AT1G30130 | DUF1365 family protein;(source:Araport11) |
AT5G16810 | Protein kinase superfamily protein;(source:Araport11) |
AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
AT1G75770 | hypothetical protein;(source:Araport11) |
AT1G34630 | transmembrane protein;(source:Araport11) |
AT1G67590 | Remorin family protein;(source:Araport11) |
AT1G55820 | lysine-specific demethylase, putative (DUF1296);(source:Araport11) |
AT5G15430 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT4G32105 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G10080 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G15630 | plant/protein;(source:Araport11) |
AT3G05900 | neurofilament protein-like protein;(source:Araport11) |
AT4G09060 | hypothetical protein;(source:Araport11) |
AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
AT1G51400 | Photosystem II 5 kD protein;(source:Araport11) |
AT1G64120 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT3G20555 | hypothetical protein;(source:Araport11) |
AT3G47540 | Chitinase family protein;(source:Araport11) |
AT4G39985 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT4G32750 | transmembrane protein;(source:Araport11) |
AT3G49790 | Carbohydrate-binding protein;(source:Araport11) |
AT1G73920 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
AT2G28360 | SIT4 phosphatase-associated family protein;(source:Araport11) |
AT2G44600 | hypothetical protein;(source:Araport11) |
AT1G11785 | transmembrane protein;(source:Araport11) |
AT4G21570 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT4G39200 | Ribosomal protein S25 family protein;(source:Araport11) |
AT2G03700 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G05870 | hypothetical protein (DUF1685);(source:Araport11) |
AT1G77200 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
AT5G49100 | vitellogenin-like protein;(source:Araport11) |
AT5G02240 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile. |
AT4G36648 | other_RNA;(source:Araport11) |
AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
AT2G29610 | pseudogene of the F-box protein family, contains Pfam profile PF00646: F-box domain |
AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G36320 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT2G36280 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT4G24750 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT2G46308 | transmembrane protein;(source:Araport11) |
AT1G15200 | protein-protein interaction regulator family protein;(source:Araport11) |
AT1G67785 | hypothetical protein;(source:Araport11) |
AT3G12970 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT3G01590 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT5G64180 | tropomyosin;(source:Araport11) |
AT1G74929 | hypothetical protein;(source:Araport11) |
AT4G24810 | similar to ABC1 family protein, contains InterPro domain ABC1 protein (InterPro:IPR004147) |
AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
AT3G15980 | Coatomer, beta subunit;(source:Araport11) |
AT4G10730 | Protein kinase superfamily protein |
AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G35500 | Protein kinase superfamily protein;(source:Araport11) |
AT1G35780 | N-lysine methyltransferase;(source:Araport11) |
AT2G25890 | Oleosin family protein;(source:Araport11) |
AT1G32410 | Vacuolar protein sorting 55 (VPS55) family protein;(source:Araport11) |
AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G27657 | hypothetical protein;(source:Araport11) |
AT2G34250 | SecY protein transport family protein;(source:Araport11) |
AT5G03204 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G56570 | SET domain-containing protein;(source:Araport11) |
AT4G38670 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT5G59140 | BTB/POZ domain-containing protein;(source:Araport11) |
AT5G13250 | RING finger protein;(source:Araport11) |
AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
AT2G37750 | hypothetical protein;(source:Araport11) |
AT5G41390 | PLAC8 family protein;(source:Araport11) |
AT5G15700 | Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast. |
AT4G18150 | Serine/Threonine-kinase, putative (DUF1296);(source:Araport11) |
AT2G32970 | G1/S-specific cyclin-E protein;(source:Araport11) |
AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
AT2G26692 | Natural antisense transcript overlaps with AT2G26690;(source:Araport11) |
AT5G63700 | zinc ion binding / DNA binding protein;(source:Araport11) |
AT5G02815 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
AT3G52230 | hypothetical protein;(source:Araport11) |
AT3G07670 | Rubisco methyltransferase family protein;(source:Araport11) |
AT3G54460 | SNF2 domain-containing protein / helicase domain-containing protein / F-box family protein;(source:Araport11) |
AT2G07000 | hypothetical protein;(source:Araport11) |
AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G61900 | hypothetical protein;(source:Araport11) |
AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G69130 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT3G06780 | glycine-rich protein;(source:Araport11) |
AT3G11773 | Thioredoxin superfamily protein;(source:Araport11) |
AT3G54470 | encodes the bi-functional orotate phosphoribosyltransferase/orotidine-5'-phosphate decarboxylase catalyzing the fifth and sixth step in the de novo pyrimidine ribonucleotide biosynthesis |
AT4G01593 | Natural antisense transcript overlaps with AT4G01595;(source:Araport11) |
AT1G18265 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT4G10080 | transmembrane protein;(source:Araport11) |
AT4G30240 | Syntaxin/t-SNARE family protein;(source:Araport11) |
AT3G28650 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
AT4G03200 | catalytics;(source:Araport11) |
AT5G22820 | ARM repeat superfamily protein;(source:Araport11) |
AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
AT5G35460 | membrane protein;(source:Araport11) |
AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G02650 | hypothetical protein;(source:Araport11) |
AT2G38090 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT1G07210 | Ribosomal protein S18;(source:Araport11) |
AT5G16210 | HEAT repeat-containing protein;(source:Araport11) |
AT4G11845 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
AT2G33280 | Major facilitator superfamily protein;(source:Araport11) |
AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G03115 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT3G03150 | hypothetical protein;(source:Araport11) |
AT1G78150 | N-lysine methyltransferase;(source:Araport11) |
AT4G12990 | transmembrane protein;(source:Araport11) |
AT1G50270 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G25964 | hypothetical protein;(source:Araport11) |
AT5G08680 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
AT3G55820 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
AT2G17845 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT5G52067 | Pseudogene of AT3G43280 |
AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
AT3G50030 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
AT2G03040 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G48830 | Ribosomal protein S7e family protein;(source:Araport11) |
AT3G11800 | Expp1 protein;(source:Araport11) |
AT5G55670 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G61826 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT5G21090 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G22520 | MICOS complex subunit Mic10-like protein (DUF543);(source:Araport11) |
AT4G25690 | stress response NST1-like protein;(source:Araport11) |
AT5G64395 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G00695 | Spc97/Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
AT4G10955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
AT3G17680 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT4G01270 | RING/U-box superfamily protein;(source:Araport11) |
AT4G19550 | zinc ion binding / transcription regulator;(source:Araport11) |
AT4G36980 | CLK4-associating serine/arginine-rich protein;(source:Araport11) |
AT2G17710 | Big1;(source:Araport11) |
AT5G16990 | molecular function has not been defined, was shown involved in oxidative stress tolerance. The mRNA is cell-to-cell mobile. |
AT5G19130 | GPI transamidase component family protein / Gaa1-like family protein;(source:Araport11) |
AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G54400 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G31590 | hypothetical protein;(source:Araport11) |
AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT1G64050 | hypothetical protein;(source:Araport11) |
AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G46630 | DCL protein (DUF3223);(source:Araport11) |
AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
AT1G10590 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
AT1G18770 | RING/U-box superfamily protein;(source:Araport11) |
AT1G09176 | transmembrane protein;(source:Araport11) |
AT5G62350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G52855 | hypothetical protein;(source:Araport11) |
AT1G72020 | TonB-dependent heme receptor A;(source:Araport11) |
AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
AT1G34620 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.5e-75 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G37650 | GRAS family transcription factor;(source:Araport11) |
AT1G15825 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G43400 | plant/protein;(source:Araport11) |
AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G59050 | G patch domain protein;(source:Araport11) |
AT1G51200 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT1G02210 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT1G19720 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT2G21180 | transmembrane protein;(source:Araport11) |
AT1G03290 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
AT5G63340 | hypothetical protein;(source:Araport11) |
AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
AT3G62970 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT4G36960 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G01422 | other_RNA;(source:Araport11) |
AT4G38330 | hemolysin-III integral membrane-like protein;(source:Araport11) |
AT5G48540 | receptor-like protein kinase-related family protein;(source:Araport11) |
AT3G56880 | VQ motif-containing protein;(source:Araport11) |
AT5G45310 | coiled-coil protein;(source:Araport11) |
AT1G15165 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT3G01513 | hypothetical protein;(source:Araport11) |
AT4G01023 | RING/U-box superfamily protein;(source:Araport11) |
AT2G21960 | transmembrane protein;(source:Araport11) |
AT3G12510 | MADS-box family protein;(source:Araport11) |
AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G62450 | DNA mismatch repair protein;(source:Araport11) |
AT1G09520 | hypothetical protein;(source:Araport11) |
AT4G17560 | Ribosomal protein L19 family protein;(source:Araport11) |
AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
AT4G30975 | None;(source:Araport11) |
AT3G51478 | pseudogene of glutamate receptor family |
AT1G19410 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT1G76954 | Encodes a defensin-like (DEFL) family protein. |
AT3G24830 | Ribosomal protein L13 family protein;(source:Araport11) |
AT5G66600 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT5G61830 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G14878 | other_RNA;(source:Araport11) |
AT5G41050 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G63390 | O-fucosyltransferase family protein;(source:Araport11) |
AT2G21430 | Papain family cysteine protease;(source:Araport11) |
AT2G46550 | transmembrane protein;(source:Araport11) |
AT1G02350 | protoporphyrinogen oxidase-like protein;(source:Araport11) |
AT1G27200 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein;(source:Araport11) |
AT1G73390 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT2G07070 | transposable_element_gene;(source:Araport11) |
AT2G23120 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
AT3G10250 | histidine-tRNA ligase;(source:Araport11) |
AT5G11640 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G21950 | transmembrane protein;(source:Araport11) |
AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
AT4G15590 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-50 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G23070 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT2G22590 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G35750 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
AT4G21520 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G05795 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT4G16190 | Papain family cysteine protease;(source:Araport11) |
AT3G11120 | Ribosomal protein L41 family;(source:Araport11) |
AT4G02110 | transcription coactivator;(source:Araport11) |
AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G02960 | Ribosomal protein S12/S23 family protein;(source:Araport11) |
AT5G55640 | Na-translocating NADH-quinone reductase subunit A;(source:Araport11) |
AT1G04320 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G55675 | transmembrane protein;(source:Araport11) |
AT5G25240 | stress induced protein;(source:Araport11) |
AT3G13404 | hypothetical protein;(source:Araport11) |
AT1G27100 | Actin cross-linking protein;(source:Araport11) |
AT5G65100 | Ethylene insensitive 3 family protein;(source:Araport11) |
AT5G50361 | hypothetical protein;(source:Araport11) |
AT5G44290 | Protein kinase superfamily protein;(source:Araport11) |
AT5G59732 | Natural antisense transcript overlaps with AT5G59730. The RNA is cell-to-cell mobile. |
AT3G51130 | transmembrane protein;(source:Araport11) |
AT1G69000 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT3G53611 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G17000 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT4G01865 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G14595 | Ribosomal protein L18ae family;(source:Araport11) |
AT3G02460 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G08230 | glycine-rich protein;(source:Araport11) |
AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
AT1G28400 | GATA zinc finger protein;(source:Araport11) |
AT4G16550 | HSP20-like chaperone, expression is induced by stress. |
AT4G01590 | DNA-directed RNA polymerase III subunit;(source:Araport11) |
AT1G43600 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G07070 | Ribosomal protein L35Ae family protein;(source:Araport11) |
AT3G61870 | plant/protein;(source:Araport11) |
AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
AT5G60400 | hypothetical protein;(source:Araport11) |
AT3G58760 | Integrin-linked protein kinase family;(source:Araport11) |
AT1G79520 | Cation efflux family protein;(source:Araport11) |
AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G62710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G09520 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G67365 | Natural antisense transcript overlaps with AT1G67370;(source:Araport11) |
AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT3G56270 | WEB family protein (DUF827);(source:Araport11) |
AT4G14310 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G60350 | hypothetical protein;(source:Araport11) |
AT3G53390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G29630 | 5-3 exonuclease family protein;(source:Araport11) |
AT3G11590 | golgin family A protein;(source:Araport11) |
AT3G52105 | DIS3-exonuclease-like protein;(source:Araport11) |
AT5G51900 | Cytochrome P450 family protein;(source:Araport11) |
AT1G74830 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
AT3G53830 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT2G07010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.9e-175 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G01740 | Mitochondrial ribosomal protein L37;(source:Araport11) |
AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G08890 | hypothetical protein (Protein of unknown function, DUF538);(source:Araport11) |
AT1G49832 | None;(source:Araport11) |
AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
AT2G17972 | transmembrane protein;(source:Araport11) |
AT1G64385 | transmembrane protein;(source:Araport11) |
AT2G20835 | hypothetical protein;(source:Araport11) |
AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G10946 | hypothetical protein;(source:Araport11) |
AT2G37880 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT1G21780 | BTB/POZ domain-containing protein. Contains similarity to gb:AJ000644 SPOP (speckle-type POZ protein) from Homo sapiens and contains a PF:00651 BTB/POZ domain. ESTs gb:T75841, gb:R89974, gb:R30221, gb:N96386, gb:T76457, gb:AI100013 and gb:T76456 come from this gene;supported by full-length. Interacts with CUL3A and CUL3B. |
AT1G50575 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT1G46554 | other_RNA;(source:Araport11) |
AT1G50290 | hypothetical protein;(source:Araport11) |
AT5G67455 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT4G17760 | PCNA domain-containing protein;(source:Araport11) |
AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT5G39535 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G16560 | HSP20-like chaperone;(source:Araport11) |
AT5G05800 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT3G51470 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G80800 | pseudogene of Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT3G04040 | transmembrane protein;(source:Araport11) |
AT3G52072 | Natural antisense transcript overlaps with AT3G52070;(source:Araport11) |
AT3G06680 | Ribosomal L29e protein family;(source:Araport11) |
AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G03160 | B-cell receptor-associated-like protein;(source:Araport11) |
AT5G51160 | Ankyrin repeat family protein;(source:Araport11) |
AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT1G13650 | hypothetical protein;(source:Araport11) |
AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
AT2G15800 | transposable_element_gene;(source:Araport11) |
AT1G70500 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G08320 | E2F-associated phosphoprotein;(source:Araport11) |
AT5G52550 | stress response NST1-like protein;(source:Araport11) |
AT1G18310 | glycosyl hydrolase family 81 protein;(source:Araport11) |
AT1G64130 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G35940 | hypothetical protein;(source:Araport11) |
AT5G54855 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT4G22360 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
AT5G22608 | hypothetical protein;(source:Araport11) |
AT1G73050 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT3G62650 | hypothetical protein;(source:Araport11) |
AT1G02813 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
AT1G18773 | acyl thioesterase-like protein;(source:Araport11) |
AT4G18720 | Transcription factor IIS protein;(source:Araport11) |
AT3G23085 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-91 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G49140 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G02360 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT5G61530 | small G protein family protein / RhoGAP family protein;(source:Araport11) |
AT4G35510 | PHD finger-like protein;(source:Araport11) |
AT5G19890 | Peroxidase superfamily protein;(source:Araport11) |
AT3G23080 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G38000 | chaperone protein dnaJ-like protein;(source:Araport11) |
AT1G28590 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G54940 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G02090 | hypothetical protein;(source:Araport11) |
AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G23460 | hypothetical protein;(source:Araport11) |
AT5G59970 | Histone superfamily protein;(source:Araport11) |
AT5G45590 | Ribosomal protein L35;(source:Araport11) |
AT3G62000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G22440 | non-LTR retroelement reverse transcriptase;(source:Araport11) |
AT1G74580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G67390 | glycosyltransferase-like protein;(source:Araport11) |
AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT5G35170 | adenylate kinase family protein;(source:Araport11) |
AT4G34360 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G15430 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT5G52280 | Myosin heavy chain-related protein;(source:Araport11) |
AT1G22403 | other_RNA;(source:Araport11) |
AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
AT4G40011 | hypothetical protein;(source:Araport11) |
AT5G41770 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
AT2G31990 | Exostosin family protein;(source:Araport11) |
AT4G36170 | hypothetical protein;(source:Araport11) |
AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
AT5G56190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
AT4G22960 | FAM63A-like protein (DUF544);(source:Araport11) |
AT4G33666 | hypothetical protein;(source:Araport11) |
AT5G13760 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT5G25510 | Protein phosphatase 2A regulatory B subunit family protein;(source:Araport11) |
AT1G16515 | transmembrane protein;(source:Araport11) |
AT1G53400 | Ubiquitin domain-containing protein;(source:Araport11) |
AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G52220 | leukocyte immunoglobulin-like receptor family A protein;(source:Araport11) |
AT3G58540 | hypothetical protein;(source:Araport11) |
AT4G17280 | Auxin-responsive family protein;(source:Araport11) |
AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
AT1G80610 | hypothetical protein;(source:Araport11) |
AT5G55960 | transmembrane protein C9orf5 protein;(source:Araport11) |
AT4G30970 | hypothetical protein;(source:Araport11) |
AT5G16060 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
AT3G47680 | DNA binding protein;(source:Araport11) |
AT1G74790 | catalytics;(source:Araport11) |
AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
AT5G05790 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT4G37445 | calcium ion-binding protein;(source:Araport11) |
AT3G55570 | cytoplasmic tRNA 2-thiolation protein;(source:Araport11) |
AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G19150 | AT5G19150 is a dehydratase that converts (S)-NAD(P)HX to NAD(P)H. |
AT2G46620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G10150 | Carbohydrate-binding protein;(source:Araport11) |
AT5G09580 | heat shock protein;(source:Araport11) |
AT4G32020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT4G21170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G16790 | ribosomal protein-like protein;(source:Araport11) |
AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT5G48657 | defense protein-like protein;(source:Araport11) |
AT3G26440 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT5G24880 | chromo domain cec-like protein;(source:Araport11) |
AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
AT3G28695 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G28703 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G39870 | hypothetical protein;(source:Araport11) |
AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
AT5G59480 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G64850 | sorbin/SH3 domain protein;(source:Araport11) |
AT4G24100 | Protein kinase superfamily protein |
AT2G36580 | Pyruvate kinase family protein;(source:Araport11) |
AT3G15450 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT4G27654 | transmembrane protein;(source:Araport11) |
AT3G63020 | hypothetical protein (DUF3049);(source:Araport11) |
AT4G23620 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G22930 | enabled-like protein (DUF1635);(source:Araport11) |
AT3G13403 | Encodes a defensin-like (DEFL) family protein. |
AT5G65380 | MATE efflux family protein;(source:Araport11) |
AT3G49796 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G74570 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT5G13100 | Gap junction beta-4 protein;(source:Araport11) |
AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT4G21926 | hypothetical protein;(source:Araport11) |
AT1G70590 | F-box family protein;(source:Araport11) |
AT5G01200 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT4G33945 | ARM repeat superfamily protein;(source:Araport11) |
AT3G48140 | B12D protein;(source:Araport11) |
AT3G05937 | hypothetical protein;(source:Araport11) |
AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
AT1G67300 | Major facilitator superfamily protein;(source:Araport11) |
AT5G54410 | hypothetical protein;(source:Araport11) |
AT3G25400 | dCTP pyrophosphatase-like protein;(source:Araport11) |
AT5G61090 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G47020 | MraZ;(source:Araport11) |
AT4G05053 | pseudogene of ATRCY1 (arginine-rich cyclin) |
AT3G06760 | Drought-responsive family protein;(source:Araport11) |
AT2G46580 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
AT5G27035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.6e-16 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT4G21437 | unknown pseudogene |
AT4G31310 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT1G64430 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G52155 | transmembrane protein;(source:Araport11) |
AT1G28395 | hypothetical protein;(source:Araport11) |
AT3G12640 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G01600 | GRAM domain family protein;(source:Araport11) |
AT3G54366 | Unknown gene The mRNA is cell-to-cell mobile. |
AT2G21720 | ArgH (DUF639);(source:Araport11) |
AT1G15730 | Cobalamin biosynthesis CobW-like protein;(source:Araport11) |
AT5G01420 | Glutaredoxin family protein;(source:Araport11) |
AT1G15170 | MATE efflux family protein;(source:Araport11) |
AT5G07590 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G24093 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT5G55840 | PPR superfamily protein;(source:Araport11) |
AT5G65290 | LMBR1-like membrane protein;(source:Araport11) |
AT1G48960 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G17705 | methionine-S-oxide reductase;(source:Araport11) |
AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
AT5G48270 | DUF868 family protein (DUF868);(source:Araport11) |
AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT5G16220 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G51430 | cTAGE family protein;(source:Araport11) |
