| AT1G01010 | NAC domain containing protein 1;(source:Araport11) |
| AT1G01090 | pyruvate dehydrogenase E1 alpha subunit |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT1G01130 | CBL-interacting Serine/Threonine-kinase;(source:Araport11) |
| AT1G01150 | Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT1G01240 | transmembrane protein;(source:Araport11) |
| AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01410 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01448 | Natural antisense transcript overlaps with AT1G01450;(source:Araport11) |
| AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
| AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G01900 | Encodes AtSBT1.1, a subtilisin-like serine protease. Cleaves the phytosulfokine AtPSK4, a growth promoting peptide. |
| AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
| AT1G02220 | NAC domain transcription factor which functions as a negative regulator of the TDIF-PXY module and fine-tunes TDIF signaling in vascular development. Controls the balance of xylem formation and cambial cell divisions. |
| AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
| AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G02470 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G02540 | hypothetical protein;(source:Araport11) |
| AT1G02560 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G02760 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G02850 | beta glucosidase 11;(source:Araport11) |
| AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
| AT1G02920 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02950 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G03010 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
| AT1G03103 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT1G03220 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G03250 | R3H domain protein involved in ribosome biogenesis. |
| AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G03550 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
| AT1G03620 | ELMO/CED-12 family protein;(source:Araport11) |
| AT1G03660 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT1G03670 | Ankyrin repeat containing protein |
| AT1G03720 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G03740 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G03960 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT1G04100 | Auxin induced gene, IAA10 (IAA10). |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT1G04180 | YUCCA 9;(source:Araport11) |
| AT1G04220 | Encodes KCS2, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G04350 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT1G04380 | encodes a protein similar to a 2-oxoglutarate-dependent dioxygenase |
| AT1G04440 | Member of CKL gene family (CKL-C group). |
| AT1G04450 | Encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. The protein most similar to RIC1 (family subgroup III). Gene is expressed predominantly in inflorescence and flower tissue. Interacts with ROP1 to modulate calcium ion influxes required to generate tip-focused calcium gradients.It |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT1G04670 | hypothetical protein;(source:Araport11) |
| AT1G04800 | glycine-rich protein;(source:Araport11) |
| AT1G04820 | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers. |
| AT1G04970 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. Putative BPI/LBP family protein. |
| AT1G05000 | Encodes an atypical dual-specificity phosphatase. |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G05270 | TraB family protein;(source:Araport11) |
| AT1G05340 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT1G05530 | Encodes a protein with glucosyltransferase activity with high sequence homology to UGT1 (AT1G05560). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT2 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. |
| AT1G05610 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS2 is a minor small subunit isoform present in all plant tissues tested. |
| AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
| AT1G05670 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT1G05770 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G05800 | Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues. |
| AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
| AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
| AT1G05990 | EF hand calcium-binding protein family;(source:Araport11) |
| AT1G06020 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT1G06148 | hypothetical protein;(source:Araport11) |
| AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT1G06265 | Natural antisense transcript overlaps with AT1G06260;(source:Araport11) |
| AT1G06340 | Plant Tudor-like protein;(source:Araport11) |
| AT1G06490 | Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding. |
| AT1G06645 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G06750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G06890 | UXT3 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and functions as a UDP-Xyl transporter. |
| AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
| AT1G06970 | member of Putative Na+/H+ antiporter family |
| AT1G07050 | FITNESS encodes a protein with a single CCT domain and belongs to the CCT motif family genes (CMF). FITNESS acts upstream JUB1 thereby controlling H2O2 levels. FITNESS has a role in cellular redox homeostasis controlling H2O2 levels, due to changes in enzymes, metabolites and transcripts related to ROS detoxification. |
| AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G07120 | CHUP1-like protein;(source:Araport11) |
| AT1G07190 | Lon protease;(source:Araport11) |
| AT1G07460 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
| AT1G07560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G07610 | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The mRNA is cell-to-cell mobile. |
| AT1G07615 | GTP-binding protein Obg/CgtA;(source:Araport11) |
| AT1G07810 | Encodes an ER-type Ca2+-pumping ATPase. The mRNA is cell-to-cell mobile. |
| AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT1G08100 | Encodes a high-affinity nitrate transporter. |
| AT1G08125 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT1G08150 | member of Putative Na+/H+ antiporter family |
| AT1G08280 | Encodes a glycosyltransferase (GT) GALT29A, which belongs to the Carbohydrate Active Enzyme family GT29. GALT29A co-expresses with other arabinogalactan GTs, GALT31A and GLCAT14A. The recombinant GALT29A expressed in Nicotiana benthamiana demonstrated a galactosyltransferase activity, transferring galactose from UDP-galactose to a mixture of various oligosaccharides derived from arabinogalactan proteins. |
| AT1G08315 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G08320 | bZIP transcription factor family protein;(source:Araport11) |
| AT1G08470 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
| AT1G08620 | Member of family of Jumonji C (JmjC)-containing demethylases, its catalytic domain exhibits both H3K4 and H3K9 demethylation activities. Together with MMD1 promotes in male meiocytes gene expression in an H3K9me3-dependent manner and thereby contributes to meiotic chromosome condensation. |
| AT1G08730 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
| AT1G08790 | 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilon-1, putative (DUF1685);(source:Araport11) |
| AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT1G09000 | NPK1-related protein kinase 1S |
| AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT1G09176 | transmembrane protein;(source:Araport11) |
| AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G09380 | nodulin MtN21-like transporter family protein |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G09640 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
| AT1G09680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
| AT1G10060 | encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
| AT1G10180 | LOW protein: exocyst complex component-like protein;(source:Araport11) |
| AT1G10210 | Encodes ATMPK1. Kinase is activated by wounding. |
| AT1G10300 | GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1. |
| AT1G10330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G10385 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G10410 | CW14 protein (DUF1336);(source:Araport11) |
| AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT1G10450 | Encodes SIN3-like 6, a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT1G10500 | Involved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues. |
| AT1G10610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G10620 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G10680 | P-glycoprotein 10;(source:Araport11) |
| AT1G11040 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
| AT1G11250 | member of SYP12 Gene Family |
| AT1G11265 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-253 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G11410 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT1G11520 | pliceosome associated protein-like protein;(source:Araport11) |
| AT1G11572 | Encodes a Plant thionin family protein |
| AT1G11690 | BRANCHLESS TRICHOME-like protein;(source:Araport11) |
| AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G11803 | pseudogene of (SAUR) auxin-responsive family protein |
| AT1G11810 | Paternally expressed gene. |
| AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
| AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
| AT1G12040 | encodes a a chimeric leucine-rich repeat/extensin protein that regulates root hair morphogenesis and elongation. Null mutants develop root hairs that frequently abort, swell, or branch. Gene is expressed in root hair cells and protein is specifically localized in the wall of the hair proper. The mRNA is cell-to-cell mobile. |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT1G12180 | 14.7 kDa heat shock-like protein;(source:Araport11) |
| AT1G12210 | RFL1 has high sequence similarity to the adjacent disease resistance (R) gene RPS5. |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G12260 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT1G12710 | This gene is predicted to encode a protein with a PP2 domain. This domain in present in lectins found in squash and cucumber, suggesting that this protein could potentially have carbohydrate binding capabilities. |
| AT1G12740 | encodes a protein with cytochrome P450 domain |
| AT1G12850 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G12855 | F-box family protein;(source:Araport11) |
| AT1G12870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G13070 | putative cytochrome P450 |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT1G13140 | member of CYP86C |
| AT1G13150 | member of CYP86C |
| AT1G13200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G13370 | Histone superfamily protein;(source:Araport11) |
| AT1G13410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G13520 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G13580 | Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
| AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
| AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
| AT1G13755 | Encodes a defensin-like (DEFL) family protein. |
| AT1G14040 | Encodes a PHO1 homologue that is upregulated in response to Zn deficiency and is involved in Pi homeostasis in response to Zn deficiency. The mRNA is cell-to-cell mobile. |
| AT1G14160 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT1G14260 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
| AT1G14450 | NADH dehydrogenase (ubiquinone)s;(source:Araport11) |
| AT1G14510 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT1G14790 | Encodes RNA-dependent RNA polymerase. While not required for virus-induced post-transcriptional gene silencing (PTGS), it can promote turnover of viral RNAs in infected plants. Nomenclature according to Xie, et al. (2004). Involved in the production of Cucumber Mosaic Virus siRNAs. |
| AT1G14870 | PCR2 encodes a membrane protein involved in zinc transport and detoxification. |
| AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
| AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
| AT1G15385 | cotton fiber protein;(source:Araport11) |
| AT1G15560 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT1G15690 | Encodes a H(+)-translocating (pyrophosphate-energized) inorganic pyrophosphatase (H(+)-PPase; EC 3.6.1.1) located in the vacuolar membrane. Expression is found in all tissues examined, including meristems and floral organ primordium. Expression is particularly enhanced in pollen, and is repressed by light. Over expression and loss of function phenotypes suggest AVP1 is involved in regulation of apoplastic pH and auxin transport. The effect on auxin transport likely involves effects of extracellular pH on subcellular localization of auxin efflux carriers such as PIN1. The mRNA is cell-to-cell mobile. |
| AT1G15850 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G16025 | hypothetical protein;(source:Araport11) |
| AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
| AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16160 | WAK-like kinase The mRNA is cell-to-cell mobile. |
| AT1G16180 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT1G16310 | Cation efflux family protein which affects ABA-JA crosstalk and susceptibility to Mamestra brassicae herbivory. |
| AT1G16320 | plant/protein (DUF2358);(source:Araport11) |
| AT1G16380 | member of Putative Na+/H+ antiporter family |
| AT1G16410 | member of CYP79F The mRNA is cell-to-cell mobile. |
| AT1G16420 | Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0. |
| AT1G16440 | Member of AGC VIIIa Kinase gene family. Invovled in the maintenance of (p)ppGpp level to accustom plastidial gene expression to darkness. |
| AT1G16515 | transmembrane protein;(source:Araport11) |
| AT1G16560 | Per1-like family protein;(source:Araport11) |
| AT1G16720 | Encodes HCF173, a protein with weak similarities to the superfamily of the short-chain dehydrogenases/reductases. HCF173 is involved in the initiation of translation of the psbA mRNA and binds a specific site in the 5' UTR of psbA mRNA. Mutants shows a high chlorophyll fluorescence phenotype (hcf) and are severely affected in the accumulation of PSII subunits. The protein HCF173 is localized in the chloroplast, where it is mainly associated with the membrane system and is part of a higher molecular weight complex with psbA mRNA as a component of this complex. |
| AT1G16760 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G16770 | hypothetical protein;(source:Araport11) |
| AT1G16890 | UBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro. |
| AT1G16900 | Encodes the Arabidopsis ortholog of the yeast/human ALG9 catalyzing the luminal addition of two alpha-1,2 Man residues in assembling Glc3Man9GlcNAc2. |
| AT1G16905 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT1G16950 | transmembrane protein;(source:Araport11) |
| AT1G17000 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active but no trehalose phosphatase (TPP)-like domain. |
| AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
| AT1G17180 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plant over-expressing At1g17180 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
| AT1G17270 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
| AT1G17495 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-213 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
| AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G17700 | prenylated RAB acceptor 1.F1;(source:Araport11) |
| AT1G17744 | hypothetical protein;(source:Araport11) |
| AT1G17780 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G18191 | Pseudogene of AT1G18200; AtRABA6b (Arabidopsis Rab GTPase homolog A6b); GTP binding |
| AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
| AT1G18370 | Encodes a kinesin HINKEL. Required for cytokinesis in pollen. Mutant has cytokinesis defects; seedling lethal. |
| AT1G18390 | Serine/Threonine kinase family catalytic domain protein;(source:Araport11) |
| AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT1G18860 | member of WRKY Transcription Factor; Group II-b |
| AT1G18879 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AUCAGUUUCUUGUUCGUUUCA |
| AT1G18960 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G18970 | Encodes a germin-like protein with possible oxalate oxidase activity (based on GenBank record). |
| AT1G19010 | hypothetical protein;(source:Araport11) |
| AT1G19160 | F-box family protein;(source:Araport11) |
| AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
| AT1G19200 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT1G19320 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G19390 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
| AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
| AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
| AT1G19940 | glycosyl hydrolase 9B5;(source:Araport11) |
| AT1G20100 | DNA ligase-like protein;(source:Araport11) |
| AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
| AT1G20320 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT1G20360 | F-box family protein;(source:Araport11) |
| AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
| AT1G20700 | Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
| AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT1G20735 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT1G20790 | F-box family protein;(source:Araport11) |
| AT1G20920 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G20990 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
| AT1G21140 | The gene encodes nodulin-like1 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
| AT1G21150 | mTERF protein involved in mitochondrial development; required for salt tolerance. |
| AT1G21210 | cell wall-associated ser/thr kinase involved in cell elongation and lateral root development |
| AT1G21220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G21240 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
| AT1G21290 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-25 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G21340 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
| AT1G21528 | hypothetical protein;(source:Araport11) |
| AT1G21529 | DRIR is a 755 nt long non coding RNA. Over-expression results in plants with increased salt and drought tolerance and ABA sensitivity. DRIR probably regulates the accumulation of genes involved in drought stress response. DRIR likely acts as a regulator of drought stress responsive gene expression. |
| AT1G21660 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G21790 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G21850 | SKU5 similar 8;(source:Araport11) |
| AT1G21900 | Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER. |
| AT1G22060 | sporulation-specific protein;(source:Araport11) |
| AT1G22080 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G22150 | sulfate transporter Sultr1;3 |
| AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT1G22200 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
| AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
| AT1G22290 | 14-3-3 family protein;(source:Araport11) |
| AT1G22310 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT1G22350 | pseudogene of UDP-glucosyl transferase 85A5;(source:Araport11) |
| AT1G22420 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G22430 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G22460 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G22660 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT1G22885 | transmembrane protein;(source:Araport11) |
| AT1G22990 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
| AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G23060 | hypothetical protein;(source:Araport11) |
| AT1G23090 | Encodes AST91 mRNA for sulfate transporter. |
| AT1G23150 | hypothetical protein;(source:Araport11) |
| AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
| AT1G23201 | GCK domain protein;(source:Araport11) |
| AT1G23240 | Caleosin-related family protein |
| AT1G23250 | Caleosin-related family protein |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G23510 | OBP32pep protein;(source:Araport11) |
| AT1G23520 | hypothetical protein (DUF220);(source:Araport11) |
| AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT1G23830 | transmembrane protein;(source:Araport11) |
| AT1G23860 | Encodes a 9G8-like serine-arginine rich (SR) protein that interacts in vivo with U1-70K, a U1 small nuclear ribonucleoprotein 70-kDa protein that is involved in nuclear precursor mRNA processing. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT1G23910 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G23950 | hypothetical protein (DUF626);(source:Araport11) |
| AT1G24060 | hypothetical protein;(source:Araport11) |
| AT1G24110 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT1G24212 | pseudogene of paired amphipathic helix repeat-containing protein |
| AT1G24230 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G24485 | ER protein carbohydrate-binding protein;(source:Araport11) |
| AT1G24540 | member of CYP86C |
| AT1G25240 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT1G25250 | Encodes a transcription factor that, together with IDD14 and IDD15, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses . IDD16 also binds to the SPCH promoter and regulates stomata initiation. |
| AT1G25290 | Predicted to be a plastid rhomboid protease. Mutants show defects in phosphatidic acid metabolism. |
| AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G25310 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT1G26140 | hypothetical protein;(source:Araport11) |
| AT1G26320 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT1G26390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26420 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26450 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G26570 | UDP-glucose dehydrogenase 1;(source:Araport11) |
| AT1G26590 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G26600 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT1G26620 | T-box transcription factor, putative (DUF863);(source:Araport11) |
| AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
| AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G26770 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G26780 | Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560). |
| AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT1G26870 | NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
| AT1G26911 | Pseudogene of AT1G66590; cox19 family protein |
| AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
| AT1G27140 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G27160 | valyl-tRNA synthetase / valine-tRNA ligase-like protein;(source:Araport11) |
| AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
| AT1G27260 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G27270 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G27320 | Encodes a histidine kinases, a cytokinin receptor that controls cytokinin-mediated leaf longevity through a specific phosphorylation of the response regulator, ARR2. The mRNA is cell-to-cell mobile. |
| AT1G27480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G27560 | pseudogene of F-box family protein-related |
| AT1G27670 | transmembrane protein;(source:Araport11) |
| AT1G27710 | Glycine-rich protein family;(source:Araport11) |
| AT1G27860 | hypothetical protein (DUF626);(source:Araport11) |
| AT1G27890 | Deadenylase. |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT1G28000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G28010 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT1G28020 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G28040 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT1G28180 | DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11) |
| AT1G28260 | Telomerase activating protein Est1;(source:Araport11) |
| AT1G28300 | Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants. |
| AT1G28323 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-140 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
| AT1G28600 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G28670 | Arabidopsis thaliana lipase |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
| AT1G28700 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT1G28720 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G29010 | verprolin;(source:Araport11) |
| AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G29071 | predicted to encode a C/D box type of snoRNA, also known as Ath-282 (GB:AJ505633). But, the submitted sequence of 106 nucleotides is only part of the 162 nucleotide sequence predicted by Northern blotting. It is assumed that a 5' portion of the gene is missing and its 5' end has not been conclusively mapped. Sequence analysis of this snoRNA suggests that it may not function like other C/D box family members that modify rRNAs or snRNAs. Its true biological target remains unknown. The promoter of this snoRNA has hallmarks of the snRNA promoters targeted by RNA polymerase II, indicating that it might also have a TMG (2,2,7 trimethyguanosine) cap. SnoRNA105 may also play a novel role in ribosome biogenesis (Marker 2002). Northern blotting reveals that snoRNA105 expression levels are higher in seedlings than in adult plants. |
| AT1G29080 | Papain family cysteine protease;(source:Araport11) |
| AT1G29090 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G29100 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G29140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT1G29240 | transcription initiation factor TFIID subunit, putative (DUF688);(source:Araport11) |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G29420 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29460 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29475 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-91 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G29490 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G29690 | Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity. |
| AT1G29715 | pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G29720 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G29860 | member of WRKY Transcription Factor; Group II-c |
| AT1G29920 | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT1G30080 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G30180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G30190 | cotton fiber protein;(source:Araport11) |
| AT1G30210 | TCP family protein involved in heterochronic regulation of leaf differentiation. |
| AT1G30250 | hypothetical protein;(source:Araport11) |
| AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
| AT1G30290 | unknown protein |
| AT1G30320 | Remorin family protein;(source:Araport11) |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT1G30410 | member of MRP subfamily |
| AT1G30490 | Dominant PHV mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Has overlapping functions with PHABULOSA, REVOLUTA and CORONA/ATHB15 in patterning the apical portion of the embryo. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. |
| AT1G30530 | The At1g30530 gene encodes a UDP-rhamnose:flavonol-3-O-rhamnosyltransferase (UGT78D1) attaching a rhamnosyl residue to the 3-O-position of the flavonols kaempferol and quercetin |
| AT1G30560 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30750 | TPRXL;(source:Araport11) |
| AT1G30755 | elongation factor G, putative (DUF668);(source:Araport11) |
| AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G30845 | cell growth defect protein;(source:Araport11) |
| AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
| AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
| AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G30935 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G30950 | Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY. |
| AT1G30972 | Encodes a Plant thionin family protein |
| AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
| AT1G31093 | pseudogene of calcium-dependant protein kinase |
| AT1G31120 | potassium transporter |
| AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
| AT1G31160 | Encodes a member of the histidine triad nucleotide-binding family of proteins, but its activity has not been determined. |
| AT1G31260 | member of Fe(II) transporter isolog family |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G31330 | Encodes subunit F of photosystem I. |
| AT1G31390 | TRAF-like family protein;(source:Araport11) |
| AT1G31400 | TRAF-like family protein;(source:Araport11) |
| AT1G31430 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G31450 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT1G31490 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G31530 | Deadenylase. |
| AT1G31540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G31630 | AGAMOUS-like 86;(source:Araport11) |
| AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT1G31780 | Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen. |
| AT1G31800 | Encodes a protein with β-ring carotenoid hydroxylase activity. The mRNA is cell-to-cell mobile. |
| AT1G31820 | Encodes POLYAMINE UPTAKE TRANSPORTER 1, an amino acid permease family protein. |
| AT1G31885 | NOD26-like intrinsic protein 3;(source:Araport11) |
| AT1G31960 | hypothetical protein;(source:Araport11) |
| AT1G31970 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G31983 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G32060 | phosphoribulokinase;(source:Araport11) |
| AT1G32090 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
| AT1G32160 | beta-casein (DUF760);(source:Araport11) |
| AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
| AT1G32250 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G32320 | member of MAP Kinase Kinase |
| AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
| AT1G32385 | snoRNA;(source:Araport11) |
| AT1G32390 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT1G32440 | encodes a chloroplast pyruvate kinase beta subunit. The enzyme is less active than the other chloroplast pyruvate kinase beta subunit encoded by AT5G52920. Involved in seed oil biosynthesis. Can partially complement the AT5G52920 mutant. |
| AT1G32470 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G32910 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G33290 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G33320 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G33490 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G33530 | F-box family protein;(source:Araport11) |
| AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
| AT1G33640 | hypothetical protein;(source:Araport11) |
| AT1G33660 | Pseudogene of AT1G33660; peroxidase family protein |
| AT1G33670 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G33700 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT1G33730 | cytochrome P450, family 76, subfamily C, polypeptide 5;(source:Araport11) |
| AT1G33890 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33900 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33930 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33950 | Avirulence induced gene (AIG1) family protein;(source:Araport11) |
| AT1G33960 | Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
| AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G34060 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT1G34120 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not act on I(1)P, I(1,4)P2, or phosphatidylinositol(4,5)P2. |
| AT1G34140 | polyadenylate-binding protein, putative / PABP, putative, non-consensus splice donor TA at exon 1; similar to polyadenylate-binding protein (poly(A)-binding protein) from (Triticum aestivum) GI:1737492, (Nicotiana tabacum) GI:7673355, {Arabidopsis thaliana} SP:P42731; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Only member of the class IV PABP family. |
| AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT1G34490 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34500 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34520 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G34530 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G34540 | member of CYP94D |
| AT1G34545 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-112 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G34575 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G35143 | transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G52950.1);(source:TAIR10) |
| AT1G35170 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G35230 | Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile. |
| AT1G35330 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35750 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G35860 | TOC75 pseudogene due to a 5.4-kb gypsy/Ty3-related retrotransposon inserted at the 5' end of the gene |
| AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G36110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G36220 | pseudogene of seryl-tRNA synthetase / serine-tRNA ligase;(source:Araport11) |
| AT1G36240 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT1G36500 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 8.7e-93 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G36840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G36880 | pseudogene of FAR1-related sequence 5;(source:Araport11) |
| AT1G37113 | hypothetical protein;(source:Araport11) |
