-rich RNA binding protein that is involved in C-> U RNA editing in mitochondria. Gene expression is induced by cold. The mRNA is cell-to-cell mobile. |
| AT5G61050 | histone deacetylase-related / HD-like protein;(source:Araport11) |
| AT5G61070 | Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation. |
| AT5G61090 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G61100 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G61120 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G61190 | putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G61240 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G61250 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted. |
| AT5G61260 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT5G61270 | Basic helix-loop-helix (bHLH) phytochrome interacting factor. Interacts specifically with the far-red light?absorbing Pfr form of phyB through a conserved domain called the active phyB binding motif. Upon light exposure, PIF7 rapidly migrates to intranuclear speckles, where it colocalizes with phyB. Role as negative regulator of phyB-mediated seedling deetiolation. |
| AT5G61280 | Remorin family protein;(source:Araport11) |
| AT5G61290 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G61320 | member of CYP89A |
| AT5G61330 | rRNA processing protein-like protein;(source:Araport11) |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |
| AT5G61360 | hypothetical protein;(source:Araport11) |
| AT5G61370 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G61412 | hypothetical protein;(source:Araport11) |
| AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
| AT5G61430 | NAC domain containing protein 100;(source:Araport11) |
| AT5G61455 | U2-7;(source:Araport11) |
| AT5G61460 | Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT5G61480 | Encodes PXY, a receptor-like kinase essential for maintaining polarity during plant vascular-tissue development. |
| AT5G61510 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT5G61540 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61570 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G61620 | myb-like transcription factor family protein;(source:Araport11) |
| AT5G61650 | The P-type cyclins (CYCPs) share a conserved central region of 100 amino acids ('cyclin box') displaying homology to the corresponding region of the PHO80 cyclin from Saccharomyces cerevisiae and the related G1 cyclins from Trypanosoma cruzi and T. brucei. |
| AT5G61680 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G61700 | ABC2 homolog 16;(source:Araport11) |
| AT5G61710 | cotton fiber protein;(source:Araport11) |
| AT5G61720 | hypothetical protein (DUF1216);(source:Araport11) |
| AT5G61750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G61760 | Encodes an inositol polyphosphate 3-/6-/5-kinase that is localized to the nucleus. Able to complement a mutation in a yeast transcriptional regulator gene (ARG82/IPK2). Acts redundantly with ATIPK2alpha during pollen development, pollen tube guidance and embryogenesis. |
| AT5G61780 | Involved in the regulation of AtGA20ox3 expression, as well as seed germination. The mRNA is cell-to-cell mobile. |
| AT5G61790 | calnexin 1;(source:Araport11) |
| AT5G61800 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G61830 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G61840 | Encodes a UDP-Xyl:beta-(1,4)-xylosyl transferase. |
| AT5G61880 | Encodes PAM16L, a paralog of PAM16 (AT3G59280). |
| AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G61910 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT5G61920 | FLX-like protein;(source:Araport11) |
| AT5G61950 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
| AT5G61980 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD1 belongs to the class 1, together with AGD2, AGD3 and AGD4. Not expressed in hypocotyls and cotyledons. |
| AT5G62030 | diphthamide synthesis DPH2 family protein;(source:Araport11) |
| AT5G62065 | Encodes a Protease inhibitor/seed storage/LTP family protein. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62162 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT5G62250 | microtubule-associated protein 65-9;(source:Araport11) |
| AT5G62260 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G62270 | Ribosomal protein L20;(source:Araport11). Required for proper mitochondrial cristae formation. Expressed throughout plant. Mutants are defective in late stages of megagametogenesis. Pollen tube defective. Gametophytic lethality is probably due to mitochondrial disfunction. |
| AT5G62280 | DUF1442 family protein (DUF1442);(source:Araport11) |
| AT5G62300 | Ribosomal protein S10p/S20e family protein;(source:Araport11) |
| AT5G62390 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. Localized to the ER. Necessary for the proper maintenance of the unfolded protein response during heat and cold tolerance. |
| AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT5G62623 | Encodes a defensin-like (DEFL) family protein. |
| AT5G62627 | Encodes a defensin-like (DEFL) family protein. |
| AT5G62630 | hipl2 protein precursor;(source:Araport11) |
| AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT5G62700 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
| AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT5G62730 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G62740 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G62750 | hypothetical protein;(source:Araport11) |
| AT5G62780 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G62840 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT5G62860 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G62865 | hypothetical protein;(source:Araport11) |
| AT5G62900 | PADRE protein down-regulated after infection by S. sclerotiorum. |
| AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
| AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G62950 | RNA polymerase II, Rpb4, core protein;(source:Araport11) |
| AT5G62960 | UDP-N-acetylglucosamine-N-acetylmuramyl-pyrophosphoryl-undecaprenol N-acetylglucosamine protein;(source:Araport11) |
| AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G62990 | Nucleus-encoded RNA-binding protein which exists only in embryophytes, catalyzes nuclear pre-mRNA and chloroplast group II intron splicing. |
| AT5G63070 | Ribosomal protein S19 family protein;(source:Araport11) |
| AT5G63080 | Encodes a HR demethylase that acts as a positive regulator of seed germination in the PHYB-PIL5-SOM pathway. |
| AT5G63087 | Encodes a Plant thionin family protein |
| AT5G63110 | RPD3-like histone deacetylase. HDA6 mutations specifically increase the expression of auxin-responsive transgenes, suggesting a role in transgene silencing. |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT5G63220 | golgi-to-ER traffic-like protein;(source:Araport11) |
| AT5G63225 | glycosyl hydrolase family protein 17 |
| AT5G63370 | CDKG1 interacts with the splicing factor RSZ33 to regulate proper splicing of Cals5 Pre-mRNA. |
| AT5G63380 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At5g63380 preferentially activates fatty acids with increased chain length (C9:0 to C8:0) and thus shares characteristics with long-chain fatty acyl-CoA synthases. Also able to catalyze the conversion of OPDA to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT5G63410 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT5G63550 | DEK domain-containing chromatin associated protein;(source:Araport11) |
| AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G63570 | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile. |
| AT5G63580 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G63650 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT5G63690 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT5G63700 | zinc ion binding / DNA binding protein;(source:Araport11) |
| AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT5G63730 | Encodes ARIADNE14 (ARI14), a putative ubiquitin E3 ligase. ARI14 and an inversely transcribed gene KPL generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT5G63740 | A paternally expressed imprinted gene. |
| AT5G63750 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G63760 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G63770 | a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold. |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT5G63810 | member of Glycoside Hydrolase Family 35 |
| AT5G63820 | hypothetical protein (DUF626);(source:Araport11) |
| AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT5G63900 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G63930 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63941 | Pseudogene of AT5G09270 |
| AT5G64000 | 3'(2'),5'-bisphosphate nucleotidase |
| AT5G64060 | NAC domain containing protein 103;(source:Araport11) |
| AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G64190 | neuronal PAS domain protein;(source:Araport11) |
| AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
| AT5G64240 | Encodes a type I metacaspase. Two Arabidopsis metacaspases, AT1G02170 (MC1) and AT4G25110 (MC2) antagonistically control programmed cell death in Arabidopsis. MC1 is a positive regulator of cell death and requires conserved caspase-like putative catalytic residues for its function. MC2 negatively regulates cell death. This function is independent of the putative catalytic residues. A third type I Arabidopsis metacaspase is MC3 (AT5g64240). |
| AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
| AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
| AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G64450 | NYN domain protein;(source:Araport11) |
| AT5G64470 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G64490 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G64530 | xylem NAC domain 1;(source:Araport11) |
| AT5G64550 | loricrin-like protein;(source:Araport11) |
| AT5G64640 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G64650 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
| AT5G64690 | neurofilament triplet H protein-like protein;(source:Araport11) |
| AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA6, along with CESA1 and CESA3 are present in the same plasma membrane complex for cellulose biosynthesis. CESA2 and CESA5 are related to CESA6, having partially redundant roles. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The mRNA is cell-to-cell mobile. |
| AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
| AT5G64770 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT5G64830 | programmed cell death 2 C-terminal domain-containing protein;(source:Araport11) |
| AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
| AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
| AT5G65030 | nitric oxide synthase-interacting protein;(source:Araport11) |
| AT5G65060 | MADS domain protein - flowering regulator that is closely related to FLC |
| AT5G65090 | Encodes a protein involved in root hair morphogenesis and tip growth. Required for restricting both the size of the root-hair initiation site and the width of the root hairs during the transition to tip growth, but, apparently, is not required for normal subsequent tip growth. |
| AT5G65100 | Ethylene insensitive 3 family protein;(source:Araport11) |
| AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G65160 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G65165 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds, and markedly decline during germination. |
| AT5G65205 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G65207 | hypothetical protein;(source:Araport11) |
| AT5G65210 | Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated. |
| AT5G65220 | Ribosomal L29 family protein;(source:Araport11) |
| AT5G65240 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G65274 | ARP2/3 complex 16 kDa subunit (p16-Arc);(source:Araport11) |
| AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT5G65320 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G65330 | AGAMOUS-like 78;(source:Araport11) |