AT5G51150 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
AT3G60540 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
AT2G45500 | AAA-type ATPase family protein;(source:Araport11) |
AT2G26520 | transmembrane protein;(source:Araport11) |
AT1G03280 | Transcription factor TFIIE, alpha subunit;(source:Araport11) |
AT5G41060 | DHHC-type zinc finger family protein;(source:Araport11) |
AT4G04692 | pseudogene of expressed protein;(source:Araport11) |
AT1G35513 | pseudogene of isochorismate synthase-related / isochorismate mutase-related |
AT1G77765 | transmembrane protein;(source:Araport11) |
AT4G01040 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G03610 | plant/protein (DUF789);(source:Araport11) |
AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G52347 | None;(source:Araport11) |
AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
AT5G23610 | DYAD protein;(source:Araport11) |
AT1G78260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G12470 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G52415 | pseudogene of TRAF-like family protein;(source:Araport11) |
AT3G60200 | hypothetical protein;(source:Araport11) |
AT2G21237 | transmembrane protein;(source:Araport11) |
AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
AT5G15940 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G55680 | glycine-rich protein;(source:Araport11) |
AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G64880 | transmembrane protein;(source:Araport11) |
AT5G16700 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G24640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G61829 | transmembrane protein;(source:Araport11) |
AT1G33230 | TMPIT-like protein;(source:Araport11) |
AT4G16563 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
AT2G44970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G25482 | Encodes a ECA1 gametogenesis related family protein |
AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G15290 | 3-hydroxyacyl-CoA dehydrogenase family protein;(source:Araport11) |
AT4G22350 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
AT2G45030 | Translation elongation factor EFG/EF2 protein;(source:Araport11) |
AT5G43000 | hypothetical protein;(source:Araport11) |
AT1G01710 | acyl-CoA thioesterase II;(source:Araport11) |
AT5G05435 | Natural antisense transcript overlaps with AT5G05430;(source:Araport11) |
AT3G10915 | Reticulon family protein;(source:Araport11) |
AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G14910 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G27850 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT1G48953 | hypothetical protein;(source:Araport11) |
AT5G63135 | transcription termination factor;(source:Araport11) |
AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G42740 | Sugar isomerase (SIS) family protein;(source:Araport11) |
AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G78170 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
AT3G05936 | hypothetical protein;(source:Araport11) |
AT1G73400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT5G10740 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G69485 | Ribosomal L32p protein family;(source:Araport11) |
AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
AT5G07260 | START (StAR-related lipid-transfer) lipid-binding domain-containing protein;(source:Araport11) |
AT3G57450 | hypothetical protein;(source:Araport11) |
AT2G45023 | other_RNA;(source:Araport11) |
AT5G43770 | proline-rich family protein;(source:Araport11) |
AT1G20890 | caveolin-1 protein;(source:Araport11) |
AT1G68580 | Agenet and bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
AT2G19796 | other_RNA;(source:Araport11) |
AT2G21980 | HAUS augmin-like complex subunit;(source:Araport11) |
AT2G46995 | hypothetical protein;(source:Araport11) |
AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
AT1G18610 | Galactose oxidase/kelch repeat superfamily protein, induced by calcium. |
AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
AT5G01850 | Protein kinase superfamily protein;(source:Araport11) |
AT1G13730 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT3G22670 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G80290 | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
AT4G39150 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT1G28327 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT1G79529 | Natural antisense transcript overlaps with AT1G79530;(source:Araport11) |
AT5G58570 | transmembrane protein;(source:Araport11) |
AT2G27180 | hypothetical protein;(source:Araport11) |
AT5G01595 | Natural antisense transcript overlaps with AT5G01600;(source:Araport11) |
AT5G01800 | saposin B domain-containing protein;(source:Araport11) |
AT3G10980 | PLAC8 family protein;(source:Araport11) |
AT3G60910 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G27752 | Ubiquitin system component Cue protein;(source:Araport11) |
AT2G04110 | pseudogene of expressed protein;(source:Araport11) |
AT4G02540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G23670 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G28105 | replication factor-A carboxy-terminal domain protein;(source:Araport11) |
AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G06437 | pseudogene of hypothetical protein;(source:Araport11) |
AT2G46560 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT4G11350 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G49440 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.6e-05 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT4G26450 | hypothetical protein;(source:Araport11) |
AT2G38610 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT2G16270 | transmembrane protein;(source:Araport11) |
AT3G54000 | TIP41-like protein;(source:Araport11) |
AT1G20030 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT1G10650 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT5G47620 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G37010 | rho GTPase-activating protein;(source:Araport11) |
AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11) |
AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
AT4G00905 | NC domain-containing protein-like protein;(source:Araport11) |
AT3G18050 | GPI-anchored protein;(source:Araport11) |
AT4G34630 | prostatic spermine-binding-like protein;(source:Araport11) |
AT5G05200 | Protein kinase superfamily protein;(source:Araport11) |
AT5G02860 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT5G44020 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT1G16740 | Ribosomal protein L20;(source:Araport11) |
AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
AT4G34500 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57220 | Glycosyl transferase family 4 protein;(source:Araport11) |
AT3G24929 | hypothetical protein;(source:Araport11) |
AT4G13245 | snoRNA;(source:Araport11) |
AT1G49680 | mutator transposase MUDRA protein;(source:Araport11) |
AT3G05905 | Natural antisense transcript overlaps with AT3G05900;(source:Araport11) |
AT3G04250 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G55160 | WAS/WASL-interacting family protein;(source:Araport11) |
AT1G30320 | Remorin family protein;(source:Araport11) |
AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G01030 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein;(source:Araport11) |
AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
AT2G18240 | Rer1 family protein;(source:Araport11) |
AT5G48655 | RING/U-box superfamily protein;(source:Araport11) |
AT3G15350 | G14 enzyme |
AT2G38660 | Amino acid dehydrogenase family protein;(source:Araport11) |
AT3G27680 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G45640 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT2G44920 | Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. Unlike other PRPs, At2g44920 consists exclusively of type II b-turns |
AT1G78915 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G47550 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT4G24090 | homer protein;(source:Araport11) |
AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
AT5G48610 | myb-like protein X;(source:Araport11) |
AT5G08670 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G55856 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G62130 | Per1-like family protein;(source:Araport11) |
AT2G35970 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT2G25970 | KH domain-containing protein;(source:Araport11) |
AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT2G31940 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
AT2G37930 | hypothetical protein (DUF3527);(source:Araport11) |
AT4G30500 | transmembrane protein (DUF788);(source:Araport11) |
AT5G60430 | antiporter/ drug transporter;(source:Araport11) |
AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G10750 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
AT1G79260 | nitrobindin heme-binding domain protein;(source:Araport11) |
AT3G62430 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT3G50840 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G56100 | glycine-rich protein / oleosin;(source:Araport11) |
AT4G28290 | hypothetical protein;(source:Araport11) |
AT5G23470 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G15350 | DUF4050 family protein;(source:Araport11) |
AT5G45490 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G01730 | Mutants exhibit shorter root hairs under phosphate-deficient conditions. |
AT4G05060 | PapD-like superfamily protein;(source:Araport11) |
AT5G58610 | PHD finger transcription factor;(source:Araport11) |
AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G29075 | glycine-rich protein;(source:Araport11) |
AT3G08740 | elongation factor P (EF-P) family protein;(source:Araport11) |
AT1G70209 | hypothetical protein;(source:Araport11) |
AT5G25990 | core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G12000 | SNARE associated Golgi protein family;(source:Araport11) |
AT5G66564 | snoRNA;(source:Araport11) |
AT2G22200 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT1G22930 | T-complex protein 11;(source:Araport11) |
AT2G16610 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 6.1e-89 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT1G76660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G35345 | hypothetical protein;(source:Araport11) |
AT2G15950 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G47565 | transposable_element_gene;(source:Araport11);retrotransposon gag protein, contains Pfam:PF03732 Retrotransposon gag protein;(source:TAIR10) |
AT4G01870 | tolB protein-like protein;(source:Araport11) |
AT1G70949 | hypothetical protein;(source:Araport11) |
AT3G53470 | 2,3-bisphosphoglycerate-independent phosphoglycerate mutase;(source:Araport11) |
AT1G63420 | O-glucosyltransferase-like protein (DUF821);(source:Araport11) |
AT4G39838 | Natural antisense transcript overlaps with AT4G39840;(source:Araport11) |
AT3G53640 | Protein kinase superfamily protein;(source:Araport11) |
AT3G15520 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G50000 | methyltransferase;(source:Araport11) |
AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT2G22790 | hypothetical protein;(source:Araport11) |
AT5G49435 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT5G19190 | hypothetical protein;(source:Araport11) |
AT5G61820 | stress up-regulated Nod 19 protein;(source:Araport11) |
AT4G03030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G04830 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G26200 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT4G27870 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
AT4G00305 | RING/U-box superfamily protein;(source:Araport11) |
AT4G30780 | ATP-dependent DNA helicase;(source:Araport11) |
AT3G26430 | Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters. |
AT5G26270 | transmembrane protein;(source:Araport11) |
AT1G06630 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G42970 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
AT2G20830 | folic acid binding / transferase;(source:Araport11) |
AT5G57910 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G46450 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
AT5G17165 | hypothetical protein;(source:Araport11) |
AT4G00840 | DHHC-type zinc finger family protein;(source:Araport11) |
AT4G25707 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G52590 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
AT5G17930 | MIF4G domain-containing protein / MA3 domain-containing protein;(source:Araport11) |
AT3G06435 | Expressed protein;(source:Araport11) |
AT3G12010 | C18orf8;(source:Araport11) |
AT2G45990 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
AT3G63510 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT5G61450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G78995 | hypothetical protein;(source:Araport11) |
AT1G55680 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G23050 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G45638 | other_RNA;(source:Araport11) |
AT4G38290 | hemolysin-III related integral membrane protein;(source:Araport11) |
AT2G35250 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT5G03285 | other_RNA;(source:Araport11) |
AT2G21130 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT2G18876 | Encodes a microtubule-associated protein. |
AT1G16620 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.7e-158 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G48840 | Plant protein of unknown function (DUF639);(source:TAIR10) |
AT1G61740 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT3G29310 | calmodulin-binding protein-like protein;(source:Araport11) |
AT4G34310 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G59500 | Integral membrane HRF1 family protein;(source:Araport11) |
AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G13660 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT2G15960 | Unknown protein. Expression decreased in response to proline. |
AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT4G02005 | None;(source:Araport11) |
AT2G02370 | SNARE associated Golgi protein family;(source:Araport11) |
AT5G05210 | Surfeit locus protein 6;(source:Araport11) |
AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
AT2G44670 | senescence-associated family protein (DUF581);(source:Araport11) |
AT3G27330 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT4G38280 | integral membrane hemolysin-III-like protein;(source:Araport11) |
AT5G66580 | PADRE protein. |
AT5G03250 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G17760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G47295 | hypothetical protein;(source:Araport11) |
AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
AT4G14315 | transmembrane protein;(source:Araport11) |
AT2G04340 | cytoplasmic dynein 2 light intermediate chain;(source:Araport11) |
AT2G26355 | Natural antisense transcript overlaps with AT2G26360. The RNA is cell-to-cell mobile. |
AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
AT1G64255 | MuDR family transposase;(source:Araport11) |
AT5G01610 | hypothetical protein (Protein of unknown function, DUF538);(source:Araport11) |
AT5G49555 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
AT4G01960 | transmembrane protein;(source:Araport11) |
AT2G46320 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G61780 | postsynaptic protein-like protein;(source:Araport11) |
AT2G42975 | myosin-G heavy chain-like protein;(source:Araport11) |
AT3G52110 | interferon-activable protein;(source:Araport11) |
AT5G54950 | Aconitase family protein;(source:Araport11) |
AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G22795 | hypothetical protein;(source:Araport11) |
AT2G45600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G08885 | pseudogene of ferretin 1;(source:Araport11) |
AT1G79640 | Protein kinase superfamily protein;(source:Araport11) |
AT4G39930 | hypothetical protein;(source:Araport11) |
AT2G23960 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT1G05350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G38820 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
AT3G59780 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT2G35470 | ribosome maturation factor;(source:Araport11) |
AT5G61445 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT2G25690 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT1G49690 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
AT5G41400 | RING/U-box superfamily protein;(source:Araport11) |
AT3G19035 | transmembrane protein;(source:Araport11) |
AT3G59490 | hypothetical protein;(source:Araport11) |
AT5G05430 | RNA-binding protein;(source:Araport11) |
AT5G13980 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT3G48240 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G10740 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G65120 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT2G22426 | hypothetical protein;(source:Araport11) |
AT5G49440 | hypothetical protein;(source:Araport11) |
AT3G15280 | hypothetical protein;(source:Araport11) |
AT5G28262 | other_RNA;(source:Araport11) |
AT5G63380 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At5g63380 preferentially activates fatty acids with increased chain length (C9:0 to C8:0) and thus shares characteristics with long-chain fatty acyl-CoA synthases. Also able to catalyze the conversion of OPDA to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
AT5G54970 | hypothetical protein;(source:Araport11) |
AT4G32920 | glycine-rich protein;(source:Araport11) |
AT5G02430 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
AT1G14010 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT2G22482 | other_RNA;(source:Araport11) |
AT4G21930 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G45230 | DCL protein (DUF3223);(source:Araport11) |
AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
AT4G13530 | transmembrane protein;(source:Araport11) |
AT3G47080 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G71350 | eukaryotic translation initiation factor SUI1 family protein;(source:Araport11) |
AT2G31981 | hypothetical protein;(source:Araport11) |
AT3G24927 | pseudogene of expressed protein;(source:Araport11) |
AT1G56165 | Natural antisense transcript overlaps with AT1G56160;(source:Araport11) |
AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
AT3G53170 | LOW protein: PPR containing protein;(source:Araport11) |
AT5G67220 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT3G27886 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 22%25 identity and 3.3e-08 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
AT1G49830 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G18850 | SET domain-containing protein;(source:Araport11) |
AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
AT4G25580 | CAP160 protein;(source:Araport11) |
AT1G49640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G61800 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G03290 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT5G15110 | Pectate lyase family protein;(source:Araport11) |
AT1G01840 | AP2-like ethylene-responsive transcription factor SNZ;(source:Araport11) |
AT1G76450 | Photosystem II reaction center PsbP family protein;(source:Araport11) |
AT5G67488 | Natural antisense transcript overlaps with AT5G67490;(source:Araport11) |
AT3G10415 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT5G19760 | Encodes a novel mitochondrial carrier capable of transporting both dicarboxylates (such as malate, oxaloacetate, oxoglutarate, and maleate) and tricarboxylates (such as citrate, isocitrate, cis-aconitate, and trans-aconitate). |
AT5G02350 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G17545 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G23680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT1G55525 | other_RNA;(source:Araport11) |
AT5G11700 | ephrin type-B receptor;(source:Araport11) |
AT1G78040 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT4G31408 | None;(source:Araport11) |
AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
AT1G73175 | This is described as a LINE; it is present at this location in 83 natural accessions of Arabidopsis, including Col-0, but it is not present in 13 natural accessions including Cvi-0. This locus is normally methylated in wild type Col plants. BONSAI (At1g73177), an adjacent gene, can become hypermethylated in a ddm1 (At5g66750) mutant, and this seems to depends on the presence of the LINE. But, transcript levels of the gene on the other side of the LINE (At1g73170) do not drop in ddm1 mutant plants. |
AT4G17765 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT1G43590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G34838.1);(source:TAIR10) |
AT1G77250 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
AT4G01595 | Protein kinase superfamily protein;(source:Araport11) |
AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
AT3G21770 | Peroxidase superfamily protein;(source:Araport11) |
AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
AT3G54363 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G03113 | transmembrane protein;(source:Araport11) |
AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G58340 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
AT1G69252 | other_RNA;(source:Araport11) |
AT1G55340 | hypothetical protein (DUF1639);(source:Araport11) |
AT1G49580 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT3G49800 | BSD domain-containing protein;(source:Araport11) |
AT4G33540 | metallo-beta-lactamase family protein;(source:Araport11) |
AT2G33690 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
AT4G14810 | hypothetical protein;(source:Araport11) |
AT1G07480 | Transcription factor IIA, alpha/beta subunit;(source:Araport11) |
AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G43401 | Encodes a defensin-like (DEFL) family protein. |
AT1G70280 | NHL domain-containing protein;(source:Araport11) |
AT4G38300 | glycosyl hydrolase family 10 protein;(source:Araport11) |
AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
AT1G21790 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT5G49152 | Natural antisense transcript overlaps with AT5G49150;(source:Araport11) |
AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
AT2G37160 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G65050 | TRAF-like superfamily protein;(source:Araport11) |
AT1G68185 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G55535 | transmembrane protein;(source:Araport11) |
AT5G66567 | snoRNA;(source:Araport11) |
AT5G14500 | aldose 1-epimerase family protein;(source:Araport11) |
AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT4G36370 | hypothetical protein;(source:Araport11) |
AT2G19180 | hypothetical protein;(source:Araport11) |
AT1G23052 | other_RNA;(source:Araport11) |
AT3G60310 | acyl-CoA synthetase family protein;(source:Araport11) |
AT2G24420 | DNA repair ATPase-like protein;(source:Araport11) |
AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G03170 | hypothetical protein;(source:Araport11) |
AT3G12835 | hypothetical protein;(source:Araport11) |
AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
AT4G01330 | Protein kinase superfamily protein;(source:Araport11) |
AT5G01870 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT3G50825 | snoRNA;(source:Araport11) |
AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
AT1G22200 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT5G03360 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
AT5G20060 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G24410 | SMAD/FHA domain protein;(source:Araport11) |
AT5G66050 | Wound-responsive family protein;(source:Araport11) |
AT4G32290 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT4G12005 | hypothetical protein;(source:Araport11) |
AT1G80450 | VQ motif-containing protein;(source:Araport11) |
AT3G11415 | other_RNA;(source:Araport11) |
AT1G68300 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT5G57760 | hypothetical protein;(source:Araport11) |
AT5G66053 | hypothetical protein;(source:Araport11) |
AT2G01667 | hypothetical protein;(source:Araport11) |
AT2G31130 | hypothetical protein;(source:Araport11) |
AT3G55795 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT4G28990 | RNA-binding protein-like protein;(source:Araport11) |
AT5G56544 | pseudogene of arginyl-tRNA synthetase |
AT2G20250 | hypothetical protein;(source:Araport11) |
AT1G62050 | Ankyrin repeat family protein;(source:Araport11) |
AT3G05425 | hypothetical protein;(source:Araport11) |
AT5G64910 | Serine/Threonine-kinase;(source:Araport11) |
AT1G32920 | hypothetical protein;(source:Araport11) |
AT2G40480 | WEB family protein (DUF827);(source:Araport11) |
AT3G03341 | cold-regulated protein;(source:Araport11) |
AT4G15120 | VQ motif-containing protein;(source:Araport11) |
AT1G15830 | hypothetical protein;(source:Araport11) |
AT2G21187 | Natural antisense transcript overlaps with AT2G21185;(source:Araport11) |
AT2G40860 | protein kinase family protein / protein phosphatase 2C ( PP2C) family protein;(source:Araport11) |
AT2G43320 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G79060 | TPRXL;(source:Araport11) |
AT2G11880 | None;(source:Araport11) |
AT5G35180 | ENHANCED DISEASE RESISTANCE protein (DUF1336);(source:Araport11) |
AT5G66860 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
AT5G52070 | Agenet domain-containing protein;(source:Araport11) |
AT1G25230 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
AT4G16510 | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein;(source:Araport11) |
AT1G36050 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT1G20970 | calponin-like domain protein;(source:Araport11) |
AT1G02228 | pseudogene of no apical meristem (NAM) family protein |
AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
AT5G02025 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT1G78172 | transmembrane protein;(source:Araport11) |
AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G06220 | LETM1-like protein;(source:Araport11) |
AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
AT5G13970 | midasin-like protein;(source:Araport11) |
AT4G24790 | AAA-type ATPase family protein;(source:Araport11) |
AT5G26990 | Drought-responsive family protein;(source:Araport11) |
AT1G13360 | hypothetical protein;(source:Araport11) |
AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
AT3G62140 | NEFA-interacting nuclear protein;(source:Araport11) |