| AT1G38185 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-21 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G38430 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 9.8e-109 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G42130 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.6e-236 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT1G42450 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.3e-96 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT1G42560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO9 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO10. The gene is expressed during early seedling growth, in cotyledon vascular system, in flowers (with strong expression in anthers) in siliques and fruit abscission zone; not expressed in roots, or in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G42980 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT1G43010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G43020 | electron protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G43600 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G43610 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G43640 | Member of TLP family of tubby like proteins that also contain an F-Box. |
| AT1G43666 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G43700 | Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. Involved in osmosensory response. The mRNA is cell-to-cell mobile. |
| AT1G43781 | Pseudogene of AT1G53790; F-box family protein |
| AT1G43883 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.1e-193 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
| AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G43895 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G44080 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT1G44100 | amino acid permease 5 |
| AT1G44160 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT1G44318 | Aldolase superfamily protein;(source:Araport11) |
| AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
| AT1G44707 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G44760 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G44770 | elongation factor;(source:Araport11) |
| AT1G44800 | Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family. |
| AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
| AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
| AT1G45545 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
| AT1G45760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-37 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
| AT1G46840 | F-box family protein;(source:Araport11) |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT1G47220 | Cyclin A3;(source:Araport11) |
| AT1G47290 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT1G47530 | MATE efflux family protein;(source:Araport11) |
| AT1G47560 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT1G47578 | Redundant octanoyltransferase involved in fatty acid synthesis. |
| AT1G47590 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.Previously annotated as pseudogene, evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G47603 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G47606 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G47630 | member of CYP96A |
| AT1G47730 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G47770 | Beta-galactosidase related protein;(source:Araport11) |
| AT1G47890 | receptor like protein 7;(source:Araport11) |
| AT1G47960 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. This protein may inhibit their activity. |
| AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G48250 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G35400.1);(source:TAIR10) |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
| AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT1G48510 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis. |
| AT1G48520 | Encodes Glu-tRNA(Gln) amidotransferase subunit B (from Genbank record AF239836). |
| AT1G48730 | hypothetical protein;(source:Araport11) |
| AT1G48870 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G48910 | A paternally expressed imprinted gene. |
| AT1G48980 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G49032 | hypothetical protein;(source:Araport11) |
| AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
| AT1G49110 | hypothetical protein;(source:Araport11) |
| AT1G49120 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G49270 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G49280 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT1G49290 | Paternally expressed gene that is localized around the sperm nuclei of pollen. PEG2 acts as a sponge for siRNA854 during endosperm development, this action is necessary to induce triploid seed abortion. |
| AT1G49350 | PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
| AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G49430 | Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation. |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G49610 | F-box family protein;(source:Araport11) |
| AT1G49740 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G49890 | Together with QWRF1 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
| AT1G49960 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G49975 | photosystem I reaction center subunit N;(source:Araport11) |
| AT1G50050 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G50070 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT1G50120 | Encodes a Golgi-localized protein which regulates pollen tube growth. Required for TGN formation and Golgi structure maintenance. |
| AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
| AT1G50310 | Sucrose transporter, expressed in pollen tubes. |
| AT1G50330 | pseudogene of methylesterase PCR A;(source:Araport11) |
| AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT1G50470 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT1G50640 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-3). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G50730 | hypothetical protein;(source:Araport11) |
| AT1G50840 | DNA Polymerase gamma2. Dual targeting to mitochondria and plastids due to alternative translation initiation. |
| AT1G50870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G50990 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT1G51030 | hypothetical protein;(source:Araport11) |
| AT1G51035 | hypothetical protein;(source:Araport11) |
| AT1G51040 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT1G51410 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
| AT1G51440 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G51460 | ABCG13 encodes a member of the ATP-binding cassette (ABC) transporter family protein. Mutants show defects in petal elongation resulting in a folded petal phenotype. |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
| AT1G51802 | Encodes a defensin-like (DEFL) family protein. |
| AT1G51840 | kinase-like protein;(source:Araport11) |
| AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
| AT1G51965 | Encodes ABA Overly-Sensitive5 (ABO5), a pentatricopeptide repeat protein required for cis-splicing of mitochondrial nad2 intron 3. Involved in response to abscisic acid. |
| AT1G52085 | pseudogene of Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
| AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G52220 | Thylakoid membrane localized protein that interacts with other CURT family proteins. Oligomerization is associated with grana thylakoid curavature. |
| AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G52315 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G52370 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G52460 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G52490 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G52520 | FAR1-related sequence 6;(source:Araport11) |
| AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G52660 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G52857 | transmembrane protein;(source:Araport11) |
| AT1G52910 | fiber (DUF1218);(source:Araport11) |
| AT1G52940 | Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea. |
| AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
| AT1G53330 | encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes. |
| AT1G53360 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
| AT1G53541 | hypothetical protein;(source:Araport11) |
| AT1G53550 | F-box family protein;(source:Araport11) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT1G53625 | hypothetical protein;(source:Araport11) |
| AT1G53660 | Nucleotide/sugar transporter family protein |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G53705 | putative aminoacyl-tRNA ligase;(source:Araport11) |
| AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53930 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G54000 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G54010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G54035 | pseudogene of epithiospecifier protein |
| AT1G54220 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
| AT1G54230 | Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT1G54340 | NADP-specific isocitrate dehydrogenase (ICDH) The mRNA is cell-to-cell mobile. |
| AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
| AT1G54550 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G54560 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
| AT1G54600 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G54640 | F-box family protein-like protein;(source:Araport11) |
| AT1G54750 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT1G54940 | Encodes a xylan glucuronosyltransferase. |
| AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
| AT1G55030 | RNI-like superfamily protein;(source:Araport11) |
| AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
| AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
| AT1G55175 | hypothetical protein;(source:Araport11) |
| AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
| AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
| AT1G55430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G55450 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G55560 | SKU5 similar 14;(source:Araport11) |
| AT1G55570 | SKU5 similar 12;(source:Araport11) |
| AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
| AT1G55604 | Pseudogene of AT1G26762 |
| AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
| AT1G55680 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G55720 | member of Low affinity calcium antiporter CAX2 family |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
| AT1G55940 | cytochrome P450 family protein;(source:Araport11) |
| AT1G56030 | RING/U-box protein;(source:Araport11) |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT1G56110 | NOP56-like protein |
| AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
| AT1G56360 | purple acid phosphatase 6;(source:Araport11) |
| AT1G56400 | F-box family protein;(source:Araport11) |
| AT1G56490 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G56510 | TIR-NB-LRR protein that confers resistance to four races of Albugo candida. The mRNA is cell-to-cell mobile. |
| AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
| AT1G56670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G57565 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT1G57580 | F-box family protein;(source:Araport11) |
| AT1G57610 | calcium uniporter (DUF607);(source:Araport11) |
| AT1G57620 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G57650 | ATP binding protein;(source:Araport11) |
| AT1G57660 | Translation protein SH3-like family protein;(source:Araport11) |
| AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
| AT1G57790 | F-box family protein;(source:Araport11) |
| AT1G57810 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 29%25 identity and 1.1e-12 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT1G57820 | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
| AT1G57850 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
| AT1G58040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G58120 | hypothetical protein;(source:Araport11) |
| AT1G58190 | receptor like protein 9;(source:Araport11) |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
| AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
| AT1G58350 | Putative serine esterase family protein;(source:Araport11) |
| AT1G58360 | Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root. |
| AT1G58370 | Encodes a protein with xylanase activity. |
| AT1G58430 | Encodes an anther-specific proline-rich protein. |
| AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
| AT1G58460 | hypothetical protein;(source:Araport11) |
| AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
| AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
| AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT1G59675 | F-box family protein;(source:Araport11) |
| AT1G59680 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G59722 | hypothetical protein;(source:Araport11) |
| AT1G59725 | DNAJ heat shock family protein;(source:Araport11) |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G59860 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile. |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT1G60030 | nucleobase-ascorbate transporter 7;(source:Araport11) |
| AT1G60050 | nodulin MtN21-like transporter family protein |
| AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT1G60240 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G60260 | beta glucosidase 5;(source:Araport11) |
| AT1G60280 | NAC domain containing protein 23;(source:Araport11) |
| AT1G60370 | KUK F-box domain protein. Natural variants are associated with GWAS trait for root meristem and cell length. Polymorphisms in the coding sequence are the major causes of KUK allele? dependent natural variation in root development. |
| AT1G60430 | actin-related protein C3;(source:Araport11) |
| AT1G60520 | pseudogene of Dynamin related protein 4A;(source:Araport11) |
| AT1G60530 | Dynamin related protein 4A;(source:Araport11) |
| AT1G60590 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G60630 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G60750 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
| AT1G60880 | Root Specific |
| AT1G60960 | Encodes a plasma membrane localized zinc/iron transporter. |
| AT1G61050 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT1G61060 | F-box family protein;(source:Araport11) |
| AT1G61080 | Hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61430 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61440 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT1G61575 | Serine/Threonine kinase;(source:Araport11) |
| AT1G61600 | DUF1262 family protein (DUF1262);(source:Araport11) |
| AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G61620 | Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G61688 | Encodes a defensin-like (DEFL) family protein. |
| AT1G61720 | Negative regulator of flavonoid biosynthesis, mutants accumulate flavonoid pigments in their seed coat, putative oxidoreductase. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
| AT1G61820 | beta glucosidase 46;(source:Araport11) |
| AT1G61860 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61880 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT1G61890 | MATE efflux family protein;(source:Araport11) |
| AT1G62075 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-28 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G62170 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G62180 | encodes a adenosine 5'-phosphosulfate reductase, involved in sulfate assimilation. Is a major effect locus for natural variation of shoot sulfate content in Arabidopsis. |
| AT1G62280 | Encodes a protein with ten predicted transmembrane helices. The SLAH1 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement a slac1-2 mutant suggesting that it performs a similar function. SLAH1:GFP localizes to the plasma membrane. |
| AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT1G62305 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT1G62320 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G62400 | Protein kinase involved in regulation of stomatal aperture in response to CO2. |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
| AT1G62550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10) |
| AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT1G62690 | hypothetical protein;(source:Araport11) |
| AT1G62766 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 6.1e-299 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G62780 | dimethylallyl, adenosine tRNA methylthiotransferase;(source:Araport11) |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT1G62980 | Alpha-expansin 18. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G62981 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
| AT1G63020 | Encodes one of two alternative largest subunits of a putative plant-specific RNA polymerase IV (aka RNA polymerase D). Required for posttranscriptional gene silencing. |
| AT1G63100 | Transcription factor belonging to the GRAS family which controls the mitotic cell cycle and division plane orientation. |
| AT1G63120 | AtRBL2 has been identified as a rhomboid protein involved in regulated intramembrane proteolysis (RIP). The enzyme has the proteolytic activity and substrate specificity comparable to the Drosophila Rho-1 protein. |
| AT1G63140 | O-methyltransferase family protein;(source:Araport11) |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G63350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G63520 | hypothetical protein (DUF3527);(source:Araport11) |
| AT1G63530 | hypothetical protein;(source:Araport11) |
| AT1G63540 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G63600 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
| AT1G63700 | Member of MEKK subfamily, a component of the stomatal development regulatory pathway. Mutations in this locus result in embryo lethality. |
| AT1G63760 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT1G63800 | ubiquitin-conjugating enzyme 5;(source:Araport11) |
| AT1G63910 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT1G63950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G64035 | pseudogene of serpin 2;(source:Araport11) |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT1G64180 | intracellular protein transport protein USO1-like protein;(source:Araport11) |
| AT1G64290 | F-box protein-like protein;(source:Araport11) |
| AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT1G64800 | DNA binding / transcription factor;(source:Araport11) |
| AT1G64810 | Encodes a chloroplast localized RNA binding protein that is involved in group II intron splicing. Splicing defects can account for the loss of photosynthetic complexes in apo1 mutants. |
| AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G65050 | TRAF-like superfamily protein;(source:Araport11) |
| AT1G65140 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65160 | ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G65310 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT1G65330 | Type I MADS-box protein, regulated by MEA and FIE, expressed transiently after fertilization in embryo and endosperm. |
| AT1G65340 | member of CYP96A |
| AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
| AT1G65483 | hypothetical protein;(source:Araport11) |
| AT1G65560 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT1G65630 | Encodes a putative DegP protease. |
| AT1G65670 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
| AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G65880 | Encodes a benzoate-CoA ligase. Involved in the biosynthesis of benzoyloxyglucosinolate in Arabidopsis seeds. |
| AT1G65890 | acyl activating enzyme 12;(source:Araport11) |
| AT1G66060 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G66110 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G66470 | ROOT HAIR DEFECTIVE6;(source:Araport11) |
| AT1G66620 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT1G66660 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT1G66670 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT1G66820 | glycine-rich protein;(source:Araport11) |
| AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G66920 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66940 | kinase-like protein;(source:Araport11) |
| AT1G66950 | Encodes a plasma membrane-localized ABC transporter. Confers tolerance to herbicide paraquat. |
| AT1G66990 | pseudogene of suppressor of npr1-1 constitutive 4;(source:Araport11) |
| AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G67020 | transmembrane protein;(source:Araport11) |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
| AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
| AT1G67150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
| AT1G67855 | hypothetical protein;(source:Araport11) |
| AT1G67856 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT1G68220 | aerobic coproporphyrinogen-III oxidase (DUF1218);(source:Araport11) |
| AT1G68238 | transmembrane protein;(source:Araport11) |
| AT1G68270 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G68280 | Thioesterase superfamily protein;(source:Araport11) |
| AT1G68350 | cotton fiber protein;(source:Araport11) |
| AT1G68370 | DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins. |
| AT1G68450 | VQ motif-containing protein;(source:Araport11) |
| AT1G68490 | translocase subunit seca;(source:Araport11) |
| AT1G68526 | hypothetical protein;(source:Araport11) |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
| AT1G68765 | Encodes a small protein of 77 amino acids. Loss of function mutations are defective in the process of ethylene independent floral organ abscission. Although the mutants have a normal appearing abscission zone, the floral organs do not abscisce. The peptide appears to be secreted and may function as a ligand. Arabidopsis 35S:IDA lines constitutively overexpressing IDA exhibit earlier abscission of floral organs, showing that the abscission zones are responsive to IDA soon after the opening of the flowers. In addition, ectopic abscission was observed at the bases of the pedicel, branches of the inflorescence, and cauline leaves. The silique valves also dehisced prematurely. |
| AT1G68780 | RNI-like superfamily protein;(source:Araport11) |
| AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
| AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
| AT1G68890 | Homologous to the four eubacterial men genes involved in menanoquinone biosynthesis. Studies of mutants defective in this gene demonstrated its involvement in phylloquinone biosynthesis in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT1G69030 | BSD domain-containing protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
| AT1G69320 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G69420 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT1G69460 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
| AT1G69500 | Encodes a cytochrome P450, designated CYP704B1. Expressed in the developing anthers. Essential for pollen exine development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis. |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G69540 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. |
| AT1G69572 | Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689). |
| AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G69630 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G69670 | cullin, putative, contains similarity to Cullin homolog 3 (CUL-3) SP:Q13618, GI:3639052 from (Homo sapiens); contains Pfam profile PF00888: Cullin family. Interacts with members of AtBPM family and RBX1 suggesting it is part of an E3 ligase complex involved in RUB modification. |
| AT1G69730 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
| AT1G69810 | member of WRKY Transcription Factor; Group II-b |
| AT1G69820 | Note that conflicting nomenclature exists in the literature: At1g69820 is named as GGT4 in Plant J. 2007 Mar 49(5):878-88; and as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
| AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
| AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G70000 | Encodes a MYB-like Domain transcription factor that plays a positive role in anthocyanin accumulation in response to light and cytokinin via repression of MYBL2.MYBD expression increased in response to light or cytokinin, and MYBD enhanced anthocyanin biosynthesis via the repression of MYBL2 encoding for a transcription factor that had a negative effect on this process. In addition, MYBD can bind in vivo to the MYBL2 promoter and a lower level of histone H3K9 acetylation (H3K9ac) at upstream region of MYBL2 in MYBD-OX in comparison to wild-type plants, implies that MYBD represses MYBL2 expression via an epigenetic mechanism. |
| AT1G70020 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT1G70030 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G70120 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT1G70250 | Encodes a Protease inhibitor/seed storage/LTP family protein. |
| AT1G70380 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G70470 | transmembrane protein;(source:Araport11) |
| AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
| AT1G70830 | MLP-like protein 28;(source:Araport11) |
| AT1G70860 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G70960 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G71002 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection. |
| AT1G71015 | PADRE protein. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
| AT1G71120 | Contains lipase signature motif and GDSL domain. |
| AT1G71360 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins that is localized to both the nuclear envelope and the ER. It is involved in early seed development and nuclear morphology. |
| AT1G71400 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile. |
| AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
| AT1G71940 | SNARE associated Golgi protein family;(source:Araport11) |
| AT1G71970 | hypothetical protein;(source:Araport11) |
| AT1G72000 | Plant neutral invertase family protein;(source:Araport11) |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT1G72131 | pseudogene of proton-dependent oligopeptide transporter |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT1G72410 | COP1-interacting protein-like protein;(source:Araport11) |
| AT1G72420 | NADH:ubiquinone oxidoreductase intermediate-associated protein 30;(source:Araport11) |
| AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT1G72590 | Encodes a polyphenol reductase. |
| AT1G72610 | germin-like protein (GLP1) |
| AT1G72620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G72890 | NBS TIR protein. |
| AT1G72970 | Originally identified as a mutation that causes floral organs to fuse together. About 10-20% of mutants also have defects in ovules. Mutants have reduced fertility most likely as because of fusions that pistil emergence. The protein has similarity to the mandelonitrile lyase family of FAD containing oxidoreductases and is predicted to be secreted (SignalP).It is expressed in all tissue layers of roots, inflorescences, stems, leaves, and flowers and is also expressed in siliques. Expression is highest in inflorescence and flower tissue.Transmission of mutant alleles to the progeny shows non mendelian segregation- a percentage of mutant alleles revert back to a previous parental (e.g. grandparental) wild type allele. It has been suggested that an RNA template driven or other extra-DNA genomic mechanism may be responsible for the non-mendelian inheritance of HTH. Reversion events in alleles at other loci have also been observed to occur in plants with an hth mutant background indicating a genome wide effect. |
| AT1G72990 | beta-galactosidase 17;(source:Araport11) |
| AT1G73040 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G73200 | testis-expressed sequence 2-like protein (DUF2404);(source:Araport11) |
| AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
| AT1G73250 | encodes a bifunctional 3, 5-epimerase-4-reductase in L-fucose synthesis and converts GDP-D-mannose to GDP-L-fucose in vitro along with MUR1 (GDP-D-mannose 4,6-dehydratase). It is expressed in all tissues examined, but most abundantly in roots and flowers. |
| AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
| AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
| AT1G73370 | Encodes a protein with sucrose synthase activity (SUS6). |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G73490 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G73590 | Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins. |
| AT1G73610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G73670 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G73790 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT1G73875 | Deadenylase. |
| AT1G74010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
| AT1G74040 | Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). |
| AT1G74110 | member of CYP78A |
| AT1G74340 | Encodes a subunit of the dolichol phosphate mannase synthase (DPMS) complex that may serve as membrane anchors for the catalytic core, DPMS1, or provide catalytic assistance. It is localized in the ER and mediates isoprenyl-linked glycan biogenesis. |
| AT1G74360 | NILR1 encodes a serine/threonine kinase involved in defense response to nematodes. |
| AT1G74410 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G74530 | transmembrane protein;(source:Araport11) |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT1G75030 | encodes a PR5-like protein |
| AT1G75050 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G75350 | Ribosomal protein L31;(source:Araport11) |
| AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
| AT1G75430 | BEL1-like homeodomain 11;(source:Araport11) |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
| AT1G75520 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis. |
| AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
| AT1G75550 | glycine-rich protein;(source:Araport11) |
| AT1G75730 | hypothetical protein;(source:Araport11) |
| AT1G75760 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT1G76010 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT1G76040 | member of Calcium Dependent Protein Kinase |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT1G76130 | alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase, putative, strong similarity to alpha-amylase GI:7532799 from (Malus x domestica);contains Pfam profile PF00128: Alpha amylase, catalytic domain. Predicted to be secreted based on SignalP analysis. |
| AT1G76160 | SKU5 similar 5;(source:Araport11) |
| AT1G76250 | transmembrane protein;(source:Araport11) |
| AT1G76280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G76370 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G76380 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G76460 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G76510 | ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
| AT1G76690 | Encodes one of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Predicted to be a cytosolic protein. |
| AT1G76800 | The gene encodes nodulin-like2 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT1G76892 | Natural antisense transcript overlaps with AT1G76890;(source:Araport11) |
| AT1G76940 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G76990 | ACT domain repeat 3;(source:Araport11) |
| AT1G77010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G77210 | AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose. |
| AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
| AT1G77320 | Mutant is defective in meiosis and produces abnormal microspores. Encodes a BRCT-domain-containing protein that could be specific to the meiotic cell cycle and that plays a crucial role in some DNA repair events independent of SPO11 DSB recombination repair. |
| AT1G77380 | Amino acid permease which transports basic amino acids. |
| AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G77655 | hypothetical protein;(source:Araport11) |
| AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G77730 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT1G78010 | tRNA modification GTPase;(source:Araport11) |
| AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G78160 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
| AT1G78320 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78340 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78370 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT1G78450 | SOUL heme-binding family protein;(source:Araport11) |
| AT1G78490 | member of CYP708A family. The mRNA is cell-to-cell mobile. |
| AT1G78520 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G78720 | SecY protein transport family protein;(source:Araport11) |
| AT1G78820 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT1G78940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G78950 | Terpenoid cyclases family protein;(source:Araport11) |
| AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
| AT1G78990 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G79000 | Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation. |
| AT1G79040 | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ. |
| AT1G79150 | binding protein;(source:Araport11) |
| AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT1G79250 | AGC kinase 1.7;(source:Araport11) |
| AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
| AT1G79330 | Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT1G79390 | centrosomal protein;(source:Araport11) |
| AT1G79400 | member of Putative Na+/H+ antiporter family |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT1G79430 | Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. |