| AT5G65380 | MATE efflux family protein;(source:Araport11) |
| AT5G65410 | Encodes ZFHD2, a member of the zinc finger homeodomain transcriptional factor family.Gain of function of ATHB25 (35S and UBQ10 proomoters) and double loss of function of ATHB25 and ATHB22 increases and decreases, respectively, seed longevity. This phenotype is maternal and related to seed coat alterations. Gain of function increases expression of GA3OX2 and GA4 and GA1 levels. Together with REM7 induces the expression of genes controlling shoot stem characteristics by ectopic expression in roots. |
| AT5G65430 | member of 14-3-3 proteins. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G65600 | L-type lectin receptor kinase which modulates metabolites and abiotic stress responses. Phosphorylates AvrPtoB which in turn reduces its virulence. |
| AT5G65650 | sugar transporter, putative (DUF1195);(source:Araport11) |
| AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
| AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G65687 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT5G65720 | Encodes a cysteine desulfurase whose activity is dependent on AtSufE activation. It requires pyridoxal phosphate (PLP) for proper folding. Its catalytic efficiency is increase three-fold in the presence of AtFH (frataxin). |
| AT5G65760 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT5G65880 | transmembrane protein;(source:Araport11) |
| AT5G65900 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G65950 | TRAPPIII complex protein which regulates TGN integrity, by altered TGN/EE association of several residents, including SYNTAXIN OF PLANTS 61 (SYP61), and altered vesicle morphology. Involved in regulation of endosomal function and salt stress response. |
| AT5G65970 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO10 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO9. The gene is expressed in root and cotyledon vascular system, in root-shoot junction and lateral root primordia and in developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s |
| AT5G65980 | Auxin efflux carrier family protein;(source:Araport11) |
| AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
| AT5G66050 | Wound-responsive family protein;(source:Araport11) |
| AT5G66052 | transmembrane protein;(source:Araport11) |
| AT5G66053 | hypothetical protein;(source:Araport11) |
| AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
| AT5G66080 | Type 2C protein phosphatase located in the plasma membrane. Functions in heat shock response memory mantainance. |
| AT5G66140 | Encodes alpha5 subunit of 20S proteosome complex involved in protein degradation. |
| AT5G66150 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
| AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G66350 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Shi mutant is dominant, has dwarf phenotype. Loss of function mutations have no observable phenotype. Putative zinc finger protein. Involved in the response to gibberellic acid. |
| AT5G66390 | Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT5G66410 | Encodes a protein that functions in microtubule assembly. Plants with reduced levels of both PLP3a (At3g50960) and PLP3b show defects in cytokinesis, cortical microtubule array formation, oriented cell growth, and maintenance of proper ploidy. |
| AT5G66430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G66455 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT5G66460 | Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence. |
| AT5G66480 | bacteriophage N4 adsorption B protein;(source:Araport11) |
| AT5G66500 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G66550 | Maf-like protein;(source:Araport11) |
| AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
| AT5G66580 | PADRE protein. |
| AT5G66607 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G66630 | DA1-related protein 5;(source:Araport11) |
| AT5G66640 | DA1-related protein 3;(source:Araport11) |
| AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
| AT5G66660 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT5G66760 | One of two genes in Arabidopsis that encode a flavoprotein subunit of the mitochondrial succinate dehydrogenase complex. The mRNA is cell-to-cell mobile. |
| AT5G66770 | GRAS family transcription factor;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66830 | F-box protein (DUF295);(source:Araport11) |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
| AT5G66890 | RPW8 -CNL gene. |
| AT5G66900 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.2. Exhibits autoimmunity. |
| AT5G66940 | Encodes a nuclear localized DOF-domain binding transcription factor. |
| AT5G66985 | hypothetical protein;(source:Araport11) |
| AT5G67040 | F-box protein, putative (DUF295);(source:Araport11) |
| AT5G67090 | Encodes a subtilisin-like serine protease with in vitro protease activity. |
| AT5G67170 | SEC-C motif-containing protein / OTU-like cysteine protease family protein;(source:Araport11) |
| AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G67260 | Encode CYCD3;2, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs and mediating cytokinin effects in apical growth and development. With PPD and NINJA, it plays a crucial role in leaf morphogenesis. |
| AT5G67280 | receptor-like kinase;(source:Araport11) |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT5G67310 | member of CYP81G |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT5G67411 | GRAS family transcription factor;(source:Araport11) |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G67470 | formin homolog 6;(source:Araport11) |
| AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT5G67550 | transmembrane protein;(source:Araport11) |
| AT5G67570 | Encodes a pentratricopeptide repeat containing protein that is targeted to the chloroplast. Mutants have pale young leave and reduced accumulation of plastid encoded transcripts suggesting a role for DG1 in regulation of plastid gene expression. |
| AT5G67640 | hypothetical protein;(source:Araport11) |