AT5G04460 | RING/U-box superfamily protein;(source:Araport11) |
AT3G52070 | RNA/RNP complex-1-interacting phosphatase;(source:Araport11) |
AT1G15740 | Leucine-rich repeat family protein;(source:Araport11) |
AT2G26360 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
AT1G33615 | None;(source:Araport11) |
AT4G16980 | arabinogalactan-protein family;(source:Araport11) |
AT3G46387 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-41 P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
AT5G09630 | LisH/CRA/RING-U-box domains-containing protein;(source:Araport11) |
AT1G31240 | Bromodomain transcription factor;(source:Araport11) |
AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G08020 | PHD finger family protein;(source:Araport11) |
AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
AT1G53282 | Encodes a Plant thionin family protein |
AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT2G29605 | Plant protein 1589 of unknown function;(source:Araport11) |
AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
AT4G15140 | hypothetical protein;(source:Araport11) |
AT3G18760 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G15780 | transmembrane protein;(source:Araport11) |
AT3G07460 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT4G32110 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G21440 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G09220 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G09649 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
AT1G44478 | Cyclophilin;(source:Araport11) |
AT3G27040 | MATH domain/coiled-coil protein;(source:Araport11) |
AT3G58530 | RNI-like superfamily protein;(source:Araport11) |
AT1G02360 | Chitinase family protein;(source:Araport11) |
AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
AT5G66568 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT1G01355 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT1G69470 | heat shock protein-binding protein;(source:Araport11) |
AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
AT1G14300 | ARM repeat superfamily protein;(source:Araport11) |
AT3G22415 | hypothetical protein;(source:Araport11) |
AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G24780 | hypothetical protein;(source:Araport11) |
AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G66190 | hypothetical protein;(source:Araport11) |
AT5G10560 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G47490 | HNH endonuclease;(source:Araport11) |
AT5G05480 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
AT1G31030 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.0e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
AT5G05370 | Cytochrome b-c1 complex, subunit 8 protein;(source:Araport11) |
AT3G47341 | transmembrane protein;(source:Araport11) |
AT1G76170 | 2-thiocytidine tRNA biosynthesis protein, TtcA;(source:Araport11) |
AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
AT2G37480 | hypothetical protein;(source:Araport11) |
AT1G51402 | hypothetical protein;(source:Araport11) |
AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
AT3G49540 | hypothetical protein;(source:Araport11) |
AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
AT1G80850 | DNA glycosylase superfamily protein;(source:Araport11) |
AT3G49270 | extensin-like protein;(source:Araport11) |
AT1G21830 | hypothetical protein;(source:Araport11) |
AT3G51990 | Protein kinase superfamily protein;(source:Araport11) |
AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
AT5G43140 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT3G27390 | transmembrane protein;(source:Araport11) |
AT3G16990 | heme oxygenase-like, multi-helical;(source:Araport11) |
AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
AT5G65910 | BSD domain-containing protein;(source:Araport11) |
AT1G11380 | PLAC8 family protein;(source:Araport11) |
AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
AT1G35150 | General transcription factor 2-related zinc finger protein;(source:Araport11) |
AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
AT3G11780 | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein;(source:Araport11) |
AT1G21770 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G55152 | hypothetical protein;(source:Araport11) |
AT4G28440 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G36290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G16765 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT3G61420 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G22510 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G71970 | hypothetical protein;(source:Araport11) |
AT3G02315 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT4G07408 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G68490 | translocase subunit seca;(source:Araport11) |
AT3G15420 | Transcription factor TFIIIC, tau55-related protein;(source:Araport11) |
AT5G27410 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein; FUNCTIONS IN: catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Aminotransferase, class IV (InterPro:IPR001544); BEST Arabidopsis thaliana protein match is: D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein (TAIR:AT3G05190.1). Note that the At5g27410.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. |
AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
AT1G78210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G12570 | Ortholog of maize IPE1 gene which is involved in pollen exine development. |
AT4G39925 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT1G75070 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT5G25520 | SPOC domain / Transcription elongation factor S-II protein;(source:Araport11) |
AT1G17450 | B-block binding subunit of TFIIIC;(source:Araport11) |
AT3G01580 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G37240 | Thioredoxin superfamily protein;(source:Araport11) |
AT3G60150 | NADH dehydrogenase ubiquinone 1 alpha subcomplex assembly factor-like protein (DUF498/DUF598);(source:Araport11) |
AT5G55410 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G21740 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
AT5G20885 | RING/U-box superfamily protein;(source:Araport11) |
AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G49900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G56085 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT5G61520 | Major facilitator superfamily protein;(source:Araport11) |
AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G56920 | DHHC-type zinc finger family protein;(source:Araport11) |
AT2G18180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G55750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G50850 | Putative methyltransferase family protein;(source:Araport11) |
AT2G39865 | transmembrane protein;(source:Araport11) |
AT5G45480 | transmembrane protein, putative (DUF594);(source:Araport11) |
AT4G16180 | transmembrane protein;(source:Araport11) |
AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
AT2G02170 | Remorin family protein;(source:Araport11) |
AT1G76440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT5G10745 | transmembrane protein;(source:Araport11) |
AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
AT2G23985 | hypothetical protein;(source:Araport11) |
AT4G05018 | transmembrane protein;(source:Araport11) |
AT1G01240 | transmembrane protein;(source:Araport11) |
AT1G15330 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
AT1G20100 | DNA ligase-like protein;(source:Araport11) |
AT1G04570 | Similar to plastid solute transporters. |
AT1G52600 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT1G18550 | ATP binding microtubule motor family protein;(source:Araport11) |
AT1G26920 | zinc finger CCHC domain protein;(source:Araport11) |
AT5G10070 | RNase L inhibitor protein-like protein;(source:Araport11) |
AT1G17390 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
AT4G39195 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT3G05625 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G23690 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT4G31410 | E3 ubiquitin-protein ligase, putative (DUF1644);(source:Araport11) |
AT2G23690 | PADRE protein. |
AT2G19582 | Natural antisense transcript overlaps with AT2G19580;(source:Araport11) |
AT2G30945 | None;(source:Araport11) |
AT5G02370 | ATP binding microtubule motor family protein;(source:Araport11) |
AT4G29970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G31760 | peroxidase superfamily protein;(source:Araport11) |
AT2G21780 | hypothetical protein;(source:Araport11) |
AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
AT5G39530 | hypothetical protein (DUF1997);(source:Araport11) |
AT3G17780 | B-cell receptor-associated-like protein;(source:Araport11) |
AT3G08680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G46020 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G25950 | PITH domain protein (DUF1000);(source:Araport11) |
AT3G13650 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT3G47160 | RING/U-box superfamily protein;(source:Araport11) |
AT1G04540 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G22241 | hypothetical protein;(source:Araport11) |
AT1G14345 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT3G08930 | LMBR1-like membrane protein;(source:Araport11) |
AT2G27500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G09620 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT3G55790 | transmembrane protein;(source:Araport11) |
AT2G37870 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G16745 | Exostosin family protein;(source:Araport11) |
AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G67792 | Natural antisense transcript overlaps with AT1G67790;(source:Araport11) |
AT1G23750 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT1G50580 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
AT1G18560 | BED zinc finger and hAT dimerization domain-containing protein;(source:Araport11) |
AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G33180 | hypothetical protein;(source:Araport11) |
AT1G71080 | RNA polymerase II transcription elongation factor;(source:Araport11) |
AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
AT3G26450 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G02816 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
AT3G11560 | LETM1-like protein;(source:Araport11) |
AT5G15710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G56260 | hypothetical protein;(source:Araport11) |
AT2G45315 | Natural antisense transcript overlaps with AT2G45310;(source:Araport11) |
AT5G14370 | CCT motif family protein;(source:Araport11) |
AT3G52100 | RING/FYVE/PHD zinc finger-containing protein. Part of emdomembrane trafficking system. |
AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
AT1G58110 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT2G31585 | other_RNA;(source:Araport11) |
AT3G02010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G47580 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G25920 | hypothetical protein;(source:Araport11) |
AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
AT3G08570 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G27350 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
AT3G48800 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT3G24612 | snoRNA;(source:Araport11) |
AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
AT5G44255 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-09 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT5G49015 | Expressed protein;(source:Araport11) |
AT5G62830 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G19440 | Pseudouridine synthase family protein;(source:Araport11) |
AT3G20820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G28660 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G24614 | Encodes a Z4 snoRNA. Gb: AJ240073 |
AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G03620 | MATE efflux family protein;(source:Araport11) |
AT1G20070 | hypothetical protein;(source:Araport11) |
AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G53670 | hypothetical protein;(source:Araport11) |
AT3G57062 | transmembrane protein;(source:Araport11) |
AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
AT2G21895 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT5G38300 | homeobox Hox-B3-like protein;(source:Araport11) |
AT1G79630 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G45253 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-48 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G19860 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT1G56220 | Dormancy/auxin associated family protein;(source:Araport11) |
AT4G29905 | hypothetical protein;(source:Araport11) |
AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
AT2G16595 | Translocon-associated protein (TRAP), alpha subunit;(source:Araport11) |
AT1G69460 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G55790 | hypothetical protein;(source:Araport11) |
AT2G46000 | LDL receptor wingless signaling/trafficking chaperone;(source:Araport11) |
AT5G66052 | transmembrane protein;(source:Araport11) |
AT1G66890 | 50S ribosomal-like protein;(source:Araport11) |
AT4G22250 | RING/U-box superfamily protein;(source:Araport11) |
AT5G48605 | Encodes a defensin-like (DEFL) family protein. |
AT4G07825 | transmembrane protein;(source:Araport11) |
AT3G56050 | Protein kinase family protein;(source:Araport11) |
AT5G01080 | Beta-galactosidase related protein;(source:Araport11) |
AT3G55780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G18820 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
AT1G67790 | sieve element occlusion protein;(source:Araport11) |
AT3G18620 | DHHC-type zinc finger family protein;(source:Araport11) |
AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT5G03460 | transmembrane protein;(source:Araport11) |
AT5G01430 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT5G53220 | hypothetical protein;(source:Araport11) |
AT5G52580 | RabGAP/TBC domain-containing protein;(source:Araport11) |
AT1G63840 | RING/U-box superfamily protein;(source:Araport11) |
AT3G19340 | aminopeptidase (DUF3754);(source:Araport11) |
AT4G16650 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G01820 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G07590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
AT5G56520 | hypothetical protein;(source:Araport11) |
AT5G15280 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
AT3G28700 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
AT2G27950 | Ring/U-Box superfamily protein;(source:Araport11) |
AT3G03350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
AT5G06380 | hypothetical protein;(source:Araport11) |
AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
AT1G18990 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
AT1G02700 | GATA transcription factor-like protein;(source:Araport11) |
AT3G50800 | PADRE protein. |
AT1G19500 | hypothetical protein;(source:Araport11) |
AT1G28540 | Tail-anchored (TA) OEP membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
AT1G27290 | transmembrane protein;(source:Araport11) |
AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G59670 | elongation factor;(source:Araport11) |
AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G32030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT3G50790 | esterase/lipase/thioesterase family protein;(source:Araport11) |
AT1G56290 | CwfJ-like family protein;(source:Araport11) |
AT2G33630 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G26730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G31850 | hypothetical protein;(source:Araport11) |
AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT2G21185 | transmembrane protein;(source:Araport11) |
AT5G40670 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
AT1G77682 | Encodes a Plant thionin family protein |
AT4G24805 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G12070 | hypothetical protein;(source:Araport11) |
AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT3G12730 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G42090 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT4G25570 | Encodes cytochrome b561. |
AT1G06360 | ADS4.2 has strong desaturase activity on acyl-CoA substrates longer than C32 and ω-7 product regio-specificity in yeast assays. It involves in characteristic (C33-C37) ω-7 monounsaturated alkene formation in cuticular wax of young rosette leaves. |
AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
AT5G19140 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT3G56900 | Encodes ALADIN, a component of the nuclear pore complex. |
AT2G17970 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G00370 | Encodes an inorganic phosphate transporter (PHT4;4) that can transport ascorbate and is located in the chloroplast envelope membrane. It has been shown to play a role in the xanthophyll cycle during photosynthesis and may be required for tolerance to strong light stress. |
AT2G30020 | Encodes AP2C1. Belongs to the clade B of the PP2C-superfamily. Acts as a MAPK phosphatase that negatively regulates MPK4 and MPK6. |
AT4G39210 | Encodes the large subunit of ADP-Glucose Pyrophosphorylase which catalyzes the first, rate limiting step in starch biosynthesis. The large subunit plays a regulatory role whereas the small subunit (ApS) is the catalytic isoform. Four isoforms (ApL1-4) have been identified. ApL3 is the major large subunit isoform present in inflorescences, fruits and roots. |
AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
AT5G67360 | Encodes a subtilisin-like serine protease essential for mucilage release from seed coats. |
AT1G28670 | Arabidopsis thaliana lipase |
AT5G43850 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G70490 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
AT5G64400 | CHCH domain protein;(source:Araport11) involved in mechanotransduction. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. The mRNA is cell-to-cell mobile. |
AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G51160 | TRAPP protein BET5 homolog. |
AT3G14000 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
AT2G02160 | Non- tandem CCCH zinc finger protein. |
AT3G19450 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. The mRNA is cell-to-cell mobile. |
AT4G01610 | Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture. |
AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
AT4G21180 | J domain protein localized in ER membrane. |
AT3G08970 | J domain protein localized in ER lumen. Can compensate for the growth defect in jem1 scj1 mutant yeast. Also shows similarity to HSP40 proteins and is induced by heat stress. At high temperatures, mutant alleles are not transmitted through the pollen due to defects in pollen tube growth. |
AT3G62600 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
AT5G55400 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
AT1G53165 | Protein kinase superfamily protein;(source:Araport11) |
AT3G05830 | Encodes alpha-helical IF (intermediate filament)-like protein.NEAP1 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
AT1G01230 | ORM1 is an ER localized orosomucoid-like protein involved in sphingolipid homeostasis. |
AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
AT5G59840 | Ras-related small GTP-binding family protein;(source:Araport11) |
AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
AT3G05840 | Glycogen synthase kinase-3 member which encodes a SHAGGY-like kinase involved in meristem organization. Regulates flowering through mediating CONSTANS stability. |
AT1G18320 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
AT1G19730 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
AT3G59660 | Encodes a C2-GRAM domain-containing protein that is induced by B. cinerea infection. It is required for cleavage of BAG6 and thus plays a role in mediating resistance to fungal infection. |
AT1G03040 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
AT3G12300 | Similar to Bug22p in Paramecium, a conserved centrosomal/ciliary protein. This protein is widespread in eukaryotes harboring centrioles/cilia at some stage of their life cycles. Among eukaryotes devoid of centrioles/cilia, plants possess BUG22 genes whereas some fungi (at least ascomycetes) do not. |
AT3G58120 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
AT3G57060 | Similar to mamalian condensin. Mutants have reduced fertility. |
AT5G03455 | Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance. |
AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G12130 | Encodes a mitochondrial COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
AT1G19140 | ubiquinone biosynthesis COQ9-like protein;(source:Araport11) |
AT1G56190 | One of a pair of plastid localized phosphoglycerate kinases involved in galactolipid biosynthesis. Functions redundantly with AT3g12780 (PGK1) in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal. |
AT5G18820 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
AT4G19560 | Cyclin family protein;(source:Araport11) |
AT3G07090 | Interacts with C3H59 via its WD40 domain and C-terminal region, respectively, in the nucleus. |
AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
AT4G26910 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
AT5G60390 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
AT5G66470 | GTP-binding protein Era-like protein;(source:Araport11) |
AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT1G60950 | encodes a major leaf ferredoxin |
AT1G52343 | Similar to GET2, transmembrane protein that interacts with GET1. |
AT1G29670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
AT2G27840 | Belongs to the plant specific HD2 type proteins; similar to nucleolar Zea mays histone deacetylase; HD2-p39 |
AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT2G37470 | Histone superfamily protein;(source:Araport11) |
AT3G53650 | Histone superfamily protein;(source:Araport11) |
AT1G08170 | Histone superfamily protein;(source:Araport11) |
AT1G01370 | Encodes a centromere-identifying protein histone H3 variant. Localized at centromeres in both mitotic and meiotic cells. Aurora3 phosphorylates CENH3 at S65; this post-translational modification is required for the proper development of the floral meristem. |
AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
AT1G49620 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle. |
AT4G30630 | hypothetical protein;(source:Araport11) |
AT1G15320 | seed dormancy control protein;(source:Araport11) |
AT4G22220 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
AT1G80920 | A nuclear encoded soluble protein found in the chloroplast stroma. Negatively regulated by light and has rapid turnover in darkness. |
AT1G70480 | Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast. |
AT3G08960 | Ran effector. |
AT5G15970 | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance. The mRNA is cell-to-cell mobile. |
AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
AT5G11650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G19290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G01883 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn2+ and Cu2+ tolerance. |
AT5G05100 | R3H RNA binding protein that interacts with AGO2 and miRNA. |
AT2G40970 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
AT3G11850 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT5G02130 | SSR1 encodes a tetratricopeptide repeat- containing protein localized in mitochondria. It is involved in root development, possibly by through effects on auxin transport. In ssr1 mutants, the expression PIN genes and trafficking of PIN2 is altered which in turn affects distribution of auxin in the roots. |
AT2G41930 | Protein kinase superfamily protein;(source:Araport11) |
AT1G73600 | Encodes a S-adenosyl-L-methionine-dependent phosphoethanolamine N-methyltransferase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. It catalyzes the three sequential P-base methylation of phosphoethanolamine to phosphocholine. Homologous biochemical function to NMT1 (At3g18000). Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
AT5G55850 | NOI protein |
AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G67900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT1G49670 | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
AT1G51130 | δ-kleisin component of the SMC5/6 complex, possibly involved in synaptonemal complex formation. |
AT1G05500 | Encodes a endomembrane-localized synaptotagmin. Synaptotagmin family proteins are calcium sensors that regulate exocytosis in mammalian cells. |
AT3G14590 | Ca2+-dependent lipid-binding protein |
AT3G56320 | PAP/OAS1 substrate-binding domain superfamily;(source:Araport11) |
AT1G76405 | outer envelope pore 21B-like protein;(source:Araport11) |
AT1G74930 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
AT5G40660 | Encodes an F-type ATP Synthase Assembly factor that binds to beta subunits of mitochondrial ATPase. |
AT2G35795 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G03030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT4G31300 | Encodes 20S proteasome subunit PBA1 (PBA1). PBA1 acts as a plant caspase-3-like enzyme. |
AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
AT5G12150 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
AT1G01460 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. |
AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
AT5G47400 | sphingomyelin phosphodiesterase;(source:Araport11) |
AT5G11560 | catalytics;(source:Araport11) |
AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT1G77800 | PHD finger family protein;(source:Araport11) |
AT5G46400 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile. |
AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT2G45910 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT3G05230 | Signal peptidase subunit;(source:Araport11) |
AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
AT2G44610 | Golgi-localized small GTPase, participates in the trafficking of CESA6 to the plasma membrane, maintaining Golgi organization and morphology, possible role in exocytosis. Plays and important role in hypocotyl growth by influencing cell elongation/growth and deposition of cellulose microfibrils in the cell wall. Plays an important role in cellulose synthesis. Influences both the distribution and velocity of cellulose synthase complexes in the plasma membrane. Encodes a GTP-binding protein with similarity to yeast YPT6 . RAB6 can complement the yeast YTP mutant. |