| AT1G79460 | Encodes for a protein with ent-kaurene synthase B activity which catalyzes the second step in the cyclization of GGPP to ent-kaurene in the gibberellins biosynthetic pathway. |
| AT1G79520 | Cation efflux family protein;(source:Araport11) |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
| AT1G79640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G79840 | Glabra 2, a homeodomain protein affects epidermal cell identity including trichomes, root hairs, and seed coat. It also down-regulates seed oil content. Expressed in atrichoblasts and required to suppress root hair development. Also expressed abundantly during early seed development. Directly regulated by WER. |
| AT1G79850 | nuclear-encoded 30S chloroplast ribosomal protein S17 |
| AT1G79960 | ovate family protein 14;(source:Araport11) |
| AT1G80060 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G80240 | DUF642 gene |
| AT1G80320 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G80450 | VQ motif-containing protein;(source:Araport11) |
| AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT1G80650 | RNAse THREE-like protein 1;(source:Araport11) |
| AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G80970 | XH domain-containing protein;(source:Araport11) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
| AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G01290 | Cytosolic ribose-5-phosphate isomerase. Knockout mutation causes chloroplast dysfunction, late flowering and premature cell death. |
| AT2G01350 | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
| AT2G01505 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT2G01554 | hypothetical protein;(source:Araport11) |
| AT2G01560 | Plant protein 1589 of unknown function;(source:Araport11) |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT2G01580 | transmembrane protein;(source:Araport11) |
| AT2G01610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G01670 | nudix hydrolase homolog 17;(source:Araport11) |
| AT2G01770 | Encodes an iron transporter required for iron sequestration into vacuoles. Expressed in developing embryo and seed. Localized in the vacuolar membrane. |
| AT2G01780 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
| AT2G01840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-34 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G01880 | PEP complex component. |
| AT2G01900 | Encodes an inositol polyphosphate phosphatidylinositol 5-phosphatase that is expressed in roots and is involved in mediating salt tolerance through endocytosis. |
| AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02140 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
| AT2G02240 | F-box family protein;(source:Araport11) |
| AT2G02250 | phloem protein 2-B2;(source:Araport11) |
| AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
| AT2G02300 | phloem protein 2-B5;(source:Araport11) |
| AT2G02330 | pseudogene of phloem protein 2-B7;(source:Araport11) |
| AT2G02350 | encodes a protein containing an F-box domain and physically interacts with SCF subunit SKP1/ASK1. The protein also exhibits similarity in sequence to phloem protein 2 (PP2) from cucumber. |
| AT2G02370 | SNARE associated Golgi protein family;(source:Araport11) |
| AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
| AT2G02540 | Zinc finger homeobox protein. Expressed in vascular tissue. In a yeast one hybrid system was not able to transactivate a reporter gene. |
| AT2G02580 | member of CYP71B |
| AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
| AT2G02830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-37 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G02835 | nucleic acid/zinc ion-binding protein;(source:Araport11) |
| AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
| AT2G02890 | F-box family protein;(source:Araport11) |
| AT2G02900 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT2G02980 | Encodes a chloroplast RNA editing factor. |
| AT2G02990 | Encodes a member of the ribonuclease T2 family that responds to inorganic phosphate starvation, and inhibits production of anthocyanin. Also involved in wound-induced signaling independent of jasmonic acid. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
| AT2G03000 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G03160 | SKP1-like 19;(source:Araport11) |
| AT2G03200 | Atypical aspartic protease which modulates lateral root development. |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT2G03270 | DNA-binding protein;(source:Araport11) |
| AT2G03460 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G03500 | Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression. |
| AT2G03505 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT2G03550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G03610 | F-box family protein;(source:Araport11) |
| AT2G03620 | Transmembrane magnesium transporter. One of nine family members. |
| AT2G03710 | This gene belongs to the family of SEP genes. It is involved in the development of sepals, petals, stamens and carpels. Additionally, it plays a central role in the determination of flower meristem and organ identity. |
| AT2G03720 | Involved in root hair development |
| AT2G03740 | Late embryogenesis abundant protein. Associates with and stabilizes membranes as part of cryoprotective response. |
| AT2G03850 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT2G04050 | MATE efflux family protein;(source:Araport11) |
| AT2G04070 | Expression in rosette leaves is activated by high concentration of boron. |
| AT2G04150 | pseudogene of F-box family protein |
| AT2G04220 | DUF868 family protein (DUF868);(source:Araport11) |
| AT2G04480 | hypothetical protein;(source:Araport11) |
| AT2G04540 | Encodes a mitochondrial beta-ketoacyl-ACP synthase. |
| AT2G05060 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G05330 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G05360 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G05410 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT2G05518 | other_RNA;(source:Araport11) |
| AT2G05590 | TLDc domain protein that confers increased tolerance to oxidative stress. |
| AT2G05600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G05620 | Involved in electron flow in Photosystem I. Essential for photoprotection. |
| AT2G05850 | serine carboxypeptidase-like 38;(source:Araport11) |
| AT2G05960 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.2e-200 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G06060 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G06520 | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT2G06770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-15 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G07213 | Natural antisense transcript overlaps with AT2G07215;(source:Araport11) |
| AT2G07280 | hypothetical protein;(source:Araport11) |
| AT2G07320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G37880.1);(source:TAIR10) |
| AT2G07550 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-313 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
| AT2G07704 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-50 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G07806 | hypothetical protein;(source:Araport11) |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT2G11778 | transmembrane protein;(source:Araport11) |
| AT2G11880 | None;(source:Araport11) |
| AT2G12320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32169.1);(source:TAIR10) |
| AT2G12475 | Encodes a defensin-like (DEFL) family protein. |
| AT2G12660 | pseudogene of xyloglucan endotransglucosylase/hydrolase 21;(source:Araport11) |
| AT2G12770 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-24 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT2G13116 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT2G13460 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G13620 | member of Putative Na+/H+ antiporter family |
| AT2G13706 | Pseudogene of AT4G15975; zinc finger (C3HC4-type RING finger) family protein |
| AT2G14070 | wound-responsive protein-like protein;(source:Araport11) |
| AT2G14090 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G14255 | Ankyrin repeat family protein with DHHC zinc finger domain-containing protein;(source:Araport11) |
| AT2G14500 | F-box family protein;(source:Araport11) |
| AT2G14535 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-19 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G14540 | serpin 2;(source:Araport11) |
| AT2G14550 | pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G14560 | Encodes LURP1, a member of the LURP cluster (late upregulated in response to Hyaloperonospora parasitica) which exhibits a pronounced upregulation after recognition of the pathogenic oomycte H. parasitica. LURP1 is required for full basal defense to H. parasitica and resistance to this pathogen mediated by the R-proteins RPP4 and RPP5. The mRNA is cell-to-cell mobile. |
| AT2G14620 | xyloglucan endotransglucosylase/hydrolase 10;(source:Araport11) |
| AT2G14690 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT2G14810 | hypothetical protein;(source:Araport11) |
| AT2G14935 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G14980 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-247 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT2G15045 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT4G08860.1);(source:TAIR10) |
| AT2G15128 | other_RNA;(source:Araport11) |
| AT2G15300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G15325 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT2G15400 | Non-catalytic subunit of Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, At2g15430 can substitute for At2g15400 in the context of Pol V and encodes the equivalent subunit of Pol II and Pol IV. |
| AT2G15430 | Non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, encoded by At2g15400, can substitute for At2g15430 in the context of Pol V. |
| AT2G15490 | UDP-glycosyltransferase 73B4;(source:Araport11) |
| AT2G15590 | spire, putative (DUF1685);(source:Araport11) |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT2G15760 | calmodulin-binding protein (DUF1645);(source:Araport11) |
| AT2G15820 | Encodes a protein that promotes splicing of type II introns. otp51 mutants fail to splice intron 2 of plastid ycf3 transcripts, a factor required for the assembly of Photosystem I. Therefore, homozygous otp51 mutants have profound photosynthetic defects and can only survive in sucrose-supplemented in vitro cultures under low light conditions. OTP51 may also be involved in splicing several other transcripts and precursor forms of the trnL, trnG, trnI, and trnA transcripts also accumulate in otp51 mutants. Although OTP51 shares some homology with DNA endonucleases, it lacks key catalytic residues suggesting that it does not participate in DNA cleavage. |
| AT2G15830 | hypothetical protein;(source:Araport11) |
| AT2G16050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
| AT2G16145 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:GGTTCGTACGTACACTGTTCA |
| AT2G16220 | Stress induced gene. Mutants show increased sensitivity to arsenate. |
| AT2G16230 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
| AT2G16290 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G16300 | F-box family protein;(source:Araport11) |
| AT2G16310 | pseudogene of endoplasmatic reticulum retrieval protein 1B;(source:Araport11) |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G16485 | Encodes NERD (Needed for RDR2-independent DNA methylation), a plant-specific GW repeat- and PHD finger-containing protein involved in siRNA-dependent DNA methylation. |
| AT2G16505 | Encodes a Maternally expressed gene (MEG) family protein. Expressed in pollen and involved in pollen-stigma interaction. |
| AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
| AT2G16530 | Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal |
| AT2G16710 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G16890 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G16910 | Encodes a basic helix-loop helix transcription factor involved in tapetal cell development, that directly regulates MGT5 expression in tapetum cells. Loss of function mutations are male sterile. AMS binds to a region termed the E box of target gene promoters. |
| AT2G16960 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G16990 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
| AT2G17010 | MSL8 encodes a protein with similarity to mechano-sensitive channel proteins. MSL8 is expressed specifically in pollen and germinating pollen tubes.It regulates pollen germination and is needed to maintain cellular integrity during pollen hydration and germination. |
| AT2G17040 | Member of the NAC transcription factor family and more specifically, the ONAC022 subfamily. Involved in leaf and inflorescence stem morphogenesis. The mRNA is cell-to-cell mobile. |
| AT2G17060 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G17064 | Pseudogene of AT2G17080 |
| AT2G17160 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT2G17170 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G17310 | Encodes an F-Box protein that regulates a novel induced defense response independent of both salicylic acid and systemic acquired resistance |
| AT2G17370 | Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds. |
| AT2G17477 | Pseudogene of AT3G22350; F-box family protein |
| AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
| AT2G17740 | VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development. |
| AT2G17770 | Encodes a paralog of bZIP transcription factor FD. This protein interacts with FD and FT. |
| AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
| AT2G17787 | cylicin;(source:Araport11) |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT2G17845 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G18080 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT2G18130 | purple acid phosphatase 11;(source:Araport11) |
| AT2G18140 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G18250 | At2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis. |
| AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
| AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT2G18380 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G18440 | Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G18460 | like COV 3;(source:Araport11) |
| AT2G18500 | ovate family protein 7;(source:Araport11) |
| AT2G18510 | Essential gene (embryo lethal) that is similar to component of splicosome. Regulates embryonic pattern formation through Pol II-Mediated transcription of WOX2 an PIN7 (DOI:10.1016/j.isci.2019.09.004). JANUS positively regulates PLT1 expression in the root meristem by recruiting RNA polymerase II (Pol II) to PLT1 and by interacting with PLT1. Nuclear accumulation of JANUS in root meristem depends on IMB4. (DOI:10.1105/tpc.20.00108 ) |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G18630 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G18690 | transmembrane protein;(source:Araport11) |
| AT2G18721 | hypothetical protein;(source:Araport11) |
| AT2G18780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G18800 | xyloglucan endotransglucosylase/hydrolase 21;(source:Araport11) |
| AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT2G18880 | vernalization5/VIN3-like protein;(source:Araport11) |
| AT2G18938 | transmembrane protein;(source:Araport11) |
| AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT2G18970 | hypothetical protein;(source:Araport11) |
| AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
| AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
| AT2G19825 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G19890 | hypothetical protein;(source:Araport11) |
| AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G19920 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G20000 | Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap. |
| AT2G20010 | Gls protein (DUF810);(source:Araport11) |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G20230 | Tetraspanin family protein;(source:Araport11) |
| AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT2G20360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G20590 | Reticulon family protein;(source:Araport11) |
| AT2G20625 | hypothetical protein (DUF626);(source:Araport11) |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT2G20770 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
| AT2G20910 | pseudogene of ATPase;(source:Araport11) |
| AT2G20970 | lipid-binding protein;(source:Araport11) |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT2G21740 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT2G21750 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT2G21780 | hypothetical protein;(source:Araport11) |
| AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
| AT2G21900 | member of WRKY Transcription Factor; Group II-c |
| AT2G21920 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G22050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G22250 | Encodes a prokaryotic-type plastidic aspartate aminotransferase with glutamate/aspartate-prephenate aminotransferase (PAT) activity. |
| AT2G22650 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
| AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT2G22810 | key regulatory enzyme in the biosynthesis of the plant hormone ethylene. ACS4 is specifically induced by indoleacetic acid (IAA). |
| AT2G22830 | squalene epoxidase 2;(source:Araport11) |
| AT2G22860 | Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. The mRNA is cell-to-cell mobile. |
| AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT2G22910 | N-acetyl-l-glutamate synthase 1;(source:Araport11) |
| AT2G22960 | Encodes a putative flavonol-phenylacyltransferase. Some accessions (e.g. C24) contain a full length protein that produces high levels of saiginols compared to Col which is non producing. The producer strains also appear to be more resistant to UV-B irradiation. |
| AT2G23000 | serine carboxypeptidase-like 10;(source:Araport11) |
| AT2G23060 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G23180 | member of CYP96A |
| AT2G23220 | member of CYP81D |
| AT2G23270 | Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. Finetuning role in modulation of immunity through the regulation of SA and JA biosynthesis and signalling pathways. |
| AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT2G23420 | nicotinate phosphoribosyltransferase 2;(source:Araport11) |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G23630 | SKU5 similar 16;(source:Araport11) |
| AT2G23680 | Cold acclimation protein WCOR413 family;(source:Araport11) |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
| AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
| AT2G23830 | PapD-like superfamily protein;(source:Araport11) |
| AT2G24010 | serine carboxypeptidase-like 23;(source:Araport11) |
| AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT2G24140 | myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
| AT2G24210 | terpene synthase 10;(source:Araport11) |
| AT2G24440 | selenium binding protein;(source:Araport11) |
| AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT2G24560 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G24592 | hypothetical protein;(source:Araport11) |
| AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT2G24710 | member of Putative ligand-gated ion channel subunit family |
| AT2G24740 | Encodes a SU(VAR)3-9 homolog, a SET domain protein (Homology Subgroup V; Orthology Group 1). Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. This protein is a putative histone methyltransferase (predicted to methylate H3K9/20) related to the the Drosophila Su(var)3-9 and mammalian G9a proteins. |
| AT2G24762 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT2G24800 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G24920 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30470.1);(source:TAIR10) |
| AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
| AT2G25210 | Ribosomal protein L39 family protein;(source:Araport11) |
| AT2G25320 | TRAF-like family protein;(source:Araport11) |
| AT2G25380 | pseudogene of zinc finger protein-related |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G25470 | receptor like protein 21;(source:Araport11) |
| AT2G25600 | Encodes SPIK, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutant plants have impaired pollen-tube growth. |
| AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT2G25790 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
| AT2G25975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-14 P-value blast match to GB:CAA26446 ORF2 (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
| AT2G26030 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G26100 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
| AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
| AT2G26290 | root-specific kinase 1;(source:Araport11) |
| AT2G26400 | Encodes a protein predicted to belong to the acireductone dioxygenase (ARD/ARD?)family. |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
| AT2G26490 | JGB contains seven WD40 repeats and is highly conserved in flowering plants. Overexpression inhibits pollen germination. suggesting JGB is a negative regulator of pollen germination |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT2G26560 | Encodes a lipid acyl hydrolase with wide substrate specificity that accumulates upon infection by fungal and bacterial pathogens. Protein is localized in the cytoplasm in healthy leaves, and in membranes in infected cells. Plays a role in cell death and differentially affects the accumulation of oxylipins. Contributes to resistance to virus. |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
| AT2G26750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G26760 | Cyclin B1;(source:Araport11) |
| AT2G26790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G27060 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G27070 | member of Response Regulator: B- Type |
| AT2G27080 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G27130 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G27270 | transmembrane protein;(source:Araport11) |
| AT2G27310 | F-box family protein;(source:Araport11) |
| AT2G27670 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
| AT2G27750 | Surfeit locus protein 6;(source:Araport11) |
| AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
| AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
| AT2G27980 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G28090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G28580 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
| AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
| AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
| AT2G28870 | cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11) |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G29020 | Rab5-interacting family protein;(source:Araport11) |
| AT2G29040 | Exostosin family protein;(source:Araport11) |
| AT2G29070 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
| AT2G29100 | member of Putative ligand-gated ion channel subunit family |
| AT2G29110 | member of Putative ligand-gated ion channel subunit family |
| AT2G29120 | member of Putative ligand-gated ion channel subunit family |
| AT2G29160 | pseudogene of senescence-associated gene 13;(source:Araport11) |
| AT2G29180 | transmembrane protein;(source:Araport11) |
| AT2G29220 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29250 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29280 | pseudogene of tropinone reductase;(source:Araport11) |
| AT2G29300 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29350 | Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis. |
| AT2G29360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29370 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29430 | coiled-coil protein (DUF572);(source:Araport11) |
| AT2G29450 | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
| AT2G29500 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT2G29620 | dentin sialophosphoprotein;(source:Araport11) |
| AT2G29630 | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. Recessive mutant isolated by Redei. Leaves but not cotyledons white, lethal; restored to normal by thiamine or 2,5-dimethyl-4-aminopyrimidine. |
| AT2G29720 | Encodes CTF2B. |
| AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
| AT2G29780 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29820 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G29870 | Aquaporin-like superfamily protein;(source:Araport11) |
| AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G29940 | pleiotropic drug resistance 3;(source:Araport11) |
| AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
| AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
| AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
| AT2G30060 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT2G30090 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G30210 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT2G30290 | VACUOLAR SORTING RECEPTOR 2;(source:Araport11) |
| AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G30310 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30330 | Putative homolog of mammalian BLOC-1 Subunit 1. Protein - protein interaction with BLOS2 and also with SNX1.Located in endomembrane system and hypothesized to be involved in endomembrane transport. |
| AT2G30370 | Encodes a small, potentially secreted protein that acts as an inhibitor of stomatal production though likely not through direct interaction with the TMM receptor. It is homologous to known stomatal regulators EPF1 and EPF2. Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT2G30400 | ovate family protein 2;(source:Araport11) |
| AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
| AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
| AT2G30766 | Functions in iron homeostasis, activates iron deficiency response genes such as bHLH38, bHLH39, IRT1, and FRO2. |
| AT2G30830 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT2G31020 | OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11) |
| AT2G31050 | Cupredoxin superfamily protein;(source:Araport11) |
| AT2G31081 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT2G31082 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT2G31335 | hypothetical protein;(source:Araport11) |
| AT2G31370 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT2G31390 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT2G31410 | coiled-coil protein;(source:Araport11) |
| AT2G31550 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
| AT2G31790 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G31902 | Natural antisense transcript overlaps with AT2G31900;(source:Araport11) |
| AT2G31953 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT2G32010 | Encodes an inositol polyphosphate 5?-phosphatase (5PTase). Mediating phosphoinositide signaling. Involved in establishment of foliar vein patterns. |
| AT2G32050 | cell cycle control-like protein (DUF572);(source:Araport11) |
| AT2G32070 | Deadenylase. |
| AT2G32140 | transmembrane receptor;(source:Araport11) |
| AT2G32235 | hypothetical protein;(source:Araport11) |
| AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
| AT2G32290 | beta-amylase 6;(source:Araport11) |
| AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G32360 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G32460 | Member of the R2R3 factor gene family. |
| AT2G32470 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT2G32610 | encodes a gene similar to cellulose synthase |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT2G32740 | galactosyltransferase 13;(source:Araport11) |
| AT2G32750 | Exostosin family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT2G32810 | putative beta-galactosidase |
| AT2G32930 | Encodes a zinc finger protein. |
| AT2G33090 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT2G33110 | member of VAMP72 Gene Family |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT2G33190 | F-box only protein (DUF295);(source:Araport11) |
| AT2G33230 | Encodes a flavin monooxygenase gene which belongs to the tryptophan-dependent auxin biosynthetic pathway and enhances drought resistance. |
| AT2G33233 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G33270 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
| AT2G33300 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
| AT2G33470 | glycolipid transfer protein 1;(source:Araport11) |
| AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
| AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT2G33530 | serine carboxypeptidase-like 46;(source:Araport11) |
| AT2G33710 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT2G33855 | transmembrane protein;(source:Araport11) |
| AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
| AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G34030 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G34110 | hypothetical protein;(source:Araport11) |
| AT2G34170 | hypothetical protein (DUF688);(source:Araport11) |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
| AT2G34270 | hypothetical protein;(source:Araport11) |
| AT2G34280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G34290 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G34320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
| AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT2G34355 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G34360 | MATE efflux family protein;(source:Araport11) |
| AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
| AT2G34480 | Encodes a nuclear localized member of the ribosomal L18ae/LX protein family. Loss of function mutations show reduced transmission through the gametophytes and embryo lethality. |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G34610 | cotton fiber protein;(source:Araport11) |
| AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G34835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-32 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G34890 | Cytidine triphosphate synthase. |
| AT2G34925 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The protein is expressed in leaf axils and the shoot apical meristem and is involved in axillary bud formation. |
| AT2G34980 | Encodes a putative phosphatidylinositol-glycan synthase subunit C gene. It is involved in the first step of the glycosylphosphatidylinositol (GPI) biosynthetic pathway. |
| AT2G35070 | transmembrane protein;(source:Araport11) |
| AT2G35080 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
| AT2G35260 | CAAX protease self-immunity protein;(source:Araport11) |
| AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G35382 | snoRNA;(source:Araport11) |
| AT2G35420 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35430 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G35470 | ribosome maturation factor;(source:Araport11) |
| AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
| AT2G35600 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT2G35615 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G35730 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G35750 | transmembrane protein;(source:Araport11) |
| AT2G35890 | member of Calcium Dependent Protein Kinase |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT2G36020 | HVA22-like protein J;(source:Araport11) |
| AT2G36040 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30610.1);(source:TAIR10) |
| AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
| AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G36220 | hypothetical protein;(source:Araport11) |
| AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
| AT2G36325 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
| AT2G36540 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G36590 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed in leaves, flowers and siliques but to a much lesser extent in roots. |
| AT2G36650 | CHUP1-like protein;(source:Araport11) |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G36750 | UDP-glucosyl transferase 73C1;(source:Araport11) |
| AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
| AT2G37010 | member of NAP subfamily |
| AT2G37020 | Translin family protein;(source:Araport11) |
| AT2G37080 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT2G37150 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G37220 | Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT2G37300 | transmembrane protein;(source:Araport11) |
| AT2G37330 | Encodes an ABC transporter-like protein, without an ATPase domain, required for aluminum (Al) resistance/tolerance and may function to redistribute accumulated Al away from sensitive tissues in order to protect the growing root from the toxic effects of Al. |
| AT2G37360 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT2G37370 | centrosomal protein of 135 kDa-like protein;(source:Araport11) |
| AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT2G37450 | nodulin MtN21-like transporter family protein |
| AT2G37585 | Encodes GlcAT14C. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
| AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G37670 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
| AT2G37750 | hypothetical protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G37910 | cation/hydrogen exchanger, putative (CHX21);(source:Araport11) |
| AT2G37920 | copper ion transmembrane transporter;(source:Araport11) |
| AT2G37960 | myosin-M heavy protein;(source:Araport11) |
| AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT2G38150 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT2G38340 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT2G38490 | member of AtCIPKs |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G38520 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.4e-60 P-value blast match to dbj|BAA78427.1| polyprotein (AtRE2-2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G38646 | hypothetical protein;(source:Araport11) |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT2G38790 | hypothetical protein;(source:Araport11) |
| AT2G38823 | hypothetical protein;(source:Araport11) |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT2G38900 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT2G39020 | Although this locus shares considerable sequence similarity with the adjacent NATA1 gene (At2g39030), they appear to encode genes with different functions. NATA1 is involved in the production of N-delta-acetylornithine, but, overexpression of At2g39020 in tobacco does not lead to the formation of this defense compound. The mRNA is cell-to-cell mobile. |
| AT2G39080 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G39110 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G39180 | CRINKLY4 related 2;(source:Araport11) |
| AT2G39320 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT2G39370 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT2G39490 | F-box family protein;(source:Araport11) |
| AT2G39630 | Encodes a putative dolichyl-phosphate β-glucosyltransferase. |
| AT2G39675 | Trans-acting siRNA1c primary transcript (TAS1c). Gb: AY922999 |
| AT2G39690 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT2G39820 | Translation initiation factor IF6;(source:Araport11) |
| AT2G39850 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT2G39855 | plant/protein;(source:Araport11) |
| AT2G39870 | hypothetical protein;(source:Araport11) |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT2G40120 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G40130 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
| AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
| AT2G40270 | Protein kinase family protein;(source:Araport11) |
| AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G40620 | Basic leucine zipper transcription factor. Localizes from cytoplasm to the nucleus under heat stress. |
| AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G40670 | response regulator 16 |
| AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
| AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G40925 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G40990 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G41150 | plant/protein;(source:Araport11) |
| AT2G41170 | F-box family protein;(source:Araport11) |
| AT2G41231 | transmembrane protein;(source:Araport11) |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT2G41330 | Glutaredoxin family protein;(source:Araport11) |
| AT2G41360 | galactose oxidase/kelch repeat protein;(source:Araport11) |
| AT2G41415 | Encodes a Maternally expressed gene (MEG) family protein |
| AT2G41473 | F-box family protein;(source:Araport11) |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT2G41670 | Encodes SIN2 (SHORT INTEGUMENTS 2), a mitochondrial DAR GTPase. SIN2 is hypothesized to function in mitochondrial ribosome assembly. sin2 mutants produce ovules with short integuments due to early cessation of cell division in these structures. |
| AT2G41680 | Encodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage. |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT2G41860 | member of Calcium Dependent Protein Kinase |
| AT2G42090 | actin related gene or pseudogene, based on sequence divergence and lack of expression |
| AT2G42180 | cotton fiber protein;(source:Araport11) |
| AT2G42200 | Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. SPL activity nonautonomously inhibits initiation of new leaves at the shoot apical meristem. |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42370 | hypothetical protein;(source:Araport11) |
| AT2G42450 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT2G42520 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G42560 | Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress. |
| AT2G42580 | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT2G42750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT2G42850 | cytochrome P450, family 718;(source:Araport11) |
| AT2G42860 | hypothetical protein;(source:Araport11) |
| AT2G42870 | Encodes PHYTOCHROME RAPIDLY REGULATED1 (PAR1), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR2 (At3g58850). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT2G42880 | member of MAP Kinase |
| AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT2G42990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT2G43020 | Encodes a polyamine oxidase. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT2G43180 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT2G43230 | Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA. |
| AT2G43460 | Ribosomal L38e protein family;(source:Araport11) |
| AT2G43570 | chitinase;(source:Araport11) |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43745 | jacalin lectin-like protein;(source:Araport11) |
| AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
| AT2G43840 | UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside), benzoic acid, quercetin, and athranilate in vitro. UGT74F1 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. The true biological substrate(s) of UGT74F1 are not known, but mutant plants lacking UGT74F1 have a decreased level of salicylate glucoside. |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
| AT2G43920 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G43945 | hypothetical protein;(source:Araport11) |
| AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT2G44140 | Autophagy protein |
| AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
| AT2G44230 | hypothetical protein (DUF946);(source:Araport11) |
| AT2G44255 | Natural antisense transcript overlaps with AT2G44260;(source:Araport11) |
| AT2G44260 | DUF946 family protein (DUF946);(source:Araport11) |
| AT2G44280 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G44360 | ecotropic viral integration site protein;(source:Araport11) |
| AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G44450 | beta glucosidase 15;(source:Araport11) |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G44560 | glycosyl hydrolase 9B11;(source:Araport11) |
| AT2G44580 | zinc ion binding protein;(source:Araport11) |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT2G44670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT2G44780 | Encodes a Uclacyanin/Basic blue family protein [pseudogene] |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT2G44830 | AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux. |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein;(source:Araport11) |
| AT2G44990 | More Axillary Branching; carotenoid cleavage dioxygenases. |
| AT2G45060 | alanine-tRNA ligase;(source:Araport11) |
| AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
| AT2G45180 | nsLTP family-related gene. Expression is strongly suppressed by bacterial pathogens. Mutants are more susceptible to pathogens and abiotic stressors suggesting a function in basal stress response. |
| AT2G45190 | Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS). |
| AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
| AT2G45290 | Transketolase;(source:Araport11) |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
| AT2G45340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT2G45550 | Member of CYP76C family of cytochrome P450 enzymes.Has geraniol 9- or 8-hydroxylase activity. |
| AT2G45560 | cytochrome P450 monooxygenase |
| AT2G45570 | member of CYP76C |
| AT2G45580 | cytochrome P450, family 76, subfamily C, polypeptide 3;(source:Araport11) |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
| AT2G45680 | TCP family transcription factor;(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT2G45810 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
| AT2G45910 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G46140 | Late embryogenesis abundant protein;(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT2G46480 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT2G46505 | Encodes succinate dehydrogenase ,a component of mitochondrial respiratory complex II. Nuclear encoded gene which is imported into the mitochondrion. |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT2G46650 | member of Cytochromes b5 The mRNA is cell-to-cell mobile. |
| AT2G46660 | Encodes a member of CYP78A cytochrome P450 monooxygenase protein family that is required in the sporophytic tissue of the mother plant to promote seed growth. |
| AT2G46760 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
| AT2G46850 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2;(source:Araport11) |
| AT2G46960 | member of CYP709B |
| AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
| AT2G47160 | Encodes a key transporter under boron (B) limitation in the soil. Protein accumulates in shoots and roots under conditions of boron deficiency and is degraded within several hours of restoring boron supply. Localized to the plasma membrane under B limitation, and to the cytoplasm after B application before degradation. Protein is transferred via the endosomes to the vacuole for degradation. Localized to the inner plasma membrane domain in the columella, lateral root cap, epidermis, and endodermis in the root tip region, and in the epidermis and endodermis in the elongation zone. Under high-boron is transported to the vacuole for degradation. Thought to be a B transceptor, directly senses the B concentration and promotes its own polyubiquitination and vacuolar sorting for quick and precise maintenance of B homeostasis. |
| AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
| AT2G47200 | hypothetical protein;(source:Araport11) |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT2G47360 | transmembrane protein;(source:Araport11) |
| AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
| AT2G47550 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G47560 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47585 | Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA. The miR164a pri-mRNA also encodes a regulatory peptide miPEP164a (AT2G47584) that regulates accumulation of its own miRNA. |
| AT2G47670 | PMEI6 pectin methylesterase inhibitor functions in establishing a patter of homogalacturonan methylesterification of seed coat cell wall proteins . |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT2G47940 | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
| AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
| AT2G48090 | hypothetical protein;(source:Araport11) |
| AT3G01080 | member of WRKY Transcription Factor; Group I |
| AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT3G01319 | hypothetical protein;(source:Araport11) |
| AT3G01322 | Encodes a ECA1 gametogenesis related family protein |
| AT3G01324 | Encodes a ECA1 gametogenesis related family protein |
| AT3G01410 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT3G01460 | Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes. |
| AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
| AT3G01670 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G01880 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT3G01900 | member of CYP94B |
| AT3G02020 | encodes a monofunctional aspartate kinase |
| AT3G02100 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G02125 | pinin-like protein;(source:Araport11) |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G02250 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G02340 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G02440 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G02493 | ROTUNDIFOLIA like 19;(source:Araport11) |
| AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
| AT3G02670 | Glycine-rich protein family;(source:Araport11) |
| AT3G02750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G02940 | Encodes a putative transcription factor (MYB107). |
| AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT3G03405 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
| AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G03650 | Exostosin family protein;(source:Araport11) |
| AT3G03800 | member of SYP13 Gene Family |
| AT3G03870 | transmembrane protein;(source:Araport11) |
| AT3G03880 | sterol O-acyltransferase, putative (DUF1639);(source:Araport11) |
| AT3G03890 | Dimeric β-barrel protein that is structurally related to the putative non-canonical heme oxygenase (HO) and is located in chloroplasts. May function additionally in the tetrapyrrole biosynthetic pathway. |
| AT3G03920 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT3G04150 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04180 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04190 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04200 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G04240 | Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene. |
| AT3G04280 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family. ARR22 is more similar to the receiver domains of hybrid kinases than other response regulators. It acts as a phosphohistidine phosphatase when tested with phospho-AHP5 in vitro suggesting that it might be involved in a two-component phosphorelay. Expression of ARR22 transcripts appears to be localized to the chalaza and to be induced by wounding. Ectopic expression of ARR in other parts of the plant leads to reduced cytokinin-related responses and impaired root, shoot, and flower development. Overexpression of wild-type ARR22 in an arr22 mutant background causes variable defects in plant growth and fertility. But, in the same ar22 background, over-expression of versions of ARR22 that should act as dominant-negative or constitutively active proteins, based on mutations to the conserved Asp residue, do not show any phenotypic abnormalities, raising the possibility that these may not act as canonical response regulators. |
| AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
| AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
| AT3G04350 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G04720 | Encodes a protein similar to the antifungal chitin-binding protein hevein from rubber tree latex. mRNA levels increase in response to ethylene and turnip crinkle virus infection. The mRNA is cell-to-cell mobile. |
| AT3G04810 | Encodes AtNek2, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT3G05010 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. |
| AT3G05070 | Cwf18 pre-mRNA splicing factor;(source:Araport11) |
| AT3G05130 | paramyosin-like protein;(source:Araport11) |
| AT3G05150 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05155 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT3G05327 | Cyclin family protein;(source:Araport11) |
| AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT3G05370 | receptor like protein 31;(source:Araport11) |
| AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
| AT3G05400 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT3G05540 | Encodes TCTP2, a homolog of Translationally Controlled Tumor Protein. Enhances in vitro plant regeneration. |
| AT3G05545 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G05600 | Encodes a cytosolic epoxide hydrolase capable of acting on 9,10-epoxystearic acid and on 12,13- epoxyoctadec-9-enoic acid that is involved in the synthesis of poly-hydroxylated cutin monomers. |
| AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT3G05770 | hypothetical protein;(source:Araport11) |
| AT3G05870 | Subunit of the anaphase promoting complex, a ubiquitin ligase complex that regulates progression through the cell cycle. |
| AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
| AT3G05905 | Natural antisense transcript overlaps with AT3G05900;(source:Araport11) |
| AT3G05937 | hypothetical protein;(source:Araport11) |
| AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
| AT3G06220 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT3G06230 | member of MAP Kinase Kinase |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
| AT3G06390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G06420 | Autophagy protein. |
| AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G06630 | protein kinase family protein;(source:Araport11) |
| AT3G06640 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G06920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G07070 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G07150 | amino acid-ligase;(source:Araport11) |
| AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT3G07280 | None;(source:Araport11) |
| AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT3G07820 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
| AT3G08500 | Encodes a putative R2R3-type MYB transcription factor (MYB83). |
| AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
| AT3G08860 | Encodes a protein that is predicted to have beta-alanine aminotransferase activity. |
| AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
| AT3G09080 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G09162 | hypothetical protein;(source:Araport11) |
| AT3G09210 | plastid transcriptionally active 13;(source:Araport11) |
| AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
| AT3G09300 | OSBP(oxysterol binding protein)-related protein 3B;(source:Araport11) |
| AT3G09320 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G09330 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT3G09850 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
| AT3G10240 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
| AT3G10350 | One of 3 GET paralogs in Arabidopsis. GET3b is a chloroplast localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
| AT3G10370 | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion. |
| AT3G10450 | serine carboxypeptidase-like 7;(source:Araport11) |
| AT3G10470 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
| AT3G10520 | Encodes a class 2 non-symbiotic hemoglobin. Over-expression of AHb2 in seeds led to a 40% increase in the total fatty acid content of developing and mature seeds in three subsequent generations. This was mainly due to an increase in the poly-unsaturated C18:2 (omega-6) linoleic and C18:3 (omega-3) alpha-linolenic acids. |
| AT3G10540 | master regulator of AGC kinases |
| AT3G10560 | member of CYP77A |
| AT3G10585 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G10590 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT3G10710 | root hair specific 12;(source:Araport11) |
| AT3G10820 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
| AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G10970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT3G11300 | hypothetical protein;(source:Araport11) |
| AT3G11310 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT3G11385 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G11405 | hypothetical protein;(source:Araport11) |
| AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT3G11500 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
| AT3G11773 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G11800 | Expp1 protein;(source:Araport11) |
| AT3G12060 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G12090 | TET6 encodes a member of the TETRASPANIN gene family that is expressed in the vascular system and is involved in organ growth redundantly with TET5. |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT3G12190 | golgin family A protein;(source:Araport11) |
| AT3G12203 | serine carboxypeptidase-like 17;(source:Araport11) |
| AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
| AT3G12420 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G12440 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G12500 | encodes a basic chitinase involved in ethylene/jasmonic acid mediated signalling pathway during systemic acquired resistance based on expression analyses. |
| AT3G12540 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G12690 | Encodes a putative serine/threonine kinase It is expressed specifically in pollen and appears to function redundantly with AGC1.7 to regulate polarized growth of pollen tubes. |
| AT3G12740 | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. The mRNA is cell-to-cell mobile. |
| AT3G12810 | Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile. |
| AT3G12835 | hypothetical protein;(source:Araport11) |
| AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
| AT3G13040 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT3G13070 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
| AT3G13220 | Encodes a ATP-binding cassette transporter G26 (ABCG26) involved in tapetal cell and pollen development. Required for male fertility and pollen exine formation. |
| AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G13340 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G13380 | Similar to BRI, brassinosteroid receptor protein. |
| AT3G13390 | SKU5 similar 11;(source:Araport11) |
| AT3G13404 | hypothetical protein;(source:Araport11) |
| AT3G13430 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G13432 | transmembrane protein;(source:Araport11) |
| AT3G13433 | transmembrane protein;(source:Araport11) |
| AT3G13500 | hypothetical protein;(source:Araport11) |
| AT3G13550 | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT3G13600 | calmodulin-binding family protein;(source:Araport11) |
| AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT3G13724 | Encodes a microRNA that targets CMT3. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGGUGGUGAUCAUAUAAGAU |
| AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
| AT3G13784 | cell wall invertase 5;(source:Araport11) |
| AT3G13790 | Encodes a protein with invertase activity. |
| AT3G13825 | pseudogene of F-box family protein |
| AT3G13830 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G13845 | transmembrane protein;(source:Araport11) |
| AT3G13890 | Encodes a putative transcription factor (MYB26). Mutants produces fertile pollen but plants are sterile because anthers do not dehisce. The cellulosic secondary wall thickenings are not formed in the endothecium as they are in non-mutant plants. |
| AT3G13940 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
| AT3G13970 | Autophagy protein. |
| AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
| AT3G14060 | hypothetical protein;(source:Araport11) |
| AT3G14090 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G14205 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G14210 | A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni. |
| AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT3G14290 | Encodes 20S proteasome subunit PAE2 (PAE2) that has RNase activity. |
| AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G14452 | transmembrane protein;(source:Araport11) |
| AT3G14470 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G14480 | glycine/proline-rich protein;(source:Araport11) |
| AT3G14520 | Encodes a sesterterpene synthase responsible for the biosynthesis of the tricyclic sesterterpene (+)-thalianatriene with a 11-6-5 fused ring system. |
| AT3G14550 | Encodes a protein with geranylgeranyl pyrophosphate synthase activity involved in isoprenoid biosynthesis. The enzyme appears to be targeted to the chloroplast in epidermal cells and guard cells of leaves, and in etioplasts in roots. |
| AT3G14610 | putative cytochrome P450 |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT3G14760 | transmembrane protein;(source:Araport11) |
| AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
| AT3G14855 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT3G14950 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT3G14960 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
| AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT3G15170 | Encodes a transcription factor involved in shoot apical meristem formation and cotyledon separation. Functions redundantly with CUC2 and CUC3. The cuc1 cuc2 double mutant phenotype is first detectable at the heart stage, as embryos lacking two distinct bulges of cotyledonary primordia.In post embryonic development it plays a role in axillary meristem formation, boundary separation, gynoecium and ovule development.Contains a MIR164 binding site. |
| AT3G15280 | hypothetical protein;(source:Araport11) |
| AT3G15330 | pseudogene of the NLI interacting factor (NIF) protein family |
| AT3G15350 | G14 enzyme |
| AT3G15490 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT3G15518 | hypothetical protein;(source:Araport11) |
| AT3G15534 | hypothetical protein;(source:Araport11) |
| AT3G15690 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G15720 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G15770 | hypothetical protein;(source:Araport11) |
| AT3G15810 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
| AT3G16090 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT3G16130 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT3G16240 | Delta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. Highly expressed in flower, shoot, and stem. Expression shows diurnal regulation and is induced by ammonium (NH3). Protein localized to vacuolar membrane. The mRNA is cell-to-cell mobile. |
| AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT3G16370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT3G16450 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G16460 | Mannose-binding protein |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT3G16660 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
| AT3G16850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G16880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17010 | transcriptional factor B3 family protein, contains Pfam profile PF02362: B3 DNA binding domain. Activated by AGAMOUS ina a cal-1, ap1-1 background. Expressed in stamen primordia, the placental region of developing carpels and the ovary. |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G17152 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
| AT3G17280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G17600 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA31 shares several residues with the conserved domain II region, believed to act as a degron in many of the rapidly degraded Aux/IAA family members. An IAA31 fusion protein is quite long-lived, but can be degraded more rapidly in the presence of auxin. Unlike many other family members, IAA31 transcript levels do not rise in response to auxin. Nevertheless, overexpression of IAA31 leads to defects in auxin-related processes such as gravitropism, root development, shoot development, and cotyledon vascular development. |
| AT3G17710 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G17900 | Plant specific component of TRAPPII vesicle transport complex. |
| AT3G17980 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G18030 | flavin mononucleotide flavoprotein involved in salt and osmotic tolerance HAL3A encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis. HAL3A is predominant over another gene with the presumably same function (HAL3B). |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT3G18120 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G18165 | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT3G18220 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
| AT3G18282 | hypothetical protein;(source:Araport11) |
| AT3G18535 | |
| AT3G18550 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Role in flowering control. |
| AT3G18670 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G18720 | F-box family protein;(source:Araport11) |
| AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18827 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CUUCUUAAGUGCUGAUAAUGC |
| AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G18900 | ternary complex factor MIP1 leucine-zipper protein;(source:Araport11) |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G19085 | F-box/RNI/FBD-like domain protein;(source:Araport11) |
| AT3G19090 | RNA-binding protein;(source:Araport11) |
| AT3G19230 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G19280 | Encodes a protein with core α1,3-fucosyltransferase activity. |
| AT3G19320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
| AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT3G19595 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
| AT3G19700 | Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments. |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G20080 | cytochrome P450, family 705, subfamily A, polypeptide 15;(source:Araport11) |
| AT3G20083 | pseudogene of cytochrome P450;(source:Araport11) |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G20220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT3G20360 | TRAF-like family protein;(source:Araport11) |
| AT3G20440 | Encodes BE1, a putative glycoside hydrolase. Involved in organogenesis and somatic embryogenesis by regulating carbohydrate metabolism. Mutation in BE1 has pleotrophic effect on the whole plant development. |
| AT3G20580 | COBRA-like protein 10 precursor;(source:Araport11) |
| AT3G20655 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G20840 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
| AT3G20850 | proline-rich family protein;(source:Araport11) |
| AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT3G20990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G20993 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G21040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-20 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
| AT3G21210 | zinc ion binding protein;(source:Araport11) |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT3G21270 | Encodes Dof zinc finger protein adof2. |
| AT3G21300 | RNA methyltransferase family protein;(source:Araport11) |
| AT3G21310 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
| AT3G21330 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G21570 | proline-rich nuclear receptor coactivator;(source:Araport11) |
| AT3G21590 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT3G21680 | hypothetical protein;(source:Araport11) |
| AT3G21710 | transmembrane protein;(source:Araport11) |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT3G21791 | Pseudogene of AT3G21790; UDP-glucoronosyl/UDP-glucosyl transferase family protein |
| AT3G21800 | UDP-glucosyl transferase 71B8;(source:Araport11) |
| AT3G21860 | SKP1-like 10;(source:Araport11) |
| AT3G21870 | cyclin p2;(source:Araport11) |
| AT3G21880 | Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570). |
| AT3G21937 | pseudogene of Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT3G22133 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10) |
| AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
| AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
| AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G22340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-60 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G22360 | encodes an alternative oxidase whose expression is limited to flowers and floral buds. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G22420 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT3G22436 | hypothetical protein;(source:Araport11) |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT3G22640 | cupin family protein;(source:Araport11) |
| AT3G22720 | F-box/associated interaction domain protein;(source:Araport11) |
| AT3G22730 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G22770 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G22961 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile. |
| AT3G23010 | receptor like protein 36;(source:Araport11) |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT3G23130 | Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants. |
| AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
| AT3G23172 | hypothetical protein;(source:Araport11) |
| AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT3G23310 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G23350 | ENTH/VHS family protein;(source:Araport11) |
| AT3G23360 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G23380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Gene is expressed predominantly in inflorescence and flower tissue. |
| AT3G23420 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
| AT3G23460 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G23510 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G23740 | hypothetical protein;(source:Araport11) |
| AT3G23770 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G23800 | selenium-binding protein 3;(source:Araport11) |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT3G23870 | magnesium transporter NIPA (DUF803);(source:Araport11) |
| AT3G24090 | Encodes a glutamine-fructose-6-phosphate transaminase that likely plays a role in UDP-N-acetylglucosamine biosynthesis. |
| AT3G24093 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT3G24100 | Encodes a secreted peptide that enhances stress indued cell death. |
| AT3G24130 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G24230 | Pectate lyase family protein;(source:Araport11) |
| AT3G24250 | glycine-rich protein;(source:Araport11) |
| AT3G24260 | paired amphipathic helix Sin3-like protein;(source:Araport11) |
| AT3G24280 | small acidic protein 2;(source:Araport11) |
| AT3G24320 | Encodes a DNA binding protein that promotes re-arrangements of mitochondrial genome. Mutations affects mitochondrial gene expression, and impairs mitochondrial function. Dual targeting of the protein to mitochondria and chloroplasts caused by alternative translation initiation. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity. |
| AT3G24450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT3G24500 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
| AT3G24520 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G24715 | HCR1 belongs to the B4 group of Raf-like MAPKKKs. It corresponds to a root hydraulic pressure QTL between Col-0 and Bur-0 accessions and appears to contribute to variation in root pressure in different haplotypes. It is involved in potassium-dependent response to hypoxia. |
| AT3G24982 | receptor like protein 40;(source:Araport11) |
| AT3G25040 | Encodes ERD2b. a homolog of the yeast endoplasmic reticulum retention receptor ERD2. Mutations in ERD2b compromise EFR but not FLS2 signaling. The mRNA is cell-to-cell mobile. |
| AT3G25140 | Quasimodo1, encodes a glycosyltransferase, involved in homogalacturonan biosynthesis; mutant shows cell adhesion defect and lower wall uronic acid content. The mRNA is cell-to-cell mobile. |
| AT3G25180 | Encodes a cytochrome P450 monooxygenase (CYP82G1) that catalyzes the production of two volatile homoterpenes, TMTT and DMNT, although it is only likely to produce TMTT in planta. TMTT can be involved in attracting predatory insects to protect Arabidopsis plants from herbivorous pests. Homoterpene synthesis is also stimulated by fungal elicitors which increase the transcript levels of CYP82G1. |
| AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
| AT3G25450 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.7e-211 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G25550 | F-box family protein;(source:Araport11) |
| AT3G25560 | NSP-interacting kinase 2;(source:Araport11) |
| AT3G25590 | micronuclear linker histone polyprotein-like protein;(source:Araport11) |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
| AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
| AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
| AT3G25960 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G26010 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G26040 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G26100 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G26120 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT3G26140 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT3G26150 | putative cytochrome P450 |
| AT3G26180 | putative cytochrome P450 |
| AT3G26190 | putative cytochrome P450 |
| AT3G26230 | putative cytochrome P450 |
| AT3G26290 | putative cytochrome P450 |
| AT3G26295 | putative cytochrome P450. |
| AT3G26300 | putative cytochrome P450 |
| AT3G26320 | putative cytochrome P450 |
| AT3G26330 | putative cytochrome P450 |
| AT3G26390 | hypothetical protein;(source:Araport11) |
| AT3G26460 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G26470 | Powdery mildew resistance protein, RPW8 domain-containing protein;(source:Araport11) |
| AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
| AT3G26539 | hypothetical protein;(source:Araport11) |
| AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT3G26805 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile. |
| AT3G26880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G26890 | meiosis chromosome segregation family protein;(source:Araport11) |
| AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
| AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT3G27110 | PGM48 is a member of a plant specific clade of metallo-endopeptidase proteins. It is found in plastoglobules. Analysis of over-expression and loss of function phenotypes suggests PGM48 may have a role in positively regulating senescence. |
| AT3G27150 | Target gene of MIR2111-5p. |
| AT3G27360 | Histone superfamily protein;(source:Araport11) |
| AT3G27400 | Encodes a pectate lyase involved in response to nematodes. |
| AT3G27440 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT3G27860 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT3G28100 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
| AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G28170 | hypothetical protein;(source:Araport11) |
| AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT3G28193 | transmembrane protein;(source:Araport11) |
| AT3G28210 | Encodes a putative zinc finger protein (PMZ). |
| AT3G28270 | AFL1 was first identified by immunoscreening an Arabidopsis expression library with antisera recognizing mammalian β1-integrin. It is a peripheral membrane protein associated with endomembranes and plasmamembrane. Based on overexpression and knockdown phenotypes, AFL1 is postulated to function in regulation of growth and proline accumulation in response to drought. AFL1 protein co-localizes with clatharin coated vesicles and has been shown to interact with itself and several endomembrane associated proteins. |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G28345 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT3G28380 | P-glycoprotein 17;(source:Araport11) |
| AT3G28412 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
| AT3G28420 | Putative membrane lipoprotein;(source:Araport11) |
| AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28560 | BCS1 AAA-type ATPase;(source:Araport11) |
| AT3G28570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28590 | transmembrane protein;(source:Araport11) |
| AT3G28610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28790 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
| AT3G28950 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G29153 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-238 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G29290 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G29300 | transmembrane protein;(source:Araport11) |
| AT3G29305 | transmembrane protein;(source:Araport11) |
| AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
| AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT3G30280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G30350 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT3G30705 | transmembrane protein;(source:Araport11) |
| AT3G30714 | Pseudogene of AT3G26870; self-incompatibility protein-related |
| AT3G30839 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-11 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G30841 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
| AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
| AT3G31460 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein -related;(source:TAIR10) |
| AT3G32040 | Chloroplast localized GFDP synthase. |
| AT3G32050 | hypothetical protein;(source:Araport11) |
| AT3G32925 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G32930 | Protein of unknown function. Locus is correlated with bacterial hypersensitive response, expression is reduced after injection with avrRpm1. |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33070 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-191 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G41761 | other_RNA;(source:Araport11) |
| AT3G41768 | rRNA;(source:Araport11) |
| AT3G41979 | 5.8SrRNA |
| AT3G42090 | transposable_element_gene;(source:Araport11);contains domain LIN-9 RELATED (PTHR21689);(source:TAIR10) |
| AT3G42178 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-197 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G42316 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.9e-38 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT3G42430 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37045.1);(source:TAIR10) |
| AT3G42640 | H[+]-ATPase 8;(source:Araport11) |
| AT3G42717 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.8e-229 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G42800 | AF-like protein;(source:Araport11) |
| AT3G42880 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G42886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-89 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G42890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-10 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G43220 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G43425 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-17 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G43540 | initiation factor 4F subunit (DUF1350);(source:Araport11) |
| AT3G43710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G43750 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, are key regulators of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
| AT3G43760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT3G44250 | putative cytochrome P450 |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G44400 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G44550 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
| AT3G44560 | fatty acid reductase 8;(source:Araport11) |
| AT3G44605 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-38 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G44620 | protein-tyrosine phosphatase;(source:Araport11) |
| AT3G44730 | kinesin-like protein 1;(source:Araport11) |
| AT3G44755 | hypothetical protein;(source:Araport11) |
| AT3G44796 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-307 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G44810 | F-box family protein;(source:Araport11) |
| AT3G44840 | SABATH methyltransferase |
| AT3G44880 | Encodes a pheide a oxygenase (PAO). Accelerated cell death (acd1) mutants show rapid, spreading necrotic responses to both virulent and avirulent Pseudomonas syringae pv. maculicola or pv. tomato pathogens and to ethylene. |
| AT3G44910 | member of Putative Na+/H+ antiporter family |
| AT3G44920 | member of Putative Na+/H+ antiporter family |
| AT3G44930 | member of Putative Na+/H+ antiporter family |
| AT3G44960 | shugoshin;(source:Araport11) |
| AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G45010 | serine carboxypeptidase-like 48;(source:Araport11) |
| AT3G45120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10) |
| AT3G45130 | lanosterol synthase 1;(source:Araport11) |
| AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile. |
| AT3G45190 | SIT4 phosphatase-associated family protein;(source:Araport11) |
| AT3G45210 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
| AT3G45220 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT3G45230 | Encodes the arabinogalactan protein core of plant cell wall proteoglycan that contains arabinogalactan and cell wall matrix glycan pectin and/or xylan domains. |
| AT3G45253 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-48 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G45310 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G45330 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
| AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT3G45510 | RING/U-box protein;(source:Araport11) |
| AT3G45577 | tRNA-intron endonuclease;(source:Araport11) |
| AT3G45610 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT3G45730 | hypothetical protein;(source:Araport11) |
| AT3G45760 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT3G45850 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G45940 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
| AT3G45980 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases as well as the UBC1 and UBC2 E2 ubiquitin conjugating enzymes. Lysine 146 appears to be the site of the ubiquitin addition. |
| AT3G46050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G46090 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G46130 | Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons. |
| AT3G46170 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G46186 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT3G46210 | Ribosomal protein S5 domain 2-like superfamily protein;(source:Araport11) |
| AT3G46260 | kinase-like protein;(source:Araport11) |
| AT3G46360 | transmembrane protein;(source:Araport11) |
| AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G46440 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
| AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
| AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT3G46660 | UDP-glucosyl transferase 76E12;(source:Araport11) |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46710 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G46770 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT3G46800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G46840 | Subtilase family protein;(source:Araport11) |
| AT3G46860 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT3G46870 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G46890 | maternal effect embryo arrest protein;(source:Araport11) |
| AT3G46930 | Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses. |
| AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
| AT3G47021 | Pseudogene of AT4G39930; unknown protein |
| AT3G47030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47160 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G47180 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G47330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
| AT3G47341 | transmembrane protein;(source:Araport11) |
| AT3G47342 | snoRNA;(source:Araport11) |
| AT3G47400 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G47420 | Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G47440 | Encodes AtTIP5;1, functions as water and urea channels in pollen. Target promoter of the male germline-specific transcription factor DUO1. Essential target of gibberellins, promotes hypocotyl cell elongation under excess boron stress. |
| AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
| AT3G47660 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G47720 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
| AT3G47730 | member of ATH subfamily |
| AT3G47740 | member of ATH subfamily |
| AT3G47750 | member of ATH subfamily |
| AT3G47760 | ABC2 homolog 4;(source:Araport11) |
| AT3G47770 | ABC2 homolog 5;(source:Araport11) |
| AT3G47780 | member of ATH subfamily The mRNA is cell-to-cell mobile. |
| AT3G47790 | ABC2 homolog 7;(source:Araport11) |
| AT3G47940 | DNAJ heat shock family protein;(source:Araport11) |
| AT3G47950 | mutant has Slight reduction in root and shoot growth; Exaggerated defects in salt stress; Plasma Membrane H+ ATPase |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT3G48010 | member of Cyclic nucleotide gated channel family |
| AT3G48180 | CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase;(source:Araport11) |
| AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT3G48209 | Encodes a Plant thionin family protein |
| AT3G48250 | Encodes a pentatricopeptide repeat protein implicated in splicing of intron 1 of mitochondrial nad7 transcripts. |
| AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
| AT3G48346 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G48390 | MA3 domain-containing protein;(source:Araport11) |
| AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT3G48745 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
| AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT3G49120 | Class III peroxidase Perx34. Expressed in roots, leaves and stems. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT3G49130 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
| AT3G49305 | transmembrane protein;(source:Araport11) |
| AT3G49350 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G49440 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
| AT3G49725 | GTP-binding protein, HflX;(source:Araport11) |
| AT3G49832 | pseudogene of kelch repeat-containing F-box family |
| AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
| AT3G50030 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
| AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50290 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50295 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
| AT3G50360 | CAM like protein with four EF-hand domains. Binds calcium. Loss of function mutants affect ABA regulation of guard cell channels and accumulation of stress responsive transcripts(PMID:28603528). |
| AT3G50390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G50400 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G50440 | Encodes a protein shown to have methyl jasmonate esterase activity in vitro. This protein does not act on methyl IAA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT3G50480 | Homolog of RPW8 |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT3G50710 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT3G50900 | hypothetical protein;(source:Araport11) |
| AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT3G50980 | dehydrin xero 1;(source:Araport11) |
| AT3G51060 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC) |
| AT3G51090 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
| AT3G51130 | transmembrane protein;(source:Araport11) |
| AT3G51190 | Ribosomal protein L2 family;(source:Araport11) |
| AT3G51220 | WEB family protein (DUF827);(source:Araport11) |
| AT3G51265 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G51280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G51390 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
| AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT3G51730 | saposin B domain-containing protein;(source:Araport11) |
| AT3G51760 | hypothetical protein (DUF688);(source:Araport11) |
| AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G51880 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. |
| AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
| AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G52000 | serine carboxypeptidase-like 36;(source:Araport11) |
| AT3G52200 | Encodes a dihydrolipoamide S-acetyltransferase, a subunit of the mitochondrial pyruvate dehydrogenase complex. |
| AT3G52320 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G52350 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT3G52980 | Zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
| AT3G53016 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUCGGUUCGCGAUCCACAAG |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT3G53065 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
| AT3G53150 | UDP-glucosyl transferase 73D1;(source:Araport11) |
| AT3G53160 | UGT73C7 is induced by pathogen infection. It glycosylates p-coumaric acid and ferulic acid to modulate phenylpropanoid metabolism and induce innate immune response. |
| AT3G53232 | ROTUNDIFOLIA like 1;(source:Araport11) |
| AT3G53280 | cytochrome P450 monooxygenase The mRNA is cell-to-cell mobile. |
| AT3G53305 | putative cytochrome P450 |
| AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
| AT3G53490 | valine-tRNA ligase;(source:Araport11) |
| AT3G53520 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT3G53550 | FBD-like domain family protein;(source:Araport11) |
| AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
| AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
| AT3G53790 | Arabidopsis thaliana telomere-binding protein, putative (At3g53790) |
| AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G53930 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G53940 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G53980 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT3G54020 | Inositol phosphorylceramide synthase |
| AT3G54030 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT3G54040 | PAR1 protein;(source:Araport11) |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G54120 | Reticulon family protein;(source:Araport11) |
| AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G54410 | hypothetical protein (DUF1163);(source:Araport11) |
| AT3G54620 | bZIP transcription factor-like protein mRNA |
| AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G55100 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin. |
| AT3G55430 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G55512 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
| AT3G55550 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
| AT3G55650 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G55720 | replication factor C subunit, putative (DUF620);(source:Araport11) |
| AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT3G55890 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
| AT3G56280 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
| AT3G56360 | hypothetical protein;(source:Araport11) |
| AT3G56450 | member of alpha-SNAP Gene Family |
| AT3G56520 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT3G56600 | phosphatidylinositol 4-kinase gamma-like protein;(source:Araport11) |
| AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT3G56660 | basic region/leucine zipper motif protein 49;(source:Araport11) |
| AT3G56700 | Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding. |
| AT3G56705 | U2-6;(source:Araport11) |
| AT3G56800 | encodes a calmodulin |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
| AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein. |
| AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
| AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
| AT3G57250 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
| AT3G57260 | beta 1,3-glucanase |
| AT3G57300 | Encodes the Arabidopsis INO80 ortholog of the SWI/SNF ATPase family that has been shown to interact with H2A.Z and facilitates the enrichment of H2A.Z at the ends of the flowering repressor genes FLC and MAF4/5. Functions as a positive regulator of DNA homologous recombination (HR) and plays a crucial role in genome stability maintenance. In INO80 mutants, the HR frequency is reduced to 15% of that in the wild-type. Plants mutated in INO80 display a pleiotropic phenotype including smaller plant and organ size, and late flowering but are not more sensitive to genotoxic agents or less efficient at T-DNA integration. INO80 has also been shown to regulate a subset of the Arabidopsis transcriptome. |
| AT3G57400 | transmembrane protein;(source:Araport11) |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
| AT3G57680 | C-terminal peptidase |
| AT3G57710 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57790 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G57840 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT3G57950 | cotton fiber protein;(source:Araport11) |
| AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G58030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE2 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
| AT3G58190 | This gene contains two auxin-responsive element (AuxRE). Required for triggering cell reprogramming during callus formation. |
| AT3G58210 | TRAF-like family protein;(source:Araport11) |
| AT3G58230 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT3G58240 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G58250 | TRAF-like family protein;(source:Araport11) |
| AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT3G58430 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT3G58740 | Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds. |
| AT3G58770 | hypothetical protein;(source:Araport11) |
| AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
| AT3G58795 | Natural antisense transcript overlaps with AT3G58790;(source:Araport11) |
| AT3G58820 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G58877 | hypothetical protein;(source:Araport11) |
| AT3G58920 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G59140 | member of MRP subfamily |
| AT3G59170 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT3G59240 | RNI-like superfamily protein;(source:Araport11) |
| AT3G59260 | pirin;(source:Araport11) |
| AT3G59340 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT3G59480 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT3G59500 | Integral membrane HRF1 family protein;(source:Araport11) |
| AT3G59640 | Plasma membrane localized. glycine rich protein of unknown function. Involved in non host resistance. |
| AT3G59730 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G59765 | None;(source:Araport11) |
| AT3G59840 | allyl alcohol dehydrogenase-like protein;(source:Araport11) |
| AT3G59950 | Autophagy protein. |
| AT3G59990 | Encodes a MAP2 like methionine aminopeptidase |
| AT3G60060 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G60075 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development. |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G60130 | beta glucosidase 16;(source:Araport11) |
| AT3G60238 | other_RNA;(source:Araport11) |
| AT3G60240 | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT3G60270 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G60328 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G60500 | Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis. |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G60560 | hypothetical protein;(source:Araport11) |
| AT3G60620 | cytidinediphosphate diacylglycerol synthase 5;(source:Araport11) |
| AT3G60710 | F-box family protein. |
| AT3G60740 | Encodes tubulin-folding cofactor D. Mutants arrest during embryogenesis with embryos that are small, mushroom-shaped ('pilz') and consist of only one or few large cells each containing one or more variably enlarged nuclei and often cell wall stubs. Gene product necessary for continuous microtubule organization. |
| AT3G60750 | Transketolase;(source:Araport11) |
| AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
| AT3G60910 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G60920 | beige/BEACH domain protein;(source:Araport11) |
| AT3G60966 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G60972 | other_RNA;(source:Araport11) |
| AT3G61182 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G61185 | Encodes a defensin-like (DEFL) family protein. |
| AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
| AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G61390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G61415 | SKP1-like 21;(source:Araport11) |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT3G61500 | BPS1-like protein;(source:Araport11) |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT3G61720 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G61770 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT3G61940 | Member of Zinc transporter (ZAT) family. Expressed in roots under low zinc conditions. |
| AT3G62070 | hypothetical protein;(source:Araport11) |
| AT3G62100 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. |
| AT3G62230 | Target promoter of the male germline-specific transcription factor DUO1. Increases seed oil content by attenuating GL2 inhibition. Overexpression results in reduced trichome numbers. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
| AT3G62370 | heme binding protein;(source:Araport11) |
| AT3G62380 | F-box/associated interaction domain protein;(source:Araport11) |
| AT3G62529 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G62590 | PLIP3 is a glycerolipid A1 lipase with substrate specificity for phosphatidylglycerol. Expression is induced by ABA. |
| AT3G62650 | hypothetical protein;(source:Araport11) |
| AT3G62670 | member of Response Regulator: B- Type |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT3G62700 | member of MRP subfamily |
| AT3G62725 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-41 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G62730 | desiccation-like protein;(source:Araport11) |
| AT3G62740 | beta glucosidase 7;(source:Araport11) |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT3G63003 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT3G63250 | Encodes a homocysteine methyltransferase (HMT). Among the three HMT coding genes in the genome, HMT2 is responsible for a significant proportion of HMT activity in the flower stalks and silique hulls. However, HMT2 does not significantly contribute to the total HMT activity in seeds. |
| AT3G63280 | Encodes AtNek4, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
| AT3G66658 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G00160 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G00170 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G00236 | pseudogene of Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT4G00240 | member of C2-PLD subfamily |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT4G00390 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT4G00400 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT4. |
| AT4G00416 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT4G00467 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT4G00500 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G00530 | UvrABC system protein A;(source:Araport11) |
| AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G00600 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT4G00660 | RNAhelicase-like 8;(source:Araport11) |
| AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G00780 | TRAF-like family protein;(source:Araport11) |
| AT4G00840 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G00870 | bHLH14 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH17 to negatively regulate jasmonate responses. |
| AT4G00872 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G00885 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC |
| AT4G00895 | ATPase, F1 complex, OSCP/delta subunit protein;(source:Araport11) |
| AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G01000 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G01030 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
| AT4G01260 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT4G01320 | CAAX protease with broad substrate specificity. Localized exclusively to the endoplasmic reticulum. |
| AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT4G01430 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
| AT4G01575 | Encodes a putative Kazal-type serine proteinase inhibitor that is highly expressed in seeds, mature roots and flowers. |
| AT4G01610 | Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture. |
| AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT4G01820 | member of MDR subfamily |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT4G02070 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. |
| AT4G02090 | PADRE protein. |
| AT4G02190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
| AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G02380 | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
| AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G02770 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD1) |
| AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
| AT4G02810 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
| AT4G03200 | catalytics;(source:Araport11) |
| AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
| AT4G03280 | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT4G03285 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
| AT4G03290 | EF hand calcium-binding protein family;(source:Araport11) |
| AT4G03364 | Pseudogene of AT4G05230; ubiquitin family protein |
| AT4G03370 | Ubiquitin family protein;(source:Araport11) |
| AT4G03480 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G04404 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT4G04405 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.6e-50 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G04410 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-176 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT4G04460 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04500 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04570 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT4G04745 | hypothetical protein;(source:Araport11) |
| AT4G04750 | Putative mitochondrial F1F0-ATPase. |
| AT4G04820 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G24930.1);(source:TAIR10) |
| AT4G04830 | methionine sulfoxide reductase B5;(source:Araport11) |
| AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
| AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
| AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
| AT4G04972 | hypothetical protein;(source:Araport11) |
| AT4G04980 | hypothetical protein;(source:Araport11) |
| AT4G05048 | Encodes a C/D box snoRNA (U49.1). Gb: AJ300655 |
| AT4G05100 | Member of the R2R3 factor gene family. |
| AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
| AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
| AT4G05240 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05260 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G05430 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G05495 | pseudogene of temperature sensing protein-like protein;(source:Araport11) |
| AT4G05530 | Encodes a peroxisomal member of the short-chain dehydrogenase/reductase (SDR) family of enzymes. Loss of IBR1 function causes increased resistance to indole-3-butyric acid without affecting plant responses to IAA, NAA, and 2,4-D. This enzyme may be responsible for catalyzing a dehydrogenation step in the beta-oxidation-like conversion of IBA to IAA. The mRNA is cell-to-cell mobile. |
| AT4G05540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G06477 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.1e-112 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G06479 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT4G06494 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam domain PF03778: Protein of unknown function (DUF321);(source:TAIR10) |
| AT4G06548 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G06562 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.9e-144 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06565 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06566 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.9e-101 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G06569 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.2e-59 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT4G06634 | Encodes an ABA responsive C2H2-type zinc finger transcription factor with both transcriptional repression and activation domains, that binds a G-rich, 11-bp DNA-binding motif. YY1 binds to the promoter of ABR1 and disruption represses ABA- and salt-induced ABR1 expression. |
| AT4G06646 | transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1081_B12.13, blastp match of 33%25 identity and 9.8e-51 P-value to GP|27817864|dbj|BAC55632.1||AP003865 OJ1081_B12.13 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT4G06702 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06708 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-289 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06710 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G06718 | transposable_element_gene;(source:Araport11);pseudogene, expressed protein;(source:TAIR10) |
| AT4G07516 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
| AT4G07720 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
| AT4G07950 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
| AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
| AT4G08098 | pseudogene of hypothetical protein |
| AT4G08160 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT4G08290 | nodulin MtN21-like transporter family protein |
| AT4G08330 | hypothetical protein;(source:Araport11) |
| AT4G08360 | KOW domain-containing protein;(source:Araport11) |
| AT4G08510 | mediator of RNA polymerase II transcription subunit-like protein;(source:Araport11) |
| AT4G08560 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT4G08596 | transposable_element_gene;(source:Araport11);pseudogene, FAR1 -related protein, temporary automated functional assignment;(source:TAIR10) |
| AT4G08610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-87 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G08652 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G35030.1);(source:TAIR10) |
| AT4G08670 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G08740 | hypothetical protein;(source:Araport11) |
| AT4G08765 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.2e-158 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT4G08871 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.2e-15 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT4G09030 | Encodes arabinogalactan protein (AGP10). The mRNA is cell-to-cell mobile. |
| AT4G09090 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT4G09350 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G09450 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT4G09455 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
| AT4G09545 | Encodes a ECA1 gametogenesis related family protein |
| AT4G09550 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT4G09800 | encodes a ribosomal protein S18C, a constituent of the small subunit of the ribosomal complex |
| AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G09940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT4G09987 | Encodes a defensin-like (DEFL) family protein. |
| AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT4G10020 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
| AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
| AT4G10070 | KH domain-containing protein;(source:Araport11) |
| AT4G10200 | TTF-type zinc finger protein with HAT dimerization domain-containing protein;(source:Araport11) |
| AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
| AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
| AT4G10360 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT4G10430 | TMPIT-like protein;(source:Araport11) |
| AT4G10490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT4G10510 | Subtilase family protein;(source:Araport11) |
| AT4G10530 | Subtilase family protein;(source:Araport11) |
| AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
| AT4G10660 | CDC68-like protein;(source:Araport11) |
| AT4G10700 | F-box/kelch-repeat protein;(source:Araport11) |
| AT4G10820 | F-box family protein;(source:Araport11) |
| AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT4G10860 | hypothetical protein;(source:Araport11) |
| AT4G10955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G10960 | Encodes a protein with UDP-D-glucose 4-epimerase activity. |
| AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
| AT4G11170 | Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1. |
| AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
| AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11485 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G11690 | Encodes ABO8, a pentatricopeptide repeat (PPR) protein responsible for the splicing of NAD4 intron 3 in mitochondrial complex I. Abo8 mutants accumulate more reactive oxygen species (ROS) in root tips than the wild type. |
| AT4G11700 | hypothetical protein (DUF626);(source:Araport11) |
| AT4G11720 | Encodes HAP2 with the following predicted motifs: an N-terminal secretion signal, a single transmembrane domain and a C-terminal histidine-rich domain. HAP2 is expressed only in the haploid sperm and is required for pollen tube guidance and fertilization. Predominantly localized to sperm endoplasmic reticulum membranes. May also reside in other endomembranes, including the plasma membrane. Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
| AT4G11745 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G11810 | Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
| AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
| AT4G11910 | Acts antagonistically with SGR1 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
| AT4G12040 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
| AT4G12220 | hypothetical protein;(source:Araport11) |
| AT4G12250 | UDP-D-glucuronate 4-epimerase |
| AT4G12520 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
| AT4G12860 | EF hand calcium-binding protein family;(source:Araport11) |
| AT4G13040 | Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation. |
| AT4G13110 | BSD domain-containing protein;(source:Araport11) |
| AT4G13195 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation. |
| AT4G13215 | pseudogene of transmembrane kinase-like 1;(source:Araport11) |
| AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT4G13265 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
| AT4G13410 | encodes a gene similar to cellulose synthase |
| AT4G13460 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT4G13530 | transmembrane protein;(source:Araport11) |
| AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
| AT4G13840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G13860 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G13890 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
| AT4G13920 | receptor like protein 50;(source:Araport11) |
| AT4G13985 | FBD-associated F-box protein;(source:Araport11) |
| AT4G14060 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT4G14225 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G14345 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT4G14480 | Encodes a putative Ser/Thr protein kinase, BLUS1 (BLUE LIGHT SIGNALING1). BLUS1 functions as a phototropin substrate and primary regulator of stomatal control to enhance photosynthetic CO2 assimilation under natural light conditions. |
| AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
| AT4G14560 | auxin (indole-3-acetic acid) induced gene (IAA1) encoding a short-lived nuclear-localized transcriptional regulator protein. The mRNA is cell-to-cell mobile. |
| AT4G14610 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT4G14650 | hypothetical protein;(source:Araport11) |
| AT4G14670 | This locus was originally annotated as encoding ClpB2 (also referred to as Hsp92.7), which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. However, according to Lee et al. (2007, Plant Journal, 49:115-127), there is no evidence for expression of an appropriate-sized mRNA from this locus. Re-annotation of the genome indicates that this locus potentially encodes a 68.8-kDa protein, containing only the N-terminal two thirds of the originally predicted open reading frame. This locus contains a 626-bp deletion in WS ecotype compared with the Col ecotype, which eliminates residues 1-86 of the predicted protein. |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G14785 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G14990 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
| AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G15165 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
| AT4G15200 | Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes. |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT4G15248 | B-box type zinc finger family protein;(source:Araport11) |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT4G15350 | member of CYP705A |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15630 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
| AT4G15820 | ABC subfamily C protein;(source:Araport11) |
| AT4G15860 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-43 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT4G15970 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G16024 | hypothetical protein;(source:Araport11) |
| AT4G16030 | Ribosomal protein L19e family protein;(source:Araport11) |
| AT4G16050 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT4G16144 | Encodes AMSH3, a deubiquitinating enzyme that hydrolyzes K48- and K63-linked ubiquitin chains in vitro. Required for intracellular trafficking and vacuole biogenesis. |
| AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT4G16190 | Papain family cysteine protease;(source:Araport11) |
| AT4G16200 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT4G16230 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G16340 | Encodes SPIKE1 (SPK1), the lone DOCK family guanine nucleotide exchange factor (GEF) in Arabidopsis. SPK1 is a peripheral membrane protein that accumulates at, and promotes the formation of, a specialized domain of the endoplasmic reticulum (ER) termed the ER exit site (ERES). SPK1 promotes polarized growth and cell-cell adhesion in the leaf epidermis. Mutant has seedling lethal; cotyledon, leaf-shape, trichome defects. |
| AT4G16620 | nodulin MtN21-like transporter family protein |
| AT4G16630 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT4G16640 | Matrix metalloprotease. |
| AT4G16720 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT4G16748 | other_RNA;(source:Araport11) |
| AT4G16790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
| AT4G16830 | Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. The mRNA is cell-to-cell mobile. |
| AT4G16920 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G16930 | Toll-Interleukin-Resistance (TIR) domain-containing protein;(source:Araport11) |
| AT4G16935 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.3e-16 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G17040 | HON5 (At4g17040) encodes the ClpR4 subunit of the chloroplast-localized Clp protease complex. hon mutations disturb plastid protein homeostasis, thereby activating plastid signaling and inducing stress acclimatization. |
| AT4G17140 | pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
| AT4G17210 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
| AT4G17260 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT4G17420 | PAWH1 along with PAWH2 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
| AT4G17470 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G17612 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G17700 | hypothetical protein;(source:Araport11) |
| AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT4G17713 | Encodes a defensin-like (DEFL) family protein. |
| AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
| AT4G17830 | NAOD encodes a functional acetylornithine deacetylase. Silenced lines plants flower early but have reduced fertility (siliques do not develop) as well as reduced ornithine levels.NAOD mediates a linear pathway for ornithine biosynthesis. |
| AT4G17990 | hypothetical protein;(source:Araport11) |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT4G18050 | P-glycoprotein 9;(source:Araport11) |
| AT4G18090 | hypothetical protein;(source:Araport11) |
| AT4G18110 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G18190 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT4G18255 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT4G18340 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT4G18425 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT4G18450 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G18540 | transmembrane protein;(source:Araport11) |
| AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
| AT4G18610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
| AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
| AT4G18910 | Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT4G18930 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
| AT4G18960 | Floral homeotic gene encoding a MADS domain transcription factor. Specifies floral meristem and carpel and stamen identity. Binds CArG box sequences. It is the only C function gene. It interacts genetically with the other homeotic genes to specify the floral organs. |
| AT4G19038 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
| AT4G19120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
| AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT4G19450 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G19570 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G19580 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT4G19633 | pseudogene of heat shock factor related protein |
| AT4G19640 | Encodes Ara7. |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT4G19720 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19730 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G19740 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G19770 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19800 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
| AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT4G19910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G19980 | hypothetical protein;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G20190 | hypothetical protein;(source:Araport11) |
| AT4G20270 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile. |
| AT4G20280 | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). |
| AT4G20310 | Encodes a Golgi-localized protease that can cleave the transcription factors bZIP17 and bZIP28 that are translocated from the ER through the Golgi so that the transcription factors can be released to translocate into the nucleus. |
| AT4G20370 | Encodes a floral inducer that is a homolog of FT. Plants overexpressing this gene flower earlier than Col. Loss-of-function mutations flower later in short days. TSF and FT play overlapping roles in the promotion of flowering, with FT playing the dominant role and together playing an antagonistic role to TFL1 in the determination of inflorescence meristem identity. .TSF sequences show extensive variation in different accessions and may contribute to quantitative variation in flowering time in these accessions. TSF has a complex pattern of spatial expression; it is expressed mainly in phloem and expression is regulated by daylength and vernalization. |
| AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20860 | involved in the generation of H2O2 from reduced compounds |
| AT4G20900 | Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein. |
| AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
| AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
| AT4G21260 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT4G21370 | The Col-0 pseudoSRKA allele contains a frameshift mutation that introduces a premature stop codon within the fourth of seven exons found in SRK genes. Its SCR sequences consist of several truncated pseudoSCR sequences, the longest of which is designated pseudoSCR1. |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT4G21480 | Putative sugar transporter. Expressed in nematode-induced root syncytia. |
| AT4G21490 | NAD(P)H dehydrogenase B3;(source:Araport11) |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT4G21560 | vacuolar protein sorting-associated protein-like protein;(source:Araport11) |
| AT4G21640 | Subtilase family protein;(source:Araport11) |
| AT4G21650 | Subtilase family protein;(source:Araport11) |
| AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
| AT4G21760 | beta-glucosidase 47;(source:Araport11) |
| AT4G21770 | Pseudouridine synthase family protein;(source:Araport11) |
| AT4G21780 | hypothetical protein;(source:Araport11) |
| AT4G21890 | zinc finger MYND domain protein;(source:Araport11) |
| AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
| AT4G22066 | Pseudogene of AT5G66830; F-box family protein |
| AT4G22070 | member of WRKY Transcription Factor; Group II-b |
| AT4G22100 | beta glucosidase 2;(source:Araport11) |
| AT4G22120 | Calcium-permeable stretch activated cation channel. |
| AT4G22140 | Encoding a chromatin remodeling factor that regulates flowering time. |
| AT4G22265 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT4G22330 | AtCES1 encodes a nuclear and endoplasmic reticulum localized Acyl-CoA independent ceramide synthase that is involved in sphingolipid metabolism, disease resistance, nutrient limitation, and response to salt stress. Facilitates adaptation to environmental stresses by regulating autophagy. |
| AT4G22545 | pseudogene of expressed protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22600 | Encodes a protein involved in involved in the formation of the pollen surface apertures. It acts late in aperture formation by excluding specific membrane domains from exine deposition. |
| AT4G22640 | LTPG protein |
| AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT4G22690 | member of CYP706A The mRNA is cell-to-cell mobile. |
| AT4G22710 | member of CYP706A |
| AT4G22730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
| AT4G22900 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G22920 | Similar to the tomato senescence-inducible chloroplast stay-green protein 1. It is upregulated during maximal senescence in the Arabidopsis life cycle, especially in senescent leaves. Acts antagonistically with SGR2 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT4G23130 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
| AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23240 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23400 | Plasma membrane intrinsic protein, involved redundantly with PIP1;1/2/3/4 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT4G23450 | AtAIRP1 gene encodes a C3H2C3-type RING E3 Ub ligase. It has been shown to be a positive regulator in the Arabidopsis ABA-dependent drought response. |
| AT4G23496 | Belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
| AT4G23560 | glycosyl hydrolase 9B15;(source:Araport11) |
| AT4G23580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G23810 | member of WRKY Transcription Factor; Group III |
| AT4G23850 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G23970 | hypothetical protein;(source:Araport11) |
| AT4G23980 | Encodes auxin response factor 9 (ARF9). The mRNA is cell-to-cell mobile. |
| AT4G24000 | encodes a protein similar to cellulose synthase |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT4G24120 | Member of a small family of oligopeptide transporters similar to the yellow stripe locus of maize (ZmYS1). |
| AT4G24140 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
| AT4G24170 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT4G24250 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO13 belongs to the clade II, with ATMLO1 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and also in placenta of developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT4G24270 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT4G24440 | transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S);(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
| AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
| AT4G24940 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G25130 | Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress. |
| AT4G25140 | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
| AT4G25220 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT4G25400 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G25434 | nudix hydrolase homolog 10;(source:Araport11) |
| AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT4G25560 | LAF1 is a R2R3-MYB transcription factor and positive regulator of the phyA photoresponse. Interaction of LAF1 with HFR1 stabilize the proteins against ubiquitination by COP1(AT2G32950) and subsequent degrations. Mutants have an elongated hypocotyl specifically under far-red light but retain wild-type responses to other light wavelengths. |
| AT4G25570 | Encodes cytochrome b561. |
| AT4G25580 | CAP160 protein;(source:Araport11) |
| AT4G25700 | Converts beta-carotene to zeaxanthin via cryptoxanthin. |
| AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
| AT4G25760 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
| AT4G25820 | Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. The mRNA is cell-to-cell mobile. |
| AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
| AT4G25910 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU1 and 2 than to NFU4 and 5. Targeted to the chloroplast. The mRNA is cell-to-cell mobile. |
| AT4G25930 | DUF295 domain containing protein. |
| AT4G25940 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G25960 | P-glycoprotein 2;(source:Araport11) |
| AT4G25970 | Encodes the major form of the two non-mitochondrail phosphatidylserine decarboxylase. Located at the ER. The mRNA is cell-to-cell mobile. |
| AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
| AT4G26040 | hypothetical protein;(source:Araport11) |
| AT4G26055 | transmembrane protein;(source:Araport11) |
| AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
| AT4G26130 | cotton fiber protein;(source:Araport11) |
| AT4G26140 | putative beta-galactosidase |
| AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
| AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
| AT4G26375 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT4G26400 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
| AT4G26580 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G26590 | oligopeptide transporter |
| AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
| AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G27052 | unknown pseudogene |
| AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT4G27300 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT4G27420 | ABC-2 type transporter family protein;(source:Araport11) |
| AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
| AT4G27570 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
| AT4G27600 | Encodes a phosphofructokinase B-type carbohydrate kinase family protein, NARA5. Regulates photosynthetic gene expression. |
| AT4G27710 | member of CYP709B The mRNA is cell-to-cell mobile. |
| AT4G27810 | hypothetical protein;(source:Araport11) |
| AT4G27860 | vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT4G27870 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT4G27900 | CCT motif family protein;(source:Araport11) |
| AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT4G28020 | tRNA-thr(GGU) m(6)t(6)A37 methyltransferase;(source:Araport11) |
| AT4G28100 | transmembrane protein;(source:Araport11) |
| AT4G28140 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock. |
| AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT4G28370 | Encodes an E3 ubiquitin ligase that is involved in plant cell wall modification, seed mucilage extrusion, and controls the degree of pectin methylesterification in seed mucilage. fly1 mutant seeds release more compact mucilage capsules and detached outer tangential primary walls when hydrated in water. Fly1 is located in the endomembrane system, likely localized in late endosome/multivesicular bodies/prevacular compartment. It has been shown to ubiquitinate proteins in conjunction with UBA1 and UBC8. |
| AT4G28430 | Reticulon family protein;(source:Araport11) |
| AT4G28460 | Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1. |
| AT4G28530 | Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue. |
| AT4G28570 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT4G28700 | ammonium transporter 1;(source:Araport11) |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT4G28740 | LOW PSII ACCUMULATION-like protein;(source:Araport11) |
| AT4G28780 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G29030 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT4G29103 | transmembrane protein;(source:Araport11) |
| AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
| AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT4G29230 | NAC domain protein involved in negative regulation of flowering. |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G29540 | Encodes a UDP-N-acetylglucosamine acyltransferase. |
| AT4G29560 | fanconi anemia group E protein FANCE protein;(source:Araport11) |
| AT4G29580 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G29630 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G29710 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G29905 | hypothetical protein;(source:Araport11) |
| AT4G29910 | Origin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits. |
| AT4G29960 | EBS7 encodes a plant specific, endoplasmic reticulum localized protein that is involved in endoplasmic reticulum-associated degradation (ERAD). It interacts with the ERAD component AtHRD1a and may regulate HRD1a stability. Identified in a screen for supressors of a mutation in bri1 that causes bri1 to be retained in the ER. Loss of EBS7 function restores BR sensitivity in the bri1-9 mutant allele. |
| AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G30050 | transmembrane protein;(source:Araport11) |
| AT4G30080 | Involved in root cap cell differentiation. Gene expression is regulated by mir160.Located in the nucleus. |
| AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
| AT4G30180 | hypothetical protein;(source:Araport11) |
| AT4G30240 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30300 | member of NAP subfamily |
| AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30420 | nodulin MtN21-like transporter family protein |
| AT4G30550 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT4G30560 | member of Cyclic nucleotide gated channel family. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT4G30700 | Encodes a pentatricopeptide repeat protein involved in mitochondrial RNA editing. |
| AT4G30790 | Encodes autophagy-related 2 (ATG11) |
| AT4G30810 | serine carboxypeptidase-like 29;(source:Araport11) |
| AT4G30872 | other_RNA;(source:Araport11) |
| AT4G31020 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT4G31150 | endonuclease V family protein;(source:Araport11) |
| AT4G31180 | The IBI1 gene encodes an aspartyl tRNA synthetase (AspRS). In addition, the IBI1 protein acts as a receptor protein of the chemical plant defence activator beta-aminobutyric acid (BABA). Binding of IBI1 to the active R-enantiomer of BABA primes non-canonical defence activity of the AspRS protein against pathogen attack. |
| AT4G31240 | protein kinase C-like zinc finger protein;(source:Araport11) |
| AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT4G31470 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT4G31620 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT4G31630 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31670 | ubiquitin-specific protease 18;(source:Araport11) |
| AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
| AT4G31810 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT4G31960 | hypothetical protein;(source:Araport11) |
| AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
| AT4G32080 | hypothetical protein;(source:Araport11) |
| AT4G32130 | ER membrane protein complex subunit-like protein (DUF2012);(source:Araport11) |
| AT4G32230 | hypothetical protein;(source:Araport11) |
| AT4G32280 | indole-3-acetic acid inducible 29;(source:Araport11) |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT4G32490 | early nodulin-like protein 4;(source:Araport11) |
| AT4G32500 | Encodes AKT5, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT4G32510 | HCO3- transporter family;(source:Araport11) |
| AT4G32540 | Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis |
| AT4G32660 | Encodes protein kinase AME3. |
| AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G32930 | hypothetical protein;(source:Araport11) |
| AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
| AT4G32960 | BRISC/BRCA1-A complex protein;(source:Araport11) |
| AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT4G33230 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G33240 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT4G33390 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
| AT4G33680 | Encodes an L,L-diaminopimelate aminotransferase. Involved in disease resistance against Pseudomonas syringae. mutants have elevated SA levels, a low level of spontaneous cell death, callose deposition, and enlarged cells in leaves. genetically maps on chr 4 between L23H3 and nga1139. |
| AT4G33810 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT4G33840 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT4G33850 | Pseudogene of AT4G33850; glycosyl hydrolase family 10 protein |
| AT4G33860 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT4G33890 | Component of SAGA complex, SPT module subunit, interacts with HAG1. |
| AT4G33970 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT4G33985 | membrane insertase, putative (DUF1685);(source:Araport11) |
| AT4G33990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G34220 | Encodes a receptor like kinase involved in ABA-mediated seedling development and drought tolerance.RDK1 is an atypical or pseudokinase and has no phosphorylation activity. Its expression is upregulated in response to ABA.interacts with ABI1 and other PP2C phosphatases. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G34320 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G34330 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT4G34460 | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. It seems to be involved in the calcium-mediated response to extracellular ATP. |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT4G34555 | Ribosomal protein S25 family protein;(source:Araport11) |
| AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
| AT4G34650 | Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function. |
| AT4G34700 | Encodes the B22 subunit of eukaryotic mitochondrial Complex I. Mutation in the gene display pleiotropic phenotypes including shorter roots, smaller plants and delayed flowering. The mRNA is cell-to-cell mobile. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT4G34770 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
| AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G34940 | Armadillo repeat protein. One of a family of four in Arabidopsis. Located in the nucleus and cytoplasm of pollen vegetative cells, and in the cytoplasm of egg cells. Involved in the signaling network controlling tip growth and actin organization in the pollen tube. |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G35025 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G35040 | Basic-region leucine zipper (bZIP19) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
| AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
| AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
| AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
| AT4G35360 | pantothenate kinase;(source:Araport11) |
| AT4G35380 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
| AT4G35460 | NADPH-dependent thioredoxin reductase 1 (NTR1. Similar to E.coli NTR and has conserved NADPH binding domains. |
| AT4G35655 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
| AT4G35810 | 2-oxoglutarate-dependent dioxygenase |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G35905 | Trm112p-like protein;(source:Araport11) |
| AT4G35970 | Encodes a microsomal ascorbate peroxidase APX5. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT4G36052 | Natural antisense transcript overlaps with AT4G36050;(source:Araport11) |
| AT4G36070 | member of Calcium Dependent Protein Kinase |
| AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
| AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT4G36260 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Encodes protein with a single zinc finger motif and a members of a small gene family of putative transcription factors in which the SHORT INTERNODES (SHI) gene is found. STY2/STY1 double mutants showed defective style, stigma as well as serrated leaves. |
| AT4G36350 | purple acid phosphatase 25;(source:Araport11) |
| AT4G36390 | Methylthiotransferase;(source:Araport11) |
| AT4G36410 | ubiquitin-conjugating enzyme |
| AT4G36420 | Ribosomal protein L12 family protein;(source:Araport11) |
| AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G36620 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G36790 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G36840 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT4G36910 | Encodes a single cystathionine beta-synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT4G37050 | Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid (ABA) or phosphate deficiency in roots. |
| AT4G37150 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES9 appears to be involved in MeSA hydrolysis in planta. Expression of MES9 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
| AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
| AT4G37320 | member of CYP81D |
| AT4G37330 | member of CYP81D |
| AT4G37340 | member of CYP81D |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G37510 | Ribonuclease III family protein;(source:Araport11) |
| AT4G37530 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G37580 | involved in apical hook development. putative N-acetyltransferase |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT4G37705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G37710 | VQ motif-containing protein;(source:Araport11) |
| AT4G37760 | squalene epoxidase 3;(source:Araport11) |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT4G37810 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G37840 | Encodes a putative hexokinase. |
| AT4G37850 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G37860 | SPT2 chromatin protein;(source:Araport11) |
| AT4G37900 | Protein of unknown function that contains DUF1399 domain and putative RNA binding motif. Expressed in many plant tissues and is involved in many aspects of plant growth and development as well as response to salt stress. |
| AT4G38000 | DNA binding with one finger 4.7;(source:Araport11) |
| AT4G38190 | encodes a gene similar to cellulose synthase |
| AT4G38230 | member of Calcium Dependent Protein Kinase |
| AT4G38250 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT4G38390 | root hair specific 17;(source:Araport11) |
| AT4G38460 | Encodes a type II small subunit of the heteromeric geranyl(geranyl) diphosphate synthase that is localized to the chloroplast, expressed in petals and sepals and is involved in monoterpene biosynthesis. The mRNA is cell-to-cell mobile. |
| AT4G38470 | Serine/threonine kinase that phosphorylate transit peptides of chloroplast and mitochondria targeted pre-proteins. |
| AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
| AT4G38690 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT4G38760 | nucleoporin (DUF3414);(source:Araport11) |
| AT4G38790 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38880 | GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2 |
| AT4G38940 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G38970 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
| AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
| AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT4G39110 | bups1 and bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule. BUSP1 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth. |
| AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G39330 | cinnamyl alcohol dehydrogenase 9;(source:Araport11) |
| AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT4G39490 | member of CYP96A |
| AT4G39530 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT4G39850 | Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. |
| AT4G39910 | Encodes a nuclear ubiquitin-specific protease. |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT4G39955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G40010 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40090 | arabinogalactan protein 3;(source:Araport11) |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G01150 | hypothetical protein (DUF674);(source:Araport11) |
| AT5G01180 | Encodes a dipeptide transporter expressed in pollen and ovules during early seed development. GFP-tagged PTR5 localizes to the plasma membrane. |
| AT5G01190 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G01215 | Natural antisense transcript overlaps with AT5G01210;(source:Araport11) |
| AT5G01225 | josephin-like protein;(source:Araport11) |
| AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT5G01270 | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. |
| AT5G01320 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT5G01330 | pyruvate decarboxylase |
| AT5G01360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
| AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT5G01690 | member of Putative Na+/H+ antiporter family |
| AT5G01710 | methyltransferase;(source:Araport11) |
| AT5G01747 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA |
| AT5G01780 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT5G02030 | Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP. |
| AT5G02060 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT5G02180 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
| AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G02510 | UDP-glucose 6-dehydrogenase;(source:Araport11) |
| AT5G02570 | Histone superfamily protein;(source:Araport11) |
| AT5G02640 | hypothetical protein;(source:Araport11) |
| AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
| AT5G02760 | Encodes a phosphatase that functions in sustaining proper leaf longevity and preventing early senescence by suppressing or perturbing SARK-mediated senescence signal transduction. |
| AT5G02840 | Encodes RVE4, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. Involved in heat shock response. |
| AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
| AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G03170 | Encodes FLA11, a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. |
| AT5G03180 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03455 | Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance. |
| AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G03510 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G03520 | GTPase that colocalizes with golgi and plasma membranes. |
| AT5G03550 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT5G03552 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGCGGGAAGCAUUUGCACAUG |
| AT5G03580 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
| AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11) |
| AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
| AT5G03750 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT5G03795 | Exostosin family protein;(source:Araport11) |
| AT5G03820 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G03858 | Pseudogene of AT5G03960; IQD12 (IQ-domain 12); calmodulin binding protein |
| AT5G03870 | Glutaredoxin family protein;(source:Araport11) |
| AT5G04000 | hypothetical protein;(source:Araport11) |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT5G04267 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT5G04390 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G04400 | NAC domain protein;(source:Araport11) |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT5G04510 | Encodes 3-phosphoinositide-dependent protein kinase that contains pleckstrin homology domain and binds 3-phosphoinositides. It activates the protein kinase AGC2-1 in a phosphatidic acid dependent manner. Phosphorylates S6K1. Interacts with PID, and transphosphorylation by PDK1 increases PID autophosphorylation. The mRNA is cell-to-cell mobile. |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G04640 | AGAMOUS-like 99;(source:Araport11) |
| AT5G04680 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G04690 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
| AT5G04980 | DNAse I-like superfamily protein;(source:Araport11) |
| AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
| AT5G05050 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G05070 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
| AT5G05220 | hypothetical protein;(source:Araport11) |
| AT5G05270 | Chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT5G05280 | Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway. |
| AT5G05320 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT5G05380 | prenylated RAB acceptor 1.B3;(source:Araport11) |
| AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT5G05760 | A SNARE protein (ortholog of syntaxin 5), a membrane fusion machine component involved in cytokinesis |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G06100 | Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity. |
| AT5G06110 | Encodes a ZRF1 chromatin regulator. Functions in regulating plant growth and development. |
| AT5G06125 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT5G06150 | Encodes a cyclin whose expression is reduced in response to high salt. |
| AT5G06170 | sucrose symporter with hight affinity for sucrose (K0.5=0.066 +/- 0.025mM), that can also transport a wide range of glucosides. |
| AT5G06270 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations |
| AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
| AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G06470 | Glutaredoxin family protein;(source:Araport11) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G06610 | DUF620 domain protein. In xylem cells BRD1 is expressed in the secondary wall pit boundaries. BRD1 interacts with and appears to be necessary to recruit WALLIN to the plasma membrane. |
| AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT5G06839 | bZIP transcription factor family protein;(source:Araport11) |
| AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
| AT5G06900 | member of CYP93D |
| AT5G06905 | member of CYP712A |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G07000 | Encodes a member of the sulfotransferase family of proteins. Although it has 85% amino acid identity with ST2A (At5g07010), this protein is not able to transfer a sulfate group to 11- or 12-hydroxyjasmonic acid in vitro. It may be able to act on structurally related jasmonates. |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
| AT5G07140 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G07170 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
| AT5G07180 | Encodes a receptor-like kinase that, together with ER and ERL1 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is also important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. When heterozygous in an er/erl1 null background, plants are female sterile due to cell division defect in the integuments. |
| AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
| AT5G07600 | Oleosin family protein;(source:Araport11) |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
| AT5G07700 | Encodes a putative transcription factor (MYB76). |
| AT5G07790 | hypothetical protein;(source:Araport11) |
| AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G07820 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT5G07850 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G07980 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G08000 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. |
| AT5G08190 | nuclear factor Y, subunit B12;(source:Araport11) |
| AT5G08260 | serine carboxypeptidase-like 35;(source:Araport11) |
| AT5G08270 | C5orf35;(source:Araport11) |
| AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT5G08430 | SWIB/MDM2 and Plus-3 and GYF domain-containing protein;(source:Araport11) |
| AT5G08730 | IBR domain-containing protein;(source:Araport11) |
| AT5G09350 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta2. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta2 is 83% identical to PI-4kbeta1 encoded by At5g64070. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta1, leads to the formation of abnormal root hairs. |
| AT5G09380 | RNA polymerase III RPC4;(source:Araport11) |
| AT5G09410 | calmodulin-binding protein, similar to another ethylene-upregulated calmodulin-binding protein ER1 GI:11612392 from (Nicotiana tabacum) |
| AT5G09460 | transcription factor bHLH143;(source:Araport11) |
| AT5G09550 | GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11) |
| AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT5G09750 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. |
| AT5G09770 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
| AT5G10010 | myosin-H heavy protein;(source:Araport11) |
| AT5G10090 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G10100 | Trehalose-6-phosphate phosphatase which enhances drought tolerance by regulating stomatal apertures. |
| AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT5G10180 | Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation. |
| AT5G10210 | nitric oxide synthase-interacting protein;(source:Araport11) |
| AT5G10240 | Encodes asparagine synthetase (ASN3). |
| AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT5G10340 | F-box family protein;(source:Araport11) |
| AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
| AT5G10590 | hypothetical protein;(source:Araport11) |
| AT5G10620 | methyltransferase;(source:Araport11) |
| AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT5G10770 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G10860 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT5G11070 | hypothetical protein;(source:Araport11) |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT5G11160 | adenine phosphoribosyltransferase 5;(source:Araport11) |
| AT5G11242 | pseudogene of ribosomal protein |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT5G11410 | Similar to receptor like kinase but does not appear to have kinase activity (psuedokinase). It is involved in HopZ1a effector triggered immunity. Interacts with ZAR1 and ZED1.Localization to membrane is dependent on N-terminal myristoylation domain |
| AT5G11530 | Involved in regulating reproductive development |
| AT5G11620 | SWIM zinc finger family protein / mitogen-activated protein kinase kinase kinase (MAPKKK)-like protein;(source:Araport11) |
| AT5G11730 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G11830 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
| AT5G11920 | Encodes a protein with fructan exohydrolase (FEH) activity acting on both inulin and levan-type fructans (1- and 6-FEH). The enzyme does not have invertase activity. |
| AT5G11990 | proline-rich family protein;(source:Araport11) |
| AT5G12010 | nuclease;(source:Araport11) |
| AT5G12100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G13010 | Encodes a nuclear localized DEAH-box containing protein that is involved in miRNA biogenesis. Loss of function mutants are embryo lethal. Gene silencing experiments demonstrated its role in the localization of DCL-1 and HYL1 to the nuclear D-body. In silenced lines, miRNA production is suppressed and plants have developmental abnormalities and are hypersensitive to fungal pathogens. |
| AT5G13060 | Encodes a novel Armadillo BTB protein that intreacts with the pre-replication complex and several transcription factors. Overexpression results in decreased cell proliferation and loss of function results in increased cell proliferation suggesting a role in negative regulation of cellular proliferation. |
| AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
| AT5G13130 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. Possible role in the development of reproductive tissues. |
| AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
| AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G13370 | IBA - specific acyl acid amido synthetase which conjugates glutamine to IBA. It is involved in generating inactive and/or storage forms of IBA in the seedling, root, and silique. May play a role in auxin homeostasis by modulating the levels of IBA for peroxisomal conversion to IAA. |
| AT5G13380 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G13390 | Required for normal pollen development and lipid accumulation within the tapetum |
| AT5G13640 | arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT) |
| AT5G13800 | Encodes a pheophytinase that is involved in chlorophyll breakdown. Its transcript levels increase during senescence and pph-1 mutants have a stay-green phenotype. |
| AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G13840 | FIZZY-related 3;(source:Araport11) |
| AT5G13930 | Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism. The mRNA is cell-to-cell mobile. |
| AT5G13940 | aminopeptidase;(source:Araport11) |
| AT5G14010 | Encodes KNUCKLES (KNU), a C2H2-type zinc finger protein with a conserved transcriptional repression motif. Mediates the repression of WUS in floral meristem determinacy control. |
| AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT5G14180 | Myzus persicae-induced lipase 1;(source:Araport11) |
| AT5G14300 | prohibitin 5;(source:Araport11) |
| AT5G14310 | carboxyesterase 16;(source:Araport11) |
| AT5G14340 | Member of the R2R3 factor gene family. |
| AT5G14420 | Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. |
| AT5G14490 | NAC domain containing protein 85;(source:Araport11) |
| AT5G14602 | methyltransferase-like protein;(source:Araport11) |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT5G14690 | transmembrane protein;(source:Araport11) |
| AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G14740 | Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform. |
| AT5G14840 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G14890 | potassium transporter;(source:Araport11) |
| AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G14990 | WPP domain associated protein;(source:Araport11) |
| AT5G15020 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT5G15100 | Encodes an auxin transporter with a strong expression in a male gametophyte. Mutant studies reveal a role for auxin transport in regulating pollen development and function. It acts together with PIN5. |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT5G15160 | BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT5G15190 | hypothetical protein;(source:Araport11) |
| AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
| AT5G15470 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G15530 | biotin carboxyl carrier protein isoform 2 (BCCP2) mRNA, |
| AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
| AT5G15770 | Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum. |
| AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
| AT5G16100 | RWP-RK domain protein;(source:Araport11) |
| AT5G16110 | hypothetical protein;(source:Araport11) |
| AT5G16260 | Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile. |
| AT5G16280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT5G16400 | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
| AT5G16410 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G16500 | Encodes a receptor-like cytoplasmic kinase localized in the membrane of pollen tube tip regions that controls micropylar pollen tube guidance in Arabidopsis. |
| AT5G16570 | Encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
| AT5G16580 | beta glucosidase 2;(source:Araport11) |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
| AT5G16920 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT5G17030 | UDP-glucosyl transferase 78D3;(source:Araport11) |
| AT5G17110 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT5G17130 | cysteine-type peptidase;(source:Araport11) |
| AT5G17220 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts. |
| AT5G17260 | NAC domain containing protein 86;(source:Araport11) |
| AT5G17280 | oxidoreductase-like protein, amino-terminal protein;(source:Araport11) |
| AT5G17420 | Encodes a xylem-specific cellulose synthase that is phosphorylated on one or more serine residues (on either S185 or one of S180 or S181). |
| AT5G17450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G17520 | Encodes a maltose transporter that is expressed in leaves and roots. Mutations at the MEX1 locus cause accumulation of both starch and maltose in leaves, with maltose levels at least 40 times higher than that of wild-type. This gene encodes a protein located in the chloroplast envelope. |
| AT5G17580 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G17590 | Putative membrane lipoprotein;(source:Araport11) |
| AT5G17600 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G17690 | Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state. |
| AT5G17710 | Chloroplast GrpE protein involved in chloroplastic response to heat stress and the correct oligomerization of the photosynthesis-related LHCII complex. |
| AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G17730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G17790 | Encodes a zinc-finger motif containing protein that is essential for chloroplast RNA editing. The protein physically interacts with ORRM1 and other components of chloroplast editosomes. VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development. Mutants display a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells. |
| AT5G17847 | hypothetical protein;(source:Araport11) |
| AT5G17870 | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
| AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G18000 | Encodes VERDANDI (VDD), a putative transcription factor belonging to the reproductive meristem (REM) family. VDD is a direct target of the MADS domain ovule identity complex. Mutation in VDD affects embryo sac differentiation. |
| AT5G18010 | Encodes SAUR19 (small auxin up RNA 19). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), At5g18010 is SAUR24. |
| AT5G18020 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G18090 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G18130 | transmembrane protein;(source:Araport11) |
| AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT5G18407 | Encodes a defensin-like (DEFL) family protein. |
| AT5G18420 | CCR4-NOT transcription complex subunit;(source:Araport11) |
| AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT5G18490 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT5G18525 | Encodes a BEACH domain containing protein that is involved in targeting storage proteins to the protein storage vacuoles and effector triggered immunity to Psuedomonas syringae. |
| AT5G18550 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
| AT5G18640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G18660 | Encodes a protein with 3,8-divinyl protochlorophyllide a 8-vinyl reductase activity. Mutants accumulate divinyl chlorophyll rather than monovinyl chlorophyll. |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT5G18870 | Similar to N terminal region of NSH1 nucleoside hydrolase. |
| AT5G18890 | Inosine-uridine preferring nucleoside hydrolase family protein;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G19165 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-237 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G19170 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G19260 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT5G19360 | member of Calcium Dependent Protein Kinase |
| AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G19740 | LAMP is an AMP paralog that overlaps in expression within the vascular system. Along with LAMP it suppresses meristem activity within the peripheral zone of the shoot apical meristem. LAMP is localized to the endoplasmic reticulum. |
| AT5G19870 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
| AT5G20320 | Encodes an RNase III-like enzyme that catalyzes processing of trans-acting small interfering RNA precursors in a distinct small RNA biogenesis pathway. The protein is also involved in the production of 21-nt primary siRNAs from both inverted-repeat constructs and endogenous sequences, as well as the RDR6-dependent 21-nt secondary siRNAs involved in long-range cell-to-cell signaling. It binds DRB4, a ds-RNA binding protein. |
| AT5G20330 | beta-1,3-glucanase 4;(source:Araport11) |
| AT5G20690 | PRK6 is pollen specific receptor kinase that functions as a receptor for the pollen attractant LURE1 in pollen tube guidance. It is localized to the tip the pollen tube and becomes asymmetrically distributed towards the source of the LURE1 signal prior to pollen tube growth reorientation. |
| AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
| AT5G20885 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G20960 | Encodes aldehyde oxidase AA01. |
| AT5G21150 | AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
| AT5G21950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G22010 | Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing. |
| AT5G22030 | ubiquitin-specific protease 8;(source:Araport11) |
| AT5G22080 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G22180 | hypothetical protein;(source:Araport11) |
| AT5G22310 | trichohyalin-like protein;(source:Araport11) |
| AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
| AT5G22410 | root hair specific 18;(source:Araport11) |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT5G22490 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
| AT5G22550 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G22690 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G22760 | PHD finger family protein;(source:Araport11) |
| AT5G22791 | F-box family protein;(source:Araport11) |
| AT5G22910 | member of Putative Na+/H+ antiporter family |
| AT5G22980 | serine carboxypeptidase-like 47;(source:Araport11) |
| AT5G23010 | Encodes a methylthioalkylmalate synthase, catalyzes the condensation reactions of the first two rounds of methionine chain elongation in the biosynthesis of methionine-derived glucosinolates. The mRNA is cell-to-cell mobile. |
| AT5G23050 | acyl-activating enzyme 17;(source:Araport11) |
| AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
| AT5G23180 | mediator-associated-like protein;(source:Araport11) |
| AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
| AT5G23220 | nicotinamidase 3;(source:Araport11) |
| AT5G23230 | nicotinamidase 2;(source:Araport11) |
| AT5G23260 | Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule. Paralogous to GOA. Plays a maternal role in fertilization and seed development. |
| AT5G23270 | Membrane localized sucrose transporter. |
| AT5G23413 | pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G23710 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
| AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
| AT5G23750 | Remorin family protein;(source:Araport11) |
| AT5G23800 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
| AT5G23950 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G23960 | Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in the stigma. |
| AT5G23970 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
| AT5G24010 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G24105 | Encodes a putative arabinogalactan-protein (AGP41). |
| AT5G24180 | Lipase class 3-related protein;(source:Araport11) |
| AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
| AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT5G24330 | Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR6 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. |
| AT5G24350 | Member of MAG2 complex on the ER that is responsible for efficient transport of seed storage proteins, functions in protein transport between the ER and Golgi apparatus, contain a Zeste?White 10 (ZW10) domain and a Sec39 domain. Required for proper maturation of seed storage proteins. |
| AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
| AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT5G24550 | beta glucosidase 32;(source:Araport11) |
| AT5G24570 | hypothetical protein;(source:Araport11) |
| AT5G24740 | Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root. |
| AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
| AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G24810 | ABC1 family protein;(source:Araport11) |
| AT5G24825 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGG |
| AT5G24860 | encodes a small protein of 12.6 kDa that regulates flowering and is involved in gibberellin signalling pathway. It is expressed in apical meristems immediately after the photoperiodic induction of flowering. Genetic interactions with flowering time and floral organ identity genes suggest that this gene may be involved in modulating the competence to flower. There are two other genes similar to FPF1, FLP1 (At4g31380) and FLP2 (no locus name yet, on BAC F8F16 on chr 4). This is so far a plant-specific gene and is only found in long-day mustard, arabidopsis, and rice. |
| AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G24890 | stress response NST1-like protein;(source:Araport11) |
| AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G25130 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT5G25140 | putative cytochrome P450 |
| AT5G25180 | putative cytochrome P450 |
| AT5G25220 | A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia |
| AT5G25260 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking. |
| AT5G25265 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
| AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
| AT5G25400 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
| AT5G25560 | CHY-type/CTCHY-type/RING-type Zinc finger protein;(source:Araport11) |
| AT5G25820 | Exostosin family protein;(source:Araport11) |
| AT5G25840 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT5G25880 | The malic enzyme (EC 1.1.1.40) encoded by the ATNADP-ME3 is presumably cytosolic and restricted in its expression by both developmental and cell-specific signals. |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT5G26080 | proline-rich family protein;(source:Araport11) |
| AT5G26100 | hypothetical protein;(source:Araport11) |
| AT5G26130 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT5G26146 | Natural antisense transcript overlaps with AT5G26150;(source:Araport11) |
| AT5G26147 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. miR156 limits plastochron length in developing leaf primordia. |
| AT5G26150 | protein kinase family protein;(source:Araport11) |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT5G26300 | TRAF-like family protein;(source:Araport11) |
| AT5G26570 | chloroplastidic phosphoglucan, water dikinase (PWD) which is required for normal degradation of leaf starch in Arabidopsis. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C3 position. |
| AT5G26692 | Encodes a Plant thionin family protein |
| AT5G26717 | Encodes a Plant thionin family protein |
| AT5G26930 | Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification. |
| AT5G27140 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
| AT5G27210 | Protein of unknown function, transmembrane-40;(source:Araport11) |
| AT5G27230 | Frigida-like protein;(source:Araport11) |
| AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
| AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G27670 | Encodes HTA7, a histone H2A protein. |
| AT5G27807 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1). Pri-mRNA coordinates for MIR164c (converted to TAIR10 based on PMID19304749): Chr5: 9852483-9853314 (forward), length: 832 bp; exon coordinates: exon 1: 9852483-9853314; mature miRNA and miRNA* are located on exon 1. |
| AT5G27840 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580). |
| AT5G27900 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-26 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G27910 | nuclear factor Y, subunit C8;(source:Araport11) |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT5G27945 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G27950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT5G28080 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT5G28210 | mRNA capping enzyme family protein;(source:Araport11) |
| AT5G28237 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G28470 | Encodes a member of the nitrate/peptide NTR/PTR family of transporters is required for accumulation and transport of pollen-specific flavonol 3-O-sophorosides, characterized by a glycosidic β-1,2-linkage, to the pollen surface of Arabidopsis. |
| AT5G28620 | kinase C-like protein;(source:Araport11) |
| AT5G28637 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-23 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
| AT5G28690 | carboxylate clamp-TPR protein (DUF1685);(source:Araport11) |
| AT5G28776 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-199 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G28840 | Encodes a protein with GDP-D-mannose 3',5'-epimerase activity. The enzyme is involved in ascorbate biosynthesis. It catalyzes the conversion of GDP-D-mannose to GDP-L-galactose. |
| AT5G28926 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.3e-152 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT5G28996 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
| AT5G29015 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.3e-121 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT5G29090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G33131.1);(source:TAIR10) |
| AT5G31770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.7e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G31821 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G32072 | pseudogene of Glucose-6-phosphate isomerase |
| AT5G33285 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
| AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
| AT5G33350 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G33355 | Encodes a defensin-like (DEFL) family protein. |
| AT5G33370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. Mutants are defective in cuticle formation with reduced sepal cuticle ridge formation. |
| AT5G33441 | pseudogene of cytochrome P450;(source:Araport11) |
| AT5G34846 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-44 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G34854 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G34945 | pseudogene of Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT5G35480 | hypothetical protein;(source:Araport11) |
| AT5G35575 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.5e-41 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G35605 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT5G35610 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT5G35643 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G35660 | Glycine-rich protein family;(source:Araport11) |
| AT5G35715 | encodes a protein with cytochrome P450 domain |
| AT5G35750 | Encodes histidine kinase AHK2. |
| AT5G35926 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G35930 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G35950 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G35960 | Protein kinase family protein;(source:Araport11) |
| AT5G36110 | Encodes a member of the CYP716A subfamily of cytochrome P450 monooxygenases with triterpene oxidizing activity catalyzing C-28 hydroxylation of alpha-amyrin, beta-amyrin, and lupeol, producing uvaol, erythrodiol, and betulin, respectively. Additionally, it shows carboxylation activity for the C-28 position of alpha- and beta-amyrin. |
| AT5G36125 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G36210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G36230 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G36260 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G36270 | Annotated as pseudogene of dehydroascorbate reductase. Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
| AT5G36937 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
| AT5G37140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT5G37170 | O-methyltransferase family protein;(source:Araport11) |
| AT5G37175 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G15750.1);(source:TAIR10) |
| AT5G37200 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37210 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G37300 | Encodes a bifunctional enzyme, wax ester synthase (WS) and diacylglycerol acyltransferase (DGAT). In vitro assay indicated a ratio of 10.9 between its WS and DGAT activities. Both mutant and in vivo expression/analysis in yeast studies indicated a role in wax biosynthesis. |
| AT5G37320 | hypothetical protein (DUF674);(source:Araport11) |
| AT5G37340 | ZPR1 zinc-finger domain protein;(source:Araport11) |
| AT5G37430 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G37442 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.7e-44 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G37450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G37475 | Translation initiation factor eIF3 subunit;(source:Araport11) |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37510 | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. The mRNA is cell-to-cell mobile. |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G37650 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G37710 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G37840 | PADRE protein, up-regulated after infection by S. sclerotiorum. |
| AT5G38005 | other_RNA;(source:Araport11) |
| AT5G38100 | SABATH family methyltransferase. |
| AT5G38120 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G38210 | Protein kinase family protein;(source:Araport11) |
| AT5G38250 | Protein kinase family protein;(source:Araport11) |
| AT5G38270 | F-box family protein;(source:Araport11) |
| AT5G38310 | hypothetical protein;(source:Araport11) |
| AT5G38344 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT5G38386 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G38393 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G38490 | B3 domain protein (DUF313);(source:Araport11) |
| AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
| AT5G38790 | hypothetical protein;(source:Araport11) |
| AT5G38810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G38870 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G38940 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G38960 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G38970 | Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized. |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT5G39400 | Calcium/lipid-binding (CaLB) phosphatase;(source:Araport11) |
| AT5G39420 | CDC2C;(source:Araport11) |
| AT5G39450 | F-box family protein;(source:Araport11) |
| AT5G39460 | F-box family protein;(source:Araport11) |
| AT5G39470 | F-box family protein;(source:Araport11) |
| AT5G39532 | Pseudogene of AT3G59455 |
| AT5G39690 | NAC domain containing protein 93;(source:Araport11) |
| AT5G39820 | NAC domain containing protein 94;(source:Araport11) |
| AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT5G39863 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT5G39880 | transmembrane protein;(source:Araport11) |
| AT5G40010 | Encodes a mitochondrial ATPase involved in seed and silique development. |
| AT5G40040 | cytosolic ribosomal protein gene, part of bL12 family |
| AT5G40200 | Encodes a putative DegP protease. The mRNA is cell-to-cell mobile. |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT5G40382 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
| AT5G40395 | U6acat;(source:Araport11) |
| AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
| AT5G41150 | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G41180 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT5G41250 | Exostosin family protein;(source:Araport11) |
| AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT5G41390 | PLAC8 family protein;(source:Araport11) |
| AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
| AT5G42020 | Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm nuclei. |
| AT5G42030 | ABL interactor-like protein 4;(source:Araport11) |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT5G42340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G42490 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G42505 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-23 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
| AT5G42680 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G42800 | dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile. |
| AT5G42810 | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level. |
| AT5G42850 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G42890 | sterol carrier protein 2;(source:Araport11) |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G42990 | ubiquitin-conjugating enzyme 18;(source:Araport11) |
| AT5G43110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43120 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT5G43175 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G43350 | Encodes an inorganic phosphate transporter Pht1;1. Mutants display enhanced arsenic accumulation. Under high arsenate concentrations, PHT1;1 levels are reduced and it is delocalized from the plasma membrane. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).PHT1;1 expression is transcriptionally regulated by WRKY6 and by PHR1. |
| AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G43520 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G43560 | Encodes MUSE14, a TRAF domain protein. Regulates the turnover of nucleotide-binding domain and leucine-rich repeat-containing (NLR) immune receptors SNC1 and RPS2. Loss of both MUSE13 and MUSE14 leads to enhanced pathogen resistance, NLR accumulation, and autoimmunity. In addition, MUSE13/14 physically interact with ATG6 and appear to regulate ATG6 ubiquitination and thus formation of autophagosomes. |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
| AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
| AT5G43700 | Auxin inducible protein similar to transcription factors. |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
| AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
| AT5G44110 | Encodes a member of the NAP subfamily of ABC transporters whose expression pattern is regulated by light and sucrose. |
| AT5G44160 | NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis. |
| AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT5G44310 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G44316 | Stabilizer of iron transporter SufD superfamily protein;(source:Araport11) |
| AT5G44345 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT5G44540 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
| AT5G44550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G44572 | transmembrane protein;(source:Araport11) |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT5G44630 | Encodes a sesquiterpene synthase involved in generating all of the group B sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in intrafloral nectaries. |
| AT5G44660 | hypothetical protein;(source:Araport11) |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
| AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT5G44710 | 37S ribosomal protein S27;(source:Araport11) |
| AT5G44760 | C2 domain-containing protein;(source:Araport11) |
| AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
| AT5G44820 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
| AT5G44960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G45070 | phloem protein 2-A8;(source:Araport11) |
| AT5G45085 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G45180 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G45240 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT5G45260 | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2. |
| AT5G45275 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT5G45360 | Encodes a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT5G45530 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT5G45770 | receptor like protein 55;(source:Araport11) |
| AT5G45790 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
| AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT5G45850 | hypothetical protein (DUF688);(source:Araport11) |
| AT5G45875 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT5G45990 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT5G46040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G46060 | spastin, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G46105 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
| AT5G46200 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT5G46270 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G46315 | U6-29;(source:Araport11) |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT5G46370 | Encodes AtTPK2 (KCO2), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK2 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G46530 | AWPM-19-like family protein;(source:Araport11) |
| AT5G46540 | P-glycoprotein 7;(source:Araport11) |
| AT5G46590 | Transcription factor required for the initiation of cell division during wound healing. Redundantly involved with ANAC071 in the process of "cambialization". |
| AT5G46600 | aluminum activated malate transporter family protein;(source:Araport11) |
| AT5G46690 | beta HLH protein 71;(source:Araport11) |
| AT5G46760 | MYC3 is a JAZ-interacting transcription factor that act together with MYC2 and MYC4 to activate JA-responses. The mRNA is cell-to-cell mobile. |
| AT5G47060 | hypothetical protein (DUF581);(source:Araport11) |
| AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
| AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
| AT5G47229 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G47430 | DWNN domain, a CCHC-type zinc finger;(source:Araport11) |
| AT5G47435 | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. |
| AT5G47520 | RAB GTPase homolog A5A;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
| AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
| AT5G47920 | transcription elongation factor;(source:Araport11) |
| AT5G47950 | BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. BIA2 may function in BR homeostasis by regulating the pool of bioactive BR. |
| AT5G48060 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G48100 | Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. |
| AT5G48130 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G48205 | zinc ion binding protein;(source:Araport11) |
| AT5G48390 | Defective in meiotic chromosome segregation. It is involved in crossover formation and involved in both male and female meiosis. |
| AT5G48510 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G48570 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G48690 | ubiquitin-associated (UBA)/TS-N domain protein;(source:Araport11) |
| AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G48740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT5G48940 | RGFR2 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT5G49015 | Expressed protein;(source:Araport11) |
| AT5G49100 | vitellogenin-like protein;(source:Araport11) |
| AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
| AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT5G49260 | hypothetical protein;(source:Araport11) |
| AT5G49270 | Involved in successfully establishing tip growth in root hairs. |
| AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G49340 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G49350 | Glycine-rich protein family;(source:Araport11) |
| AT5G49490 | AGAMOUS-like 83;(source:Araport11) |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G49525 | transmembrane protein;(source:Araport11) |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT5G49615 | trans-acting siRNA (tasi-RNA) |
| AT5G49630 | Is a high affinity amino acid transporter capable of transporting aspartate and tryptophan. May be involved in the amino acid uptake from xylem. |
| AT5G49640 | hypothetical protein;(source:Araport11) |
| AT5G49660 | The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT5G49720 | Encodes a membrane-bound endo-1,4-beta-D-glucanase, involved in cellulose biosynthesis. Loss-of-function mutants have severe cellulose-deficient phenotypes. During cell elongation, KOR1 is associated with Golgi apparatus and early endosome. Inhibition of cellulose biosynthesis promoted a redistribution of KOR1 in subcellular locations. These observations suggest that deposition of cellulose involves the intracellular cycling of KOR1. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT5G49770 | Leucine rich receptor kinase. |
| AT5G49920 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G49980 | auxin F-box protein 5;(source:Araport11) |
| AT5G50260 | Encodes a papain-like cysteine protease involved in tapetal programmed cell death and pollen development.CEP1 is expressed specifically in the tapetum from stages 5 to 11 of anther development. The CEP1 protein first appears as a proenzyme in precursor protease vesicles, and is then transported to the vacuole and transformed into the mature enzyme before rupture of the vacuole. CEP1 was also released to the tapetal cell wall during late stage 6 and stage 7. After the tapetal cell wall degenerated, the CEP1 enzyme entered the callose wall from the degenerated tapetal cell wall and was probably involved in degeneration of the callose wall. |
| AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT5G50790 | Encodes a member of the SWEET sucrose efflux transporter family proteins. Transcriptionally activated by long photoperiods; activation depends on FT and SOC1. The ectopic expression of SWEET10 causes early flowering and leads to higher levels of transcription of flowering-time related genes in the shoot apex. |
| AT5G50890 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
| AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT5G51320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42556.1);(source:TAIR10) |
| AT5G51500 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G51640 | Encodes leaf-senescence-related protein. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G51860 | Encodes a MADS-box transcription factor involved in floral transition. |
| AT5G51920 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G52020 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT5G52050 | MATE efflux family protein;(source:Araport11) |
| AT5G52170 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G52260 | Member of the R2R3 factor gene family. |
| AT5G52270 | SNARE-like superfamily protein;(source:Araport11) |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
| AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G52355 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT5G52410 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT5G52450 | MATE efflux family protein;(source:Araport11) |
| AT5G52480 | RNI-like superfamily protein;(source:Araport11) |
| AT5G52490 | Fibrillarin family protein;(source:Araport11) |
| AT5G52510 | SCARECROW-like 8;(source:Araport11) |
| AT5G52540 | keratin-associated protein, putative (DUF819);(source:Araport11) |
| AT5G52620 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G52640 | Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile. |
| AT5G52690 | Copper transport protein family;(source:Araport11) |
| AT5G52780 | Chloroplast NAD(P)H dehydrogenase complex assembly factor. |
| AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G52880 | F-box family protein;(source:Araport11) |
| AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
| AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
| AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53260 | Seed maturation protein;(source:Araport11) |
| AT5G53350 | CLP protease regulatory subunit CLPX mRNA, nuclear gene |
| AT5G53380 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
| AT5G53460 | NADH-dependent glutamate synthase The mRNA is cell-to-cell mobile. |
| AT5G53490 | thylakoid lumenal 17.4 kDa protein, chloroplast, identical to SP:P81760 Thylakoid lumenal 17.4 kDa protein, chloroplast precursor (P17.4) {Arabidopsis thaliana}. Putative pentapeptide protein. |
| AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G53540 | Encodes a P-loop NTPase APP1. The disruption of APP1 is accompanied by a reduction in ROS level, a rise in the rate of cell division in the quiescent center (QC) and the promotion of root distal stem cell (DSC) differentiation. |
| AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G53620 | RNA polymerase II degradation factor;(source:Araport11) |
| AT5G53635 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G53680 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G53700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G53770 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT5G53775 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-39 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT5G53830 | VQ motif-containing protein;(source:Araport11) |
| AT5G53870 | early nodulin-like protein 1;(source:Araport11) |
| AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
| AT5G54010 | Encodes a flavonoid 3-O-glucoside:2″-O-glucosyltransferase that determines pollen-specific flavonol structure. |
| AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
| AT5G54070 | A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation. |
| AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
| AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT5G54145 | hypothetical protein;(source:Araport11) |
| AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
| AT5G54200 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT5G54375 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G54450 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54490 | Encodes a PINOID (PID)-binding protein containing putative EF-hand calcium-binding motifs. The interaction is dependent on the presence of calcium. mRNA expression is up-regulated by auxin. Not a phosphorylation target of PID, likely acts upstream of PID to regulate the activity of this protein in response to changes in calcium levels. |
| AT5G54585 | hypothetical protein;(source:Araport11) |
| AT5G54640 | Isolated from T-DNA insertion line, the rat5 mutant is deficient in T-DNA integration. Encodes histone2A protein. |
| AT5G54661 | Pseudogene of AT5G54660; heat shock protein-related |
| AT5G54680 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G54730 | yeast autophagy 18 F-like protein;(source:Araport11) |
| AT5G54865 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G54930 | AT hook motif-containing protein;(source:Araport11) |
| AT5G54990 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
| AT5G55110 | Stigma-specific Stig1 family protein;(source:Araport11) |
| AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT5G55310 | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. |
| AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT5G55520 | kinesin-like protein;(source:Araport11) |
| AT5G55800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G55810 | encodes a bi-functional enzyme that expresses both nicotinamide-nucleotide adenylyltransferase (2.7.7.1) and nicotinate-nucleotide adenylyltransferase (2.7.7.18)activity. |
| AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
| AT5G55910 | Member of AGC VIIIa Kinase family. D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. D6PK is associated with sterol enriched membrane rafts and may be involved in regulation of the switch from basal to planar polarity during root hair initiation. Involved in pulse-induced phototropism but also for time-dependent second positive phototropism. Works with PIN3 in the same genetic pathway of hypocotyl phototropism under all light conditions. Involved in the generation of auxin asymmetrical distribution induced by phototropic stimulation. |
| AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT5G56110 | Encodes a member of the R2R3 MYB transcription factor gene family that is required for anther development by regulation tapetum development, callose dissolution and exine formation. It acts upstream of MS2. |
| AT5G56150 | ubiquitin-conjugating enzyme 30;(source:Araport11) |
| AT5G56160 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
| AT5G56340 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G56369 | Encodes a defensin-like (DEFL) family protein. |
| AT5G56390 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G56520 | hypothetical protein;(source:Araport11) |
| AT5G56560 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G56630 | phosphofructokinase 7;(source:Araport11) |
| AT5G56640 | Myo-Inositol Oxygenase gene family |
| AT5G56760 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT5G56790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G56850 | hypothetical protein;(source:Araport11) |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT5G57000 | DEAD-box ATP-dependent RNA helicase;(source:Araport11) |
| AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
| AT5G57070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G57080 | transmembrane protein;(source:Araport11) |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT5G57190 | Encodes the minor form of the two non-mitochondrail phosphatidylserine decarboxylase. The gene expression level is very low. Located at the tonoplast. |
| AT5G57260 | putative cytochrome P450 |
| AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
| AT5G57420 | Belongs to auxin inducible gene family. |
| AT5G57510 | cotton fiber protein;(source:Araport11) |
| AT5G57520 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G57550 | xyloglucan endotransglycosylase-related protein (XTR3) |
| AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT5G57670 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
| AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
| AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G57870 | Encodes a putative eukaryotic translation initiation factor The mRNA is cell-to-cell mobile. |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT5G57990 | Encodes a ubiquitin-specific protease. |
| AT5G58060 | Constitutively expressed SNARE protein of the YKT6 family. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT5G58170 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58412 | Encodes a Plant thionin family protein |
| AT5G58460 | member of Putative Na+/H+ antiporter family |
| AT5G58500 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT5G58580 | Encodes a functional E3 ligase that is involved in membrane trafficking and regulation of salt stress responses. It is localized to membranes including the plasma membrane, pre-vacuolar compartments and Golgi. |
| AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
| AT5G58670 | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). |
| AT5G58750 | Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases). |
| AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
| AT5G58780 | Encodes a novel Z,E-mixed heptaprenyl diphosphate (Z,E-HepPP) synthase, which may be responsible for short-chain betulaprenols. It catalyzes the formation of C 35 short-chain polyisoprenoids in which the optimal allylic substrate was E,E-FPP. It may have a role in response to cold stress in root. |
| AT5G58820 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G58830 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G58840 | Subtilase family protein;(source:Araport11) |
| AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
| AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
| AT5G58900 | R-R-type MYB protein |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G59050 | G patch domain protein;(source:Araport11) |
| AT5G59055 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT5G59090 | subtilase 4.12;(source:Araport11) |
| AT5G59100 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G59110 | subtilisin-like serine protease-like protein;(source:Araport11) |
| AT5G59120 | SBT4.13 subtilase. Activity is inhibited by SPI-1. |
| AT5G59130 | Subtilase family protein;(source:Araport11) |
| AT5G59190 | subtilase family protein;(source:Araport11) |
| AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT5G59305 | CLAVATA 3/ESR (CLE)-like protein;(source:Araport11) |
| AT5G59360 | hypothetical protein;(source:Araport11) |
| AT5G59370 | Encodes one of eight Arabidopsis actins. ACT4 belongs to the reproductive actin subclass which is predominantly expressed in developing and reproductive tissues, such as pollen, pollen tubes, ovules, and developing seeds. Expression of the ACT4/GUS fusion was restricted to young vascular tissues, tapetum, and developing and mature pollen. |
| AT5G59390 | XH/XS domain-containing protein;(source:Araport11) |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G59505 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: GAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172e (converted to TAIR10 based on PMID19304749): Chr5: 23988070-23988886 (forward), length: 817 bp; exon coordinates: exon 1: 23988070 to 23988886; mature miRNA and miRNA* are located on exon 1. |
| AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G59770 | Protein-tyrosine phosphatase-like, PTPLA;(source:Araport11) |
| AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G60070 | ankyrin repeat family protein;(source:Araport11) |
| AT5G60080 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G60090 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G60100 | Encodes pseudo-response regulator 3 (APRR3/PRR3). PRR3 transcript levels vary in a circadian pattern with peak expression at dusk under long and short day conditions. PRR3 affects the period of the circadian clock and seedlings with reduced levels of PRR3 have shorter periods, based on transcriptional assays of clock-regulated genes. PRR3 is expressed in the vasculature of cotyledons and leaves where it may help stabilize the TOC1 protein by preventing interactions between TOC1 and the F-box protein ZTL. |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G60210 | Encodes RIP5 (ROP interactive partner 5), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT5G60270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60350 | hypothetical protein;(source:Araport11) |
| AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
| AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G60850 | Encodes a zinc finger protein. |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT5G61090 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G61120 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G61160 | anthocyanin 5-aromatic acyltransferase 1;(source:Araport11) |
| AT5G61250 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted. |
| AT5G61290 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |
| AT5G61390 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G61430 | NAC domain containing protein 100;(source:Araport11) |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61570 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G61620 | myb-like transcription factor family protein;(source:Araport11) |
| AT5G61640 | ubiquitous enzyme that repairs oxidatively damaged proteins |
| AT5G61700 | ABC2 homolog 16;(source:Araport11) |
| AT5G61710 | cotton fiber protein;(source:Araport11) |
| AT5G61720 | hypothetical protein (DUF1216);(source:Araport11) |
| AT5G61750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
| AT5G61980 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD1 belongs to the class 1, together with AGD2, AGD3 and AGD4. Not expressed in hypocotyls and cotyledons. |
| AT5G62065 | Encodes a Protease inhibitor/seed storage/LTP family protein. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
| AT5G62510 | F-box family protein;(source:Araport11) |
| AT5G62627 | Encodes a defensin-like (DEFL) family protein. |
| AT5G62630 | hipl2 protein precursor;(source:Araport11) |
| AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT5G62730 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G62800 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT5G62900 | PADRE protein down-regulated after infection by S. sclerotiorum. |
| AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G62980 | Encodes an enzyme that can act as a aldolase or an epimerase for 7,8-dihydroneopterin and 7,8-dihydromonapterin in vitro. It is likely to act in folate biosynthesis as a homooctamer in vivo. |
| AT5G63087 | Encodes a Plant thionin family protein |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT5G63410 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G63590 | flavonol synthase 3;(source:Araport11) |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G63690 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT5G63730 | Encodes ARIADNE14 (ARI14), a putative ubiquitin E3 ligase. ARI14 and an inversely transcribed gene KPL generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT5G63750 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT5G63970 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT5G64000 | 3'(2'),5'-bisphosphate nucleotidase |
| AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G64190 | neuronal PAS domain protein;(source:Araport11) |
| AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
| AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
| AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
| AT5G64520 | Encodes a protein of the XRCC2 family involved in DNA repair. atxrcc2-1 Mutants are sensitive to MitomycinC but do not show fertility defects. |
| AT5G64550 | loricrin-like protein;(source:Araport11) |
| AT5G64570 | Encodes a beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT5G64620 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. |
| AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
| AT5G65090 | Encodes a protein involved in root hair morphogenesis and tip growth. Required for restricting both the size of the root-hair initiation site and the width of the root hairs during the transition to tip growth, but, apparently, is not required for normal subsequent tip growth. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G65160 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G65207 | hypothetical protein;(source:Araport11) |
| AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
| AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT5G65460 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA1 |
| AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
| AT5G65640 | bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering time. Mutants are non-flowering in short days and phenotype can be reversed with GA application. Based on the expression of GA biosynthetic genes in the mutant, it likely acts through regulation of GA metabolism. Its expression shows developmental stage and tissue specificity. In short days it is expressed mainly in root tips and SAM, with weak expression in cotyledons throughout development. In LD GUS activity was observed in the hypocotyl and in root tips and SAM throughout the developmental stages. |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
| AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
| AT5G66080 | Type 2C protein phosphatase located in the plasma membrane. Functions in heat shock response memory mantainance. |
| AT5G66190 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT5G66220 | Chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66870 | Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination. |
| AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G67280 | receptor-like kinase;(source:Araport11) |
| AT5G67310 | member of CYP81G |
| AT5G67350 | hypothetical protein;(source:Araport11) |
| AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT5G67411 | GRAS family transcription factor;(source:Araport11) |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT5G67550 | transmembrane protein;(source:Araport11) |
| AT5G67640 | hypothetical protein;(source:Araport11) |