AT4G11230 | NADPH-oxidase RbohI is expressed highly in seeds and roots. Mutants have inreased sensitivity to osmotic stress suggesting a role in mediating cellular response to stress in roots. |
AT5G08050 | Encodes a grana core localized protein. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
AT1G08390 | Involved in preserving the stability of 45S rDNA repeats. |
AT1G55140 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
AT3G13740 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
AT4G35740 | Encodes RECQ3, an ATP-dependent helicase. |
AT5G63980 | Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration and increased levels of 3'-phosphoadenosine 5'-phosphate (PAP). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity. Its activity is sensitive to the redox state of its environment, decreasing under oxidative conditions and is regulated by dimerization and intra and inter-molecular disulfide bond formation. |
AT5G51340 | SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage. |
AT1G18830 | Together with SEC31B a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
AT5G58575 | Component of the deubiquitination module of the SAGA complex. |
AT1G78880 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
AT1G21410 | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. |
AT1G77000 | AtSKP2;2 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. AtSKP2b may also be involved in the degradation of KRP1/ICK1, a CDK inhibitor. |
AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
AT4G29160 | SNF7 family protein;(source:Araport11) |
AT1G71890 | Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation. |
AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
AT2G14880 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G29310 | SecY protein transport family protein;(source:Araport11) |
AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
AT3G19100 | Encodes a protein kinase that positively regulates gibberellic acid (GA) signaling by inactivating the E3 ubiquitin ligase GARU. GARU mediates ubiquitin-dependent degradation of GID1s, which are GA receptors. |
AT4G29000 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX6 in repressing the expression of these genes. |
AT4G23050 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
AT5G25100 | Endomembrane protein 70 protein family;(source:Araport11) |
AT1G72840 | NBS TIR LRR protein. It is induced in response to bacterial pathogens and overexpression results in cell death in leaves. |
AT5G54750 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
AT4G02890 | Polyubiquitin gene containing 4 ubiquitin repeats. |
AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
AT1G16780 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT4G01720 | member of WRKY Transcription Factor; Group II-b |
AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
AT5G58060 | Constitutively expressed SNARE protein of the YKT6 family. |
AT5G21920 | One of four Arabidopsis homologs of bacterial ymlg proteins. |
AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
AT4G39980 | Encodes a 2-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase, which catalyzes the first committed step in aromatic amino acid biosynthesis. Gene expression is induced by wounding and pathogenic bacteria Pseudomonas syringae. The mRNA is cell-to-cell mobile. |
AT1G04220 | Encodes KCS2, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT5G43760 | Encodes KCS20, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
AT1G07720 | Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT4G34350 | Arabidopsis ISPH is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis. It was shown to complement the lethal phenotype of E. coli ispH mutant and is therefore most likely encodes a protein with 4-hydroxy-3-methylbut-2-en-1-yl diphosphate reductase activity involved in the last step of mevalonate-independent isopentenyl biosynthesis. Mutant has Albino seedling. |
AT1G62180 | encodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis. |
AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT5G14920 | Encodes a GASA domain containing protein that regulates increases in plant growth through GA-induced and DELLA-dependent signal transduction and that can increase abiotic stress resistance by reducing ROS accumulation. |
AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
AT5G57050 | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT5G63350 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G02480 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G64940 | ABC1K8 is a member of an atypical protein kinase family that is induced by heavy metals. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K7 in mediating lipid membrane changes in response to stress. The mRNA is cell-to-cell mobile. |
AT1G69260 | ABI five binding protein;(source:Araport11) |
AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
AT3G29575 | ABI five binding protein 3;(source:Araport11) |
AT5G42030 | ABL interactor-like protein 4;(source:Araport11) |
AT3G19290 | bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediates ABA-dependent stress responses.ABF4 acts through SnRK2 pathway and binds to ABA response elements of the promoters of NYE1 and regulates their expression to promote chlorophyll degradation. |
AT1G49720 | Identified as a protein that binds to abscisic acid response elements. May mediate transcriptional regulation of ABA responses. |
AT4G34000 | Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid. |
AT2G19590 | encodes a protein whose sequence is similar to 1-aminocyclopropane-1-carboxylate oxidase |
AT1G62380 | Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene. |
AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
AT1G12420 | ACT domain repeat 8;(source:Araport11) |
AT5G09810 | Member of Actin gene family.Mutants are defective in germination and root growth. The mRNA is cell-to-cell mobile. |
AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
AT1G18450 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. Phenotype of the arp4-1 mutant allele revealed partial sterility due to defects in anther development. Targeting the distinct, 3' UTR of AtARP4 transcripts with RNA interference caused a drastic reduction in the level of AtARP4 protein expression, and resulted in strong pleiotropic phenotypes such as altered organization of plant organs, early flowering, delayed flower senescence and high levels of sterility. Western blot analysis and immunolabelling demonstrated a clear correlation between reductions in the level of AtARP4 expression and severity of the phenotypes. |
AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
AT2G33385 | actin-related protein C2B;(source:Araport11) |
AT1G60430 | actin-related protein C3;(source:Araport11) |
AT1G73910 | Encodes a gene similar to actin-related proteins in other organisms. Member of nuclear ARP family of genes. Component of chromatin remodeling complexes, involved in chromatin-mediated gene regulation. |
AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
AT3G05420 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
AT2G35690 | Encodes an acyl-CoA oxidase. Involved in jasmonate biosynthesis. Expressed uniformly in seedlings and throughout development. |
AT3G50860 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
AT4G01100 | Adenine nucleotide transporter. Located in mitochondrion. Expressed in a broad range of tissues, but predominantly in root tips. Loss of function mutants exhibit reduced root growth and respiration. |
AT2G37250 | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth |
AT5G03300 | Encodes adenosine kinase 2 (ADK2), a typical, constitutively expressed housekeeping enzyme. Shows a high sequence identity with ADK1. Involved in salvage synthesis of adenylates and methyl recycling. Enzyme activity is substantially inhibited in roots, siliques and dry seeds by an unknown compound. May contribute to cytokinin interconversion. The mRNA is cell-to-cell mobile. |
AT3G49870 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
AT3G08580 | mitochondrial ADP/ATP carrier |
AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
AT2G14210 | MADS box gene, transcription factor |
AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
AT5G60910 | MADS box gene negatively regulated by APETALA1 |
AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
AT3G12740 | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. The mRNA is cell-to-cell mobile. |
AT1G79450 | ALA-interacting subunit 5;(source:Araport11) |
AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
AT2G28800 | member of Chloroplast membrane protein ALBINO3 family. Similar to pea PPF1 and may play a role in plant senescence. |
AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
AT2G14170 | Arabidopsis thaliana methylmalonate-semialdehyde dehydrogenase |
AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
AT4G34240 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. ALDH3I1 was able to use both NAD+ and NADP+ as cofactors. |
AT1G79440 | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
AT2G37760 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including aliphatic and aromatic aldehydes and steroids. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
AT5G26210 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
AT1G23740 | AOR is an alkenal/one oxidoreductase that acts on compounds with unsaturated alpha,beta-carbonyls. The activity of this enzyme with a number of substrates, including acrolein and 3-buten-2-one, was demonstrated in vitro using a truncated form of the protein that lacked approximately 80 of the first amino acids. This protein appears to localize to the chloroplast where it likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. |
AT3G29320 | Encodes a plastidic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for maltooligosaccharides, such as maltoheptaose. The mRNA is cell-to-cell mobile. |
AT3G10740 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 51 of glycoside hydrolases. It may be involved in cell wall modification. |
AT1G18460 | Alpha/beta hydrolase |
AT2G24100 | ATP-dependent DNA helicase;(source:Araport11) |
AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein;(source:Araport11) |
AT1G01520 | RVE3 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
AT1G20650 | Protein kinase superfamily protein;(source:Araport11) |
AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
AT5G64210 | encodes an isoform of alternative oxidase, which is expressed in rosettes, stems, and roots. Transcript accumulates in dry seeds and decreased upon germination and is not affected by actinomycin A. Protein is localized to mitochondria. |
AT5G27610 | protein ALWAYS EARLY 1;(source:Araport11) |
AT3G05380 | ALWAYS EARLY 2;(source:Araport11) |
AT3G27870 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT1G28530 | Encodes a protein that localizes to both chloroplasts and amyloplasts and is required for both chloroplast and mesophyll development. |
AT1G01510 | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. It has been shown to localize to cytosolic stress granules and is involved in their formation. |
AT5G66055 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
AT4G00730 | Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of anthocyanin and in root development. Loss of function mutants have increased cell wall polysaccharide content. |
AT4G38730 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT1G69120 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24. |
AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
AT3G15460 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
AT4G35840 | RING/U-box superfamily protein;(source:Araport11) |
AT5G57750 | RING/U-box superfamily protein;(source:Araport11) |
AT1G49200 | RING/U-box superfamily protein;(source:Araport11) |
AT5G47610 | RING/U-box superfamily protein;(source:Araport11) |
AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
AT3G05200 | Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6). The mRNA is cell-to-cell mobile. |
AT1G30680 | Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B. |
AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
AT4G09030 | Encodes arabinogalactan protein (AGP10). The mRNA is cell-to-cell mobile. |
AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
AT2G46330 | Encodes arabinogalactan protein (AGP16). |
AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
AT1G55330 | Encodes a putative arabinogalactan-protein (AGP21). |
AT5G18690 | arabinogalactan protein 25;(source:Araport11) |
AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
AT5G65390 | arabinogalactan protein 7;(source:Araport11) |
AT2G14890 | putative proline-rich protein (At2g14890) mRNA, complete The mRNA is cell-to-cell mobile. |
AT3G45230 | Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains. |
AT4G05330 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT1G16610 | Encodes SR45, a member of the highly conserved family of serine/arginine-rich (SR) proteins, which play key roles in pre-mRNA splicing and other aspects of RNA metabolism. SR45 is a spliceosome protein, interacts with SR33 and the U1-70K protein of the U1 snRNP. Also involved in plant sugar response. sr45-1 mutation confers hypersensitivity to glucose during early seedling growth. |
AT3G61860 | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT2G46610 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT4G25500 | Encodes an arginine/serine-rich splicing factor. The transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS40 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis (DOI:10.1093/nar/gkv751). |
AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
AT2G27040 | AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation, abnormal ovule/megagametophyte develoment and increased susceptibility to bacterial pathogens including Tobacco rattle virus. |
AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
AT1G68310 | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. Required for both leaf adaxial?abaxial polarity formation and normal cell proliferation. It is part of a protein complex with CIA1, NAR1, and MET18, which are highly conserved in eukaryotes and are involved in the biogenesis of cytosolic and nuclear Fe-S proteins. |
AT3G09640 | Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT1G76710 | SET domain group 26;(source:Araport11) |
AT4G11560 | BAH domain protein which cooperates with PHD protein AIPP2 to read H3K27me3 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Responsible for preventing flowering by suppressing the expression of flowering genes. Binding of BDT1 to the H3K27me3 peptide, which is enhanced by PHD proteins, is critical for preventing early flowering. |
AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. They also exhibit abnormal responses to MAMPs possibly because the glycan properties of FL22 are affected. |
AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
AT1G10600 | associated molecule with the SH3 domain of STAM 2;(source:Araport11) |
AT2G37630 | Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP. Also functions as a regulator of the plant immune response. |
AT2G42440 | Lateral organ boundaries (LOB) domain family protein;(source:Araport11) |
AT1G67370 | Meiotic asynaptic mutant 1 (ASY1). ASY1 protein is initially distributed as numerous foci throughout the chromatin. During early G2, the foci are juxtaposed to the nascent chromosome axes to form a continuous axis associated signal. |
AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
AT5G49700 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT2G25880 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. |
AT2G45490 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. The protein is concentrated in nuclear dots arranged around the nucleolus and the nuclear periphery in early prophase cells. |
AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
AT3G17100 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
AT4G09650 | Encodes the chloroplast ATPase delta-subunit. The mRNA is cell-to-cell mobile. |
AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
AT5G44110 | Encodes a member of the NAP subfamily of ABC transporters whose expression pattern is regulated by light and sucrose. |
AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
AT2G39480 | P-glycoprotein 6;(source:Araport11) |
AT3G62700 | member of MRP subfamily |
AT5G64840 | ABCF5 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein GCN20. |
AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
AT1G53390 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
AT2G33270 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
AT1G08570 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. The mRNA is cell-to-cell mobile. |
AT5G50230 | autophagy-related (ATG) gene |
AT3G49590 | Autophagy protein. |
AT5G43700 | Auxin inducible protein similar to transcription factors. |
AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
AT5G62000 | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. The mRNA is cell-to-cell mobile. |
AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
AT1G78100 | F-box family protein;(source:Araport11) |
AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
AT1G68190 | B-box zinc finger family protein;(source:Araport11) |
AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
AT3G21890 | B-box type zinc finger family protein;(source:Araport11) |
AT5G48250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
AT2G18160 | Encodes a b-ZIP transcription factor. |
AT3G49760 | basic leucine-zipper 5;(source:Araport11) |
AT2G22850 | basic leucine-zipper 6;(source:Araport11) |
AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT2G01930 | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.Along with BPC2, BPC1 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus. |
AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
AT1G55530 | RING/U-box superfamily protein;(source:Araport11) |
AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
AT1G78700 | BES1/BZR1 homolog 4;(source:Araport11) |
AT2G44480 | beta glucosidase 17;(source:Araport11) |
AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
AT5G42100 | encodes a plasmodesmal (Pd)-associated membrane protein involved in plasmodesmal callose degradation, i.e. beta-1,3-glucanase (EC 3.2.1.39), and functions in the gating of Pd |
AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
AT3G23920 | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.Activity of BAM1 increases 4 days after osmotic stress. BAM1 has a higher temperature optimum than BAM3 (PMID:25293962). |
AT5G18670 | putative beta-amylase BMY3 (BMY3) |
AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
AT3G52840 | beta-galactosidase 2;(source:Araport11) |
AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. Located in the extracellular matrix. Gene is expressed specifically in tissues undergoing secondary wall thickening. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
AT1G19660 | Wound-responsive family protein;(source:Araport11) |
AT1G69160 | suppressor;(source:Araport11) |
AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT5G49550 | Putative homolog of mammalian BLOC-1 Subunit 2. Protein - protein interaction with BLOS1. |
AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
AT4G17720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT5G46870 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT2G46020 | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
AT1G75080 | Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. There is evidence for phosphorylation-dependent nucleocytoplasmic shuttling of BZR1. GSK3-like kinases (including BIN2), 14-3-3 proteins, and the phosphatase BSU1 seem to participate in this process. Phosphorylation also appears to affect BZR1's transcriptional activities. |
AT4G18710 | Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation. |
AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
AT3G15120 | Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions. |
AT1G04020 | Encodes a protein containing two tandem BRCA1 C-Terminal (BRCT) domains, which function in phosphorylation-dependent protein-protein interactions. Loss of function mutations cause defects in meristem organization due to failure to repress WUS. BARD1 binds to WUS promoter and over expression of BARD reduces the extent of WUS expression. |
AT1G19350 | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes. Works with BRAVO to regulate QC division in the root. AT1G19350.3(BES1-L) is the long isoform of BES1. It contains an additive N-terminal NLS compared with the canonical BES1-S. This recently evolved isoform is expressed specifically in the Arabidopsis lineage |
AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
AT1G74770 | zinc ion binding protein;(source:Araport11) |
AT3G63310 | Mediates cell elongation in brassinosteroid signaling. |
AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
AT2G46080 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
AT1G19490 | Putative bZIP transcription factor. Expression is induced by drought and mutants are sensitive to drought. |
AT4G39070 | Encodes BZS1, a brassinosteroids-regulated BZR1 target (BRBT) gene. BZS1 is a putative zinc finger transcription factor. Expression of BZS1 was increased under BR-deficient condition and repressed by BR. Transgenic Arabidopsis plants overexpressing BZS1 showed a hypersensitivity to the BR biosynthetic inhibitor brassinazole (BRZ). In contrast, transgenic plants expressing reduced level of BZS1 had longer hypocotyls than wild type when grown on BRZ. |
AT5G51990 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature. |
AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
AT1G73580 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G80910 | vacuolar fusion CCZ1-like protein (DUF1712);(source:Araport11) |
AT5G66210 | Calcium Dependent Protein Kinase. Functions in the BIK1 innate immune response pathway. |
AT4G23650 | Encodes calcium dependent protein kinase 3 (CPK3), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK3 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK6 is also a member of the Arabidopsis CDPK family. |
AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
AT5G37780 | encodes a calmodulin that is involved in thigmomorphogenesis. Gene expression is rapidly induced upon a variety of abiotic stimuli, including water spray, subirrigation, wind, touch, wounding, or darkness. |
AT3G51920 | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. The gene itself is Al inducible, and AtALMT1 expression is partially repressed in camta2 mutant. The mRNA is cell-to-cell mobile. |
AT4G16150 | CATMA5 is a transcriptional activator. It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
AT1G76650 | calmodulin-like 38;(source:Araport11) |
AT5G61790 | calnexin 1;(source:Araport11) |
AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
AT1G57680 | plasminogen activator inhibitor;(source:Araport11) |
AT4G01060 | Encodes a Myb-related protein similar to CPC. Involved in epidermal cell differentiation. Mutants have reduced numbers of root hairs and increased trichome branching. Involved in endoreduplication. Loss of function mutants are hypertrophic and early flowering. |
AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
AT5G14740 | Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform. |
AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
AT5G01270 | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. |
AT2G44680 | Encodes casein kinase II beta chain, a CK2 regulatory subunit. Nuclear-localized CKB4 protein exists in vivo as different isoforms, resulting from phosphorylation on serine residues. The phosphorylated isoforms are the preferred substrate for ubiquitination and degradation by the proteasome pathway. Involved in regulation of circadian clock. |
AT5G15450 | Encodes a chloroplast-targeted Hsp101 homologue. Functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. APG6 expression is upregulated in response to heat shock in various organs, but not in response to other abiotic stresses. Apg6 mutants have a pale-green phenotype. |
AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT5G15290 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
AT1G54115 | Involved in cation (Na and K) homeostasis. |
AT1G08960 | Encodes a member of the Potassium-dependent sodium-calcium exchanger like-family that localizes to the plasma membrane and nuclear periphery, and has a role in mediating high-affinity K+ uptake and Na+ transport in yeast. |
AT3G14070 | Involved in cation (K, Na and Mn) homeostasis and transport |
AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
AT5G10930 | Encodes CBL-interacting protein kinase 5 (CIPK5). |
AT1G80090 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
AT2G46700 | CDPK-related kinase 3;(source:Araport11) |
AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
AT4G31590 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
AT2G47450 | A component of the chloroplast signal recognition particle pathway that is involved in LHCP targeting. It is downregulated in response to high light. It recognizes the DPLG motif in Lhcb1. The mRNA is cell-to-cell mobile. |
AT5G20890 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT3G02530 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT5G56500 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
AT3G14870 | hypothetical protein (DUF641);(source:Araport11) |
AT3G16920 | Encodes a chitinase-like protein expressed predominantly in stems. Mutants accumulate ligning in etiolated hypocotyls. |
AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
AT1G19670 | Chlorophyllase is the first enzyme involved in chlorophyll degradation. It catalyzes the hydrolysis of the ester bond to yield chlorophyllide and phytol. AtCLH1 lacks a typical signal sequence for the chloroplast. Its expression is induced rapidly by methyljasmonate, a known promoter of senescence and chlorophyll degradation. |
AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
AT4G13010 | Oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
AT2G47390 | Prolyl oligopeptidase family protein;(source:Araport11) |
AT5G57180 | Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. |
AT5G03940 | mutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit |
AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
AT5G16390 | Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex. |
AT1G08490 | Chloroplastic NifS-like protein that can catalyze the conversion of cysteine into alanine and elemental sulfur (S(0)) and of selenocysteine into alanine and elemental Se (Se(0)). Overexpression enhances selenium tolerance and accumulation. |
AT5G55740 | Encodes a member of the E+ subgroup of the PPR protein family, containing the E and E+ motifs following a tandem array of PPR motifs. It also contains an unknown motif consisting of 15 aa, which is highly conserved in some PPR proteins, including CRR4. CRR21 is involved in RNA editing of the site 2 of ndhD (ndhD-2),which encodes a subunit of the NDH complex. The RNA editing changes aa 128 from Ser to Leu. Mutants have impaired NDH complex activity. |
AT2G47910 | Encodes a chloroplast thylakoid membrane protein. Required for the assembly/accumulation of the NAD(P)H dehydrogenase complex of the photosynthetic electron transport chain. |
AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
AT2G21890 | cinnamyl alcohol dehydrogenase homolog 3;(source:Araport11) |
AT2G46830 | Encodes a transcriptional repressor that performs overlapping functions with LHY in a regulatory feedback loop that is closely associated with the circadian oscillator of Arabidopsis. Binds to the evening element in the promoter of TOC1 and represses TOC1 transcription. CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis. CCA1 binds the GI promoter. |
AT2G17570 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT3G58750 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
AT3G11130 | CHC1 heavy chain subunit of clathrin. Involved in vesicle mediated trafficking. Mutants show reduced rates of endocytosis and defects clathrin mediated exocytosis. Mutants also have increased dehydration tolerance which may be related to the overall slower stomatal aperture dynamics. Overall growth is affected. |
AT3G08530 | CHC2 heavy chain subunit of clathrin. Involved in vesicle mediated trafficking. Mutants show reduced rates of endocytosis and defects clathrin mediated exocytosis Mutants have increased drought tolerance due to defects in stomatal movement. |
AT2G20760 | Clathrin light chain protein;(source:Araport11) |
AT3G51890 | Clathrin light chain protein;(source:Araport11) |
AT4G38060 | hypothetical protein;(source:Araport11) |
AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
AT1G53000 | Encodes a mitochondrial-localized CMP-KDO (3-deoxy-D-manno-octulosonate) synthetase. This is the enzyme activating KDO as a nucleotide sugar prior to its incorporation into rhamnogalacturonan-II. Heterozygous mutants are defective in pollen development and in pollen tube elongation. |
AT2G44050 | 6,7-dimethyl-8-ribityllumazine synthase / DMRL synthase / lumazine synthase / riboflavin synthase [Arabidopsis thaliana]. Acts in the jasmonic acid signaling pathway. The mRNA is cell-to-cell mobile. |
AT1G29395 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. involved in response to salt tolerance |
AT1G29390 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. |
AT2G15970 | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. The mRNA is cell-to-cell mobile. |
AT3G50830 | cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. |
AT1G20440 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. Cold regulated gene, amino acid sequence homology with Group II LEA (late embryogenesis abundant) proteins. Also responds to osmotic stress, ABA, dehydration and inhibits e.coli growth while overexpressed. COR47 and RAB18 double overexpressor plants are cold tolerant. Regulated by heat shock. |
AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
AT5G03190 | peptide upstream protein;(source:Araport11) |
AT2G24790 | Positive regulator of photomorphogenesis that acts downstream of COP1 but can promote lateral root development independently of COP1 and also function as a daylength-sensitive regulator of shoot branching. The mRNA is cell-to-cell mobile. |
AT5G24930 | Flowering repressor in long days (LD) and short days (SD) and acts on the expression of FT and FT-like genes as well as on SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). |
AT5G57660 | CONSTANS-like 5;(source:Araport11) |
AT3G07650 | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. The mRNA is cell-to-cell mobile. |
AT5G64930 | Regulator of expression of pathogenesis-related (PR) genes. Participates in signal transduction pathways involved in plant defense (systemic acquired resistance -SAR). |
AT5G03730 | Homologous to the RAF family of serine/threonine protein kinases. Negative regulator in the ethylene signal transduction pathway. Interacts with the putative ethylene receptors ETR1 and ERS. Constitutively expressed. |
AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
AT2G47400 | CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The mRNA is cell-to-cell mobile. |
AT5G44120 | Encodes a 12S seed storage protein. The Landsberg erecta genome contains another copy of 12S globulin gene, CRA2, which is located tandemly with CRA1. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT1G04400 | Blue light receptor mediating blue-light regulated cotyledon expansion and flowering time. Positive regulator of the flowering-time gene CONSTANS. This gene possesses a light-induced CNT2 N-terminal homodimerisation domain.Involved in blue-light induced stomatal opening. Involved in triggering chromatin decondensation. An 80-residue motif (NC80) is sufficient to confer CRY2's physiological function. It is proposed that the PHR domain and the C-terminal tail of the unphosphorylated CRY2 form a "closed" conformation to suppress the NC80 motif in the absence of light. In response to blue light, the C-terminal tail of CRY2 is phosphorylated and electrostatically repelled from the surface of the PHR domain to form an "open" conformation, resulting in derepression of the NC80 motif and signal transduction to trigger photomorphogenic responses. Cry2 phosphorylation and degradation both occur in the nucleus.The life-time of cry2 signaling state in situ (in planta) is about 16 min. |
AT5G24850 | Binds flavin adenine dinucleotide and DNA. It does not have photolyase activity, and it is likely to act as photoreceptor. Closely related to Synechocystis cryptochrome. |
AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
AT4G02120 | Cytidine triphosphate synthase. |
AT1G52220 | Thylakoid membrane localized protein that interacts with other CURT family proteins. Oligomerization is associated with grana thylakoid curavature. |
AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
AT3G17690 | member of Cyclic nucleotide gated channel family |
AT2G23980 | Encodes a cyclic GMP-activated non-selective cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
AT1G44110 | Cyclin A1;(source:Araport11) |
AT1G20610 | Cyclin B2;(source:Araport11) |
AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
AT4G34160 | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
AT5G02110 | Encodes CYCLIN D7;1. Overexpression of CYCD7;1 induces cell proliferation and cell enlargement in the embryo and endosperm leading to overgrowth. |
AT3G21870 | cyclin p2;(source:Araport11) |
AT5G63370 | CDKG1 interacts with the splicing factor RSZ33 to regulate proper splicing of Cals5 Pre-mRNA. |
AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
AT3G03630 | Encodes a protein that possesses S-sulfocysteine synthase activity and lacks O-acetylserien(thiol)lyase activity. |
AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT5G56090 | Encodes a homolog of COX15. Microarray analysis show a 3.2 fold increase in transcription after treatment with rotenone, an electron transport chain inhibitor. |
AT4G10040 | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. Double mutants with CYTC-1 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
AT3G19270 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. |
AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11) |
AT5G42590 | putative cytochrome P450 |
AT5G25120 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT1G79370 | member of CYP79C |
AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
AT2G40890 | encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level. |
AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT1G25470 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
AT1G65930 | Encodes a NADP+-isocitrate dehydrogenase that is believed to function in the cytosol. It appears to contribute to NADPH production under oxidative stress, and thereby to participate in redox signalling linked to defense responses. The mRNA is cell-to-cell mobile. |
AT1G04270 | Encodes cytosolic ribosomal protein S15. |
AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT5G66620 | DA1-related protein 6;(source:Araport11) |
AT5G66610 | DA1-related protein 7;(source:Araport11) |
AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
AT5G01880 | RING/U-box superfamily protein;(source:Araport11) |
AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT3G60140 | Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT3G13450 | branched chain alpha-keto acid dehydrogenase E1 beta |
AT3G20550 | Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL. |
AT5G03210 | Encodes a small polypeptide contributing to resistance to potyvirus. |
AT5G61590 | Encodes an AP2/ERF-type transcription factor that is preferentially expressed in the epidermis and induced by darkness and negatively regulates cuticular wax biosynthesis. |
AT1G19100 | Encodes a member of the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
AT1G32210 | Encodes protein involved in suppression of apoptosis. Complements a mammalian apoptosis suppressor mutation. |
AT4G25480 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT1G54410 | Encodes a KS-type dehydrin can reduce the formation of reactive oxygen species (ROS) from Cu. |
AT5G16710 | DHAR3 protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.Encodes 30-40% of extractable leaf GSH-dependent DHAR activity. Single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions.Makes a minor contribution to glutathione oxidation in response to increased intracellular hydrogen peroxide (catalase deficiency) (PMID:28381499). |
AT5G45830 | Encodes DOG1 (DELAY OF GERMINATION 1). A quantitative trait locus involved in the control of seed dormancy. Belongs to a novel plant-specific gene family whose members include: DOG1-like 1-4 (DOGL1-4, At4g18660, At4g18680, At4g18690, At4g18650 respectively) and DOG1. DOG1 expression is seed-specific. |
AT3G16240 | Delta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. Highly expressed in flower, shoot, and stem. Expression shows diurnal regulation and is induced by ammonium (NH3). Protein localized to vacuolar membrane. The mRNA is cell-to-cell mobile. |
AT1G65520 | encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
AT4G29330 | DERLIN-1;(source:Araport11) |
AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
AT1G01040 | Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs. The mRNA is cell-to-cell mobile. |
AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
AT1G53280 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. |
AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G12610 | Plays role in DNA-damage repair/toleration. Partially complements RecA- phenotypes. |
AT4G12010 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. Co-regulates with WRKY19 basal levels of immunity to root-knot nematodes. |
AT1G28330 | dormancy-associated protein (DRM1) |
AT4G25670 | stress response NST1-like protein;(source:Araport11) |
AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
AT5G05410 | Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress?inducible genes. The mRNA is cell-to-cell mobile. |
AT3G11020 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A. |
AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11) |
AT3G05700 | Encodes a DNA binding protein with transcription activation activity. It is expressed in response to osmotic, drought and ABA stress. |
AT3G26932 | dsRNA-binding protein 3;(source:Araport11) |
AT5G67040 | F-box protein, putative (DUF295);(source:Araport11) |
AT5G25460 | Encodes a DUF642 cell wall protein. |
AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
AT3G03990 | Encodes an alpha/beta hydrolase essential for strigolactone signaling. Degradation of the protein is promoted by strigolactone. The mRNA is cell-to-cell mobile. |
AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
AT1G50430 | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype. EXO70 interactor and presumed negative secretion regulator. |
AT4G34280 | Encodes a putative substrate receptor for the cullin4-RING ubiquitin E3 ligase complex that is involved in negative regulation of plant UV-B response. |
AT3G60190 | At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central `dynamin 2` domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection. |
AT4G33650 | Encodes a protein with high sequence similarity to the dynamin superfamily. Among those members ADL2 was most closely related to Dnm1p of yeast and likely a member of the Vps1p subfamily. Widely expressed in various tissues with highest expression in flower tissues. Localizes to the chloroplast, mitochondrion and peroxisome. Involved in peroxisome and mitochondria fission in combination with DRP3B. |
AT5G16260 | Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile. |
AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
AT4G32490 | early nodulin-like protein 4;(source:Araport11) |
AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
AT1G20450 | Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. |
AT2G41430 | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. |
AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
AT1G10370 | Encodes GSTU17 (Glutathione S-Transferase U17). Functions as a negative component of stress-mediated signal transduction pathways in drought and salt stress responses. |
AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
AT5G15440 | EID1-like 1;(source:Araport11) |
AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
AT2G25490 | Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. The mRNA is cell-to-cell mobile. |
AT5G25350 | Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA. Part of the SCF complex, it is located in the nucleus and is involved in the ethylene-response pathway. |
AT5G64905 | elicitor peptide 3 precursor;(source:Araport11) |
AT1G56200 | Encodes a chloroplast localized protein that is essential for chloroplast development. |
AT1G21390 | embryo defective 2170;(source:Araport11) |
AT2G21710 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT5G40480 | embryo defective 3012;(source:Araport11) |
AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
AT2G41475 | Embryo-specific protein 3, (ATS3);(source:Araport11) |
AT5G11530 | Involved in regulating reproductive development |
AT1G71220 | Encodes UDP-glucose:glycoprotein glucosyltransferase. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
AT1G18260 | Encodes an Arabidopsis homolog of the yeast Hrd3/mammlian Sel1L protein. Involved in ERAD (Endoplasmic reticulum-associated degradation). |
AT5G66460 | Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence. |
AT1G07670 | TPLATE complex protein involved in clathrin-mediated endocytosis. |
AT1G68290 | Encodes an endonuclease ENDO2. ENDO2 purified from transgenic Arabidopsis digests RNA, ssDNA, and dsDNA, with a substrate preference for ssDNA and RNA. ENDO2 produced and purified from Nicotiana benthamiana expression showed no demonstrable endonuclease activity, either towards single stranded DNA or mismatches, in vitro. |
AT3G07100 | Encodes SEC24a/ERMO2. Required for endoplasmic reticulum (ER) morphology. Has epistatic interactions with AT1G55350, AT3G59420, and AT3G10525. |
AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
AT3G48090 | Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases. |
AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
AT1G30630 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
AT3G59290 | Involved in plant trans-Golgi network (TGN) transport. |
AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
AT4G29960 | EBS7 encodes a plant specific, endoplasmic reticulum localized protein that is involved in endoplasmic reticulum-associated degradation (ERAD). It interacts with the ERAD component AtHRD1a and may regulate HRD1a stability. Identified in a screen for supressors of a mutation in bri1 that causes bri1 to be retained in the ER. Loss of EBS7 function restores BR sensitivity in the bri1-9 mutant allele. |
AT5G09410 | calmodulin-binding protein, similar to another ethylene-upregulated calmodulin-binding protein ER1 GI:11612392 from (Nicotiana tabacum) |
AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. The mRNA is cell-to-cell mobile. |
AT2G27050 | ethylene-insensitive3-like1 (EIL1) The mRNA is cell-to-cell mobile. |
AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile. |
AT3G13460 | Physically interacts with CIPK1. ECT2 regulates the mRNA levels of the roteasome regulator PTRE1 and of several 20S proteasome subunits, resulting in enhanced 26S proteasome activity. YTHDF protein which togeteher with ECT3 and ECT4 is involved in cell proliferation during plant organogenesis. |
AT5G61020 | YTHDF protein which togeteher with ECT2 and ECT4 is involved in cell proliferation during plant organogenesis. |
AT1G48110 | evolutionarily conserved C-terminal region 7;(source:Araport11) |
AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
AT1G47550 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. It binds phosphoinositide lipids. |
AT1G47560 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
AT1G54090 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G59730 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. The mRNA is cell-to-cell mobile. |
AT4G08950 | Phosphate-responsive 1 family protein;(source:Araport11) |
AT5G64260 | EXORDIUM like 2;(source:Araport11) |
AT5G09440 | EXORDIUM like 4;(source:Araport11) |
AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT1G12090 | extensin-like protein (ELP) |
AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
AT4G21510 | F-box family protein;(source:Araport11) |
AT4G05010 | F-box family protein;(source:Araport11) |
AT4G35930 | F-box family protein;(source:Araport11) |
AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
AT1G44080 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT4G10820 | F-box family protein;(source:Araport11) |
AT1G80790 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). The mRNA is cell-to-cell mobile. |
AT1G10240 | FAR1-related sequence 11;(source:Araport11) |
AT3G59470 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. FRF1 has been shown to bind the RB-box in vitro. The RB-box contributes to restricting SHOOTMERISTEMLESS expression to the shoot apical meristem. |
AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT3G60900 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT1G03870 | fasciclin-like arabinogalactan-protein 9 (Fla9). Possibly involved in embryogenesis and seed development. |
AT1G74960 | Encodes a plastidic beta-ketoacyl-ACP synthase II, involved in fatty acid elongation from 16:0-ACP to 18:0-ACP. Homozygous knock-out mutants are embryo lethal, indicating early embryo development is sensitive to elevated 16:0. |
AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
AT1G10960 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G32550 | Encodes FdC2, a ferredoxin protein capable of alternative electron partitioning. FdC1 level increases in conditions of acceptor limitation at PSI. |
AT1G20020 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the stroma The mRNA is cell-to-cell mobile. |
AT5G08410 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 2;(source:Araport11) |
AT5G01600 | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
AT3G56090 | Encodes FERRITIN 3, AtFER3. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative damage, but they do not constitute the major iron pool. |
AT4G04020 | Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. The mRNA is cell-to-cell mobile. |
AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
AT2G41705 | Encodes a fluoride export protein. |
AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
AT4G31380 | encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves. |
AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
AT1G07510 | encodes an FtsH protease that is localized to the mitochondrion |
AT5G53170 | encodes an FtsH protease that is localized to the chloroplast and the mitochondrion |
AT5G58870 | encodes an FtsH protease that is localized to the chloroplast |
AT4G24740 | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
AT3G61140 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Component of the nuclear-localized COP9 complex. Mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons, first become defective during embryogenesis and exhibit limited seedling development. |
AT1G20110 | Encodes a protein that is localized to the peripheral membrane of late endosomal compartments. Involved in the regulation of mulitivesicular/prevacuolar compartment protein sorting. Loss of function mutations are embryo lethal. Regulates IRT1-dependent metal transport and metal homeostasis. The mRNA is cell-to-cell mobile. |
AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
AT4G01120 | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
AT1G74670 | Gibberellin-regulated family protein;(source:Araport11) |
AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
AT1G14430 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
AT2G38650 | Galacturonosyltransferase (GAUT) family member, interacts with GAUT1. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
AT5G49150 | Encodes a transmembrane domain containing protein expressed in sperm cells. Mutants are defective in gamete fusion. Target promoter of the male germline-specific transcription factor DUO1. |
AT3G52115 | Induced in response to ionizing radiation, shows basal expression in mitotically active cells and high expression in endoreduplicating cells. May be involved in DNA damage-induced growth arrest. Protein sequence contains a PEST destruction box. |
AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile. |
AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
AT5G15230 | Encodes gibberellin-regulated protein GASA4. Promotes GA responses and exhibits redox activity. |
AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G56860 | Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression. |
AT1G72030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT5G65280 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
AT2G18440 | Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. Has been identified as a translated small open reading frame by ribosome profiling. |
AT4G09000 | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
AT5G38480 | general regulatory factor, a 14-3-3 gene |
AT5G16050 | Encodes GF14 upsilon chain, a 14-3-3 gene family member. |
AT3G02520 | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). |
AT1G35160 | GF14 protein phi chain member of 14-3-3 protein family. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 The mRNA is cell-to-cell mobile. |
AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
AT1G22770 | Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression. The mRNA is cell-to-cell mobile. |
AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
AT1G23310 | Identified by cloning the gene that corresponded to a purified protein having glyoxylate aminotransferase activity. Localized to the peroxisome and thought to be involved in photorespiration/ metabolic salvage pathway. |
AT3G47340 | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
AT4G11600 | Encodes glutathione peroxidase. Exhibits moderate binding affinity with dinotefuran. |
AT1G49860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
AT2G30870 | early dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002) |
AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G02790 | GST functions in reductive deglutathionylation of glutathione conjugates of quercetin. |
AT5G02780 | Encodes a member of the lambda family of glutathione transferases. It has thiol transferase activity and self S-glutathionylation activity in vitro. |
AT3G04120 | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS. The mRNA is cell-to-cell mobile. |
AT1G79530 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
AT4G17550 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT1G71340 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
AT3G58550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G14805 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G55260 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
AT3G25530 | Encodes gamma-hydroxybutyrate dehydrogenase (AtGHBDH). Contains a NADP-binding domain. GHBDH is proposed to function in oxidative stress tolerance. |
AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
AT1G79830 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
AT4G00850 | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA |
AT2G22840 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower |
AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
AT5G64300 | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile. |
AT5G52210 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
AT3G57550 | guanylate kinase |
AT4G16444 | GET1 membrane receptor homolog . ER localized protein that Interacts with GET3a and GET2 orthologs. Disruption of both genes results in a decreased membrane localization of the SNARE proteinSYP123 and defects in root hair elongation. |
AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
AT5G57350 | member of Plasma membrane H+-ATPase family |
AT1G80660 | H[+]-ATPase 9;(source:Araport11) |
AT1G28440 | HAESA-like 1;(source:Araport11) |
AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
AT4G16660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
AT3G22830 | member of Heat Stress Transcription Factor (Hsf) family |
AT3G51910 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT1G67970 | member of Heat Stress Transcription Factor (Hsf) family |
AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT3G24520 | member of Heat Stress Transcription Factor (Hsf) family |
AT1G32330 | Member of Heat Stress Transcription Factor (Hsf) family. Negatively regulated by HSP90.2. |
AT3G02990 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT5G03720 | Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence. |
AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G13440 | Encodes a HemK class glutamine‐methyltransferase that is involved in the termination of translation and essential for iron homeostasis. |
AT2G24150 | heptahelical transmembrane protein HHP3 |
AT4G30850 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT3G17040 | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. It binds in the psbT?psbH intercistronic region and blocks the progression of 5′ → 3′ exoribonucleases, which defines the 5′ end of processed psbH transcripts and also stabilizes the downstream RNA segment. In addition, HCF107 binding remodels the structure of the psbH 5′ UTR in a way that can account for its ability to enhance psbH translation. |
AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
AT1G14900 | Encodes a protein belonging to the subgroup of HMGA (high mobility group A) proteins that interact with A/T-rich stretches of DNA. |
AT2G17560 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
AT1G27320 | Encodes a histidine kinases, a cytokinin receptor that controls cytokinin-mediated leaf longevity through a specific phosphorylation of the response regulator, ARR2. The mRNA is cell-to-cell mobile. |
AT1G80100 | AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. AHP6 does not appear to have phosphotransfer activity. Acts as an inhibitor of cytokinin signaling by interacting with the phosphorelay machinery. Expressed in developing protoxylem and associated pericycle cell files. Negative regulator of cytokinin signaling. Expression is down-regulated by cytokinins. There are two alternatively spliced genes for this locus, AHP6a and AHP6b, differing in the length of the first exon. In ahp6-2 seedlings, only the AHP6a transcript is present. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT3G21510 | Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT4G40040 | Histone superfamily protein;(source:Araport11) |
AT4G40030 | Histone superfamily protein;(source:Araport11) |
AT1G79000 | Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation. |
AT5G61060 | Encodes a member of the histone deacetylase family. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
AT5G61070 | Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation. |
AT2G18050 | encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA. The mRNA is cell-to-cell mobile. |
AT5G27670 | Encodes HTA7, a histone H2A protein. |
AT2G38810 | Encodes HTA8, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA9 and HTA11) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT2G18350 | homeobox protein 24;(source:Araport11) |
AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
AT5G46880 | homeobox-7;(source:Araport11) |
AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
AT3G60390 | Encodes homeobox protein HAT3. |
AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT3G03260 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT2G18300 | DNA-binding bHLH protein involved in positive regulation of cell elongation and proliferation and, negative control of plant immunity.One component of PRE-IBH1-HBI1 tripartite module. |
AT5G03160 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
AT1G65040 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
AT1G17550 | Protein Phosphatase 2C |
AT4G31750 | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
AT2G06990 | Encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
AT3G63070 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile. |
AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
AT4G24960 | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. The mRNA is cell-to-cell mobile. |
AT5G50720 | Encodes one of five HVA22 homologs in Arabidopsis. HVA22 is an ABA- and stress-inducible gene first isolated from barley. Members of this gene family have only been found in eukaryotes. AtHVA22e mRNA is upregulated to varying degrees in response to cold stress, salt stress, ABA treatment or dehydration. |
AT1G68010 | Encodes hydroxypyruvate reductase. |
AT1G72770 | mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. The mRNA is cell-to-cell mobile. |
AT4G27450 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT3G10020 | plant/protein;(source:Araport11) |
AT3G10040 | Encodes HRA1 (HYPOXIA RESPONSE ATTENUATOR1), a low oxygen-inducible transcription factor. |
AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
AT4G37550 | Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM. |
AT2G31580 | ICA1 is a nuclear localized member of the tRNA(His) guanylyl transferase superfamily. Loss of function alleles show increased sensitivity to growth at high temperatures defects in cell cycle progression and DNA repair. |
AT5G03070 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT1G48490 | Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network. |
AT5G11470 | SG1 is a Bromo-Adjacent Homology (BAH) domain containing protein involved in CHG methylation within genebodies. Loss of function results in pleiotrophic developmental effects that increase after 4 generations. |
AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
AT3G23030 | auxin inducible gene expressed in the nucleus |
AT3G62100 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. |
AT3G04730 | early auxin-induced (IAA16) |
AT3G26744 | Encodes a MYC-like bHLH transcriptional activator that binds specifically to the MYC recognition sequences in the CBF3 promoter. It also binds to and inhibits the expression of ABI3. Mutants are defective in cold-regulated gene expression and ABA signaling druing seed germination.. Cold stress triggers protein degradation of nuclear GFPICE1 protein, and the RING finger protein HOS1 is required. Sumoylation of ICE1 controls CBF3/DREB1A expression and freezing tolerance. Together with ZOU, ICE1 determines primary seed dormancy depth independently of their joint role in endosperm development.ICE1 interacts with ABI5. Also members of the DELLA family, which repress ICE1 function. |
AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
AT5G52200 | Encodes an inhibitor of protein phosphatase one (PP1). |
AT5G16760 | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
AT2G43330 | Encodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium. |
AT3G05820 | Encodes a putative plastid-targeted alkaline/neutral invertase.Expression is induced by salt, osmotic and ABA treatments. Loss of function affects mitochondrial functioning and ROS production. |
AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
AT1G60960 | Encodes a plasma membrane localized zinc/iron transporter. |
AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
AT1G18870 | Encodes a protein with isochorismate synthase activity involved in phylloquinone biosynthesis. Mutant studies of this gene's function suggest that its function is redundant with that of ICS1 (AT1G7410). |
AT5G03290 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. The mRNA is cell-to-cell mobile. |
AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
AT5G20900 | jasmonate-zim-domain protein 12;(source:Araport11) |
AT1G17380 | jasmonate-zim-domain protein 5;(source:Araport11) |
AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
AT5G51710 | member of Putative potassium proton antiporter family |
AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT4G33530 | potassium transporter |
AT5G09400 | Encodes a potassium uptake permease with a functional adenylate cyclase (AC) center. The first 100 aa of this protein can complement AC-deficient E. coli and display AC activity in vitro. KUP7 is localized to the plasma membrane where it functions in potassium uptake and translocation. |
AT5G16560 | Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis. |
AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G37470 | HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion. |
AT1G26945 | Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity. |
AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
AT3G02880 | Probable inactive receptor kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins from the three affinity chromatography systems with LPS chemotype Xcc 8530 as ligand. |
AT4G21270 | Encodes a kinesin-like motor protein heavy chain. Loss of function mutations have reduced fertility and are defective in spindle formation in male meiosis. |
AT3G12020 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
AT1G23380 | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants. |
AT3G08550 | mutant is Dwarfed and shows defects in cell elongation; Cellulose deficient; Plasma Membrane Protein |
AT5G56490 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
AT3G62130 | Encodes an enzyme that decomposes L-cysteine into pyruvate, H2S, and NH3. |
AT4G33670 | Encodes a L-galactose dehydrogenase, involved in ascorbate biosynthesis |
AT3G24090 | Encodes a glutamine-fructose-6-phosphate transaminase that likely plays a role in UDP-N-acetylglucosamine biosynthesis. |
AT3G10050 | first enzyme in the biosynthetic pathway of isoleucine |
AT5G65600 | L-type lectin receptor kinase which modulates metabolites and abiotic stress responses. Phosphorylates AvrPtoB which in turn reduces its virulence. |
AT5G55830 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G53380 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G25540 | Encodes a ceramide synthase that together with LOH3 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
AT1G01060 | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
AT2G35300 | Encodes LEA4-2/LEA18, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
AT2G44060 | Late embryogenesis abundant protein, group 2;(source:Araport11) |
AT2G46140 | Late embryogenesis abundant protein;(source:Araport11) |
AT1G32560 | Encodes LEA4-1, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
AT1G67360 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
AT5G61850 | Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction. |
AT3G24480 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
AT3G08940 | Lhcb4.2 protein (Lhcb4.2, protein involved in the light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
AT1G15820 | Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II. |
AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
AT5G47110 | Encodes a light-harvesting-like protein that is involved in chlorophyll and tocopherol biosynthesis anchoring geranylgeranyl reductase in the thylakoid membrane. |
AT1G78600 | light-regulated zinc finger protein 1;(source:Araport11) |
AT2G46260 | Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. LRBs physically interact with photoexcited and phosphorylated CRY2, at the CCE domain of CRY2, to facilitate polyubiquitination and degradation of CRY2 in response to blue light. |
AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
AT5G03080 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene, LPPgamma appears to be more important for diacylglycerol formation than LPPepsilon1 and LPPepsilon2 in the plastids. Heterozygous lppgamma mutants produce pollen that have defects in pollen tube germination and no homozygous mutants have been recovered. The mRNA is cell-to-cell mobile. |
AT5G59320 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. The mRNA is cell-to-cell mobile. |
AT5G08415 | Radical SAM superfamily protein;(source:Araport11) |
AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
AT1G02340 | Encodes a light-inducible, nuclear bHLH protein involved in phytochrome signaling. Mutants exhibit a long-hypocotyl phenotype only under far-red light but not under red light and are defective in other phytochrome A-related responses. Mutants also show blue light response defects. HFR1 interacts with COP1, co-localizes to the nuclear specks and is ubiquinated by COP1. |
AT2G04350 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
AT4G36480 | Encodes the LCB1 subunit of serine palmitoyltransferase. Together with the LCB2 subunit, forms a functional serine palmitoyltransferase complex, which catalyzes the first reaction of sphingolipid biosynthesis. Knockout of LCB1 was embryo lethal. Partial suppression of LCB1 expression led to smaller plants due to reduced cell expansion. |
AT5G16500 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
AT3G02810 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
AT1G73060 | Low PSII Accumulation 3;(source:Araport11) |
AT5G47010 | Required for nonsense-mediated mRNA decay. Involved in RNA interference. lba1 mutants has reduced sugar-induced expression of Atb- amylase, is hypersensitive to glucose and abscisic acid and resistant to mannose, and shows early flowering, short day-sensitive growth, and seed germination phenotypes. The mRNA is cell-to-cell mobile. |
AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
AT2G17120 | Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsCEBiP. |
AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
AT3G18850 | lysophosphatidyl acyltransferase 5;(source:Araport11) |
AT2G45670 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 20:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
AT5G63190 | Encodes a member of the MRF (MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR) gene family under TOR control that is transcriptionally induced by dark and starvation. MRF1 can be phosphorylated in vitro by S6K1 and S6K2. |
AT5G50850 | Transketolase family protein;(source:Araport11) |
AT5G22830 | Transmembrane magnesium transporter that is essential for chloroplast development and photosynthesis. One of nine family members. |
AT1G68990 | MGP3 (male gametophyte-defective 3) belongs to a small family of nuclear-encoded Phage type RNA polymerases (RPOTs) involved in the transcription of mitochondrial genes in Arabidopsis thaliana. Mutation in MGP 3 significantly retarded pollen tube growth and caused defective embryo development. |
AT1G72250 | Malectin domain kinesin. |
AT3G10920 | manganese superoxide dismutase (MSD1) |
AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
AT5G43710 | Glycosyl hydrolase family 47 protein;(source:Araport11) |
AT1G73670 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
AT2G42880 | member of MAP Kinase |
AT4G11330 | MAP kinase |
AT2G18170 | MAP kinase 7;(source:Araport11) |
AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
AT5G20100 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
AT2G35340 | helicase domain-containing protein;(source:Araport11) |
AT3G02570 | Encodes a protein with phosphomannose isomerase activity. |
AT3G19350 | Encodes a the C-terminal domain of poly(A) binding proteins. MPC is imprinted such that only the maternal allele is expressed in the endosperm. MPC is silenced by the action of MET1 and its expression is promoted by DEM. |
AT5G03220 | Encodes together with its paralog MED7B a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
AT1G26665 | Mediator complex, subunit Med10;(source:Araport11) |
AT5G02850 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
AT2G03070 | Encodes a subunit of the Mediator complex. Regulates plant defense and flowering. |
AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
AT5G15460 | membrane-anchored ubiquitin-fold protein 2;(source:Araport11) |
AT4G14965 | membrane-associated progesterone binding protein 4;(source:Araport11) |
AT2G31840 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G07600 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
AT3G09390 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
AT5G02380 | cysteine-rich protein with copper-binding activity |
AT5G17920 | Encodes a cytosolic cobalamin-independent methionine synthase, involved in methionine regeneration via the activated methyl cycle (SAM cycle). The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
AT4G22745 | Protein containing methyl-CpG-binding domain. |
AT1G15340 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G63030 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G12290 | MTHFD1 encodes a cytoplasmic bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase that is involved in one carbon metabolism and control of DNA methylation. |
AT4G30972 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
AT5G10945 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
AT3G10745 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCCAAAUGUAGACAAAGCA. Pri-mRNA coordinates for MIR158a (converted to TAIR10 based on PMID19304749): Chr3: 3366553-3366019 (reverse), length: 535 bp; exon coordinates: exon 1: 3366553 to 3366303, exon 2: 3366185 to 3366019; mature miRNA and miRNA* are located on exon 1. |
AT1G73687 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUA. Functions redundantly with MIR159B. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. Pri-mRNA coordinates for MIR159a (converted to TAIR10 based on PMID19304749): Chr1: 27713700-27712893 (reverse), length: 808 bp; exon coordinates: exon 1: 27713700 to 27712893, mature miRNA and miRNA* are located on exon 1. |
AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
AT5G45307 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
AT3G13405 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGA |
AT5G66045 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGUGUCAAUAUC |
AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
AT5G62162 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG |
AT4G14811 | Encodes a microRNA that targets CHX18. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCUUCGUGAAUAUCUGGCA |
AT3G13724 | Encodes a microRNA that targets CMT3. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGGUGGUGAUCAUAUAAGAU |
AT4G26760 | microtubule-associated protein 65-2;(source:Araport11) |
AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
AT2G20980 | Similar to MCM10, which in other organism was shown to be involved in the initiation of DNA replication. |
AT2G44620 | Encodes a mitochondrial acyl carrier protein (ACP) that forms part of the bridge domain which connects the membrane and the peripheral arm of mitochondrial complex I and contributes to the mitochondrial respiratory chain. Its acylated form is predominantly present in the mitochondrial membrane while the non-acylated form is soluble. The mRNA is cell-to-cell mobile. The designations of mtACP-1 and mtACP-2 in Klusch et al. 2021 (DOI:10.1093/plcell/koab092) are flipped with respect to the nomenclature published by Meyer et al. 2007 (DOI:10.1007/s11103-007-9156-9). |
AT5G09590 | heat shock protein 70 (Hsc70-5); nuclear |
AT5G08040 | mitochondrial import receptor subunit TOM5-like protein;(source:Araport11) |
AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. The mRNA is cell-to-cell mobile. |
AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
AT1G53570 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
AT1G28280 | VQ motif-containing protein;(source:Araport11) |
AT2G22900 | Encodes MUCI10, a galactomannan-1,6-galactosyltransferase. MUCI10 likely decorates glucomannan, synthesized by CSLA2, with galactose residues in vivo. The degree of galactosylation is essential for the synthesis of the GGM backbone, the structure of cellulose, mucilage density, as well as the adherence of pectin. |
AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT3G06790 | Encodes a protein involved in RNA editing in mitochondria. Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT3G24500 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores. |
AT5G16505 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT3G24495 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH7 exhibit moderate affinity for a (T/G) substrate and weak binding of (+T), suggesting MSH2*MSH7 may be specialized for lesions/base mispairs not tested or for (T/G) mispairs in special contexts. |
AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
AT3G30210 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB121). |
AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
AT2G23290 | Member of the R2R3 factor gene family. |
AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
AT4G05100 | Member of the R2R3 factor gene family. |
AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
AT5G47390 | Encodes a circadian-regulated transcription factor which specifically controls cell expansion during leaf development by controlling ROS homeostasis. The mRNA is cell-to-cell mobile. |
AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
AT3G57560 | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
AT5G11790 | Plays a role in dehydration stress response. |
AT2G44170 | pseudogene of myristoyl-CoA:protein N-myristoyltransferase;(source:Araport11) |
AT5G55470 | member of Sodium proton exchanger family |
AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
AT5G04410 | NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile. |
AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
AT1G02230 | NAC domain containing protein 4;(source:Araport11) |
AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
AT3G04430 | NAC domain containing protein 49;(source:Araport11) |
AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
AT3G49530 | Transcription factor that serves as a molecular link between cold signals and pathogen resistance responses. Undergoes proteolytic processing triggered by cold-induced changes in membrane fluidity.It relocates from the plasma membrane to the nucleus in response to ER stress. NAC062 is phosphorylated by SnRK2.8 at Thr-142. |
AT5G04400 | NAC domain protein;(source:Araport11) |
AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
AT5G22290 | Encodes ANAC089, a membrane-tethered transcription factor that negatively regulates floral initiation. Also controls ER-stress-induced programmed cell death. |
AT5G41090 | NAC domain containing protein 95;(source:Araport11) |
AT1G32870 | Expression in rosette leaves is activated by high concentration of boron. |
AT1G04280 | Encodes a mitochondrial CaM/Ca2+-dependent NAD+ kinase. |
AT1G78590 | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
AT5G17770 | Encodes NADH:cytochrome (Cyt) b5 reductase that displayed strict specificity to NADH for the reduction of a recombinant Cyt b5 (AtB5-A), whereas no Cyt b5 reduction was observed when NADPH was used as the electron donor. |
AT5G58330 | lactate/malate dehydrogenase family protein;(source:Araport11) |
AT1G16520 | NAI1 interacting protein, involved in ER body and vesicle formation. |
AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT1G74560 | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination. |
AT1G80830 | Thought to be involved in iron homeostasis. Induced in leaves in response to iron deficiency. Transgenic plants accumulate toxic levels of iron. Gene complements yeast iron uptake mutants. |
AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT1G03470 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the nuclear membrane and the vacuolar membrane. |
AT2G47920 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT2G30500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT4G01940 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU2 and 3 than to NFU4 and 5. Targeted to the chloroplast. |
AT1G51390 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile. |
AT5G64170 | LNK1 is a member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex.Functions as a transcriptional coactivator. |
AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
AT3G60320 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile. |
AT3G16400 | Encodes a nitrile-specifier protein NSP1 responsible for constitutive and herbivore-induced simple nitrile formation in rosette leaves. NSP1 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
AT3G54360 | Encodes a catalase chaperon that is essential for catalase activity. Required for multiple stress responses. |
AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
AT1G62720 | Encodes a PPR protein gene that localizes to the mitochondrion and is required for seed germination. |
AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
AT2G19400 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT1G30640 | Protein kinase family protein;(source:Araport11) |
AT5G12840 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
AT2G34720 | nuclear factor Y, subunit A4;(source:Araport11) |
AT1G30500 | nuclear factor Y, subunit A7;(source:Araport11) |
AT5G47640 | Involved in the regulation of response to nutrient levels. |
AT4G14540 | nuclear factor Y, subunit B3;(source:Araport11) |
AT2G37060 | nuclear factor Y, subunit B8;(source:Araport11) |
AT3G12480 | nuclear factor Y, subunit C11;(source:Araport11) |
AT1G56170 | Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast.One of two members of this class (HAP5B) and expressed in vegetative and reproductive tissues. Involved in the regulation of response to nutrient levels. |
AT1G08970 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC9. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
AT5G63320 | Encodes NPX1 (Nuclear Protein X1), a nuclear factor regulating abscisic acid responses. |
AT1G79150 | binding protein;(source:Araport11) |
AT1G48920 | Encodes ATNUC-L1 (NUCLEOLIN LIKE 1), the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. The mRNA is cell-to-cell mobile. |
AT3G18610 | Encodes ATNUC-L2 (NUCLEOLIN LIKE 2). |
AT3G12600 | nudix hydrolase homolog 16;(source:Araport11) |
AT2G01670 | nudix hydrolase homolog 17;(source:Araport11) |
AT1G14860 | nudix hydrolase homolog 18;(source:Araport11) |
AT5G20070 | nudix hydrolase homolog 19;(source:Araport11) |
AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
AT5G60850 | Encodes a zinc finger protein. |
AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
AT1G76400 | Ribophorin I;(source:Araport11) |
AT1G61790 | Encodes the OST3/6 subunit of the hetero-oligomeric plant oligosaccharyltransferase complex (OST). Also identified by GWAS as having a role in interspecific pollen tube recognition. |
AT1G17370 | Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA. |
AT5G02120 | Encodes a one helix protein homologous to cyanobacterial high-light inducible proteins. The protein is localized to the thylakoid membrane and its transcript is transiently induced by exposure to high light conditions. The mRNA is cell-to-cell mobile. |
AT4G33950 | Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network. |
AT3G48810 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G25270 | Encodes OTP70, a pentatricopeptide repeat protein of the E subgroup involved in splicing of the plastid transcript rpoC1. |
AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
AT5G35080 | Encodes a protein involved in the endoplasmic reticulum-associated degradation of glycoproteins. |
AT2G27350 | Encodes an otubain-like histone deubiquitinase involved in chromatin modification and regulation of plant gene expression. |
AT2G36050 | ovate family protein 15;(source:Araport11) |
AT2G19810 | Encodes Oxidation-related Zinc Finger 1 (OZF1), a plasma membrane protein involved in oxidative stress. |
AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
AT5G56550 | Encodes OXIDATIVE STRESS 3 (OXS3), involved in tolerance to heavy metals and oxidative stress. |
AT5G21930 | P-Type ATPase, mediates copper transport to chloroplast thylakoid lumen. Required for accumulation of copper-containing plastocyanin in the thylakoid lumen and for effective photosynthetic electron transport |
AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
AT1G60440 | The gene AT1G60440 encodes pantothenate kinase 1. Its molecular function was shown to phosphorylate pantothenate to form 4?-phosphopantothenate. |
AT4G17410 | PQT3 is a nuclear localized E3 ligase involved in negative regulation of stress tolerance.PRMT4b is a substrate of PQT3. |
AT2G02710 | Encodes a putative blue light receptor protein. |
AT4G14990 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
AT5G06370 | PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway. |
AT3G28690 | Protein kinase superfamily protein;(source:Araport11) |
AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
AT1G21750 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily; isoform contains non-consensus GA donor splice site at intron 9. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. The mRNA is cell-to-cell mobile. |
AT1G77510 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner. |
AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
AT3G05910 | Pectinacetylesterase family protein;(source:Araport11) |
AT1G53840 | encodes a pectin methylesterase |
AT1G53830 | encodes a pectin methylesterase |
AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
AT3G23020 | Encodes a chloroplast nucleoid-localized protein whose absence leads to broadly impaired plastid gene expression and chloroplast development. |
AT1G06580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G26000 | Encodes a novel Arabidopsis gene encoding a polypeptide with K-homology (KH) RNA-binding modules, which acts on vegetative growth and pistil development. Genetic studies suggest that PEP interacts with element(s) of the CLAVATA signaling pathway. |
AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
AT2G26350 | Zinc-binding peroxisomal integral membrane protein (PEX10). Inserted directly from the cytosol into peroxisomes and is involved in importing proteins into the peroxisome. Required for embryogenesis. |
AT3G21865 | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. |
AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
AT1G12710 | This gene is predicted to encode a protein with a PP2 domain. This domain in present in lectins found in squash and cucumber, suggesting that this protein could potentially have carbohydrate binding capabilities. |
AT3G53000 | phloem protein 2-A15;(source:Araport11) |
AT2G02360 | Encodes an F-box protein containing a Nictaba-related lectin domain that can act as a carbohydrate-binding protein.Expression is induced by SA and pathogenic bacteria. |
AT1G80110 | phloem protein 2-B11;(source:Araport11) |
AT5G23630 | A member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. MIA is also named PDR2 and was shown to be required for proper expression of SCARECROW (SCR), a key regulator of root patterning, and for stem-cell maintenance in Pi-deprived roots. |
AT2G29650 | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. |
AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
AT1G12580 | phosphoenolpyruvate carboxylase-related kinase 1;(source:Araport11) |
AT1G78050 | phosphoglycerate/bisphosphoglycerate mutase;(source:Araport11) |
AT2G46500 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. Phosphorylates PUFD1 and RPN10 in vitro. |
AT4G11850 | Encodes a phospholipase D (gamma) that is involved in aluminum tolerance and plays a role in membrane lipid modulation under Al stress. |
AT4G11830 | Encodes one of three phospholipase D enzymes of the gamma class. |
AT4G11840 | member of C2-PLD subfamily |
AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT1G80860 | Encodes a single-copy phospholipid N-methyltransferase, involved in phosphatidylcholine biosynthesis. Has specific activity towards phosphatidylmonomethylethanolamine and phosphatidyldimethylethanolamine, but not phosphatidylethanolamine. |
AT1G04010 | phospholipid sterol acyl transferase 1;(source:Araport11) |
AT1G32060 | phosphoribulokinase;(source:Araport11) |
AT4G15130 | phosphorylcholine cytidylyltransferase2;(source:Araport11) |
AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
AT3G16250 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. Contains a 4Fe-4S cluster. |
AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
AT1G19150 | PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA, The mRNA is cell-to-cell mobile. |
AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
AT2G20260 | Encodes subunit E of photosystem I. The mRNA is cell-to-cell mobile. |
AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
AT1G52230 | Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
AT1G30380 | Encodes subunit K of photosystem I reaction center. The mRNA is cell-to-cell mobile. |
AT1G08380 | Encodes subunit O of photosystem I. |
AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
AT4G21280 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
AT1G79040 | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ. |
AT3G21055 | Encodes photosystem II 5 kD protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which also has a plastid-encoded paralog (PsbTc). |
AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
AT1G62390 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G20360 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G29000 | MYB-CC family member. PHL1 acts redundantly with PHR1 to regulate responses to Pi starvation. |
AT2G01490 | Encodes a phytanoyl-CoA 2-hydroxylase (PAHX). The mRNA is cell-to-cell mobile. |
AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT3G16500 | phytochrome-associated protein 1 (PAP1) |
AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G06570 | Mutation of the PDS1 locus disrupts the activity of p-hydroxyphenylpyruvate dioxygenase (HPPDase), the first committed step in the synthesis of both plastoquinone and tocopherols in plants. |
AT1G71720 | Encodes a chloroplast localized protein that regulates the translation of Ycf1 by binding to its mRNA. It is involved in the biogenesis of photosynthetic complexes. |
AT2G26510 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT2G01420 | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). |
AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
AT1G71090 | Auxin efflux carrier family protein;(source:Araport11) |
AT5G65980 | Auxin efflux carrier family protein;(source:Araport11) |
AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
AT3G02800 | Encodes an atypical dual-specificity phosphatase. |
AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT3G11330 | Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
AT2G40120 | Protein kinase superfamily protein;(source:Araport11) |
AT4G36650 | Encodes a protein with similarity to the general transcription factor TFIIB. pBRP binds rDNA sequences in vitro. pBRP has been localized to the outer face of the plastid membrane with GFP fusion however, under conditions of proteosome inhibition it is found in the nucleus. |
AT3G61430 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. The mRNA is cell-to-cell mobile. |
AT2G45960 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. Involved redundantly with PIP1;1/3/4/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
AT1G01620 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. Involved redundantly with PIP1;1/2/4/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
AT2G37170 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev |
AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
AT3G62590 | PLIP3 is a glycerolipid A1 lipase with substrate specificity for phosphatidylglycerol. Expression is induced by ABA. |
AT1G02660 | PLIP2 is a glycerolipid A1 lipase with substrate preference for monogalactosyldiacylglycerol. Expression is induced by ABA. |
AT3G13120 | Ribosomal protein S10p/S20e family protein;(source:Araport11) |
AT5G47190 | Ribosomal protein L19 family protein;(source:Araport11) |
AT1G29070 | Ribosomal protein L34;(source:Araport11) |
AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
AT1G80480 | plastid transcriptionally active 17;(source:Araport11) |
AT1G21600 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. essential subunit of the plastid-encoded RNA polymerase (PEP). Mediates phytochrome signaling. |
AT3G56910 | Encodes PSRP5 (PLASTID-SPECIFIC 50S RIBOSOMAL PROTEIN 5). Functions in plastid translation. |
AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
AT4G39730 | PLAT1 domain stress protein family member. Involved in mediating response to stresses such as pathogen infection. It is found in endoplasmic reticulum bodies. PLAT1 is induced by pathogenic fungi and induces the production of scopolin. |
AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
AT1G67960 | POD1 is involved in pollen tube guidence and early embryo patterning. |
AT1G71770 | Encodes a Class I polyA-binding protein. Expressed in floral organs. Binds polyA sepharose in vitro. |
AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
AT2G43020 | Encodes a polyamine oxidase. |
AT3G59050 | Encodes a polyamine oxidase. |
AT1G70370 | Polygalacturonase involved in cell wall modification. |
AT1G48100 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
AT4G23660 | Encodes para-hydroxy benzoate polyprenyl diphosphate transferase. The enzyme was shown to be able to use a wide range of prenyl substrates : from GPP (C10) to decaprenyl diphosphate (C50). |
AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT5G03240 | encodes ubiquitin that is attached to proteins destined for degradation. UBQ3 is most homologous with UBQ4, and is expressed in higher levels in vegetative tissue but lower levels in flowers than UBQ4. UBQ3 encodes different number of ubiquitins in different ecotypes. UBQ3 transcript level is modulated by UV-B and light/dark treatments. |
AT4G07410 | Encodes a WD-40 protein expressed both during embryo development and postembryonically in the SAM and RAM that functions in the auxin pathway, integrating auxin signaling in the organization and maintenance of the SAM and RAM. |
AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
AT1G04690 | potassium channel beta subunit 1;(source:Araport11) |
AT2G40540 | putative potassium transporter AtKT2p (AtKT2) mRNA, |
AT3G61600 | POZ/BTB containing-protein AtPOB1. Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. The mRNA is cell-to-cell mobile. |
AT5G51700 | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
AT5G05380 | prenylated RAB acceptor 1.B3;(source:Araport11) |
AT3G13710 | prenylated RAB acceptor 1.F4;(source:Araport11) |
AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
AT1G49630 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed in flower, leaf and root. Not expressed in silique and shoot. |
AT2G14260 | encodes proline iminopeptidase |
AT3G62120 | Encodes a cytosolic prolyl-tRNA synthetase. |
AT5G04270 | DHHC-type zinc finger family protein;(source:Araport11) |
AT4G22750 | Encodes a protein S-acyltransferase that, together with PAT14, cooperatively regulates leaf senescence. |
AT5G49020 | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
AT5G47420 | PAWH2 along with PAWH1 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
AT2G02800 | Encodes protein kinase APK2b. |
AT5G19680 | PP1 Regulatory Subunit3. Interacts with members of the Type One Protein Phosphatases (TOPP) family.Facilitates the nuclear localization of TOPP4 which is required for its activity in mediating ABA responses. |
AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
AT2G33640 | DHHC-type zinc finger family protein that encodes a functional s-acyl transferase. |
AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
AT5G50240 | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
AT3G08730 | Encodes a protein-serine kinase that phosphorylates ribosomal protein in vitro. Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Involved in translational up-regulation of ribosomal proteins. Phosphorylated by PDK1. Interacts with RAPTOR1, which in turn interacts with TOR. SPK6 activity is affected by osmotic stress, and plants overexpressing S6k1 are hypersensitive to osmotic stress. The gene is expressed in all tissues examined, with highest expression level detected in metabolically active tissues. |
AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
AT5G06970 | PATROL1 is a Munc13-like protein involved in mediating H[+]-ATPase translocation. It interacts with AHA1and is responsible for its translocation during stomatal movement. |
AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
AT2G01918 | Encode a protein homologous to each PQL protein. Mutational analysis indicates that PQL3 is also required for NDH activity. |
AT5G02810 | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
AT2G46790 | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR7 to regulate hypocotyl growth under photoperiodic conditions. |
AT5G52420 | transmembrane protein;(source:Araport11) |
AT5G56510 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT2G16430 | Encodes an acid phosphatase involved plant acclimation to Pi deprivation. |
AT2G27190 | Encodes a root-secreted purple acid phosphatase involved in extracellular phosphate-scavenging. PEP complex component. |
AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
AT3G20500 | purple acid phosphatase 18;(source:Araport11) |
AT3G52810 | purple acid phosphatase 21;(source:Araport11) |
AT5G34850 | Encodes a root-secreted purple acid phosphatase precursor involved in extracellular phosphate-scavenging. |
AT5G40340 | PWWP domain protein involved in regulation of FLC and flowering time. |
AT3G05430 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT5G02950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
AT2G36570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. The mRNA is cell-to-cell mobile. |
AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
AT3G20330 | encodes aspartate carbamoyltransferase catalyzing the second step in the de novo pyrimidine ribonucleotide biosynthesis |
AT2G18230 | Encodes a protein that might have inorganic pyrophosphatase activity. |
AT3G53620 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
AT5G54960 | pyruvate decarboxylase-2 |
AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile. |
AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
AT3G53610 | GTPase AtRAB8 (atrab8). AtRAB8s associate with the endomembrane system and modulate tubulovesicular trafficking between compartments of the biosynthetic and endocytic pathways. Together with RAB8A and 8D interacts with several RTNLB proteins and participates in A. tumefaciens and P. syringae infection processes. |
AT5G03520 | GTPase that colocalizes with golgi and plasma membranes. |
AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
AT2G22390 | Encodes an unusual RabA family member as it has a Lysine the position of the highly conserved Glu of the WDTAGQE motif and has the sequence CVAA! at its C-ter rather than the conventional CCXX(X) or CXC motifs that promote geranylgeranylation and membrane anchoring. |
AT5G47520 | RAB GTPase homolog A5A;(source:Araport11) |
AT5G39620 | RAB GTPase homolog G1;(source:Araport11) |
AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
AT3G25170 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
AT3G21060 | Encodes a structural core component of a COMPASS-like H3K4 histone methylation complex that is also involved in the timing of the floral transition. |
AT3G05370 | receptor like protein 31;(source:Araport11) |
AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
AT5G27680 | RECQ helicase SIM;(source:Araport11) |
AT4G28080 | Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment. |
AT5G53160 | Encodes RCAR3, a regulatory component of ABA receptor. Interacts with protein phosphatase 2Cs ABI1 and ABI2. Stimulates ABA signaling. The mRNA is cell-to-cell mobile. |
AT5G42040 | regulatory particle non-ATPase 12B;(source:Araport11) |
AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. The mRNA is cell-to-cell mobile. |
AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile. |
AT1G22190 | The gene encodes a putative transcription factor belongings to the abiotic stress-associated DREB A-6 clade. The mRNA is cell-to-cell mobile. |
AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
AT3G57540 | Remorin family protein;(source:Araport11) |
AT2G41870 | Remorin family protein;(source:Araport11) |
AT4G11170 | Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1. |
AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
AT1G09090 | NADPH-oxidase AtrbohB plays a role in seed after-ripening. Major producer of superoxide in germinating seeds. AtrbohB pre-mRNA is alternatively spliced in seeds in a hormonally and developmentally regulated manner. ABA caused accumulation of AtrbohB-? mRNA and prevented prevented AtrbohB-a mRNA expression in fresh seeds. |
AT5G58080 | member of Response Regulator: B- Type |
AT3G62670 | member of Response Regulator: B- Type |
AT3G48100 | Encodes a transcription repressor that mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two-component phosphorelay. |
AT1G19050 | Encodes a member of the Arabidopsis response regulator (ARR) family, most closely related to ARR15. A two-component response regulator protein containing a phosphate accepting domain in the receiver domain but lacking a DNA binding domain in the output domain. Involved in response to cytokinin and meristem stem cell maintenance. Arr7 protein is stabilized by cytokinin. |
AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
AT1G09950 | RESPONSE TO ABA AND SALT 1;(source:Araport11) |
AT1G03120 | responsive to abscisic acid 28;(source:Araport11) |
AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
AT2G33380 | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxy-octadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. |
AT4G28430 | Reticulon family protein;(source:Araport11) |
AT2G46170 | Reticulon family protein;(source:Araport11) |
AT3G10260 | Reticulon family protein;(source:Araport11) |
AT3G12280 | Encodes a retinoblastoma homologue RETINOBLASTOMA-RELATED protein (RBR or RBR1). RBR controls nuclear proliferation in the female gametophyte. Also required for correct differentiation of male gametophytic cell types. Regulates stem cell maintenance in Arabidopsis roots. Involved in the determination of cell cycle arrest in G1 phase after sucrose starvation. RBR1 is also involved in regulation of imprinted genes. Together with MSI1 it represses the expression of MET1. This in turn activates expression of the imprinted genes FIS2 and FWA. Functions as a positive regulator of the developmental switch from embryonic heterotrophic growth to autotrophic growth.ChIP studies indicate that one class of targets of RBR1 are transposable elements. |
AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
AT4G01280 | RVE5 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
AT5G15740 | RRT1 is a member of a novel glycosyltransferase famly in plants. It functions as a rhamnosyltransferase, elongating the RG-1 backbone. It functions during seed coat mucilage development. |
AT1G14020 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
AT5G07250 | RHOMBOID-like protein 3;(source:Araport11) |
AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
AT3G49080 | Mitochondrial ribosomal protein, similar to RPS9 from E.coli. Loss of function results in gametophyte lethality, particularly the megagametophyte. |
AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
AT5G59550 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
AT5G63970 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
AT3G56580 | Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis. |
AT5G22920 | Encodes a protein with sequence similarity to RING, zinc finger proteins. Loss of function mutations show reduced (15%) stomatal aperture under non stress conditions. |
AT4G11370 | Encodes a putative RING-H2 finger protein RHA1a. |
AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
AT3G11770 | RICE1 is a 23kDa protein with 3?- 5? exoribonuclease activity. It is expressed ubiquitously and localized to the cytoplasm. When RICE1 and its paralog RICE2 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage. |
AT1G80670 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
AT3G61240 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G55150 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G12700 | Encodes RNA PROCESSING FACTOR 1 (RPF1), a pentatricopeptide repeat (PPR) protein of the P-class containing canonical PPR-repeats. RPF1 is required for the 5?-end processing of the nad4 mRNA in mitochondria. Ler and other accessions impaired in processing of the nad4 mRNA 5′-end, contain a single nucleotide polymorphism (SNP) 807 nucleotides downstream of the predicted translation start codon (G807A). The resulting premature translation termination codon abolishes the function of the RPF1 gene in Ler. Required for the formation of nad4L-atp4 transcripts with -318 5′ termini. |
AT3G23830 | encodes a glycine-rich RNA binding protein. Gene expression is induced by cold and reduced by ionic (salt) and non-ionic (mannitol) osmotic stress. Lines overexpressing the gene are slightly more tolerant to osmotic stress during germination. |
AT4G13850 | Encodes a glycine-rich RNA-binding protein. Gene expression is induced by cold. |
AT5G61030 | Encodes a glycine-rich RNA binding protein that is involved in C-> U RNA editing in mitochondria. Gene expression is induced by cold. The mRNA is cell-to-cell mobile. |
AT3G26420 | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. Members of this protein family include AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b) and AT5G04280 (AtRZ-1c). |
AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
AT3G22680 | Encodes RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex with DMS3 (AT3G49250) and DRD1 (AT2G16390). This complex is termed DDR. The DDR complex is required for polymerase V transcripts and RNA-directed DNA methylation. |
AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
AT1G64440 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis. |
AT5G02820 | Involved in the patterning and shape of leaf trichomes. Encodes the DNA topoisomerase VI SPO11-3, involved in endoreduplication |
AT5G01510 | root UVB sensitive protein (Protein of unknown function, DUF647);(source:Araport11) |
AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
AT3G16130 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT4G34870 | belongs to cyclophilin family |
AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
AT2G16600 | Encodes cytosolic cyclophilin ROC3. The mRNA is cell-to-cell mobile. |
AT5G58710 | Encodes cyclophilin ROC7. The mRNA is cell-to-cell mobile. |
AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
AT1G67265 | ROTUNDIFOLIA like 21;(source:Araport11) |
AT4G35783 | ROTUNDIFOLIA like 6;(source:Araport11) |
AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
AT1G77680 | Ribonuclease II/R family protein;(source:Araport11) |
AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
AT1G23860 | Encodes a 9G8-like serine-arginine rich (SR) protein that interacts in vivo with U1-70K, a U1 small nuclear ribonucleoprotein 70-kDa protein that is involved in nuclear precursor mRNA processing. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT5G18700 | Encodes a microtubule-associated kinase-like protein RUNKEL (RUK). Contains a putative serine/threonine kinase domain and a microtubule-binding domain. RUK directly binds to microtubules in vitro and colocalizes with mitotic preprophase band, spindle, and phragmoplast in vivo. Required for cell plate expansion in cytokinesis. |
AT2G35800 | Encodes a predicted calcium-dependent S-adenosyl methionine carrier. |
AT3G02470 | Encodes a S-adenosylmethionine decarboxylase involved in polyamine biosynthesis. |
AT5G15950 | Adenosylmethionine decarboxylase family protein;(source:Araport11) |
AT1G12800 | SDP is a chloroplast localized RNA binding protein that is required for plastid rRNA processing. Plants harboring a mutation in SDP have numerous defects including reduced chlorophyll content, poor growth, yellow leaves and abnormal chloroplasts. |
AT3G23700 | Encodes a chloroplast-localized S1 domain-containing protein with RNA chaperone activity that affects the splicing and processing of chloroplast transcripts and plays a role in seedling growth in the presence of ABA. Binds the chloroplast psbA RNA and some other chloroplast RNAs. Required for the stability of the chloroplast ndhC RNA. Inhibits ribosome association with psbA RNA and ycf1 RNA. Not required for the splicing of chloroplast trnL, as had been reported previously. |
AT5G03350 | Belongs to the group of early SA-activated genes. Involved in resistance to Pst Avr-Rpm1 as a component of the SA35 mediated defense processes associated to the ETI response. Involved in resistance to P.syringae pv. tomato Avr-Rpm1 in Arabidopsis, as a component of the SA-mediated defense processes associated with the effector-triggered immunity response. |
AT3G51830 | putative transmembrane protein G5p (AtG5) mRNA, complete. autophagy-related (ATG) gene |
AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
AT3G46550 | Isolated in a screen for salt hypersensitive mutants. Mutants have thinner cell walls, abnormal siliques and root growth is inhibited under salt stress. The gene has similarity to arabinogalactan proteins and domains associated with cell adhesion.SOS5 is required for normal mucilage adherence to seeds. |
AT1G27760 | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
AT5G60410 | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. Regulates leaf cell division and expansion through salicylic acid accumulation. signaling |
AT1G75060 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
AT5G52510 | SCARECROW-like 8;(source:Araport11) |
AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile. |
AT4G18140 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
AT4G36490 | SEC14-like 12;(source:Araport11) |
AT3G62440 | Encodes an F-box protein which is predominantly expressed in flower tissues and interacts with ASK19 protein. Mutations in this gene suggest it acts as a negative regulator of endothecial secondary wall thickening in anthers. |
AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
AT1G56330 | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. |
AT1G09180 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
AT2G20840 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
AT1G32050 | SCAMP family protein;(source:Araport11) |
AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile. |
AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
AT4G18520 | Encodes a PPR (pentatricopeptide repeat) protein PDM1/SEL1. Involved in RNA editing and splicing of plastid genes. |
AT3G10420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G47300 | SELT-like protein precursor;(source:Araport11) |
AT4G35770 | Senescence-associated gene that is strongly induced by phosphate starvation. Transcripts are differentially regulated at the level of mRNA stability at different times of day. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
AT3G06510 | Encodes a protein with beta-glucosidase and galactosyltransferase activity, mutants show increased sensitivity to freezing. Though it is classified as a family I glycosyl hydrolase, it has no hydrolase activity in vitro. |
AT5G59560 | Encodes a novel protein conserved in higher eukaryotes. Normal function of the protein is required for normal oscillator function during circadian rhythm. Mutant analyses also suggest a role in phytochrome B (phyB)-mediated light signaling. |
AT1G24260 | Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. Flowers of SEP1/2/3 triple mutants show a conversion of petals and stamens to sepals.SEP3 forms heterotetrameric complexes with other MADS box family members and binds to the CArG box motif. |
AT2G22970 | serine carboxypeptidase-like 11;(source:Araport11) |
AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
AT3G63470 | serine carboxypeptidase-like 40;(source:Araport11) |
AT3G10410 | SERINE CARBOXYPEPTIDASE-LIKE 49;(source:Araport11) |
AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
AT4G38470 | Serine/threonine kinase that phosphorylate transit peptides of chloroplast and mitochondria targeted pre-proteins. |
AT2G24360 | STYK serine threonine kinase that phosphorylates several oil body proteins including OLE1 and CLO4/CAL4. |
AT4G25520 | SEUSS-like 1;(source:Araport11) |
AT5G62090 | Encodes a protein that functions with LUH to promote Al binding to the root cell wall. |
AT1G17040 | Encodes a protein that contains an SH2 domain. It can pull down a 120-kD tyrosine-phosphorylated protein in vitro. It is predicted to act as a transcription factor. |
AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
AT3G06125 | Unknown gene The mRNA is cell-to-cell mobile. |
AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT3G27884 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT5G24735 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G55290 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
AT1G08180 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT1G07500 | SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
AT5G16270 | Encodes a SCC1/REC8 ortholog that may be involved in mitosis and may represent a mitotic cohesin. Plays a role in somatic DNA double strand break damage repair. The mRNA is cell-to-cell mobile. |
AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
AT1G10230 | Involved in protein degradation. One target is PHR1. |
AT2G45950 | SKP1-like 20;(source:Araport11) |
AT5G67250 | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
AT1G76160 | SKU5 similar 5;(source:Araport11) |
AT4G38420 | SKU5 similar 9;(source:Araport11) |
AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
AT4G38850 | mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants. |
AT4G38840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34800 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G03310 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G06210 | Encodes a chloroplast protein involved in the responses to salt and oxidative stresses. |
AT2G30942 | Encodes a 56-amino acid polypeptide with low but significant similarity to human small subunit of serine palmitoyltransferase that localizes to the ER and physically interacts with and greatly stimulates the activity of LCB1/LCB2 heterodimer ser palmitoyltransferase complex. |
AT4G34620 | Encodes ribosomal protein S16, has embryo-defective lethal mutant phenotype |
AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
AT5G63650 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
AT1G17050 | Encodes one of the two paralogous solanesyl diphosphate synthases - SPS1 (At1g78510) and SPS2 (At1g17050) - that assemble the side-chain of plastoquinone-9 in plastids. |
AT1G14750 | Encodes a meiotic cyclin-like protein, distinct from all other known Arabidopsis cyclins. It is not required for meiotic DSB formation but is necessary for meiotic DSB repair via the homologous chromosome. |
AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
AT1G69640 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
AT5G15600 | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
AT4G34640 | Encodes squalene synthase, which converts two molecules of farnesyl diphosphate (FPP) into squalene via an intermediate: presqualene diphosphate (PSPP). It is generally thought to be one of the key enzymes of sterol biosynthesis, since it catalyzes the first pathway-specific reaction of the sterol branch of the isoprenoid pathway. The mRNA is cell-to-cell mobile. |
AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
AT2G15790 | SQN encodes the Arabidopsis homolog of cyclophilin 40 (CyP40). It is specifically required for the vegetative but not the reproductive maturation of the shoot. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
AT2G36390 | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues. The mRNA is cell-to-cell mobile. |
AT1G10760 | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position. |
AT5G24300 | SSI is a plastidial enzyme and crucial for the synthesis of normal amylopectin in the leaves of Arabidopsis. The absence of SSI results in a deficiency in the number of shorter glucans which in turn affect the formation and connection of the amylopectin clusters in starch. |
AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
AT3G57420 | Regulates the assembly and trafficking of cellulose synthase complexes. |
AT1G07420 | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. The sterol 4alpha-methyl oxidase2 family proteins SMO2-1 and SMO2-2 function partially through effects on auxin accumulation, auxin response and PIN1 expression to regulate embryogenesis in Arabidopsis. |
AT5G13710 | SMT1 controls the level of cholesterol in plants |
AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
AT4G30620 | Homolog of STIC2, recent duplication. |
AT4G18530 | lysine ketoglutarate reductase trans-splicing-like protein, putative (DUF707);(source:Araport11) |
AT3G12630 | Encodes a protein with E3 ligase activity that acts as a positive regulator of stress responses in Arabidopsis. |
AT2G17975 | SRP1 is a C2C2 type zinc finger protein that binds RNA. It has a role in response to ABA.. It can bind the 3'UTR of ABI2 and appears to be involved in RNA turnover. |
AT2G21970 | stress enhanced protein 2 (SEP2) chlorophyll a/b-binding protein |
AT2G25110 | Encodes an endoplasmic reticulum protein SDF2 (stromal-derived factor-2). Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
AT5G65165 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds, and markedly decline during germination. |
AT5G67490 | SDHAF4 acts on FAD-SDH1 and promotes its assembly with SDH2, thereby stabilizing SDH2 and enabling its full assembly with SDH3/SDH4 to form the SDH complex. |
AT2G46505 | Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. |
AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
AT5G11110 | Encodes a sucrose-phosphate synthase involved in pollen exine formation. This is the dominant SPS isoform in leaves with respect to protein levels. |
AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
AT3G12520 | Encodes a sulfate transporter that in induced under sulfate limitation. |
AT5G04590 | A.thaliana gene encoding sulfite reductase. |
AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
AT1G04770 | SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis. |
AT5G66040 | Encodes a protein with thiosulfate sulfurtransferase/rhodanese activity in vitro, however, it is likely to use a substrate other than thiosulfate or 3-mercaptopyruvate in vivo. The mRNA is cell-to-cell mobile. |
AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
AT1G71360 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. |
AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
AT3G09630 | Ribosomal protein L4/L1 family;(source:Araport11) |
AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
AT3G06670 | SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA. |
AT2G43710 | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. Redundant Δ9 stearoyl-ACP desaturase gene which together with AAD1 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with AAD1, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
AT2G45070 | Sec61 Beta Subunit |
AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
AT5G05490 | Encodes a RAD21-like gene essential for meiosis. Encodes a 627 a.a. protein that is slightly longer in the N-terminus than SYN1 BP5. |
AT2G20990 | Encodes a protein specifically localized to the ER-PM boundary with similarity to synaptotagmins, a class of membrane trafficking proteins. SYT1 is expressed in all tissues. Loss of function mutations show hypersensitivity to NaCl and electrolyte leakage from the plasma membrane. SYT1 also affects calcium dependent freezing tolerance and mechanical stress response. Regulates endocytosis endosome recycling at the plasma membrane, but not membrane traffic along the secretory pathway. SYT1 may have a role in membrane repair such as membrane resealing after freezing induced damage. SYT1 binds to phosphatidylinositol phosphates in vitro. It is distributed to immobile tubules and likely plays an important role in the formation of the tubular ER network as well as in cellular ER-PM tethering. |
AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
AT5G26980 | member of SYP4 Gene Family |
AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
AT3G61450 | syntaxin of plants 73 (SYP73) |
AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
AT4G34270 | TOR signaling pathway protein. |
AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
AT1G55520 | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex. |
AT1G50300 | TBP-associated factor 15;(source:Araport11) |
AT5G51910 | TCP family transcription factor;(source:Araport11) |
AT5G24590 | Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV. |
AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
AT2G19580 | Member of TETRASPANIN family |
AT3G45600 | Member of TETRASPANIN family |
AT5G60220 | Member of TETRASPANIN family |
AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
AT1G04530 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. The mRNA is cell-to-cell mobile. |
AT3G59280 | Encodes the ortholog of yeast PAM16, part of the mitochondrial inner membrane protein import motor. Single mutant plants exhibit a smaller size and enhanced resistance against virulent pathogens. They also display elevated reactive oxygen species (ROS) accumulation. |
AT5G42980 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. The mRNA is cell-to-cell mobile. |
AT5G16400 | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
AT4G09010 | Encodes a thylakoid lumen protein that was initially believed to act as a microsomal ascorbate peroxidase APX4 but to date, no evidence of enzymatic activity has been found. |
AT4G01050 | hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain. Required for anchoring the FNR flavoenzyme to the thylakoid membranes and sustaining high efficiency photosynthetic linear electron flow. The mRNA is cell-to-cell mobile. |
AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT3G63180 | TIC-like protein;(source:Araport11) |
AT2G46640 | Encodes TAC1 (Tiller Angle Control 1). Influences axillary branch growth angle. Inflorescence stems of TAC1 mutants are vertically oriented and have axillary shoots with narrow branch angles. |
AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
AT5G56220 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
AT3G63500 | Encodes a PHD-finger protein that, with TTA2, is redundantly required for MP-dependent embryonic root meristem initiation. |
AT1G32400 | TOM2A encodes a 280 amino acid putative four-pass transmembrane protein with a C-terminal farnesylation signal, essential for efficient multiplication of tobacco mosaic viruses. |
AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
AT1G21380 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT5G63640 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
AT5G47450 | Tonoplast intrinsic protein, transports ammonium (NH3) and methylammonium across the tonoplast membrane, gene expression shows diurnal regulation and is upregulated by ammonium (NH3). |
AT1G80080 | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. Its transcript levels change after inducing MUTE expression in a mute background. |
AT1G15750 | Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. |
AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
AT3G16830 | TOPLESS family member which directly binds the N-terminal domain of SNC1 and interacts with TPR1. |
AT5G27030 | TOPLESS family member involved in the negative regulation of SNC1-dependent phenotypes. |
AT5G16750 | Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. |
AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
AT3G10330 | Cyclin-like family protein;(source:Araport11) |
AT5G24710 | WD40/YVTN repeat protein which cooperates with the AP2 complex in the clathrin-mediated endocytosis of cellulose synthase to regulate cellulose biosynthesis. |
AT3G46560 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM10, AtTIM9 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
AT5G16620 | chloroplast protein import (Tic40) |
AT1G10950 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. Functions in the deposition of rhamnogalacturonan II and I for cell growth. |
AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G06410 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G55440 | Encodes triosephosphate isomerase. |
AT4G01880 | methyltransferase;(source:Araport11) |
AT3G02320 | Involved in posttranscriptional modification of tRNA. |
AT3G56330 | Involved in posttranscriptional modification of plastid tRNA. |
AT1G03110 | Encodes a gene involved in the modification of nucleosides in tRNA. Mutants have no 7-methylguanosine. |
AT5G19200 | Encodes one of the Arabidopsis proteins (At3g06060/TSC10A and At5g19200/TSC10B) with significant similarity to the yeast 3-ketodihydrosphinganine (3-KDS) reductase, Tsc10p. Both TSC10A and TSC10B are bona fide 3-KDS reductase as shown by complementation experiment in yeast. |
AT2G47770 | Encodes a membrane-bound protein designated AtTSPO (Arabidopsis thaliana TSPO-related). AtTSPO is related to the bacterial outer membrane tryptophan-rich sensory protein (TspO) and the mammalian mitochondrial 18 kDa Translocator Protein (18 kDa TSPO), members of the TspO/MBR domain-containing membrane proteins. Mainly detected in dry seeds, but can be induced in vegetative tissues by osmotic or salt stress or abscisic acid treatment. Located in endoplasmic reticulum and the Golgi stacks. It is degraded through the autophagy pathway. |
AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
AT1G50010 | Encodes alpha-2,4 tubulin. TUA2 and TUA4 encode identical proteins. The mRNA is cell-to-cell mobile. |
AT5G19770 | tubulin 3 |
AT1G04820 | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers. |
AT4G14960 | Encodes an alpha-tubulin isoform required for right handed helical growth. |
AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
AT5G62700 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
AT1G20010 | beta tubulin |
AT5G61780 | Involved in the regulation of AtGA20ox3 expression, as well as seed germination. The mRNA is cell-to-cell mobile. |
AT5G01075 | Encodes a small ER-localized protein that is strongly expressed in seeds and regulates both embryo development and accumulation of storage compounds. At the cellular level, TWS1 is responsible for cuticle deposition on epidermal cells and organization of the endomembrane system. |
AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
AT5G09585 | U2;(source:Araport11) |
AT4G10970 | UAP56-interacting factor1, binds single stranded RNA and, along with UIEF2,,appears to play a role in nuclear export of RNA. |
AT4G05050 | polyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. |
AT3G46460 | May function together with UBC7 and UBC14 in the plant READ pathway, required in plant responses to multiple stress conditions. |
AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
AT5G42990 | ubiquitin-conjugating enzyme 18;(source:Araport11) |
AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
AT1G78870 | UBC35/UBC13A encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UBC35/UBC13A can form diubiquitin and triubiquitin chains in combination with MMZ1,2,3,4/(UEV1A,B,C,D) in vitro. It can also functionally complement an mms2 ubc13 mutation in budding yeast by increasing the double mutant's viability in the presence of the DNA damaging agent MMS, when it is co-expressed with MMZ / UEV1 genes. A wild type phenotype is restored with MMZ3/UEV1C and MMZ4/UEV1D, but only partial complementation is achieved with MMZ1/UEV1A or MMZ2/UEV1B. The mRNA is cell-to-cell mobile. |
AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT5G06600 | Encodes a ubiquitin-specific protease which together with UBP13 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
AT3G11910 | Ubiquitin-specific protease, which together with UBP12 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
AT1G17110 | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. Together with CUC2/CUC3-DA1 part of a regulatory module controls the initiation of axillary meristems, thereby determining plant architecture. As a direct substrate of DA1 peptidase, it represses the initiation of axillary meristems. |
AT2G27860 | Encodes UDP-d-apiose/UDP-d-xylose synthase that requires NAD+ for enzymatic activity and is strongly inhibited by UDP-d-galacturonate. |
AT1G08200 | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
AT4G23920 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis. |
AT4G10960 | Encodes a protein with UDP-D-glucose 4-epimerase activity. |
AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
AT2G45310 | UDP-D-glucuronate 4-epimerase |
AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
AT2G02810 | Encodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER. |
AT2G41490 | UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase |
AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
AT3G21780 | Encodes a protein with UDP-glucosyl transferase activity that was shown to preferentially glucosylates abscisic acid (ABA), and not its catabolites. Moreover, UGT71B6 was shown to have a strict preference for the naturally-occurring ABA enantiomer, (+)-ABA, and not its 'unnatural' relative, (-)-ABA. This is in contrast to the other identified UGT genes catalyzing the glucosylation of ABA which were shown to accept both stereoisomers as substrates. |
AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
AT5G05860 | Encodes a cytokinin N-glucosyltransferase that is involved in cytokinin homeostasis and cytokinin response in planta through cytokinin N-glucosylation. Expression is induced by ABA, mannitol and drought stress. Analysis of overexpressors and loss of function mutants indicate a role in response to osmotic and drought stress. |
AT1G78270 | UDP-glucosyl transferase 85A4;(source:Araport11) |
AT4G09500 | Glycosyltransferase which negatively regulates hypoxia stress response. |
AT5G52560 | Encodes a protein with UTP:sugar 1-phosphate uridylyltransferase activity, which has been shown to use a wide range of substrates including glucose-1-P, galactose-1-P, xylose-1-P, arabinose-1-P and glucuronate-1-P. The enzyme was shown to require Mg2+ or Mn2+ for activity. Mutations in USP can lead to a complete loss of male fertility. |
AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
AT5G02100 | Encodes a protein that binds to beta-sitosterol and localizes to the ER. The WFDE motif in ORP3a appears to be important for a direct interaction with PVA12 [Plant VAMP-Associated protein 12]. Mutation of this motif causes ORP3a to relocalize to the Golgi and cytosol. The interaction between PVA12 and ORP3a does not appear to be sterol-dependent. |
AT2G47470 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. The mRNA is cell-to-cell mobile. |
AT3G03340 | LUC7 related protein;(source:Araport11) |
AT3G03690 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G16730 | hypothetical protein;(source:Araport11) |
AT1G55810 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
AT2G37450 | nodulin MtN21-like transporter family protein |
AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
AT3G15620 | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
AT1G75630 | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile. |
AT1G78920 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
AT2G30950 | Metalloprotease that functions in thylakoid membrane biogenesis. Involved in the repair of PSII following damaged incurred during photoinhibition. Forms a complex with VAR1. Mutants show a variegated phenotype, which decreases during development. Transcript and protein levels increase with light intensity. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. |
AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
AT2G18870 | vernalization5/VIN3-like protein;(source:Araport11) |
AT1G26670 | member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. |
AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
AT4G23630 | VIRB2-interacting protein 1;(source:Araport11) |
AT4G11220 | VIRB2-interacting protein 2;(source:Araport11) |
AT5G41600 | VIRB2-interacting protein 3;(source:Araport11) |
AT5G04490 | Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis. |
AT5G67500 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16140 | Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT1G70950 | Microtubule-stabilizing protein. Module with MREL57 regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
AT2G26570 | Encodes a coiled-coil protein WEB1 (weak chloroplast movement under blue light 1). WEB1, together with another coiled-coil protein WEB2/PMI2 (At1g66840), maintains the chloroplast photorelocation movement velocity. |
AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
AT3G18750 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
AT3G55770 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
AT4G28240 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
AT4G05070 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
AT4G26455 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT5G56270 | Encodes WRKY transcription factor 2, a zinc-finger protein. In wrky2 mutants, egg cells polarize normally but zygotes fail to reestablish polar organelle positioning from a transient symmetric state, resulting in equal cell division and distorted embryo development. |
AT1G69810 | member of WRKY Transcription Factor; Group II-b |
AT3G04670 | member of WRKY Transcription Factor; Group II-d |
AT2G21900 | member of WRKY Transcription Factor; Group II-c |
AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
AT5G46350 | member of WRKY Transcription Factor; Group II-c |
AT5G07270 | hypothetical protein;(source:Araport11) |
AT1G09850 | Arabidopsis thaliana papain-like cysteine peptidase |
AT2G06850 | endoxyloglucan transferase (EXGT-A1) gene |
AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
AT4G03210 | Encodes a member of xyloglucan endotransglucosylase/hydrolases (XTHs) that catalyze the cleavage and molecular grafting of xyloglucan chains function in loosening and rearrangement of the cell wall. Gene is expressed in shoot apex region, flower buds, flower stalks and internodes bearing flowers. |
AT3G06290 | Encodes a component of the conserved TREX-2 complex that couples mRNA transcription with nucleo-cytoplasmic export, that is required for prevention of epigenetic gene silencing and has additional roles in regulating siRNAs and DNA methylation. |
AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
AT2G35980 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and during senescence. The gene product is localized to the chloroplast. The mRNA is cell-to-cell mobile. |
AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
AT5G13740 | Encodes ZIF1 (ZINC-INDUCED FACILITATOR1), a member of the Major Facilitator Superfamily (MFS) of membrane proteins which are found in all organisms and transport a wide range of small, organic molecules. Involved in a mechanism of Zn sequestration, possibly by transport of a Zn ligand or Zn-ligand complex into vacuoles. The mRNA is cell-to-cell mobile. |
AT5G13750 | zinc induced facilitator-like 1;(source:Araport11) |
AT1G10970 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root and shoot. Expression is regulated by copper, but response to copper deficiency is detected only after three weeks of deficiency. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT2G46800 | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |