| AT5G51920 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G53400 | peptide upstream protein;(source:Araport11) |
| AT2G28580 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G14280 | LL-diaminopimelate aminotransferase;(source:Araport11) |
| AT4G10780 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT5G02180 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G55950 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT2G15640 | F-box family protein;(source:Araport11) |
| AT1G23600 | OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11) |
| AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
| AT1G33740 | pseudogene of TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT1G63340 | Flavin-containing monooxygenase family protein;(source:Araport11) |
| AT4G09090 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G35200 | pseudogene of Ribosomal protein L4/L1 family;(source:Araport11) |
| AT3G29050 | receptor-like protein kinase-like protein;(source:Araport11) |
| AT1G71320 | F-box family protein;(source:Araport11) |
| AT3G28412 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
| AT1G11850 | transmembrane protein;(source:Araport11) |
| AT2G22650 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT1G64880 | Ribosomal protein S5 family protein;(source:Araport11) |
| AT5G09430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G23510 | hypothetical protein;(source:Araport11) |
| AT3G47000 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT2G11230 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.9e-61 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G50580 | transmembrane protein;(source:Araport11) |
| AT3G47540 | Chitinase family protein;(source:Araport11) |
| AT4G27290 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G08400 | structural maintenance of chromosomes-like protein, putative (DUF3531);(source:Araport11) |
| AT3G46170 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G51180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G11510 | Ribosomal protein S11 family protein;(source:Araport11) |
| AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT2G23520 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G58007 | multidrug resistance protein;(source:Araport11) |
| AT5G22150 | transmembrane protein;(source:Araport11) |
| AT5G48020 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G15640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT2G11778 | transmembrane protein;(source:Araport11) |
| AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G34320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G67240 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.5e-23 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G21020 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G29475 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-91 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G44580 | zinc ion binding protein;(source:Araport11) |
| AT2G34020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G56100 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G52350 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT2G25185 | Encodes a defensin-like (DEFL) family protein. |
| AT1G51000 | hypothetical protein;(source:Araport11) |
| AT2G29300 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G57080 | transmembrane protein;(source:Araport11) |
| AT1G78990 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G18960 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G62095 | Pseudogene of AT1G11820; hydrolase, hydrolyzing O-glycosyl compounds |
| AT4G10390 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G16960 | Ubiquitin domain-containing protein;(source:Araport11) |
| AT4G31020 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G13690 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G58830 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G21310 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G22800 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G17410 | Nucleoside diphosphate kinase family protein;(source:Araport11) |
| AT2G11235 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-94 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G28996 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
| AT1G75180 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT2G21840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
| AT1G09820 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT2G02050 | NADH-ubiquinone oxidoreductase B18 subunit;(source:Araport11) |
| AT4G06752 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.8e-276 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G20850 | proline-rich family protein;(source:Araport11) |
| AT5G55893 | hypothetical protein;(source:Araport11) |
| AT2G38350 | hypothetical protein;(source:Araport11) |
| AT5G55350 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT4G34320 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT5G56061 | Pseudogene of AT5G56050 |
| AT1G16950 | transmembrane protein;(source:Araport11) |
| AT3G53490 | valine-tRNA ligase;(source:Araport11) |
| AT3G52980 | Zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
| AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT4G26350 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G27140 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
| AT1G13410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G51620 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G11405 | hypothetical protein;(source:Araport11) |
| AT5G46530 | AWPM-19-like family protein;(source:Araport11) |
| AT1G53050 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G36297 | pseudogene of aspartyl protease family protein |
| AT3G46183 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-230 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT3G30834 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-90 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G28700 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G16850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G37750 | hypothetical protein;(source:Araport11) |
| AT3G44810 | F-box family protein;(source:Araport11) |
| AT1G61760 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G06790 | cotton fiber protein;(source:Araport11) |
| AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G14305 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT2G32970 | G1/S-specific cyclin-E protein;(source:Araport11) |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
| AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT3G52230 | hypothetical protein;(source:Araport11) |
| AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G27710 | Glycine-rich protein family;(source:Araport11) |
| AT1G17360 | LOW protein: protein phosphatase 1 regulatory subunit-like protein;(source:Araport11) |
| AT3G07810 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G17700 | MATE efflux family protein;(source:Araport11) |
| AT5G02920 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G47940 | DNAJ heat shock family protein;(source:Araport11) |
| AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G19460 | Reticulon family protein;(source:Araport11) |
| AT5G38850 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT3G47630 | translocator assembly/maintenance protein;(source:Araport11) |
| AT3G53010 | carbohydrate esterase, putative (DUF303);(source:Araport11) |
| AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
| AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G50390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G03920 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
| AT1G71690 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT5G30870 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G46460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G61190 | putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT1G56540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G67645 | pseudogene of F-box protein (DUF295);(source:Araport11) |
| AT2G13460 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G50130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G21528 | hypothetical protein;(source:Araport11) |
| AT5G38396 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G02080 | Ribosomal protein S19e family protein;(source:Araport11) |
| AT5G42325 | Transcription factor IIS protein;(source:Araport11) |
| AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G03200 | catalytics;(source:Araport11) |
| AT1G47495 | hypothetical protein;(source:Araport11) |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT3G43130 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins, Arabidopsis thaliana;(source:TAIR10) |
| AT3G16880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G44950 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G66270 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT5G35460 | membrane protein;(source:Araport11) |
| AT5G04980 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G51570 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G60972 | other_RNA;(source:Araport11) |
| AT5G14440 | Surfeit locus protein 2 (SURF2);(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G44760 | transmembrane protein;(source:Araport11) |
| AT1G24320 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT4G39795 | hypothetical protein (DUF581);(source:Araport11) |
| AT5G43390 | plant/protein;(source:Araport11) |
| AT4G04190 | transmembrane protein;(source:Araport11) |
| AT5G18090 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT1G78150 | N-lysine methyltransferase;(source:Araport11) |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT1G58643 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
| AT1G69110 | pseudogene of Ribosomal protein S10p/S20e family protein;(source:Araport11) |
| AT4G12990 | transmembrane protein;(source:Araport11) |
| AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G49250 | ATP-dependent DNA ligase;(source:Araport11) |
| AT3G42800 | AF-like protein;(source:Araport11) |
| AT1G66820 | glycine-rich protein;(source:Araport11) |
| AT4G36560 | transmembrane protein;(source:Araport11) |
| AT5G66250 | kinectin-like protein;(source:Araport11) |
| AT5G48550 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G65160 | ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
| AT5G49780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G23270 | hypothetical protein;(source:Araport11) |
| AT5G34644 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.1e-50 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G54600 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G16050 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT1G26140 | hypothetical protein;(source:Araport11) |
| AT4G04972 | hypothetical protein;(source:Araport11) |
| AT3G46500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G04350 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT4G01390 | TRAF-like family protein;(source:Araport11) |
| AT3G50030 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT1G11765 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G30090 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT4G09340 | SPla/RYanodine receptor (SPRY) domain-containing protein;(source:Araport11) |
| AT4G09150 | T-complex protein 11;(source:Araport11) |
| AT4G13615 | Uncharacterized protein family SERF;(source:Araport11) |
| AT4G34670 | Ribosomal protein S3Ae;(source:Araport11) |
| AT3G28900 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT3G53330 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT5G37210 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G45850 | hypothetical protein (DUF688);(source:Araport11) |
| AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT4G14225 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT4G02170 | cotton fiber protein;(source:Araport11) |
| AT1G23830 | transmembrane protein;(source:Araport11) |
| AT2G24650 | B3 domain-containing protein REM13;(source:Araport11) |
| AT1G75610 | pseudogene of Histone superfamily protein;(source:Araport11) |
| AT1G29140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G52820 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G24310 | TPRXL;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G06990 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT3G49410 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT5G41250 | Exostosin family protein;(source:Araport11) |
| AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G42430 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37045.1);(source:TAIR10) |
| AT3G48770 | ATP/DNA binding protein;(source:Araport11) |
| AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
| AT4G23470 | PLAC8 family protein;(source:Araport11) |
| AT3G26805 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G63630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G34330 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT3G47670 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G01460 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G43950 | vacuolar protein sorting-associated protein (DUF946);(source:Araport11) |
| AT5G05220 | hypothetical protein;(source:Araport11) |
| AT1G16750 | GPI-anchored adhesin-like protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G09176 | transmembrane protein;(source:Araport11) |
| AT5G01320 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT1G16170 | ephrin-A3 protein;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G18220 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G01010 | rRNA;(source:Araport11) |
| AT3G26010 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G21250 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT2G05280 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-30 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G18130 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT2G34530 | transmembrane protein;(source:Araport11) |
| AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT1G29418 | transmembrane protein;(source:Araport11) |
| AT1G43580 | Sphingomyelin synthetase family protein;(source:Araport11) |
| AT4G36960 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G04480 | F-box protein with a domain protein;(source:Araport11) |
| AT5G26749 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT4G30910 | Cytosol aminopeptidase family protein;(source:Araport11) |
| AT4G01490 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-44 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G25330 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G43440 | encodes a protein whose sequence is similar to ACC oxidase |
| AT3G17080 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G01513 | hypothetical protein;(source:Araport11) |
| AT1G78110 | nucleolar GTP-binding protein;(source:Araport11) |
| AT1G23570 | hypothetical protein (DUF220);(source:Araport11) |
| AT4G30010 | ATP-dependent RNA helicase;(source:Araport11) |
| AT3G15220 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G62180 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G14358 | high affinity nitrate transporter;(source:Araport11) |
| AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
| AT2G24460 | C3HC4-type RING finger protein;(source:Araport11) |
| AT5G07860 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G10880 | Putative role in response to salt stress. Mutants grow larger than the wild type under salt stress condition (Ann Stapleton and Ashley Green, 2009, personal communication). |
| AT1G33290 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G10780 | ER membrane protein complex subunit-like protein;(source:Araport11) |
| AT3G30790 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-149 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT3G29520 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
| AT4G22320 | golgin family A protein;(source:Araport11) |
| AT1G48080 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G19410 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G27120 | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; has similarity to MAR binding NOP58 protein The mRNA is cell-to-cell mobile. |
| AT3G47590 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G28000 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G55360 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G43520 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G37705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G10820 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.8e-34 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT3G44770 | transmembrane protein, putative (DUF626);(source:Araport11) |
| AT3G59270 | FBD-like domain family protein;(source:Araport11) |
| AT5G63690 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G34270 | hypothetical protein;(source:Araport11) |
| AT5G38340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G38820 | Encodes a putative amino acid transporter. |
| AT2G21430 | Papain family cysteine protease;(source:Araport11) |
| AT3G62920 | zinc metalloproteinase aureolysin;(source:Araport11) |
| AT1G69030 | BSD domain-containing protein;(source:Araport11) |
| AT2G40390 | neuronal PAS domain protein;(source:Araport11) |
| AT3G30841 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
| AT4G13970 | zinc ion binding protein;(source:Araport11) |
| AT2G40765 | transmembrane protein;(source:Araport11) |
| AT3G58260 | TRAF-like family protein;(source:Araport11) |
| AT3G56408 | Natural antisense transcript overlaps with AT3G56410;(source:Araport11) |
| AT2G10810 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.9e-39 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT4G08095 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.5e-92 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT3G26240 | Cysteine/Histidine-rich C1 domain family protein. Accumulation of this protein is regulated by a cis-Natural Antisense RNA (cis-NAT). |
| AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G50295 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G33820 | hypothetical protein;(source:Araport11) |
| AT5G37420 | Note that previous reports (Plant Cell 2003,15:1538; PNAS 2003, 100:13407) have incorrectly named AT5G37420 as AGL105. AT5G37415 has now been named as AGL105 based on Plant Cell 2003, 15:1538 where the GenBank accession number given for AGL105 is AY141227 (Supplemental Table 3), which corresponds to AT5G37415. |
| AT1G33700 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT4G36790 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G27945 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G23100 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G09410 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT4G08550 | electron carrier/ protein disulfide oxidoreductase;(source:Araport11) |
| AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT5G58300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G31490 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G42090 | transposable_element_gene;(source:Araport11);contains domain LIN-9 RELATED (PTHR21689);(source:TAIR10) |
| AT3G27950 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G42240 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G29410 | Ribosomal L28e protein family;(source:Araport11) |
| AT5G56690 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G72800 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G24710 | NADPH-dependent diflavin oxidoreductase;(source:Araport11) |
| AT5G62340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
| AT5G33432 | similar to En/Spm-like transposon |
| AT3G15518 | hypothetical protein;(source:Araport11) |
| AT4G08135 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-10 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
| AT3G25550 | F-box family protein;(source:Araport11) |
| AT5G58820 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G17675 | Encodes a Plantacyanin/Basic blue family protein |
| AT1G66780 | MATE efflux family protein;(source:Araport11) |
| AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
| AT4G12450 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT5G60090 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G26775 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.9e-28 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G39080 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G67856 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G23540 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G03260 | SNARE associated Golgi protein family;(source:Araport11) |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT1G13630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G63530 | hypothetical protein;(source:Araport11) |
| AT1G67365 | Natural antisense transcript overlaps with AT1G67370;(source:Araport11) |
| AT5G25530 | DNAJ heat shock family protein;(source:Araport11) |
| AT2G44260 | DUF946 family protein (DUF946);(source:Araport11) |
| AT3G58877 | hypothetical protein;(source:Araport11) |
| AT3G29077 | Pseudogene of AT3G26880; self-incompatibility protein-related |
| AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
| AT1G33710 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT4G14820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G40205 | Ribosomal protein L41 family;(source:Araport11) |
| AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G06180 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G42160 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT3G22180 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G74830 | myosin-binding protein, putative (Protein of unknown function, DUF593);(source:Araport11) |
| AT3G51265 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT3G53830 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G28690 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G07150 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0707D10.17, blastp match of 27%25 identity and 3.3e-12 P-value to GP|13603432|dbj|BAB40159.1||AP002910 P0707D10.17 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT1G49832 | None;(source:Araport11) |
| AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
| AT5G39470 | F-box family protein;(source:Araport11) |
| AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
| AT1G50680 | AP2/B3 transcription factor family protein;(source:Araport11) |
| AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
| AT1G48820 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT2G43865 | hypothetical protein;(source:Araport11) |
| AT1G12850 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT4G33860 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT2G21680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G25360 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G39290 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G32975 | hypothetical protein;(source:Araport11) |
| AT3G11070 | Outer membrane OMP85 family protein;(source:Araport11) |
| AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
| AT3G44640 | transposable_element_gene;(source:Araport11);transposase IS4 family protein, contains Pfam profile: PF01609 transposase DDE domain;(source:TAIR10) |
| AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT3G56760 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
| AT3G48830 | tRNA nucleotidyltransferase/polyA polymerase family protein;(source:Araport11) |
| AT2G33710 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT4G26130 | cotton fiber protein;(source:Araport11) |
| AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G44125 | Natural antisense transcript overlaps with AT1G44120;(source:Araport11) |
| AT3G28370 | spindle assembly checkpoint component;(source:Araport11) |
| AT3G03290 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT3G10310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G38383 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.9e-185 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G23510 | OBP32pep protein;(source:Araport11) |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT1G23520 | hypothetical protein (DUF220);(source:Araport11) |
| AT4G39170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G05040 | UBA-like domain protein;(source:Araport11) |
| AT2G40630 | Uncharacterized conserved protein (UCP030365);(source:Araport11) |
| AT3G51470 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G06200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G58880 | LRR protein;(source:Araport11) |
| AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G22840 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G60240 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G16560 | Per1-like family protein;(source:Araport11) |
| AT3G10590 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G34520 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G35280 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G07310.1);(source:TAIR10) |
| AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
| AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G16410 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G03510 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT4G24170 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT5G51670 | hypothetical protein (DUF668);(source:Araport11) |
| AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT2G30660 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT1G14220 | Ribonuclease T2 family protein;(source:Araport11) |
| AT3G01660 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT2G22530 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT1G51970 | B3 domain protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT3G61962 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G44200 | pre-mRNA splicing factor domain-containing protein;(source:Araport11) |
| AT1G67855 | hypothetical protein;(source:Araport11) |
| AT1G80620 | S15/NS1, RNA-binding protein;(source:Araport11) |
| AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
| AT2G15760 | calmodulin-binding protein (DUF1645);(source:Araport11) |
| AT5G59190 | subtilase family protein;(source:Araport11) |
| AT3G28420 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G04547 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-68 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT4G07770 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.7e-12 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G44345 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G47570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G18005 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G05495 | pseudogene of temperature sensing protein-like protein;(source:Araport11) |
| AT2G30105 | LRR/ubiquitin-like domain protein;(source:Araport11) |
| AT3G09915 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G16070 | lipase class 3 family protein;(source:Araport11) |
| AT1G56612 | Natural antisense transcript overlaps with AT1G56610;(source:Araport11) |
| AT3G61400 | 1-aminocyclopropane-1-carboxylate oxidase-like protein |
| AT5G52547 | hypothetical protein;(source:Araport11) |
| AT5G31122 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative copia-type polyprotein, blastp match of 56%25 identity and 1.5e-39 P-value to GP|15209144|gb|AAK91877.1|AC091665_3|AC091665 Putative copia-type polyprotein {Oryza sativa};(source:TAIR10) |
| AT2G42730 | F-box/FBD/LRR protein;(source:Araport11) |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT3G26250 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G08220 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.3e-67 P-value blast match to Q9SUF8 /145-308 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G28910 | alpha-(1,6)-fucosyltransferase;(source:Araport11) |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G12950 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT5G37200 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03970 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G29783 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-193 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G18180 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT5G42430 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G59240 | RNI-like superfamily protein;(source:Araport11) |
| AT4G33850 | Pseudogene of AT4G33850; glycosyl hydrolase family 10 protein |
| AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
| AT3G15240 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT5G37450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G27230 | Frigida-like protein;(source:Araport11) |
| AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G30270 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
| AT2G25130 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G15385 | cotton fiber protein;(source:Araport11) |
| AT2G27430 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G15430 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G44960 | SNARE associated Golgi protein family;(source:Araport11) |
| AT4G07454 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-139 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G14610 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G44755 | hypothetical protein;(source:Araport11) |
| AT4G22440 | hypothetical protein;(source:Araport11) |
| AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT3G42542 | Encodes a defensin-like (DEFL) family protein. |
| AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
| AT5G01790 | hypothetical protein;(source:Araport11) |
| AT5G35640 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT3G19300 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G22960 | FAM63A-like protein (DUF544);(source:Araport11) |
| AT1G08120 | TP53-regulating kinase-like protein;(source:Araport11) |
| AT1G35430 | transmembrane protein;(source:Araport11) |
| AT2G14570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10) |
| AT5G45920 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G30740 | pseudogene of Ribosomal protein S25 family protein;(source:Araport11) |
| AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
| AT1G62480 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
| AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT5G35736 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
| AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G07160 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT2G29310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G37320 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G52700 | hypothetical protein;(source:Araport11) |
| AT1G56230 | enolase (DUF1399);(source:Araport11) |
| AT5G22310 | trichohyalin-like protein;(source:Araport11) |
| AT4G00600 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT5G38393 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT3G53550 | FBD-like domain family protein;(source:Araport11) |
| AT2G19890 | hypothetical protein;(source:Araport11) |
| AT4G01180 | XH/XS domain-containing protein;(source:Araport11) |
| AT5G05790 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT1G06340 | Plant Tudor-like protein;(source:Araport11) |
| AT4G37530 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G61575 | Serine/Threonine kinase;(source:Araport11) |
| AT2G04790 | PTB domain engulfment adapter;(source:Araport11) |
| AT1G33680 | KH domain-containing protein;(source:Araport11) |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G22460 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G10610 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-162 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G44400 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
| AT5G02480 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT3G25590 | micronuclear linker histone polyprotein-like protein;(source:Araport11) |
| AT3G59870 | hypothetical protein;(source:Araport11) |
| AT2G15440 | polysaccharide biosynthesis protein (DUF579);(source:Araport11) |
| AT2G14430 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.5e-45 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G20760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42700.1);(source:TAIR10) |
| AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT4G17150 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G07720 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-59 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G20190 | hypothetical protein;(source:Araport11) |
| AT1G06590 | anaphase-promoting complex subunit;(source:Araport11) |
| AT3G59260 | pirin;(source:Araport11) |
| AT1G01080 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G57850 | transmembrane protein;(source:Araport11) |
| AT1G64850 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
| AT3G19360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G20720 | amino-terminal region of chorein;(source:Araport11) |
| AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT4G27480 | GT14 enzyme |
| AT4G21705 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G40470 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-102 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G26010 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G24880 | chromo domain cec-like protein;(source:Araport11) |
| AT3G17480 | F-box/associated interaction domain protein;(source:Araport11) |
| AT4G14840 | spindle assembly abnormal protein;(source:Araport11) |
| AT1G43444 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.2e-242 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT1G49650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G19580 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G29090 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G63750 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G33610 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G35413 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.6e-41 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G39870 | hypothetical protein;(source:Araport11) |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G14180 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-307 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G14350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G19610 | nucleotide/nucleic acid binding protein;(source:Araport11) |
| AT1G75860 | DNA ligase;(source:Araport11) |
| AT3G50880 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G68930 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT5G34945 | pseudogene of Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT2G33847 | hypothetical protein;(source:Araport11) |
| AT5G40470 | RNI-like superfamily protein;(source:Araport11) |
| AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT3G57930 | rho GTPase-activating gacO-like protein;(source:Araport11) |
| AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT2G23300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G13700 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-117 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT5G07870 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G42323 | Pseudogene of AT1G06390; GSK1 (GSK3/SHAGGY-LIKE PROTEIN KINASE 1); kinase |
| AT5G50460 | secE/sec61-gamma protein transport protein;(source:Araport11) |
| AT1G22170 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G63020 | hypothetical protein (DUF3049);(source:Araport11) |
| AT2G33855 | transmembrane protein;(source:Araport11) |
| AT4G17140 | pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
| AT4G10320 | tRNA synthetase class I (I, L, M and V) family protein;(source:Araport11) |
| AT5G63520 | F-box/LRR protein;(source:Araport11) |
| AT3G04200 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G15760 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT1G71180 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
| AT5G34852 | pseudogene of Intron maturase;(source:Araport11) |
| AT5G39473 | pseudogene of DC1 (domain-containing protein) |
| AT5G17040 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G58210 | TRAF-like family protein;(source:Araport11) |
| AT1G30845 | cell growth defect protein;(source:Araport11) |
| AT2G19290 | hypothetical protein;(source:Araport11) |
| AT3G58270 | phospholipase-like protein (PEARLI 4) with TRAF-like domain protein;(source:Araport11) |
| AT3G48120 | serine/arginine-rich splicing factor;(source:Araport11) |
| AT5G13310 | hypothetical protein;(source:Araport11) |
| AT5G38250 | Protein kinase family protein;(source:Araport11) |
| AT3G46260 | kinase-like protein;(source:Araport11) |
| AT5G28463 | transmembrane protein;(source:Araport11) |
| AT1G30830 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
| AT1G21470 | hypothetical protein;(source:Araport11) |
| AT2G26780 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT5G37920 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G07140 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G35205 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-36 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G13920 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G33350 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G35111 | pseudogene of Peroxidase superfamily protein;(source:Araport11) |
| AT5G28637 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-23 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G23420 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G44713 | hypothetical protein;(source:Araport11) |
| AT2G25370 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
| AT5G45275 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G54410 | hypothetical protein;(source:Araport11) |
| AT3G22723 | hypothetical protein;(source:Araport11) |
| AT5G24316 | proline-rich family protein;(source:Araport11) |
| AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G24690 | hypothetical protein;(source:Araport11) |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G37030 | membrane protein;(source:Araport11) |
| AT3G24542 | Beta-galactosidase related protein;(source:Araport11) |
| AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT1G28720 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G29700 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT1G09812 | multidrug resistance protein;(source:Araport11) |
| AT5G58200 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT4G08640 | ATP binding protein;(source:Araport11) |
| AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT5G12120 | Ubiquitin-associated/translation elongation factor EF1B protein;(source:Araport11) |
| AT1G49110 | hypothetical protein;(source:Araport11) |
| AT4G27595 | Encodes a microtubule-associated protein. |
| AT1G53980 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G03220 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT2G32750 | Exostosin family protein;(source:Araport11) |
| AT1G52450 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G06908 | hypothetical protein;(source:Araport11) |
| AT3G33175 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
| AT2G03505 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G15730 | Cobalamin biosynthesis CobW-like protein;(source:Araport11) |
| AT5G59240 | Ribosomal protein S8e family protein;(source:Araport11) |
| AT4G08160 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT5G49050 | universal stress A-like protein;(source:Araport11) |
| AT1G48960 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT3G17890 | hypothetical protein;(source:Araport11) |
| AT3G15330 | pseudogene of the NLI interacting factor (NIF) protein family |
| AT4G14190 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G33145 | hypothetical protein;(source:Araport11) |
| AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G38100 | SABATH family methyltransferase. |
| AT1G28640 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G35660 | selection/upkeep of intraepithelial T-cells protein, putative (DUF241);(source:Araport11) |
| AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT1G51120 | AP2/B3 transcription factor family protein;(source:Araport11) |
| AT1G21290 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-25 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G35805 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
| AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G21530 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G16410 | transmembrane protein;(source:Araport11) |
| AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G12190 | golgin family A protein;(source:Araport11) |
| AT2G05160 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
| AT3G55710 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G07339 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.1e-75 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G63930 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G31360 | selenium binding protein;(source:Araport11) |
| AT3G22700 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G71015 | PADRE protein. |
| AT4G31980 | PPPDE thiol peptidase family protein;(source:Araport11) |
| AT3G21690 | MATE efflux family protein;(source:Araport11) |
| AT1G03502 | small nucleolar RNA |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G08125 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G11145 | hypothetical protein (DUF674);(source:Araport11) |
| AT5G35603 | hypothetical protein (DUF3287);(source:Araport11) |
| AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
| AT2G11640 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10) |
| AT3G55810 | Pyruvate kinase family protein;(source:Araport11) |
| AT1G10220 | ZCF37;(source:Araport11) |
| AT5G50315 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.0e-14 P-value blast match to Q9XE24 /118-277 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G49610 | F-box family protein;(source:Araport11) |
| AT4G06710 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G36355 | RAB6-interacting golgin (DUF662);(source:Araport11) |
| AT5G67640 | hypothetical protein;(source:Araport11) |
| AT1G02570 | transmembrane protein;(source:Araport11) |
| AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G05812 | Natural antisense transcript overlaps with AT2G05810;(source:Araport11) |
| AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
| AT2G47970 | Nuclear pore localization protein NPL4;(source:Araport11) |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G05670 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G24640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-37 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G20250 | hypothetical protein;(source:Araport11) |
| AT1G70400 | NOSIC domain protein;(source:Araport11) |
| AT3G43090 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.4e-12 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT4G03450 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G56570 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G21600 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT3G08600 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G16600 | pseudogene of camelliol C synthase 1;(source:Araport11) |
| AT5G38005 | other_RNA;(source:Araport11) |
| AT4G13320 | hypothetical protein;(source:Araport11) |
| AT3G06950 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G18500 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G62880 | Cornichon family protein;(source:Araport11) |
| AT5G49900 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G28870 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G28780 | PIF1 helicase;(source:Araport11) |
| AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT5G52055 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-30 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G28570 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT5G42740 | Sugar isomerase (SIS) family protein;(source:Araport11) |
| AT3G53235 | hypothetical protein;(source:Araport11) |
| AT4G06702 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT1G36380 | transmembrane protein;(source:Araport11) |
| AT4G10420 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G60070 | ankyrin repeat family protein;(source:Araport11) |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G03600 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G57510 | cotton fiber protein;(source:Araport11) |
| AT1G61650 | pseudogene of chromomethylase 1;(source:Araport11) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT1G69485 | Ribosomal L32p protein family;(source:Araport11) |
| AT4G39270 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G76460 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G05610 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.2e-179 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT2G13240 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.1e-49 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G25485 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.3e-49 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G13040 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G19320 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G33090 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT3G06240 | F-box family protein;(source:Araport11) |
| AT2G39855 | plant/protein;(source:Araport11) |
| AT5G43770 | proline-rich family protein;(source:Araport11) |
| AT1G43140 | Cullin family protein;(source:Araport11) |
| AT5G56390 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G21980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT4G38940 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G75460 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT2G17680 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
| AT1G43775 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G42835 | Natural antisense transcript overlaps with AT2G42830;(source:Araport11) |
| AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G24080 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G07590 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G59300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G39756 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G28155 | hypothetical protein;(source:Araport11) |
| AT2G35430 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT3G63220 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G16200 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT1G14210 | Ribonuclease T2 family protein;(source:Araport11) |
| AT3G28216 | hypothetical protein;(source:Araport11) |
| AT5G01440 | hypothetical protein;(source:Araport11) |
| AT1G77992 | Natural antisense transcript overlaps with AT1G77990;(source:Araport11) |
| AT3G05260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G28210 | mRNA capping enzyme family protein;(source:Araport11) |
| AT4G18740 | Rho termination factor;(source:Araport11) |
| AT5G39540 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G01595 | Natural antisense transcript overlaps with AT5G01600;(source:Araport11) |
| AT3G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G33070 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-191 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G28570 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G13830 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G46360 | transmembrane protein;(source:Araport11) |
| AT4G18450 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT1G11362 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G56452 | FBD-like domain family protein;(source:Araport11) |
| AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
| AT3G29300 | transmembrane protein;(source:Araport11) |
| AT4G01535 | hypothetical protein;(source:Araport11) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G14970 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
| AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT2G17160 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT1G03106 | hypothetical protein;(source:Araport11) |
| AT1G19485 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G24280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G63450 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G63880 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. The mRNA is cell-to-cell mobile. |
| AT5G22780 | Adaptor protein complex AP-2, alpha subunit;(source:Araport11) |
| AT3G48220 | F-box protein;(source:Araport11) |
| AT3G26742 | hypothetical protein;(source:Araport11) |
| AT1G36010 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.8e-40 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G49260 | hypothetical protein;(source:Araport11) |
| AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT2G36240 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT5G61290 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT4G22900 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT2G31460 | B3 domain protein, putative (DUF313);(source:Araport11) |
| AT5G49640 | hypothetical protein;(source:Araport11) |
| AT1G30190 | cotton fiber protein;(source:Araport11) |
| AT5G02140 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G04680 | Rix1 complex component;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT2G25190 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT1G36720 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.3e-308 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT5G17970 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G61880 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G12600 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT4G10720 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G17600 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G03550 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT1G10650 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT2G02660 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G57650 | eukaryotic translation initiation factor-like protein;(source:Araport11) |
| AT4G22380 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT1G64800 | DNA binding / transcription factor;(source:Araport11) |
| AT3G24850 | B3 domain protein (DUF313);(source:Araport11) |
| AT4G16140 | proline-rich family protein;(source:Araport11) |
| AT5G04700 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT4G34630 | prostatic spermine-binding-like protein;(source:Araport11) |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G00872 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G35360 | pantothenate kinase;(source:Araport11) |
| AT5G60610 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G38310 | hypothetical protein;(source:Araport11) |
| AT1G20810 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G25790 | Tesmin/TSO1-like CXC domain-containing protein;(source:Araport11) |
| AT1G16740 | Ribosomal protein L20;(source:Araport11) |
| AT5G57950 | 26S proteasome regulatory subunit;(source:Araport11) |
| AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G41979 | 5.8SrRNA |
| AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G34680 | pseudogene of maturase K;(source:Araport11) |
| AT1G41730 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.7e-253 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G63300 | Myosin heavy chain-related protein;(source:Araport11) |
| AT5G66631 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G03110 | protamine P1 family protein;(source:Araport11) |
| AT1G29465 | transmembrane protein;(source:Araport11) |
| AT2G44230 | hypothetical protein (DUF946);(source:Araport11) |
| AT2G10790 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G30320 | Remorin family protein;(source:Araport11) |
| AT3G44280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
| AT2G01870 | transmembrane protein;(source:Araport11) |
| AT2G44020 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G51420 | long-chain-alcohol O-fatty-acyltransferase family protein / wax synthase family protein;(source:Araport11) |
| AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
| AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G63980 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT1G70360 | F-box family protein;(source:Araport11) |
| AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT4G21366 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G01881 | transmembrane protein;(source:Araport11) |
| AT5G10210 | nitric oxide synthase-interacting protein;(source:Araport11) |
| AT4G16045 | TRAF-like superfamily protein;(source:Araport11) |
| AT5G38960 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G45520 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G55856 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G16680 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G61720 | hypothetical protein (DUF1216);(source:Araport11) |
| AT4G02140 | hypothetical protein;(source:Araport11) |
| AT1G26450 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT4G19930 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G25560 | CHY-type/CTCHY-type/RING-type Zinc finger protein;(source:Araport11) |
| AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
| AT1G19560 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT1G64330 | myosin heavy chain-like protein;(source:Araport11) |
| AT3G21660 | UBX domain-containing protein;(source:Araport11) |
| AT1G13490 | hypothetical protein (DUF1262);(source:Araport11) |
| AT5G20870 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G17495 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-213 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G44540 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
| AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
| AT5G52270 | SNARE-like superfamily protein;(source:Araport11) |
| AT3G21570 | proline-rich nuclear receptor coactivator;(source:Araport11) |
| AT3G42313 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.2e-227 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT2G16895 | pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G28030 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G06631 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G13432 | transmembrane protein;(source:Araport11) |
| AT2G21080 | Ras guanine nucleotide exchange factor K;(source:Araport11) |
| AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G15160 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.8e-86 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G48960 | Ribosomal protein L13e family protein;(source:Araport11) |
| AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
| AT1G51410 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G58610 | PHD finger transcription factor;(source:Araport11) |
| AT3G58230 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G10710 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to MURA transposase of maize Mutator transposon;(source:TAIR10) |
| AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G29120 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT5G35660 | Glycine-rich protein family;(source:Araport11) |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT3G14340 | hypothetical protein;(source:Araport11) |
| AT1G67270 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT1G13200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G29620 | dentin sialophosphoprotein;(source:Araport11) |
| AT3G43970 | hypothetical protein;(source:Araport11) |
| AT3G18670 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G02930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G15770 | RNA binding protein;(source:Araport11) |
| AT4G10925 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT2G07550 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-313 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G12100 | Cullin family protein;(source:Araport11) |
| AT5G47435 | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. |
| AT1G10455 | B3 DNA-binding domain protein;(source:Araport11) |
| AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT2G34930 | disease resistance family protein / LRR family protein;(source:Araport11) |
| AT3G01319 | hypothetical protein;(source:Araport11) |
| AT2G18190 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G15860 | plant self-incompatibility protein S1 family protein;(source:Araport11) |
| AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G32315 | Natural antisense transcript overlaps with AT2G32310;(source:Araport11) |
| AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G01008 | maternal effect embryo arrest protein;(source:Araport11) |
| AT5G29560 | caleosin-related family protein;(source:Araport11) |
| AT3G05150 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G42890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-10 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G29480 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.3e-232 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G27520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G05110 | Cystatin/monellin family protein;(source:Araport11) |
| AT3G21040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-20 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G63870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G43180 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT1G23770 | F-box family protein;(source:Araport11) |
| AT3G53640 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G03515 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT1G44707 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G22790 | hypothetical protein;(source:Araport11) |
| AT4G29710 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G14060 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G35375 | hypothetical protein;(source:Araport11) |
| AT4G03290 | EF hand calcium-binding protein family;(source:Araport11) |
| AT4G23860 | PHD finger protein-like protein;(source:Araport11) |
| AT2G19920 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT4G03030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G22080 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G19980 | hypothetical protein;(source:Araport11) |
| AT5G26200 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G05740 | FAM136A-like protein (DUF842);(source:Araport11) |
| AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
| AT3G49510 | F-box family protein;(source:Araport11) |
| AT2G38250 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G42150 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G30180 | hypothetical protein;(source:Araport11) |
| AT2G18140 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G51802 | Encodes a defensin-like (DEFL) family protein. |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G65180 | ENTH/VHS family protein;(source:Araport11) |
| AT5G47460 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G00525 | hypothetical protein;(source:Araport11) |
| AT3G22133 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10) |
| AT5G60250 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G23150 | hypothetical protein;(source:Araport11) |
| AT4G01260 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT5G10620 | methyltransferase;(source:Araport11) |
| AT5G42850 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G33251 | pseudogene of Beta-galactosidase related protein;(source:Araport11) |
| AT3G01030 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G42460 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05570.1);(source:TAIR10) |
| AT5G28053 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.3e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G76705 | calmodulin binding protein;(source:Araport11) |
| AT5G61180 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G46440 | PPR containing-like protein;(source:Araport11) |
| AT2G03410 | Mo25 family protein;(source:Araport11) |
| AT3G05130 | paramyosin-like protein;(source:Araport11) |
| AT1G34530 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G50080 | ribonuclease;(source:Araport11) |
| AT3G51580 | transmembrane protein;(source:Araport11) |
| AT5G57100 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT5G49770 | Leucine rich receptor kinase. |
| AT2G42930 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G68980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT3G30727 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-10 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT3G07860 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G39380 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT3G59250 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G46310 | WRKY family transcription factor;(source:Araport11) |
| AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT3G19410 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G32570 | hypothetical protein;(source:Araport11) |
| AT3G63040 | hypothetical protein;(source:Araport11) |
| AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT3G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G28160 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G19221 | Natural antisense transcript overlaps with AT5G19220;(source:Araport11) |
| AT2G30060 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT5G35926 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G26717 | Encodes a Plant thionin family protein |
| AT3G55930 | pre-mRNA-splicing factor;(source:Araport11) |
| AT5G13470 | hypothetical protein;(source:Araport11) |
| AT1G10705 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
| AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT3G14452 | transmembrane protein;(source:Araport11) |
| AT3G61170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G64540 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT3G24465 | Encodes a Plant thionin family protein |
| AT2G25220 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G51760 | hypothetical protein (DUF688);(source:Araport11) |
| AT2G42247 | Natural antisense transcript overlaps with AT2G42250;(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G33030 | O-methyltransferase family protein;(source:Araport11) |
| AT3G13205 | pseudogene of vacuolar protein sorting-associated protein |
| AT1G35465 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-27 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G09375 | pseudogene of eukaryotic initiation factor 4A-III;(source:Araport11) |
| AT5G62627 | Encodes a defensin-like (DEFL) family protein. |
| AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G64107 | Encodes a defensin-like (DEFL) family protein. |
| AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G62320 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT1G56470 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G09690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G05930 | B3 domain protein (DUF313);(source:Araport11) |
| AT3G49310 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G61035 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT5G48690 | ubiquitin-associated (UBA)/TS-N domain protein;(source:Araport11) |
| AT1G55604 | Pseudogene of AT1G26762 |
| AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G63225 | glycosyl hydrolase family protein 17 |
| AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT2G24791 | Pseudogene of AT5G18880; glucose transmembrane transporter |
| AT4G37110 | Zinc-finger domain of monoamine-oxidase A repressor R1;(source:Araport11) |
| AT2G06950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-243 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G25380 | pseudogene of zinc finger protein-related |
| AT3G29710 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G23480.1);(source:TAIR10) |
| AT1G48870 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
| AT4G05170 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G52110 | interferon-activable protein;(source:Araport11) |
| AT5G44990 | Glutathione S-transferase family protein;(source:Araport11) |
| AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G56360 | hypothetical protein;(source:Araport11) |
| AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT5G03452 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G13930 | Involved in response to salt stress. Knockout mutants are hypersensitive to salt stress. The mRNA is cell-to-cell mobile. |
| AT5G56400 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G79640 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G22065 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-09 P-value blast match to GB:AAB51275 reverse transcriptase, gag, polyprotein (Ty1_Copia-element) (Volvox carteri f. nagariensis);(source:TAIR10) |
| AT1G22080 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G28020 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G61710 | cotton fiber protein;(source:Araport11) |
| AT3G20730 | PPR superfamily protein;(source:Araport11) |
| AT2G24140 | myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G32140 | transmembrane receptor;(source:Araport11) |
| AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G14190 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.5e-177 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G08280 | Thioredoxin superfamily protein;(source:Araport11) |
| AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G13860 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G01130 | CBL-interacting Serine/Threonine-kinase;(source:Araport11) |
| AT2G06860 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT5G61445 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT3G55860 | hypothetical protein;(source:Araport11) |
| AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
| AT5G61370 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G55020 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
| AT5G50450 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G28630 | transcriptional regulator EFH1-like protein;(source:Araport11) |
| AT1G67520 | lectin protein kinase family protein;(source:Araport11) |
| AT1G18485 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT4G08032 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, similar to transposase, putative;(source:TAIR10) |
| AT3G19620 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT5G26080 | proline-rich family protein;(source:Araport11) |
| AT5G40410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G62950 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT3G45730 | hypothetical protein;(source:Araport11) |
| AT3G20890 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G25530 | AFG1-like ATPase family protein;(source:Araport11) |
| AT4G00225 | pseudogene of Major facilitator superfamily protein;(source:Araport11) |
| AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G50710 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G56560 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G65560 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT5G10950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT4G19006 | Proteasome component (PCI) domain protein;(source:Araport11) |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT4G23580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G43760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT2G02890 | F-box family protein;(source:Araport11) |
| AT1G54550 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
| AT5G35995 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G04520 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT3G41761 | other_RNA;(source:Araport11) |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G52610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.0e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G42470 | BRCA1-A complex subunit BRE-like protein;(source:Araport11) |
| AT5G25360 | hypothetical protein;(source:Araport11) |
| AT2G05115 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G05770 | hypothetical protein;(source:Araport11) |
| AT3G46540 | ENTH/VHS family protein;(source:Araport11) |
| AT3G30770 | Eukaryotic aspartyl protease family protein. Upregulated by cold. |
| AT4G32342 | hypothetical protein;(source:Araport11) |
| AT1G21560 | hypothetical protein;(source:Araport11) |
| AT5G62865 | hypothetical protein;(source:Araport11) |
| AT1G65010 | Encodes a microtubule-associated protein. Putative role in flower development. Comparison of SALK_061426C to Columbia wild type in normal lighting and under low light of 33 micromoles per meter-squared per second resulted in a trend toward earlier bolting in the mutant under low light (P=0.055) (Ann Stapleton and Patrick Pridgen, 2009, personal communication). |
| AT1G32880 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G06682 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-196 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G33399 | other_RNA;(source:Araport11) |
| AT3G04220 | Target of miR825/825. Mutants have decreased resistance to fungal pathogens. |
| AT1G21540 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G32640 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT3G25510 | disease resistance protein (TIR-NBS-LRR class) family protein;(source:Araport11) |
| AT4G38020 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G77020 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT3G09020 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT4G07720 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
| AT3G01350 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G57400 | transmembrane protein;(source:Araport11) |
| AT1G52440 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G60420 | phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G24200 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT3G10840 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G55520 | kinesin-like protein;(source:Araport11) |
| AT4G33590 | transmembrane protein;(source:Araport11) |
| AT5G28180 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G47330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
| AT3G30812 | pseudogene of lysyl-tRNA synthetase 1;(source:Araport11) |
| AT4G00780 | TRAF-like family protein;(source:Araport11) |
| AT4G31150 | endonuclease V family protein;(source:Araport11) |
| AT4G05592 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G41765 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT3G08943 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G45470 | IBR domain containing protein;(source:Araport11) |
| AT1G53330 | encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes. |
| AT2G18721 | hypothetical protein;(source:Araport11) |
| AT1G02020 | nitroreductase family protein;(source:Araport11) |
| AT4G36390 | Methylthiotransferase;(source:Araport11) |
| AT2G25730 | zinc finger FYVE domain protein;(source:Araport11) |
| AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G19850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G43726 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0703B11.15, blastp match of 44%25 identity and 1.3e-42 P-value to GP|18844826|dbj|BAB85296.1||AP003302 P0703B11.15 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT5G25310 | Exostosin family protein;(source:Araport11) |
| AT5G16640 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G29715 | pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G12211 | hypothetical protein;(source:Araport11) |
| AT1G49980 | DNA/RNA polymerases superfamily protein;(source:Araport11) |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT1G47940 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT2G04260 | pseudogene of P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT2G41150 | plant/protein;(source:Araport11) |
| AT1G28410 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT3G07000 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G55070 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G08740 | hypothetical protein;(source:Araport11) |
| AT4G05594 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G11300 | hypothetical protein;(source:Araport11) |
| AT4G02480 | AAA-type ATPase family protein;(source:Araport11) |
| AT3G22560 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G25475 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G57480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G62680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G17908 | pseudogene of ubiquitin-specific protease |
| AT3G31358 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.8e-151 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G03490 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT2G37370 | centrosomal protein of 135 kDa-like protein;(source:Araport11) |
| AT1G12080 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
| AT5G07610 | F-box family protein;(source:Araport11) |
| AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
| AT5G41730 | Protein kinase family protein;(source:Araport11) |
| AT2G47340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
| AT4G06748 | pseudogene of TSK-associating protein 1;(source:Araport11) |
| AT2G24110 | pseudogene of ribosomal protein S11-beta;(source:Araport11) |
| AT4G06708 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-289 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G05894 | hypothetical protein;(source:Araport11) |
| AT3G56520 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT4G04980 | hypothetical protein;(source:Araport11) |
| AT3G24730 | mRNA splicing factor, thioredoxin-like U5 snRNP;(source:Araport11) |
| AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT1G34500 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT2G40815 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
| AT3G30330 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.7e-83 P-value blast match to At1g36190.1/92-340 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G26150 | protein kinase family protein;(source:Araport11) |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT3G09162 | hypothetical protein;(source:Araport11) |
| AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G58960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G27050 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G46970 | pectin methylesterase inhibitor |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT3G62310 | RNA helicase family protein;(source:Araport11) |
| AT4G26542 | Natural antisense transcript overlaps with AT4G26540;(source:Araport11) |
| AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G24680 | transposable_element_gene;(source:Araport11);similar to zinc finger protein, putative [Arabidopsis thaliana] (TAIR:AT2G15520.1);(source:TAIR10) |
| AT5G18180 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
| AT4G31230 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G18840 | LOW protein: PPR containing-like protein;(source:Araport11) |
| AT2G19180 | hypothetical protein;(source:Araport11) |
| AT2G27790 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G59130 | Subtilase family protein;(source:Araport11) |
| AT4G03470 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G29590 | Thioesterase superfamily protein;(source:Araport11) |
| AT2G28790 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G02900 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G71370 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G73810 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
| AT1G24220 | paired amphipathic helix repeat-containing protein;(source:Araport11) |
| AT5G21080 | Uncharacterized protein;(source:Araport11) |
| AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G44925 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G29031 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G43745 | jacalin lectin-like protein;(source:Araport11) |
| AT1G10610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G62130 | AAA-type ATPase family protein;(source:Araport11) |
| AT1G22200 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
| AT1G68730 | Zim17-type zinc finger protein;(source:Araport11) |
| AT2G21560 | nucleolar-like protein;(source:Araport11) |
| AT5G04970 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT2G38570 | hypothetical protein;(source:Araport11) |
| AT2G34700 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G22440 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G22210 | aspartyl/glutamyl-tRNA (Asn/Gln) amidotransferase subunit B;(source:Araport11) |
| AT1G66660 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT1G69680 | ran guanine nucleotide release factor, putative (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein);(source:Araport11) |
| AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT1G35535 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-252 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G07190 | Lon protease;(source:Araport11) |
| AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G28080 | RING finger protein;(source:Araport11) |
| AT3G11415 | other_RNA;(source:Araport11) |
| AT3G23190 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT5G57760 | hypothetical protein;(source:Araport11) |
| AT1G68300 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G40080 | Mitochondrial ribosomal protein L27;(source:Araport11) |
| AT5G46200 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT3G28855 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G46720 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G35900 | Mal d 1-associated protein;(source:Araport11) |
| AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT5G32072 | pseudogene of Glucose-6-phosphate isomerase |
| AT1G77932 | FANTASTIC four protein, putative (DUF3049);(source:Araport11) |
| AT5G37475 | Translation initiation factor eIF3 subunit;(source:Araport11) |
| AT5G37430 | hypothetical protein (DUF577);(source:Araport11) |
| AT4G19110 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G34500 | transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G35950.1);(source:TAIR10) |
| AT2G30430 | hypothetical protein;(source:Araport11) |
| AT2G15325 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT1G32920 | hypothetical protein;(source:Araport11) |
| AT2G36650 | CHUP1-like protein;(source:Araport11) |
| AT1G73320 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G15022 | Natural antisense transcript overlaps with AT5G15030;(source:Araport11) |
| AT1G58050 | RNA helicase family protein;(source:Araport11) |
| AT4G14390 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G35382 | snoRNA;(source:Araport11) |
| AT1G01310 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT2G40680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G52065.1);(source:TAIR10) |
| AT2G16710 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT5G07600 | Oleosin family protein;(source:Araport11) |
| AT1G70120 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
| AT2G14730 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32621.1);(source:TAIR10) |
| AT3G23300 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G66860 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
| AT1G16480 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G66010 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT4G14650 | hypothetical protein;(source:Araport11) |
| AT4G33810 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G03063 | Pseudogene of AT4G03070; AOP1 (2-oxoglutarate-dependent dioxygenase 1.1); |
| AT1G52800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G16960 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT4G05260 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT2G21350 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT3G32383 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G32250 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G07510 | maternal effect embryo arrest protein;(source:Araport11) |
| AT2G05060 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G38490 | B3 domain protein (DUF313);(source:Araport11) |
| AT3G19595 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G22961 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT5G31770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.7e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G80580 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G32630 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, various predicted helicase proteins, Arabidopsis thaliana and others;(source:TAIR10) |
| AT4G10910 | hypothetical protein;(source:Araport11) |
| AT1G79190 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G24790 | AAA-type ATPase family protein;(source:Araport11) |
| AT1G73750 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT1G36495 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G20120 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G28560 | BCS1 AAA-type ATPase;(source:Araport11) |
| AT1G70030 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G32050 | hypothetical protein;(source:Araport11) |
| AT3G43358 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-69 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G26500 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G35570 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G05260 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G03670 | Ankyrin repeat containing protein |
| AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT5G54000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G25305 | Encodes a defensin-like (DEFL) family protein. |
| AT2G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G32980 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT2G27320 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G24340 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT5G22180 | hypothetical protein;(source:Araport11) |
| AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
| AT2G27730 | copper ion binding protein;(source:Araport11) |
| AT5G41780 | myosin heavy chain-like protein;(source:Araport11) |
| AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G60340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G17780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
| AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT5G35555 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-177 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G40050 | F-box/FBD-like domains containing protein;(source:Araport11) |
| AT3G42886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-89 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT2G10265 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 0.00012 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G15970 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT3G50560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G41620 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
| AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G18540 | transmembrane protein;(source:Araport11) |
| AT4G04404 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G63230 | senescence-associated-like protein (DUF581);(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT2G13830 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.4e-283 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G13620 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. The mRNA is cell-to-cell mobile. |
| AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
| AT5G32518 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.5e-246 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT1G65140 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G29150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G26320 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G69510 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
| AT1G76250 | transmembrane protein;(source:Araport11) |
| AT5G44040 | eisosome SEG2-like protein;(source:Araport11) |
| AT1G09870 | histidine acid phosphatase family protein;(source:Araport11) |
| AT5G22810 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G28690 | carboxylate clamp-TPR protein (DUF1685);(source:Araport11) |
| AT4G19500 | nucleoside-triphosphatase/transmembrane receptor/nucleotide binding/ATP binding protein;(source:Araport11) |
| AT4G24140 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G43010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G42053 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G17680 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
| AT5G44820 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G33800 | hypothetical protein;(source:Araport11) |
| AT2G29780 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT4G26055 | transmembrane protein;(source:Araport11) |
| AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
| AT1G14300 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G06860 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT3G58420 | TRAF-like superfamily protein;(source:Araport11) |
| AT2G39100 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30250 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G45220 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT5G02640 | hypothetical protein;(source:Araport11) |
| AT5G25210 | hypothetical protein;(source:Araport11) |
| AT3G01690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G19120 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
| AT4G22940 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G26850 | F-box family protein;(source:Araport11) |
| AT4G16330 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G52565 | cytochrome P450 family protein;(source:Araport11) |
| AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G36920 | B3 domain protein;(source:Araport11) |
| AT3G54070 | LOW protein: ankyrin repeat protein;(source:Araport11) |
| AT3G23740 | hypothetical protein;(source:Araport11) |
| AT2G14535 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-19 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G21580 | Ribosomal protein S25 family protein;(source:Araport11) |
| AT1G35660 | erythroid differentiation factor-like protein;(source:Araport11) |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT5G50310 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G43211 | hypothetical protein;(source:Araport11) |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G07550 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G17430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G15640 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT5G63900 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT2G13080 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
| AT1G51055 | FBD-like domain family protein;(source:Araport11) |
| AT2G24670 | B3 domain protein (DUF313);(source:Araport11) |
| AT1G12790 | DNA ligase-like protein;(source:Araport11) |
| AT3G20990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G65910 | BSD domain-containing protein;(source:Araport11) |
| AT1G66110 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G34842 | transposable_element_gene;(source:Araport11);non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT3G11673 | pseudogene of F-box family protein |
| AT1G54230 | Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT2G37000 | TCP family transcription factor;(source:Araport11) |
| AT3G43850 | hypothetical protein;(source:Araport11) |
| AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G16260 | Encodes a putative beta-1,3-endoglucanase that interacts with the 30C02 cyst nematode effector. May play a role in host defense. |
| AT4G04316 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 9.6e-40 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G28980 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
| AT5G49990 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT4G08910 | homeobox protein;(source:Araport11) |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G32130 | ER membrane protein complex subunit-like protein (DUF2012);(source:Araport11) |
| AT3G61420 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
| AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G07213 | Natural antisense transcript overlaps with AT2G07215;(source:Araport11) |
| AT3G51940 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G47790 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT5G49350 | Glycine-rich protein family;(source:Araport11) |
| AT5G42210 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G20350 | actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11) |
| AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
| AT4G06648 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-181 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G58430 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT5G44320 | Eukaryotic translation initiation factor 3 subunit 7 (eIF-3);(source:Araport11) |
| AT2G30830 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT2G10530 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-42 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT1G28180 | DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11) |
| AT2G07660 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.8e-303 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT4G18970 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT5G20050 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66920 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G32910 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G32230 | hypothetical protein;(source:Araport11) |
| AT2G21820 | seed maturation protein;(source:Araport11) |
| AT3G62529 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT1G13485 | hypothetical protein;(source:Araport11) |
| AT2G06080 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 38%25 identity and 7.7e-40 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT4G30830 | myosin-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT3G59000 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G05502 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-53 P-value blast match to Q9ZQK9 /304-464 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G58120 | hypothetical protein;(source:Araport11) |
| AT2G40590 | Ribosomal protein S26e family protein;(source:Araport11) |
| AT5G58410 | HEAT/U-box domain-containing protein;(source:Araport11) |
| AT1G03010 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT4G02090 | PADRE protein. |
| AT1G15410 | aspartate-glutamate racemase family;(source:Araport11) |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G37030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G27435 | fiber (DUF1218);(source:Araport11) |
| AT5G36190 | F-box protein interaction domain protein;(source:Araport11) |
| AT1G20210 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT2G40270 | Protein kinase family protein;(source:Araport11) |
| AT3G30885 | pseudogene of Glucose-6-phosphate/phosphate translocator-like protein;(source:Araport11) |
| AT3G56920 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G14770 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G15680 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G18180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
| AT1G62550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10) |
| AT2G20625 | hypothetical protein (DUF626);(source:Araport11) |
| AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G50390 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT4G33230 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G36470 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G10790 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G30020 | PA-domain containing subtilase family protein;(source:Araport11) |
| AT1G31920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G13000 | ubiquinone biosynthesis protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G08310 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G04380 | hypothetical protein;(source:Araport11) |
| AT1G68905 | Encodes a defensin-like (DEFL) family protein. |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT4G35025 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G13600 | calmodulin-binding family protein;(source:Araport11) |
| AT5G26100 | hypothetical protein;(source:Araport11) |
| AT5G27885 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.4e-260 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G46710 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G36110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G64540 | mucin-like protein;(source:Araport11) |
| AT5G44250 | peptidase, S9A/B/C family, catalytic domain protein (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
| AT2G37730 | glycosyltransferase (DUF604);(source:Araport11) |
| AT4G24610 | pesticidal crystal cry8Ba protein;(source:Araport11) |
| AT1G18550 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G24010 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G03364 | Pseudogene of AT4G05230; ubiquitin family protein |
| AT5G53635 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G27865 | snoRNA;(source:Araport11) |
| AT3G44060 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G12420 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G21480 | Exostosin family protein;(source:Araport11) |
| AT4G24977 | Pseudogene of AT4G24972; TPD1 (TAPETUM DETERMINANT 1) |
| AT1G68220 | aerobic coproporphyrinogen-III oxidase (DUF1218);(source:Araport11) |
| AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G42470 | TRAF-like family protein;(source:Araport11) |
| AT3G19320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G09940 | hypothetical protein (DUF1635);(source:Araport11) |
| AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G61750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G30872 | other_RNA;(source:Araport11) |
| AT4G19910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT5G01150 | hypothetical protein (DUF674);(source:Araport11) |
| AT1G41770 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G33064.1);(source:TAIR10) |
| AT3G16370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT1G43895 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT3G62070 | hypothetical protein;(source:Araport11) |
| AT5G11290 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT4G01570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G57500 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G21780 | hypothetical protein;(source:Araport11) |
| AT5G12260 | transferring glycosyl group transferase;(source:Araport11) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT1G74680 | Exostosin family protein;(source:Araport11) |
| AT3G11380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G11960 | Cleavage and polyadenylation specificity factor (CPSF) A subunit protein;(source:Araport11) |
| AT3G08680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G38900 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT4G06548 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G24250 | glycine-rich protein;(source:Araport11) |
| AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G34610 | cotton fiber protein;(source:Araport11) |
| AT1G34095 | hypothetical protein;(source:Araport11) |
| AT1G67035 | homeobox Hox-B3-like protein;(source:Araport11) |
| AT4G17210 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
| AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G48900 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G75260 | oxidoreductases, acting on NADH or NADPH;(source:Araport11) |
| AT3G45400 | exostosin family protein;(source:Araport11) |
| AT1G29080 | Papain family cysteine protease;(source:Araport11) |
| AT4G10613 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT1G03620 | ELMO/CED-12 family protein;(source:Araport11) |
| AT5G48385 | FRIGIDA-like protein;(source:Araport11) |
| AT3G49551 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT5G34728 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative myosin-like protein;(source:TAIR10) |
| AT4G02880 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT5G35070 | pseudogene of hypothetical protein;(source:Araport11) |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G26375 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT2G33180 | hypothetical protein;(source:Araport11) |
| AT3G46890 | maternal effect embryo arrest protein;(source:Araport11) |
| AT4G11000 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G74370 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT4G29680 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT5G15990 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G37880.1);(source:TAIR10) |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT2G44010 | hypothetical protein;(source:Araport11) |
| AT4G16095 | RNI-like superfamily protein;(source:Araport11) |
| AT1G56490 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G16905 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT3G46870 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G57020 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT5G49860 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G23480 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
| AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
| AT1G53180 | hypothetical protein;(source:Araport11) |
| AT4G06646 | transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1081_B12.13, blastp match of 33%25 identity and 9.8e-51 P-value to GP|27817864|dbj|BAC55632.1||AP003865 OJ1081_B12.13 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G52415 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G04100 | MATE efflux family protein;(source:Araport11) |
| AT4G15050 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G28469 | pseudogene of disease-resistance protein |
| AT3G59450 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G59690 | Histone superfamily protein;(source:Araport11) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G52750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT3G56810 | hypothetical protein;(source:Araport11) |
| AT3G02125 | pinin-like protein;(source:Araport11) |
| AT5G28285 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT1G60330 | pseudogene of Chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
| AT5G06440 | polyketide cyclase/dehydrase/lipid transport superfamily protein;(source:Araport11) |
| AT3G02370 | tRNA-splicing endonuclease subunit;(source:Araport11) |
| AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT4G18180 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G13480 | hypothetical protein (DUF1262);(source:Araport11) |
| AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT5G28468 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.9e-46 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G03120 | transmembrane protein;(source:Araport11) |
| AT1G57765 | transmembrane protein;(source:Araport11) |
| AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT5G45720 | AAA-type ATPase family protein;(source:Araport11) |
| AT1G55030 | RNI-like superfamily protein;(source:Araport11) |
| AT4G14780 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G67550 | transmembrane protein;(source:Araport11) |
| AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
| AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
| AT5G34835 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G05400 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT3G28315 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-224 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G06148 | hypothetical protein;(source:Araport11) |
| AT3G18900 | ternary complex factor MIP1 leucine-zipper protein;(source:Araport11) |
| AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
| AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G11950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-158 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G43900 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G38300 | homeobox Hox-B3-like protein;(source:Araport11) |
| AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT5G45990 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT1G56220 | Dormancy/auxin associated family protein;(source:Araport11) |
| AT3G19370 | filament-like protein (DUF869);(source:Araport11) |
| AT1G63600 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
| AT1G29700 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT3G01880 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT1G15790 | mediator of RNA polymerase II transcription subunit 15a-like protein;(source:Araport11) |
| AT5G03810 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G38810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G38570 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G25585 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
| AT1G68410 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G31390 | TRAF-like family protein;(source:Araport11) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G54460 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT2G14200 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-133 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G43770 | transposable_element_gene;(source:Araport11);similar to disease resistance protein (TIR-NBS-LRR class), putative [Arabidopsis thaliana] (TAIR:AT5G45230.1);(source:TAIR10) |
| AT2G32235 | hypothetical protein;(source:Araport11) |
| AT1G28100 | hypothetical protein;(source:Araport11) |
| AT4G30670 | Putative membrane lipoprotein;(source:Araport11) |
| AT1G53550 | F-box family protein;(source:Araport11) |
| AT3G01920 | DHBP synthase RibB-like alpha/beta domain-containing protein;(source:Araport11) |
| AT3G48209 | Encodes a Plant thionin family protein |
| AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G35130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G09130 | hypothetical protein;(source:Araport11) |
| AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G06350 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G13274 | Pseudogene of AT2G13150; transcription factor |
| AT4G15150 | glycine-rich protein;(source:Araport11) |
| AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT5G48740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G43880 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G40116 | Phosphoinositide-specific phospholipase C family protein;(source:Araport11) |
| AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT3G04560 | nucleolar/coiled-body phosphoprotein;(source:Araport11) |
| AT1G79030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G20720 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G27990 | transmembrane protein;(source:Araport11) |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G36791 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G62380 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G80140 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
| AT5G52880 | F-box family protein;(source:Araport11) |
| AT3G56870 | hypothetical protein;(source:Araport11) |
| AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT4G25180 | RNA polymerase III RPC4;(source:Araport11) |
| AT3G11350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G23970 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G65925 | hypothetical protein;(source:Araport11) |
| AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
| AT4G39900 | adenine deaminase;(source:Araport11) |
| AT1G02700 | GATA transcription factor-like protein;(source:Araport11) |
| AT1G76870 | transcription factor;(source:Araport11) |
| AT3G32930 | Protein of unknown function. Locus is correlated with bacterial hypersensitive response, expression is reduced after injection with avrRpm1. |
| AT2G38580 | Mitochondrial ATP synthase D chain-related protein;(source:Araport11) |
| AT1G54955 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05145.1);(source:TAIR10) |
| AT3G09760 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G17200 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G57970 | Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein;(source:Araport11) |
| AT2G26790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G14360 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G04690 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G53705 | putative aminoacyl-tRNA ligase;(source:Araport11) |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G45380 | myeloid leukemia factor;(source:Araport11) |
| AT1G67190 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G27790 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT1G54770 | Fcf2 pre-rRNA processing protein;(source:Araport11) |
| AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT3G62620 | Encodes a protein of unknown function. Previously this protein has been annotated computationally as a sucrose-phosphatase-related protein. However, the source of this annotation can not be verified. This annotation (sucrose-phosphatase-related) has been removed. |
| AT1G42490 | pseudogene of glutamate dehydrogenase 2;(source:Araport11) |
| AT4G02715 | flocculation FLO11-like protein;(source:Araport11) |
| AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G27680 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT4G06633 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G17265 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G62780 | dimethylallyl, adenosine tRNA methylthiotransferase;(source:Araport11) |
| AT3G27050 | plant/protein;(source:Araport11) |
| AT5G65274 | ARP2/3 complex 16 kDa subunit (p16-Arc);(source:Araport11) |
| AT3G19480 | Encodes a stromal phosphoglycerate dehydrogenase with a high NAD(H)-specificity that is active in photosynthesizing chloroplasts and draws its substrate 3-PGA directly from the Calvin-Benson-Bassham cycle. |
| AT5G42090 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT2G24530 | Member of SAGA complex, SPT modulu subunit, interacts with HAG1. |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT5G21030 | PAZ domain-containing protein / piwi domain-containing protein;(source:Araport11) |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT4G32200 | meiotic asynaptic mutant 2, homologue of ASY1 |
| AT4G13980 | member of Heat Stress Transcription Factor (Hsf) family |
| AT1G24140 | Expression induced by fungal and bacterial pathogens. |
| AT1G34575 | FAD-binding Berberine family protein;(source:Araport11) |
| AT2G34810 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20860 | involved in the generation of H2O2 from reduced compounds |
| AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G66810 | Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis. |
| AT3G06010 | Encodes AtCHR12, a SNF2/Brahma-type chromatin-remodeling protein. AtCHR12 mediates temporary growth arrest in Arabidopsis upon perceiving environmental stress. |
| AT1G08150 | member of Putative Na+/H+ antiporter family |
| AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT4G21300 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G17780 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
| AT1G76410 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G55450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
| AT3G05830 | Encodes alpha-helical IF (intermediate filament)-like protein.NEAP1 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT3G47980 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT3G14300 | pectinesterase family protein;(source:Araport11) |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
| AT3G23660 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT3G05840 | Glycogen synthase kinase-3 member which encodes a SHAGGY-like kinase involved in meristem organization. Regulates flowering through mediating CONSTANS stability. |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT4G36690 | Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65b. |
| AT5G44380 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT4G00870 | bHLH14 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH17 to negatively regulate jasmonate responses. |
| AT3G24100 | Encodes a secreted peptide that enhances stress indued cell death. |
| AT5G40880 | Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1. |
| AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
| AT4G34430 | Member of a small family of SWI3-like genes in Arabidopsis. Referred to as CHB4 in Zhou et al. (2002). |
| AT4G18480 | Encodes the CHLI subunit of magnesium chelatase which is required for chlorophyll biosynthesis. All four cysteine residues of the protein form two disulfide bonds (Cys102-Cys193 and Cys354-Cys396) under oxidized conditions but are fully reduced by reduction. It was suggested that the redox state of CHLI is regulated in vivo by the change of the redox environment in the chloroplasts probably via the Trx system. |
| AT4G31810 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G04030 | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response and crucial for protein import into the chloroplast stroma. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
| AT2G29720 | Encodes CTF2B. |
| AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT4G31450 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G37150 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G46390 | C-terminal peptidase |
| AT1G64620 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT5G18400 | Cytosolic Iron-sulfur cluster Assembly protein. |
| AT1G47530 | MATE efflux family protein;(source:Araport11) |
| AT5G65750 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
| AT4G26910 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
| AT2G35615 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G76810 | eukaryotic translation initiation factor 2 (eIF-2) family protein;(source:Araport11) |
| AT3G02030 | transferase;(source:Araport11) |
| AT4G09640 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT5G04670 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT1G55290 | encodes a protein whose sequence is similar to oxidoreductase, 2OG-Fe(II) oxygenase |
| AT1G53290 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G32470 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT3G11600 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations. |
| AT1G13120 | nucleoporin GLE1-like protein;(source:Araport11) |
| AT1G12230 | Aldolase superfamily protein;(source:Araport11) |
| AT2G31250 | Glutamyl-tRNA reductase family protein;(source:Araport11) |
| AT5G24580 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G08570 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G10465 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
| AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT3G48870 | Encodes a nuclear encoded protein with similarity to Clpa regulatory subunit of CLP protease complex. The protein is localized to the chloroplast stroma. May function redundantly with TIC complex in chloroplast protein import. |
| AT2G28720 | Histone superfamily protein;(source:Araport11) |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT1G49620 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle. |
| AT5G24360 | IRE1A and IRE1B catalyze bZIP60 mRNA splicing, producing the active bZIP60 transcription factor. |
| AT1G09060 | JMJ24 is a nuclear localized JmjC domain containing protein. It has been shown to bind to transcribed regions AtSN1 and solo LTR and the promoter of SDC. JMJ24 appears to regulate basal levels of transcription of silenced loci in part by controlling methylation in heterochromatic regions. |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT3G08960 | Ran effector. |
| AT3G50240 | Encodes a kinesin-related protein. |
| AT3G23670 | Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT4G15093 | catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11) |
| AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT1G19260 | Encodes a ceramide synthase that uses very-long- chain fatty acyl-CoA and trihydroxy LCB substrates. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT4G29540 | Encodes a UDP-N-acetylglucosamine acyltransferase. |
| AT1G32080 | Encodes a plant LrgAB/CidAB protein localized to the chloroplast envelope that is involved in chloroplast development, carbon partitioning, ABA/drought response, and leaf senescence. The gene may have evolved from gene fusion of bacterial lrgA and lrgB. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT1G11090 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G55180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
| AT1G56380 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G70000 | Encodes a MYB-like Domain transcription factor that plays a positive role in anthocyanin accumulation in response to light and cytokinin via repression of MYBL2.MYBD expression increased in response to light or cytokinin, and MYBD enhanced anthocyanin biosynthesis via the repression of MYBL2 encoding for a transcription factor that had a negative effect on this process. In addition, MYBD can bind in vivo to the MYBL2 promoter and a lower level of histone H3K9 acetylation (H3K9ac) at upstream region of MYBL2 in MYBD-OX in comparison to wild-type plants, implies that MYBD represses MYBL2 expression via an epigenetic mechanism. |
| AT1G49010 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT3G15950 | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
| AT5G19640 | Influences leaf N export via sink-to-source feedback, perhaps via a role in sensing plant internal N-status. Necessary for normal leaf N export under low N. |
| AT1G73600 | Encodes a S-adenosyl-L-methionine-dependent phosphoethanolamine N-methyltransferase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. It catalyzes the three sequential P-base methylation of phosphoethanolamine to phosphocholine. Homologous biochemical function to NMT1 (At3g18000). Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
| AT1G06560 | NOL1/NOP2/sun family protein;(source:Araport11) |
| AT3G45630 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G38100 | Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos. |
| AT1G67900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G11475 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10. |
| AT3G52090 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB11 and the E. oli RNA polymerase alpha subunit. |
| AT5G09920 | Non-catalytic subunit specific to DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB4) |
| AT2G04630 | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940. |
| AT3G22900 | Non-catalytic subunit specific to DNA-directed RNA polymerase IV; homologous to budding yeast RPB7 |
| AT1G76940 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G60980 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT3G14590 | Ca2+-dependent lipid-binding protein |
| AT4G12720 | Encodes a protein with ADP-ribose hydrolase activity. Negatively regulates EDS1-conditioned plant defense and programmed cell death. |
| AT2G05120 | Nucleoporin, Nup133/Nup155-like protein;(source:Araport11) |
| AT1G24310 | nuclear pore complex protein;(source:Araport11) |
| AT1G32090 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT3G22640 | cupin family protein;(source:Araport11) |
| AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT4G31880 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
| AT3G27110 | PGM48 is a member of a plant specific clade of metallo-endopeptidase proteins. It is found in plastoglobules. Analysis of over-expression and loss of function phenotypes suggests PGM48 may have a role in positively regulating senescence. |
| AT5G12150 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
| AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT5G54430 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
| AT4G11810 | Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
| AT4G25940 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G25240 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT1G14686 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT3G28210 | Encodes a putative zinc finger protein (PMZ). |
| AT5G11560 | catalytics;(source:Araport11) |
| AT5G41880 | DNA primase POLA3;(source:Araport11) |
| AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G22420 | Encodes a cell wall-localized class III peroxidase that is directly regulated by the MADS-box transcription factor AGL15 and is involved in lignified tissue formation. |
| AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT2G23830 | PapD-like superfamily protein;(source:Araport11) |
| AT1G22700 | Encodes a TPR protein with homology to Ycf37 from Synechocystis that is localized to the thylakoid membrane and is involved in photosystem I biogenesis. |
| AT5G26667 | encodes a uridine 5'-monophosphate (UMP)/cytidine 5'-monophosphate (CMP) kinase. The mRNA is cell-to-cell mobile. |
| AT5G20850 | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation. Also involved in defense gene transcription during plant immune responses. |
| AT3G08850 | Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutants show embryo lethal phenotype which occurs at pre-globular stage. May interact with TOR kinase in a rapamycin like signaling pathway. Interacts with TOR and S6K1 in vivo. Overexpression of RAPTOR1 rendered the S6K1 osmotic stress insensitive. |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT1G16590 | putative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT3G24240 | RGFR1 is a leucine--rich repeat receptor kinase that, together with RGFR2 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT5G48940 | RGFR2 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT2G33680 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G08050 | Encodes a grana core localized protein. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
| AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
| AT1G22670 | Protease-associated (PA) RING/U-box zinc finger family protein;(source:Araport11) |
| AT5G18600 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT5G11930 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT5G45400 | Replication factor-A protein 1-like protein;(source:Araport11) |
| AT1G58370 | Encodes a protein with xylanase activity. |
| AT1G58430 | Encodes an anther-specific proline-rich protein. |
| AT5G64000 | 3'(2'),5'-bisphosphate nucleotidase |
| AT2G47820 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
| AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
| AT4G38490 | transmembrane protein;(source:Araport11) |
| AT1G78880 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
| AT1G69220 | Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion. |
| AT5G18290 | Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER |
| AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G23090 | Encodes AST91 mRNA for sulfate transporter. |
| AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G73140 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
| AT3G16160 | TCX8 is a transcriptional regulatory protein. It binds the LOX2 promoter and represses its expression. |
| AT1G24706 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. Mutations in THO have severe developmental defects and affect the production of several different classes of small RNAs indicating a broader role in small RNA biosynthesis. |
| AT1G55900 | component of a translocase in the mitochondrial inner membrane |
| AT3G04210 | TN13 is a TIR-NBS protein involved in immune response. It co localizes with the ER and perinuclear membranes and interacts with MOS6. It also associates with the CC-NBS-LRR resistance protein RPS5 and contributes to RPS5-triggered immunity. |
| AT5G15510 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT1G78010 | tRNA modification GTPase;(source:Araport11) |
| AT4G27570 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
| AT1G61180 | Coiled-coil nucleotide-binding leucine-rich-repeat protein involved in disease resistance. |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT5G04920 | EAP30/Vps36 family protein;(source:Araport11) |
| AT3G19770 | Guanine nucleotide exchange factor VPS9a. Can activate all Rab5 members to GTP-bound forms in vitro. Required for embryogenesis. Regulates the localization of ARA7 and ARA6. Involved in postembryonic root development. |
| AT4G18600 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT1G54560 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
| AT3G58160 | Class XI myosin gene expressed in flowers from 4-6 week old plants and leaves from 3 week old plants |
| AT1G58380 | Ribosomal protein S5 family protein;(source:Araport11) |
| AT5G58060 | Constitutively expressed SNARE protein of the YKT6 family. |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT1G21430 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
| AT3G60580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G67470 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G44318 | Aldolase superfamily protein;(source:Araport11) |
| AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
| AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT1G74040 | Encodes an active Arabidopsis isopropylmalate synthase IPMS2. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS2 can be compensated by a second isopropylmalate synthase gene IPMS1 (At1g18500). |
| AT4G28470 | encoding the RPN subunits of the 26S proteasome |
| AT4G03415 | Encodes a myristoylated 2C-type protein phosphatase that interacts with AGB1 and is localized to the plasma membrane. |
| AT5G04510 | Encodes 3-phosphoinositide-dependent protein kinase that contains pleckstrin homology domain and binds 3-phosphoinositides. It activates the protein kinase AGC2-1 in a phosphatidic acid dependent manner. Phosphorylates S6K1. Interacts with PID, and transphosphorylation by PDK1 increases PID autophosphorylation. The mRNA is cell-to-cell mobile. |
| AT3G10540 | master regulator of AGC kinases |
| AT5G48880 | Encodes a peroxisomal 3-keto-acyl-CoA thiolase 2 precursor. EC2.3.1.16 thiolases. AT5G48880.1 is named PKT1 and AT5G48880.2 is named PKT2. |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT4G34250 | Encodes KCS16, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT4G34510 | Encodes KCS17, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G15090 | Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
| AT4G11080 | Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT5G11920 | Encodes a protein with fructan exohydrolase (FEH) activity acting on both inulin and levan-type fructans (1- and 6-FEH). The enzyme does not have invertase activity. |
| AT3G02360 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT5G24420 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT5G40010 | Encodes a mitochondrial ATPase involved in seed and silique development. |
| AT5G04895 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT4G11690 | Encodes ABO8, a pentatricopeptide repeat (PPR) protein responsible for the splicing of NAD4 intron 3 in mitochondrial complex I. Abo8 mutants accumulate more reactive oxygen species (ROS) in root tips than the wild type. |
| AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
| AT5G63350 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G46510 | Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses. |
| AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
| AT2G20300 | Encodes ABNORMAL LEAF SHAPE 2 (ALE2), a receptor-like protein kinase (RLK) with a cluster of basic amino acid residues followed by a cysteine-containing sequence in the putative extracellular domain. Function together with ACR4 (Arabidopsis homolog of the Crinkly4) and ALE1 in positively regulating protoderm-specific gene expression and for the formation of leafy organs. ale2 mutants have various epidermal defects, including disorganization of epidermis-related tissues, defects in the leaf cuticle and the fusion of organs. |
| AT1G62340 | Subtilisin-like serine protease required for epidermal surface formation in embryos and juvenile plants |
| AT1G62380 | Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene. |
| AT5G48230 | Encodes an acetoacetyl-CoA thiolase that generates the bulk of the acetoacetyl-CoA precursor needed for the cytosolic localized, mevalonate-derived isoprenoids biosynthetic pathway. Loss-of-function mutants are embryo lethal. |
| AT5G35360 | Encodes biotin carboxylase subunit (CAC2). |
| AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
| AT2G26400 | Encodes a protein predicted to belong to the acireductone dioxygenase (ARD/ARD?)family. |
| AT5G59370 | Encodes one of eight Arabidopsis actins. ACT4 belongs to the reproductive actin subclass which is predominantly expressed in developing and reproductive tissues, such as pollen, pollen tubes, ovules, and developing seeds. Expression of the ACT4/GUS fusion was restricted to young vascular tissues, tapetum, and developing and mature pollen. |
| AT3G60830 | Encodes an actin-related protein required for normal embryogenesis, plant architecture and floral organ abscission. |
| AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
| AT5G53470 | Encodes an acyl-CoA binding protein that is localized to vesicles,and plasma membrane especially in epidermal cells of heart, torpedo and cotyledon stage embryos, cell wall of the seed coat. Northern blot analysis showed that the 1.4 kb ACBP1 mRNA was expressed in silique, root, stem, leaf and flower. |
| AT4G27780 | Encodes acyl-CoA-binding protein with ankyrin repeats The mRNA is cell-to-cell mobile. |
| AT1G62940 | encodes an acyl-CoA synthetase, has in vitro activity towards medium- to long-chain fatty acids and their hydroxylated derivatives. Expressed in the tapetum. Involved in pollen wall exine formation. Null mutants were devoid of pollen grains at anther maturity and were completely male sterile. |
| AT1G31730 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT4G24550 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT2G47420 | Encodes a putative rRNA dimethyltransferase. |
| AT2G37250 | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth |
| AT3G09820 | Involved in the salvage synthesis of adenylates and methyl recycling |
| AT1G05610 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS2 is a minor small subunit isoform present in all plant tissues tested. |
| AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT5G27050 | AGAMOUS-like 101;(source:Araport11) |
| AT5G37415 | Encodes a MADS-box gene AGL105 (AGAMOUS-LIKE 105). Note that previous reports (Plant Cell 2003,15:1538; PNAS 2003, 100:13407) have incorrectly named AT5G37420 as AGL105. Current nomenclature is based on Plant Cell 2003, 15:1538 where the GenBank accession number given for AGL105 is AY141227 (Supplemental Table 3), which corresponds to AT5G37415. |
| AT3G57390 | encodes a MADS-box containing protein likely to be a transcription factor that is expressed in endosperm and developing gametophytes. The protein sequence is most similar to that of AGL15, which is expressed in developing embryos. |
| AT1G01530 | AGAMOUS-like 28;(source:Araport11) |
| AT1G65300 | Encodes PHERES2, a homolog of PHERES1. PHERES1 and PHERES2 are both target genes of the FIS Polycomb group complex but only PHERES1 is regulated by genomic imprinting, which is likely caused by the presence of repeat sequences in the proximity of the PHERES1 locus. |
| AT1G59810 | AGL50 MADS box gene. |
| AT1G77950 | Cooperates with the histone mark reader EBS to modulate seed germination under high temperature. |
| AT5G38620 | MADS-box transcription factor family protein;(source:Araport11) |
| AT5G49420 | MADS-box transcription factor family protein;(source:Araport11) |
| AT1G31640 | A paternally expressed imprinted gene. |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
| AT5G04640 | AGAMOUS-like 99;(source:Araport11) |
| AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT3G66658 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT5G20960 | Encodes aldehyde oxidase AA01. |
| AT2G37760 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including aliphatic and aromatic aldehydes and steroids. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
| AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
| AT1G23740 | AOR is an alkenal/one oxidoreductase that acts on compounds with unsaturated alpha,beta-carbonyls. The activity of this enzyme with a number of substrates, including acrolein and 3-buten-2-one, was demonstrated in vitro using a truncated form of the protein that lacked approximately 80 of the first amino acids. This protein appears to localize to the chloroplast where it likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT1G69830 | Encodes a plastid-localized α-amylase. Expression is reduced in the SEX4 mutant. Loss of function mutations show normal diurnal pattern of starch accumulation/degradation. Expression follows circadian rhythms. |
| AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT3G56310 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT1G51590 | Encodes an alpha-mannosidase I enzyme responsible for N-glycan maturation. |
| AT1G62020 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. Required for the acceptance of compatible pollen. |
| AT1G79430 | Encodes gene product that is required for several aspects of phloem development in the root: (1) the specific divisions organizing the phloem pole, (2) sieve element differentiation and (3) the expression of a companion-specific gene. Mutant has a defect in the organization of phloem poles in the root. apl seedlings have a short, determinate root with only occasional lateral branches. |
| AT1G68370 | DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins. |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
| AT1G25480 | Encodes a phosphorylation-dependent anion channel that can mediate malate release from the vacuole and is required for stomatal closure in response to abscisic acid. |
| AT1G77380 | Amino acid permease which transports basic amino acids. |
| AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
| AT5G04930 | Encodes a putative aminophospholipid translocase (p-type ATPase) involved in chilling response. It is targeted to the plasma membrane following association in the endoplasmic reticulum with an ALIS protein beta-subunit. The mRNA is cell-to-cell mobile. |
| AT1G54280 | Encodes a member of the P4 subfamily of P-type ATPases expressed in the pollen plasma membrane. Double mutants with ALA7 display pollen and pollen tube defects. |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
| AT2G38760 | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT4G28395 | related to lipid transfer proteins |
| AT5G01310 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
| AT5G18280 | Encodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY1 causes a complete inhibition of pollen germination. |
| AT5G60340 | Encodes a nuclear adenylate kinase that interacts with a putative homolog of Rps14, AtRPS14-1 and affects the elongation of cells in the stem. |
| AT1G13330 | Encodes the Arabidopsis Hop2 homologue. In other species, Hop2 is proposed to be involved in inter-homolog bias in double strand break repair. |
| AT3G54020 | Inositol phosphorylceramide synthase |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT1G49220 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G74410 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47560 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G49210 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G33565 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46493 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT5G24330 | Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR6 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. |
| AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
| AT1G68725 | AGP19 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP18, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers. Non-consensus splice site at the intron:exon boundary (AT:exon) |
| AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
| AT1G35230 | Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile. |
| AT1G59980 | ARG1-like 2;(source:Araport11) |
| AT2G46610 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT1G31290 | ARGONAUTE 3;(source:Araport11) |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT2G31760 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G31780 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
| AT5G63750 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G63730 | Encodes ARIADNE14 (ARI14), a putative ubiquitin E3 ligase. ARI14 and an inversely transcribed gene KPL generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT5G08730 | IBR domain-containing protein;(source:Araport11) |
| AT1G65430 | IBR domain-containing protein;(source:Araport11) |
| AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G13060 | Encodes a novel Armadillo BTB protein that intreacts with the pre-replication complex and several transcription factors. Overexpression results in decreased cell proliferation and loss of function results in increased cell proliferation suggesting a role in negative regulation of cellular proliferation. |
| AT1G01950 | Encodes a member of the armadillo/beta-catenin repeat kinesin motor family. Mutants have twisted roots due to abnormal cell file rotation; the phenotype is dependent on microtubules. |
| AT1G12430 | Encodes the kinesin-like protein PAK has an Armadillo motif tail and is involved in guard cell development in Arabidopsis (from Genbank record AF159052).However, no defect in stomatal complexes has been observed in loss of function mutations. It accumulates at the preprophase band (PPB) in a cell-cycle and microtubule-dependent manner and is most highly expressed in cells where the placement of the division plane (early embryogenesis, stomatal lineages) is critical. |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G32320 | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
| AT5G66870 | Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination. |
| AT3G61310 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G25320 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G51590 | Member of the 29 AT-hook family TFs involved in the development of root xylem. |
| AT1G76500 | Encodes an AT hook domain containing protein. Identified in a screen of activation tagged lines that suppress the long-hypocotyl phenotype of a weak phyB allele. Affects cell elongation in the hypocotyl and leaves.Acts redundantly with ESC to modulate hypocotyl growth inhibition in response to light |
| AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
| AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
| AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
| AT5G61690 | ABC2 homolog 15;(source:Araport11) |
| AT3G47770 | ABC2 homolog 5;(source:Araport11) |
| AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT4G01820 | member of MDR subfamily |
| AT5G46540 | P-glycoprotein 7;(source:Araport11) |
| AT1G30410 | member of MRP subfamily |
| AT3G62700 | member of MRP subfamily |
| AT4G30300 | member of NAP subfamily |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G21090 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G55100 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin. |
| AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
| AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
| AT1G19800 | Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
| AT1G56310 | DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation. |
| AT2G03200 | Atypical aspartic protease which modulates lateral root development. |
| AT3G21180 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT3G18770 | Autophagy protein. |
| AT5G50230 | autophagy-related (ATG) gene |
| AT4G30790 | Encodes autophagy-related 2 (ATG11) |
| AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT2G46530 | auxin response factor 11;(source:Araport11) |
| AT3G61830 | auxin response factor 18;(source:Araport11) |
| AT5G60450 | Encodes a member of the ARF family of transcription factors which mediate auxin responses. ARF4 appears to have redundant function with ETT(ARF3) in specifying abaxial cell identity. |
| AT3G26810 | Auxin F box protein, the dominant auxin receptor in roots. |
| AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G16270 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT5G15160 | BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT1G61720 | Negative regulator of flavonoid biosynthesis, mutants accumulate flavonoid pigments in their seed coat, putative oxidoreductase. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
| AT4G20270 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile. |
| AT4G36060 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G25710 | Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein. |
| AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G40620 | Basic leucine zipper transcription factor. Localizes from cytoplasm to the nucleus under heat stress. |
| AT2G21230 | bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1. |
| AT3G56660 | basic region/leucine zipper motif protein 49;(source:Araport11) |
| AT3G60080 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT1G75430 | BEL1-like homeodomain 11;(source:Araport11) |
| AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
| AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
| AT1G52400 | encodes a member of glycosyl hydrolase family 1, located in inducible ER bodies which were formed after wounding, required in inducible ER body formation The mRNA is cell-to-cell mobile. |
| AT5G16580 | beta glucosidase 2;(source:Araport11) |
| AT4G22100 | beta glucosidase 2;(source:Araport11) |
| AT2G44470 | beta glucosidase 29;(source:Araport11) |
| AT5G24540 | beta glucosidase 31;(source:Araport11) |
| AT1G61820 | beta glucosidase 46;(source:Araport11) |
| AT1G60260 | beta glucosidase 5;(source:Araport11) |
| AT5G46690 | beta HLH protein 71;(source:Araport11) |
| AT2G32290 | beta-amylase 6;(source:Araport11) |
| AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
| AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
| AT1G05590 | Encodes a protein with β-hexosaminidase activity (the enzyme is active with p-nitrophenyl-β-N-acetylglucosaminide as substrate but displayed only a minor activity toward p-nitrophenyl-β-N-acetylgalactosaminide). Chitotriose-PA was digested almost completely overnight by a 50% ammonium sulfate fraction of a supernatant yeast expressing AtHEX3. |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT3G02260 | Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance. |
| AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT4G35380 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT5G04430 | Gene model AT5G04430.1 produces active protein. (BTS1S). Binds to ToMV genomic RNA and prevents viral multiplication. |
| AT4G30825 | P-class pentatricopeptide repeat (PPR) protein essential for accumulation of the dicistronic atpH/F transcript in chloroplasts. Acts as barrier to prevent the atpH/F transcript degradation by exoribonucleases by binding to the consensus sequence of the atpF-atpA intergenic region. |
| AT4G13590 | Chloroplast manganese transporter required for chloroplast manganese homeostasis and photosynthetic function. |
| AT2G30330 | Putative homolog of mammalian BLOC-1 Subunit 1. Protein - protein interaction with BLOS2 and also with SNX1.Located in endomembrane system and hypothesized to be involved in endomembrane transport. |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G64670 | Encodes a epidermally expressed extracellular protein that likely functions as an alpha-beta hydrolase and is required for normal cuticle formation. Homozygous mutant plants are dwarfed and have abnormal leaves, collapsed cells, reduced numbers of trichomes. The specific role of BDG is unclear: it may function in cutin biosynthesis or as a cross-linking enzyme in the cell wall itself. |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Mutants exhibit temperature-sensitive growth defects and increased hypersensitive response where permissive conditions are low temperature (22 degrees Celsius) and low humidity. Gene is expressed at 22 but not at 28 (restrictive condition) degrees. Lethality of double mutants with BON3 can be partially suppressed by SNC1. Double mutants show defects in development that are genetically separable from hypersensitive/cell death response. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT2G39660 | Encodes a plasma membrane-localized ser/thr protein kinase that is a crucial component of host response signaling required to activate the resistance responses to Botrytis and A. brassicicola infection. It is likely a negative regulator of salicylic acid accumulation and basal defense against virulent bacterial pathogens. Together with ER plays opposing roles in leaf morphogenesis and inflorescence architecture. Required to maintain appropriate auxin response during leaf margin morphogenesis. Interacts with ER-family proteins and directly phosphorylates ER. |
| AT1G27690 | lipase, putative (DUF620);(source:Araport11) |
| AT5G11400 | Psuedokinase that appears to produce a truncated (42AA protein) in Col-0 reference genome. Full length transcripts have been identified in Hh-0, Västervik and Dju-1 ecotypes. |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT5G38970 | Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized. |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT5G46570 | Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G21070 | Encodes AtBRCA1, an ortholog of the human breast cancer susceptibility gene 1. Contains one N-terminal RING finger, two C-terminal BRCT and the p300/CBP interacting domain. Strongly induced by gamma rays, consistent with a putative role in DNA repair and in cell cycle control. |
| AT1G31880 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. BRX encodes a key regulator of cell proliferation and elongation in the root, which has been implicated in the brassinosteroid (BR) pathway as well as regulation of auxin-responsive gene expression. Also involved in cytokinin-mediated inhibition of lateral root initiation. A loss-of-function allele, named brx-2 in Rodrigues et al. (2009) Plant Physiol. but changed to brx-3 to resolve nomenclature conflict (Li et al. Planta 2009:229(3):593-603), shows enhanced response to ABA-mediated inhibition of root growth. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with PAX, thereby timing PPSE differentiation. Dampens PIN-mediated auxin efflux. |
| AT1G55610 | mutant has Altered vascular cell differentiation; LRR Receptor Kinase |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
| AT3G13380 | Similar to BRI, brassinosteroid receptor protein. |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G18910 | E3 ubiquitin ligase that functions redundantly in the root with BTSL1 to negatively regulate iron uptake. |
| AT2G40400 | Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development. |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT1G31870 | Ortholog of yeast BUD13 RES complex protein. Functions in pre mRNA processing of RNAs expressed in embryos. |
| AT5G04480 | Encodes a protein with sequence similarity to glycosyltransferases that is localized to the golgi apparatus and is involved in pollen tube development. |
| AT3G48250 | Encodes a pentatricopeptide repeat protein implicated in splicing of intron 1 of mitochondrial nad7 transcripts. |
| AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT3G19600 | Encodes a Ser-2-specific RNAPII CTD phosphatase with two tandem-repeated CTD phosphatase domains that belongs to the group III CTD phosphatase-like (CPL) family. It positively regulates ABA and drought responses. |
| AT1G29290 | Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2. |
| AT5G66815 | Counteracts auxin effects by stabilizing AUX/IAA transcriptional repressors. Impact on abiotic stress processes. |
| AT1G72180 | Encodes a leucine-rich repeat receptor kinase that functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
| AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
| AT4G32820 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G41860 | member of Calcium Dependent Protein Kinase |
| AT4G36070 | member of Calcium Dependent Protein Kinase |
| AT1G61950 | member of Calcium Dependent Protein Kinase |
| AT2G31500 | member of Calcium Dependent Protein Kinase |
| AT1G76040 | member of Calcium Dependent Protein Kinase |
| AT5G15730 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G68200 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT3G16030 | lectin protein kinase family protein;(source:Araport11) |
| AT3G56800 | encodes a calmodulin |
| AT1G71790 | Encodes a heterodimeric actin binding protein composed of an alpha and a beta sumunit. Stabilizes actin filament cytoskeleton by capping. |
| AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT5G14740 | Encodes a beta carbonic anhydrase likely to be localized in the cytoplasm. Expression of its mRNA is seen in etiolated seedlings and points to a possible nonphotosynthetic role for this isoform. |
| AT5G14310 | carboxyesterase 16;(source:Araport11) |
| AT1G06820 | Encodes carotenoid isomerase. Catalyzes the isomerization of poly-cis-carotenoids to all-trans-carotenoids. Together with PDS and ZDS, CRTiso is required to complete the synthesis of lycopene from phytoene. |
| AT5G57015 | Member of CKL gene family (member of CKL-B group). |
| AT4G28540 | Member of CKL gene family (CKL-C group). |
| AT4G14670 | This locus was originally annotated as encoding ClpB2 (also referred to as Hsp92.7), which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. However, according to Lee et al. (2007, Plant Journal, 49:115-127), there is no evidence for expression of an appropriate-sized mRNA from this locus. Re-annotation of the genome indicates that this locus potentially encodes a 68.8-kDa protein, containing only the N-terminal two thirds of the originally predicted open reading frame. This locus contains a 626-bp deletion in WS ecotype compared with the Col ecotype, which eliminates residues 1-86 of the predicted protein. |
| AT3G06390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G17200 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G11655 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G37235 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G16385 | CAF1 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF2 it is required for formation of the casparian band. |
| AT1G31530 | Deadenylase. |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
| AT1G55720 | member of Low affinity calcium antiporter CAX2 family |
| AT3G44930 | member of Putative Na+/H+ antiporter family |
| AT3G44920 | member of Putative Na+/H+ antiporter family |
| AT3G44910 | member of Putative Na+/H+ antiporter family |
| AT1G64170 | member of Putative Na+/H+ antiporter family |
| AT5G01690 | member of Putative Na+/H+ antiporter family |
| AT5G22900 | member of Putative Na+/H+ antiporter family |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT1G08135 | cation/H+ exchanger 6B;(source:Araport11) |
| AT1G05940 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
| AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
| AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT1G27890 | Deadenylase. |
| AT3G44240 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G39420 | CDC2C;(source:Araport11) |
| AT3G50530 | CDPK-related kinase |
| AT5G23040 | Encodes a protein that enables protochlorophillide's binding to pPORA's transit sequence, regulating pPORA's translocation into the plastid stroma, and blocking movement of the translocating polypeptide chain back into the cytosol. Causes Bax mediated lethality in yeast by generating reactive oxygen species and this effect is suppressed by AtBI-1. |
| AT2G25540 | cellulose synthase |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
| AT5G44030 | Encodes a cellulose synthase involved in secondary cell wall biosynthesis. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. The mRNA is cell-to-cell mobile. |
| AT2G32610 | encodes a gene similar to cellulose synthase |
| AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
| AT3G28180 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT4G00450 | Encodes the Arabidopsis homolog of the transcriptional regulator MED12, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. Involved in flowering time. The mutant enhances the expression of the flowering time (FT) gene. A knockout mutant of this gene showed late-flowering phenotype. |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT2G32130 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
| AT2G30380 | MYB family transcription factor;(source:Araport11) |
| AT3G60680 | DUF641 family protein (DUF641);(source:Araport11) |
| AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
| AT2G43570 | chitinase;(source:Araport11) |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT1G55620 | Encodes a chloride channel protein that has been localized to the chloroplast and golgi apparatus. Complements yeast gef1 mutant and therefor may function to acidify the golgi lumen. |
| AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
| AT1G29910 | member of Chlorophyll a/b-binding protein family |
| AT2G20270 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G37770 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including saturated and unsaturated aldehydes, steroids, and sugars. GFP-tagged AKR4C9 localizes to the chloroplast where it may play a role in detoxifying reactive carbonyl compounds that threaten to impair the photosynthetic process. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
| AT2G21450 | chromatin remodeling 34;(source:Araport11) |
| AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
| AT4G39330 | cinnamyl alcohol dehydrogenase 9;(source:Araport11) |
| AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
| AT5G60500 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT3G58740 | Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds. |
| AT3G58750 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT1G69320 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G66145 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. Mutations in this gene cause embryo lethality and reduced transmission through the female gametophyte. Over-expression of a CLPS3:TAP protein changes the relative levels of two alternatively processed FCA transcripts. It also causes abnormal phyllotaxy and flower development, early flowering under long and short days, and increased levels of CUC1 and WUS expression. |
| AT4G27110 | COBRA-like protein 11 precursor;(source:Araport11) |
| AT5G60950 | COBRA-like protein 5 precursor;(source:Araport11) |
| AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT4G36290 | R-protein-interacting protein that localizes to endosomes and functions in resistance gene?mediated immunity. Belongs to the conserved Microrchidia (MORC) adenosine triphosphatase (ATPase) family, predicted to catalyze alterations in chromosome superstructure. Required for heterochromatin condensation and gene silencing. |
| AT1G77710 | ubiquitin-fold modifier;(source:Araport11) |
| AT1G31780 | Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen. |
| AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
| AT3G01490 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
| AT4G00930 | Encodes COP1-interacting protein CIP4.1. |
| AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
| AT4G12290 | Copper amine oxidase. Induced by ABA and involved in stomatal closure. |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT5G18100 | A putative peroxisomal CuZnSOD inducible by a high-light pulse. |
| AT4G23600 | Encodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. |
| AT2G47400 | CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The mRNA is cell-to-cell mobile. |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT2G39180 | CRINKLY4 related 2;(source:Araport11) |
| AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
| AT3G01370 | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
| AT4G36280 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. |
| AT5G51020 | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
| AT1G02980 | encodes an Arabidopsis cullin |
| AT2G02560 | Arabidopsis thaliana homolog of human CAND1 (cullin-associated and neddylation-dissociated). Putative similarity to TBP-interacting protein TIP120. Ubiquitously expressed in plant tissues throughout development. T-DNA insertion mutant plants were completely sterile and resistant to sirtinol and auxin, but not to gibberellins or brassinolide. Displayed developmental phenotypes similar to those of axr1, namely, short petioles, downwardly curling leaves, shorter inflorescence. Required for SCF function and appears to modulate SCF complex cycling. Physically interacts with CUL1. The mRNA is cell-to-cell mobile. |
| AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
| AT3G17690 | member of Cyclic nucleotide gated channel family |
| AT3G48010 | member of Cyclic nucleotide gated channel family |
| AT4G30360 | member of Cyclic nucleotide gated channel family |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT5G67260 | Encode CYCD3;2, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs and mediating cytokinin effects in apical growth and development. With PPD and NINJA, it plays a crucial role in leaf morphogenesis. |
| AT3G63120 | cyclin p1;(source:Araport11) |
| AT2G44740 | cyclin p4;(source:Araport11) |
| AT5G07450 | cyclin p4;(source:Araport11) |
| AT1G76540 | Encodes a cyclin-dependent protein kinase involved in regulation of the G2/M transition of the mitotic cell cycle. Specifically binds to the cyclin CYCD4;1, expressed in shoot meristem, young leaves and vascular tissue during the G2/M phase. Required for proper organization of the shoot apical meristem and for hormone signaling. |
| AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT4G33060 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT3G55920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G12140 | Encodes a cystatin. |
| AT3G48340 | KDEL-tailed cysteine endopeptidase. Mutants generated via RNAi show decreased lateral root growth. |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
| AT4G23180 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile. |
| AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
| AT4G23240 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23140 | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT5G53560 | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase. |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT4G15310 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT3G30290 | a member of cytochrome P450 gene family |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
| AT3G20080 | cytochrome P450, family 705, subfamily A, polypeptide 15;(source:Araport11) |
| AT3G20110 | member of CYP705A |
| AT3G20140 | member of CYP705A |
| AT2G27000 | member of CYP705A |
| AT2G27010 | member of CYP705A |
| AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
| AT3G19270 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. |
| AT1G55940 | cytochrome P450 family protein;(source:Araport11) |
| AT1G78490 | member of CYP708A family. The mRNA is cell-to-cell mobile. |
| AT2G46960 | member of CYP709B |
| AT4G27710 | member of CYP709B The mRNA is cell-to-cell mobile. |
| AT5G57260 | putative cytochrome P450 |
| AT5G25120 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT5G25130 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26230 | putative cytochrome P450 |
| AT3G26270 | putative cytochrome P450 |
| AT3G26290 | putative cytochrome P450 |
| AT1G13070 | putative cytochrome P450 |
| AT3G26295 | putative cytochrome P450. |
| AT3G26320 | putative cytochrome P450 |
| AT3G26330 | putative cytochrome P450 |
| AT3G26280 | cytochrome P450 monooxygenase |
| AT2G02580 | member of CYP71B |
| AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
| AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT4G37330 | member of CYP81D |
| AT5G67310 | member of CYP81G |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT1G24540 | member of CYP86C |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT1G05160 | Encodes an ent-kaurenoic acid hydroxylase, a member of the CYP88A cytochrome p450 family. |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT3G01900 | member of CYP94B |
| AT1G34540 | member of CYP94D |
| AT4G39500 | cytochrome P450, family 96, subfamily A, polypeptide 11;(source:Araport11) |
| AT1G66030 | Encodes a protein with cytochrome P450 domain. Probable psuedogene. |
| AT1G65340 | member of CYP96A |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
| AT2G21910 | member of CYP96A |
| AT2G40890 | encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level. |
| AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
| AT5G50915 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G40730 | kinase family with ARM repeat domain-containing protein;(source:Araport11) |
| AT2G29560 | Encodes a putative phosphoenolpyruvate enolase that is localized both to the nucleus and the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT4G36400 | Encodes a (D)-2-hydroxyglutarate dehydrogenase. |
| AT1G48420 | Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. There is conflicting evidence on its 1-aminocyclopropane-1-carboxylate deaminase activity. Involved in regulating ethylene levels. DCD enhances plant cadmium tolerance by promoting hydrogen sulfide production. |
| AT2G39830 | Essential for early phloem development and function, and for root system development.DAR2 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT1G51440 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT1G12840 | Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. The mRNA is cell-to-cell mobile. |
| AT3G01540 | RNA HELICASE DRH1 |
| AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
| AT1G14620 | decoy;(source:Araport11) |
| AT1G72490 | DRO1 is a member of the IGT gene family and has a unknown function . It is expressed in roots and involved in leaf root architecture, specifically the orientation of lateral root angles. Involved in determining lateral root branch angle. |
| AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
| AT2G41610 | Transmembrane protein from a plant specific gene family. Overexpression causes abnormal cell wall composition and defects in cell growth. |
| AT4G33400 | Together with DEM2 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
| AT3G19240 | Together with DEM1 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
| AT3G49250 | Similar to hinge-domain region of structural maintenance of chromosomes (SMC)proteins.Putative chromosome architecture protein that can potentialy link nucleic acids in facilitating an RNA1-mediated epigenetic modification involving secondary siRNA and spreading of DNA methylation. |
| AT4G18370 | Encodes DEG5. Forms a hexamer with DEG8 in the thylakoid lumen. Involved in the cleavage of photodamaged D2 protein of photosystem II (PSII). |
| AT5G39830 | Encodes DEG8. Forms a hexamer with DEG5 in the thylakoid lumen. Involved in the cleavage of photodamaged D2 protein of photosystem II (PSII). Recombinant DEG8 is proteolytically active toward both a model substrate (beta-casein) and photodamaged D1 protein of photosystem II. |
| AT2G38340 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT3G50980 | dehydrin xero 1;(source:Araport11) |
| AT5G67570 | Encodes a pentratricopeptide repeat containing protein that is targeted to the chloroplast. Mutants have pale young leave and reduced accumulation of plastid encoded transcripts suggesting a role for DG1 in regulation of plastid gene expression. |
| AT1G11500 | DUF1218 family member. |
| AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
| AT1G63900 | Encodes a RING-type ubiquitin E3 ligase of the chloroplast outer membrane that associates with TOC complexes and mediates ubiquitination of TOC components, promoting their degradation. It not only regulates chloroplast protein import but also targets components of the peroxisome protein import apparatus, PEX13 in particular. Several studies have been done to examine the peroxisomal localization of this protein, with varying interpretations. |
| AT5G64280 | dicarboxylate transporter 2.2;(source:Araport11) |
| AT4G35420 | Encodes DRL1 (Dihydroflavonol 4-reductase-like1), a closely related homolog of the rice anther-specific gene OsDFR2. DRL1 may be involved in a metabolic pathway essential for pollen wall development and male fertility. Mutant plants have impaired pollen formation and seed production. |
| AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT1G13180 | Mutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype. |
| AT4G10490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G18140 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G77930 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G18465 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G67630 | DNA polymerase alpha 2;(source:Araport11) |
| AT5G18070 | encodes a novel protein involved in DNA repair from UV damage. Isolated by functional complementation of E. coli UV-sensitive mutants (UVR genes). |
| AT4G13830 | DnaJ-like protein (J20); nuclear gene |
| AT3G45610 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT4G18650 | A maternally expressed imprinted gene in the endosperm. It's expression is positively regulated by ROS1. |
| AT1G11420 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
| AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
| AT1G05800 | Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues. |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT1G27461 | Nuclear localized protein involved in osmotic stress tolerance. |
| AT5G54420 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G13680 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G52930 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54330 | hypothetical protein (DUF295);(source:Araport11) |
| AT1G64570 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G62230 | Target promoter of the male germline-specific transcription factor DUO1. Increases seed oil content by attenuating GL2 inhibition. Overexpression results in reduced trichome numbers. |
| AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
| AT1G60530 | Dynamin related protein 4A;(source:Araport11) |
| AT1G60510 | pseudogene of Dynamin related protein 4C;(source:Araport11) |
| AT4G21330 | Encodes a bHLH transcription factor strongly expressed in the tapetum from late anther stage 5 to early stage 6, and at a lower level in meiocytes. dyt1 mutant exhibits abnormal anther morphology beginning at anther stage 4. DYT1 acts downstream of SPL/NZZ and EMS1/EXS , and regulates the expression of downstream genes like AMS, MS1 and other tapetum preferential genes for pollen development, primarily via TDF1. |
| AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT3G16800 | EGR3 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress, EGR3 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT2G25930 | Encodes a nuclear protein that is expressed rhythmically and interacts with phytochrome B to control plant development and flowering through a signal transduction pathway. Required component of the core circadian clock regardless of light conditions. |
| AT1G79730 | Encodes a PAF1 homolog that is involved in the control of flowering time by elevating FLC expression to a level that creates the vernalization-responsive, winter-annual habit. Yeast PAF1 is a component of a five-member complex that associates with RNA pol II and is thought to regulate gene expression by recruiting SET1 (a histone 3 Lys 4 [H3-K4] methyl transferase) to the initially transcribed [5'] regions of target chromatin. Mutants display reduced H3-K4 methylation in both FLC and FLM chromatin. Member of PAF-C complex. |
| AT2G03500 | Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression. |
| AT2G25060 | early nodulin-like protein 14;(source:Araport11) |
| AT1G64640 | early nodulin-like protein 8;(source:Araport11) |
| AT3G20570 | early nodulin-like protein 9;(source:Araport11) |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
| AT5G51070 | ATP-dependent Clp protease regulatory subunit The mRNA is cell-to-cell mobile. |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT5G48090 | EDM2-like protein1;(source:Araport11) |
| AT5G56780 | Encodes a transcriptional regulator that is required for the induction of dormancy during late seed development.ET2 contains DNA and Zinc binding domains and is involved in DNA methylation. ET2 may function in DNA repair. |
| AT2G21740 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT2G21750 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT2G25490 | Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. The mRNA is cell-to-cell mobile. |
| AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
| AT5G09990 | elicitor peptide 5 precursor;(source:Araport11) |
| AT5G09978 | elicitor peptide 7 precursor;(source:Araport11) |
| AT3G06460 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1 |
| AT5G22800 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT5G21140 | Encodes a nuclear localized, structural subunit of the SMC 5/6 complex and a non- SMC element. Loss of function results in abnormal cell division and embryo lethality. Analysis of partially rescued lines indicates a role in double strand break DNA repair. Similar phenotype to NSE3 which it also interacts with. Maintains cell viability together with NSE3 during early embryogenesis. |
| AT5G49930 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT5G37510 | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. The mRNA is cell-to-cell mobile. |
| AT1G04635 | ribonuclease P family protein / Rpp14 family protein;(source:Araport11) |
| AT3G54350 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT2G28880 | ADCS encodes a protein that has two functional domains. The N-terminal domain has glutamine amidotransferase activity while the C-terminal domain has aminodeoxychorismate synthase (ADCS) activity. These two domains act together to catalyze the transformation of chorismate to 4-amino-4-deoxychorismate. This reaction is required for 4-aminobenzoate (pABA) production and ultimately for folate biosynthesis. The putative target peptide of ADCS can direct GFP to the chloroplast. |
| AT1G22090 | hypothetical protein;(source:Araport11) |
| AT1G02780 | Ribosomal protein L19e family protein;(source:Araport11) |
| AT2G18510 | Essential gene (embryo lethal) that is similar to component of splicosome. Regulates embryonic pattern formation through Pol II-Mediated transcription of WOX2 an PIN7 (DOI:10.1016/j.isci.2019.09.004). JANUS positively regulates PLT1 expression in the root meristem by recruiting RNA polymerase II (Pol II) to PLT1 and by interacting with PLT1. Nuclear accumulation of JANUS in root meristem depends on IMB4. (DOI:10.1105/tpc.20.00108 ) |
| AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT3G12080 | Encodes a putative plastid-targeted GTP-binding protein that is essential for embryogenesis and chloroplast development. |
| AT1G67320 | DNA primase, large subunit family;(source:Araport11) |
| AT2G03870 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT5G24670 | A protein coding gene with unknown function. The 5?UTR of this gene overlaps with a RNA coding gene TER2. TER2 (GenBank accession no. HQ401285) encodes a putative template sequence corresponding to 1.5 copies of the Arabidopsis telomere repeat (PNAS 2011, 108:73-78). Natural epiallele in Nok-1, transmission of the epiallele over generations depends only on the selfreinforcing loop between CHROMOMETHYLASE 3 and KRYPTONITE, involving DNA methylated in the CHG context and histone H3 lysine 9 methylation. |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G18080 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G03650 | Exostosin family protein;(source:Araport11) |
| AT4G00310 | Putative membrane lipoprotein;(source:Araport11) |
| AT5G62200 | Embryo-specific protein 3, (ATS3);(source:Araport11) |
| AT5G11530 | Involved in regulating reproductive development |
| AT1G16900 | Encodes the Arabidopsis ortholog of the yeast/human ALG9 catalyzing the luminal addition of two alpha-1,2 Man residues in assembling Glc3Man9GlcNAc2. |
| AT5G67270 | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT2G38960 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO2 is mainly present in the Ox2 redox state. |
| AT3G48090 | Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases. |
| AT1G11300 | The annotation for At1g11300 in TAIR10 is incorrect. This locus has been split into two At1g11300 (symbol: EGM1) and At1g11305 (symbol: EGM2) (Olivier Loudet, personal communication, 2013-04-03). See Comment field for revised annotation. |
| AT1G76150 | Encodes a monofunctional enoyl-CoA hydratase 2, involved in the degradation of even cis-unsaturated fatty acids, gene expression is enhanced during the first 2 days of germination, as well as in senescent leaves. |
| AT3G13898 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G14210 | A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni. |
| AT1G70330 | encodes an adenosine transporter that catalyze a proton-dependent adenosine transport. The mRNA is cell-to-cell mobile. |
| AT1G44830 | Encodes a nuclear-localized member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.ERF014 differentially regulates responses to bacterial and fungal pathogens. |
| AT2G22140 | Forms a complex with MUS81 that functions as endonuclease in DNA recombination and repair processes. |
| AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
| AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
| AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT1G05010 | Encodes 1-aminocyclopropane-1-carboxylate oxidase |
| AT5G21120 | ethylene-insensitive3-like2 (EIL2) |
| AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G13950 | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced. |
| AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
| AT3G19760 | Encodes an RNA helicase that may be a component of the Exon Junction Complex. Subcellular localization is modulated by stress. Under normal conditions it is localized to the nuceloplasm but under hyopoxic conditions it localizes to the nucleolus and splicing speckles. |
| AT2G39820 | Translation initiation factor IF6;(source:Araport11) |
| AT5G05470 | Encodes an eIF2alpha homolog that can be phosphorylated by GCN2 in vitro. |
| AT4G11420 | Encodes a subunit of eukaryotic initiation factor 3 (eIF3), a multisubunit complex that is required for binding of mRNA to 40 S ribosomal subunits, stabilization of ternary complex binding to 40 S subunits, and dissociation of 40 and 60 S subunits. |
| AT5G12370 | exocyst complex component sec10;(source:Araport11) |
| AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G72470 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G14090 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G28650 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
| AT3G15370 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G28950 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G45970 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile. |
| AT5G35190 | proline-rich extensin-like family protein;(source:Araport11) |
| AT4G08370 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT4G08400 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
| AT2G27380 | Encodes an extensin like gene involved in seed germination. |
| AT1G61340 | Encodes a F-box protein induced by various biotic or abiotic stress. |
| AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G14500 | F-box family protein;(source:Araport11) |
| AT2G24080 | F-box protein (DUF295);(source:Araport11) |
| AT2G33200 | F-box family protein;(source:Araport11) |
| AT4G10820 | F-box family protein;(source:Araport11) |
| AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
| AT1G69090 | F-box protein (DUF295);(source:Araport11) |
| AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT5G19260 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
| AT3G22170 | A component of the PHYA signaling network, mediates the FR-HIR response to far-red light in concert with FAR1. Expression is induced by age; involved in negative regulation of leaf senescence. |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT1G33390 | Over-expression of this gene results in stem fasciation. The predicted amino acid sequence reveals the presence of two domains (DEXH-box or DEAD-box helicase and DUF1065 domain) and fragments of two more domains (HrpA domain and HA2 domain). |
| AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
| AT2G04780 | fasciclin-like arabinogalactan-protein 7 (Fla7). Possibly involved in embryogenesis and seed development. |
| AT3G56700 | Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding. |
| AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G57790 | F-box family protein;(source:Araport11) |
| AT5G55150 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
| AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT5G50160 | Encodes a ferric chelate reductase that is expressed in shoots and flowers. |
| AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
| AT3G26080 | localized to chloroplasts |
| AT1G04650 | FLIP is a member of a conserved gene family with wide distribution across taxa. In Arabidopsis, it forms a complex with FIGL1 regulates meiotic crossover formation via RAD51 and DMC1. |
| AT4G22910 | FIZZY-related 2;(source:Araport11) |
| AT4G25340 | Encodes a member of the FKBP-type immunophilin family that functions as a histone chaparone. Binds to 18S rDNA and represses its expression. The N-terminal nucleoplasmin domain interacts with H2A/H2B and H3/H4 histone oligomers, individually, as well as simultaneously, suggesting two different binding sites for H2A/H2B and H3/H4. |
| AT5G64350 | Encodes FK506-binding protein 12 (FKBP12 or FKP12). FKP12 overexpression dramatically enhances rapamycin sensitivity, whereas rapamycin inhibition is relieved in transgenic plants deficient in FKP12. |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
| AT5G08640 | Encodes a flavonol synthase that catalyzes formation of flavonols from dihydroflavonols. Co-expressed with CHI and CHS (qRT-PCR). |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G25260 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking. |
| AT2G42280 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G00315 | Member of a family of F-Box proteins. May function redundantly with FOF2 to negatively regulate FLC and flowering. |
| AT4G15060 | FBD, F-box/LRR protein;(source:Araport11) |
| AT3G02400 | Contains a single exon and encodes a ~66-kD protein with a Forkhead- Associated domain. Binds the promoter of PEX11b and expression is correlated with negative regulation of PEX11b. |
| AT3G13225 | WW domain-containing protein;(source:Araport11) |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT3G25500 | Poly-L-proline-containing (PLP) protein that form part of the signal-transduction cascade that leads to rearrangement of the actin cytoskeleton. AFH1 is a nonprocessive formin that moves from the barbered end to the side of an actin filament after the nucleation event. |
| AT5G58160 | Class II formin; modulator of pollen tube elongation. |
| AT4G31380 | encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves. |
| AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G16320 | family member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004884 |
| AT4G38970 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT2G26990 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT1G02090 | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT1G50240 | The FUSED (FU) gene belongs to Ser/Thr protein kinase family and has a key role in the hedgehog signaling pathway known to control cell proliferation and patterning in fruit flies and humans . Arabidopsis thaliana genome has a single Fu gene that is involved in male meiosis cytokinesis. Cytokinesis-defective mutants, named two-in-one (tio), result from mutations in Arabidopsis Fu. Phenotypic analysis of tio mutants reveals an essential role for TIO in conventional modes of cytokinesis in plant meristems and during male gametogenesis. TIO is tightly localized to the midline of the nascent phragmoplast and remains associated with the expanding phragmoplast ring. This gene was previously annotated as two gene models, AT1G50230.1 and AT1G50240.1, however the experimental evidence exists (Oh et al, Current Biology, 2005) showing that these two models are in fact single gene, named FUSED. |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
| AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
| AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT2G46480 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G02130 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G26220 | ChaC-like family protein;(source:Araport11) |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT5G26930 | Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification. |
| AT1G73250 | encodes a bifunctional 3, 5-epimerase-4-reductase in L-fucose synthesis and converts GDP-D-mannose to GDP-L-fucose in vitro along with MUR1 (GDP-D-mannose 4,6-dehydratase). It is expressed in all tissues examined, but most abundantly in roots and flowers. |
| AT1G71120 | Contains lipase signature motif and GDSL domain. |
| AT5G14280 | DNA-binding storekeeper-like protein;(source:Araport11) |
| AT2G23800 | encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT4G14630 | germin-like protein with N-terminal signal sequence that may target it to the vacuole, plasma membrane and/or outside the cell. The mRNA is cell-to-cell mobile. |
| AT4G32680 | Similar to yeast GET2 encodes an ER localized transmembrane protein that interacts with GET1 receptor via its transmembrane domain. |
| AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
| AT4G25420 | Encodes gibberellin 20-oxidase that is involved in the later steps of the gibberellin biosynthetic pathway. Regulated by a circadian clock. Weak expression response to far red light. |
| AT1G79840 | Glabra 2, a homeodomain protein affects epidermal cell identity including trichomes, root hairs, and seed coat. It also down-regulates seed oil content. Expressed in atrichoblasts and required to suppress root hair development. Also expressed abundantly during early seed development. Directly regulated by WER. |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
| AT4G34740 | Encodes glutamine 5-phosphoribosylpyrophosphate amidotransferase. Mutants are deficient in leaf, but not cotyledon, plastid and palisade cell development. Mutants exhibit defective chloroplast development under non-low light, suggesting that the defect in chloroplast development is caused by photo-oxidative damage. Plays role in differential development of vascular-associated cells. Demonstrates a cell-specific difference in chloroplast development.Mutant leaves are highly reticulate with a green vascular pattern. |
| AT5G08000 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. |
| AT5G36870 | encodes a gene similar to callose synthase |
| AT5G04500 | Encodes a member of the CAZy Glycosyltransferase Family 64 that is involved in glycosylinositolphosphorylceramide and sphingolipid glycosylation. In mutants, seed germination was less sensitive to salt stress than in wild-type plants. [The protein was expected to be Golgi-localized based on function as well as the Golgi localization of its homolog GMT1. However, GFP-fusion proteins localized both to the ER and Golgi, and especially to ER when co-expressed with Golgi markers. Therefore, localization cannot confidently be defined. (pers. communication, J. Mortimer)] |
| AT5G15770 | Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum. |
| AT5G35790 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is more prevalent in developing organs but absent in the root. |
| AT5G25980 | Myrosinase (thioglucoside glucohydrolase) gene involved in glucosinoloate metabolism. The mRNA is cell-to-cell mobile. |
| AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
| AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT2G24710 | member of Putative ligand-gated ion channel subunit family |
| AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
| AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT5G16570 | Encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
| AT1G02950 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G17220 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts. |
| AT2G30860 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78320 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G02390 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. It functions in vitro as a maleylacetoacetate isomerase and is likely to be involved in tyrosine catabolism. |
| AT1G80380 | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT3G47420 | Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT1G30560 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT4G17550 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G43300 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT3G20470 | encodes a glycine-rich protein that is expressed more abundantly in immature seed pods than in stems and leaves. Expression is not detected in roots or flowers. |
| AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
| AT2G44560 | glycosyl hydrolase 9B11;(source:Araport11) |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT4G12360 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G06130 | glyoxalase 2-4;(source:Araport11) |
| AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
| AT2G35110 | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs. Its ER localization is independent of upstream SPK1 activation signaling and the physical association with the WAVE/SCAR Regulatory complex binding partner SRA1. ER-localized NAP1 has little colocalization with actin and represent the inactive pool of NAP1 in these cell types. |
| AT5G19610 | GNOM-like 2;(source:Araport11) |
| AT2G19950 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC1 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (558-715 aa) portion of the protein. |
| AT2G46180 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein. |
| AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
| AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT1G53130 | Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space. |
| AT2G06200 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower |
| AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G20940 | Encodes a plasma-membrane localized LRR receptor-like protein involved in both ABA and H202 mediated signaling involved in stomatal movement. TAIR10 annotation for this gene has a low confidence score (2-star). See Comments field for structural annotation by the community. |
| AT5G63220 | golgi-to-ER traffic-like protein;(source:Araport11) |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
| AT3G42640 | H[+]-ATPase 8;(source:Araport11) |
| AT3G19700 | Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments. |
| AT2G43920 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT1G74310 | Encodes ClpB1, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Involved in refolding of proteins which form aggregates under heat stress. Also known as AtHsp101. AtHsp101 is a cytosolic heat shock protein required for acclimation to high temperature. |
| AT4G14830 | 17.6 kDa class II heat shock protein;(source:Araport11) |
| AT1G11660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT5G52640 | Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile. |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G54070 | A member of Heat Stress Transcription Factor (Hsf) family. Not responding to heat stress. Is regulated by the seed-specific transcription factor ABI3. In turn, it regulates other heat stress proteins including Hsp17.4-CI, Hsp17.7-CII and Hsp101 during seed maturation. |
| AT2G19540 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G30110 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT3G50330 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. Inhibits thermomorphogenesis. |
| AT1G69720 | Encodes a member (HO3) of the heme oxygenase family. |
| AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
| AT1G50460 | Involved in glucose-ethylene crosstalk. |
| AT3G09650 | RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit. |
| AT3G51880 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. |
| AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
| AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
| AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
| AT5G10980 | Histone superfamily protein;(source:Araport11) |
| AT1G67220 | histone acetyltransferase of the CBP family 2;(source:Araport11) |
| AT1G55970 | HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain. |
| AT5G09740 | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT5G03740 | HD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression via histone modification. |
| AT3G44680 | Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD. |
| AT2G44950 | The gene encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. Regulates expression of disease resistance genes. |
| AT2G20000 | Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap. |
| AT1G37150 | Although HCS2 is predicted to encode a biotin protein ligase / holocarboxylase synthetase (HCS), hcs2 mutants do not show a decrease in HCS activity. A dual-targeted HCS1 (At2g25710) might account for the HCS activity observed in multiple subcellular compartments in Arabidopsis. |
| AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
| AT5G42780 | Zinc finger and homeobox domain protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
| AT2G33880 | Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling. |
| AT5G46880 | homeobox-7;(source:Araport11) |
| AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
| AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G52170 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G66240 | homolog of anti-oxidant 1;(source:Araport11) |
| AT3G50460 | Homolog of RPW8 |
| AT5G41370 | Encodes XPB1, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies. The mRNA is cell-to-cell mobile. |
| AT4G30510 | yeast autophagy 18 B-like protein;(source:Araport11) |
| AT2G40810 | yeast autophagy-like protein;(source:Araport11) |
| AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G08950 | Encodes HCC1, homologue of the copper chaperone SCO1 (synthesis of cytochrome c oxidase 1) from the yeast Saccharomyces cerevisiae. SCO1 encodes a mitochondrial protein that is essential for the correct assembly of complex IV in the respiratory chain. HCC1 is localized in the mitochondrion. A chimeric yeast Sco1-Arabidopsis HCC1 protein complements yeast Sco1 activity. Embryos of hcc1 mutants became arrested at various developmental stages, mostly at the heart stage. |
| AT1G72970 | Originally identified as a mutation that causes floral organs to fuse together. About 10-20% of mutants also have defects in ovules. Mutants have reduced fertility most likely as because of fusions that pistil emergence. The protein has similarity to the mandelonitrile lyase family of FAD containing oxidoreductases and is predicted to be secreted (SignalP).It is expressed in all tissue layers of roots, inflorescences, stems, leaves, and flowers and is also expressed in siliques. Expression is highest in inflorescence and flower tissue.Transmission of mutant alleles to the progeny shows non mendelian segregation- a percentage of mutant alleles revert back to a previous parental (e.g. grandparental) wild type allele. It has been suggested that an RNA template driven or other extra-DNA genomic mechanism may be responsible for the non-mendelian inheritance of HTH. Reversion events in alleles at other loci have also been observed to occur in plants with an hth mutant background indicating a genome wide effect. |
| AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT4G20910 | Encodes an enhancer of hua1 and hua2 tha acts to specify reproductive organ identities and to repress A gene function. HEN1 also shares AG's non-homeotic function in controlling floral determinacy. Mutants display corymb-like inflorescences. HEN1 is a methyltransferase that methylates miRNAs and siRNAs on the ribose of the last nucleotide. The 3'-end methylation probably protects the 3' ends of the small RNAs from uridylation. |
| AT2G06990 | Encodes a putative DExH-box RNA helicase that acts redundantly with HEN1, HUA1, and HUA2 in the specification of floral organ identity in the third whorl. |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
| AT4G10020 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G41950 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G61460 | Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT5G55510 | PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Acts in the export of proteins from chloroplasts during leaf senescence. |
| AT5G66985 | hypothetical protein;(source:Araport11) |
| AT3G27770 | plant/protein;(source:Araport11) |
| AT1G24180 | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900. Serine 296 phosphorylation of IAR4 has critical function in root hair formation and root development. Changing Ser296 in IAR4 to Ala resulted in a phenotype intermediate between mutant and wild-type, while substitution to Asp was either lethal or caused an extreme dwarf phenotype. |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT1G72270 | Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation. |
| AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
| AT1G64790 | ILITHYIA (ILA) is a HEAT repeat protein involved in plant immunity. The gene is also involved in systemic acquired resistance induced by P. syringae expressing avrRps4. Loss-of-function mutants of ILA caused pleiotropic defects in the mutant plants. The mutant plants are smaller in size and the leaves are serrated and yellow to light green in color. Required for bacterium-triggered stomatal closure. |
| AT4G09940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G33970 | IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens. |
| AT4G31180 | The IBI1 gene encodes an aspartyl tRNA synthetase (AspRS). In addition, the IBI1 protein acts as a receptor protein of the chemical plant defence activator beta-aminobutyric acid (BABA). Binding of IBI1 to the active R-enantiomer of BABA primes non-canonical defence activity of the AspRS protein against pathogen attack. |
| AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
| AT4G16143 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G49310 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G52000 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. Target promoter of the male germline-specific transcription factor DUO1. |
| AT1G48490 | Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network. |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
| AT1G76790 | Encodes a protein with similarity to N-acetylserotonin O-methyltransferase (ASMT) but it does not have ASMT activity in vitro. |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
| AT3G15540 | Primary auxin-responsive gene. Involved in the regulation stamen filaments development. |
| AT4G32280 | indole-3-acetic acid inducible 29;(source:Araport11) |
| AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
| AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
| AT5G03960 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G00820 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G18840 | Member of IQ67 (CaM binding) domain containing family. |
| AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
| AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
| AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT5G14200 | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. Encodes methylthioalkylmalate dehydrogenase. Involved in glucosinolate biosynthesis, in methionine chain elongation. The mRNA is cell-to-cell mobile. |
| AT1G31180 | The AtIMD3 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. |
| AT3G45300 | Encodes isovaleryl-coenzyme a dehydrogenase. Mutants have increases in 12 seed free amino acids, accumulation of seed homomethionine and 3-isovaleroyloxypropyl-glucosinolate, with a concomitant decrease in seed 3-benzoyloxypropyl-glucosinolate. The mRNA is cell-to-cell mobile. |
| AT1G52315 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT2G39330 | jacalin-related lectin 23;(source:Araport11) |
| AT1G68480 | Encodes a putative zinc finger transcription factor that is necessary for proper lateral organ shape and is sufficient to induce the proliferation of lateral organ tissue. Together with NUB, it is involved in stamen and carpel development. |
| AT3G11180 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT2G26490 | JGB contains seven WD40 repeats and is highly conserved in flowering plants. Overexpression inhibits pollen germination. suggesting JGB is a negative regulator of pollen germination |
| AT3G20810 | JMJD5 encodes a protein which contains a jumonji-C (jmjC) domain. jmjd5 mutant plants have a short-period circadian phenotype. JMJD5 has histone demethylase activity and interacts with EFM to repress FT. |
| AT1G63490 | Histone demethylase belonging to the KDM5/JARID1 family which plays crucial roles in response to dehydration stress and abscisic acid (ABA). Directly binds the chromatin of OPEN STOMATA 1 (OST1) and demethylated H3K4me3 for the regulation of OST1 mRNA abundance, thereby modulating the dehydration stress response. |
| AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
| AT4G38600 | encodes a member of HECT ubiquitin protein ligase family that is involved in trichome cell morphogenesis. Mutants in this gene exhibit supernumerary trichome branches and increased DNA content. |
| AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT4G14950 | KMS1 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
| AT3G12020 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT5G10470 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells. |
| AT5G65460 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA1 |
| AT3G44730 | kinesin-like protein 1;(source:Araport11) |
| AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
| AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
| AT1G70510 | A member of class I knotted1-like homeobox gene family (together with KNAT1). Similar to the knotted1 (kn1) homeobox gene of maize. KNAT2 acts synergistically with cytokinins and antagonistically with ethylene based on ectopic expression studies in different mutant backgrounds and hormone treatments. In addition, KNAT2 is negatively regulated by AS and YABBY genes. KNAT2 is strongly expressed in the shoot apex of seedlings, while in mature plants the gene is primarily expressed in flowers and inflorescence stems. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT2G46760 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
| AT3G10050 | first enzyme in the biosynthetic pathway of isoleucine |
| AT5G60310 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60320 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
| AT3G45440 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29250 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT3G46760 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G55550 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G55830 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G70130 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
| AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
| AT3G25440 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT1G01060 | LHY encodes a myb-related putative transcription factor involved in circadian rhythm along with another myb transcription factor CCA1 |
| AT2G42560 | Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress. |
| AT2G46140 | Late embryogenesis abundant protein;(source:Araport11) |
| AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
| AT3G22500 | late embryogenesis abundant (LEA) protein |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
| AT4G38360 | LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways. |
| AT5G14090 | LAZY1 is required for gravitropic response. Mutants have abnormal shoot angles and abnormal root gravitropism. LZY1 affects the redistribution of auxin in response to gravity in shoots and roots via an unknown mechanism. |
| AT1G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G20380 | LSD1 monitors a superoxide-dependent signal and negatively regulates a plant cell death pathway. contains zinc-finger motifs. LSD1 negatively regulates a basal defense pathway that can act upstream or independently of both NIM1/NPR1 function and SA accumulation following avirulent or virulent pathogen challenge |
| AT3G59530 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT4G14730 | Stress induced membrane protein. Mutants show enhanced cell death under stress. |
| AT1G03070 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT4G10340 | photosystem II encoding the light-harvesting chlorophyll a/b binding protein CP26 of the antenna system of the photosynthetic apparatus The mRNA is cell-to-cell mobile. |
| AT5G54270 | Lhcb3 protein is a component of the main light harvesting chlorophyll a/b-protein complex of Photosystem II (LHC II). |
| AT2G34430 | Photosystem II type I chlorophyll a/b-binding protein The mRNA is cell-to-cell mobile. |
| AT4G01160 | Encodes a member of LRB BTB family. It does not appear to participate in red light responses like LRB1 and LRB2. NO-interacting protein. |
| AT5G01240 | Encodes LAX1 (LIKE AUXIN RESISTANT), a member of the AUX1 LAX family of auxin influx carriers. Required for the establishment of embryonic root cell organization. |
| AT2G18460 | like COV 3;(source:Araport11) |
| AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT5G58010 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
| AT2G23660 | LOB domain-containing protein 10;(source:Araport11) |
| AT2G40470 | LOB-domain containing protein. Involved in regulation of xylem differentiation- acts as a regulator of VND7 which is a master regulator of xylem cell differentiation. |
| AT3G11090 | LOB domain-containing protein 21;(source:Araport11) |
| AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
| AT1G10920 | Encodes LOV1, a disease susceptibility gene that, paradoxically, is a member of the NBS-LRR resistance gene family. Conditions susceptibility to the fungus Cochliobolus victoriae and victorin-dependent induction of defense-associated proteins. Saturation mutagenesis identified 59 lov mutations that all display reduced susceptibility to vitorin. Mutations in known defense response pathways do not prevent susceptibility to C. victoriae. |
| AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
| AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
| AT5G50150 | LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1. |
| AT4G26466 | Encodes a membrane localized (putative GPI-anchored) protein involved in fertilization. Loss of function mutations display defects in fertilization-around 25% of embryo sacs abort. |
| AT2G30575 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT3G53110 | Encodes a putative DEAD-Box RNA Helicase and has RNA-dependent ATPase activity. Mutant is Sensitive to chilling stress and heat stress. Germination of the mutant is inhibited by ABA. LOS4 may be involved in temperature sensing. Is enriched in the nuclear envelope and also located in the cytoplasm. LOS4 is involved in export of poly A RNA. The mRNA is cell-to-cell mobile. |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
| AT1G14030 | Encodes a lysine methyltransferase whose main soluble physiological substrates are chloroplastic fructose 1,6-bisphosphate aldolases, FBA1, FBA2, and FBA3. Lysines near the C-terminal end of the target proteins are trimethylated. |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT1G51940 | Encodes a LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity.It is required for the suppression of defense responses in absence of pathogen infection or upon abscisic acid treatment. Loss-of-function mutants display enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum. Its expression is repressed by pathogen infection and biological elicitors and is induced abscisic acid.Expression is strongly repressed by elicitors and fungal infection, and is induced by the hormone abscisic acid (ABA). Insertional mutants show increased expression of PHYTOALEXIN-DEFICIENT 3 (PAD3), enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum infection and reduced physiological responses to ABA, suggesting that LYK3 is important for the cross-talk between signaling pathways activated by ABA and pathogens (PMID:24639336). |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT1G12640 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. |
| AT1G63050 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. Involved in triacylglycerol biosynthesis. |
| AT5G60160 | Vacuolar aspartyl aminopeptidase which also functions as a molecular chaperone. |
| AT4G02530 | MPH2 is a green lineage-specific thylakoid lumen protein required for photosynthetic acclimation of PSII to stressful light conditions (PMID:28874535). |
| AT5G07020 | Encodes an integral thylakoid membrane protein that interacts with PSII core complexes and contributes to the maintenance of PSII homeostasis upon exposure to photoinhibitory light conditions by participating in the protection and stabilization of PSII under photoinhibitory stress. |
| AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G11980 | Similar to fatty acid reductases. |
| AT4G11330 | MAP kinase |
| AT1G32320 | member of MAP Kinase Kinase |
| AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
| AT5G11850 | MAP3 kinase involved phosphorylation of a critical Ser171 for OST1/SnRK2.6 activation. |
| AT2G41970 | Encodes MRI, a plasma membrane-localized member of the RLCK-VIII subfamily. Preferentially expressed in both pollen tubes and root hairs. mri-knockout mutants display spontaneous pollen tube and root-hair bursting. |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34220 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT2G34870 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G34880 | JMJ15 is a novel H3K4 demethylase that regulates genes involved in flowering and response to stress. It is also a maternally expressed, imprinted gene. |
| AT3G06350 | Encodes a bi-functional dehydroquinate-shikimate dehydrogenase enzyme that catalyzes two steps in the chorismate biosynthesis pathway. |
| AT2G02240 | F-box family protein;(source:Araport11) |
| AT1G25310 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT5G19520 | mechanosensitive channel of small conductance-like 9;(source:Araport11) |
| AT1G60460 | Encodes a structural homolog of the archaeal topo VIB subunit that forms a complex with the two Arabidopsis thaliana SPO11 orthologs required for meiotic DSB formation (SPO11-1 and SPO11-2) and is essential for meiotic DSB formation. |
| AT5G45420 | The gene encodes a MYB transcription factor belons to R2R3-MYB family of transcription factors. Knock-down mutant analysis indicates its role in root hair elongation. |
| AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
| AT4G28590 | Encodes a dual-targeted nuclear/plastidial phytochrome signaling component required for PEP assembly. It controls PhAPG expression primarily from the nucleus by interacting with phytochromes and promoting their localization to photobodies for the degradation of the transcriptional regulators PIF1 and PIF3. RCB-dependent PIF degradation in the nucleus signals the plastids for PEP assembly and PhAPG expression. |
| AT1G79330 | Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT5G04200 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT5G56795 | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The MT1b gene, however, is indicated to be inactive. |
| AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
| AT4G37040 | encodes a methionine aminopeptidase |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G04830 | methionine sulfoxide reductase B5;(source:Araport11) |
| AT3G29770 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT4G16690 | Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on MeSA, MeGA4, or MEGA9 in vitro. Although MES16 is similar to MES17, a MeIAA hydrolase, two mes16 mutant lines (SALK_151578) and (SALK_139756) do not show altered sensitivity to MeIAA in root growth assays. MES16 transcripts appear to be more than 10-fold less abundant than those of MES17 in roots. |
| AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
| AT4G22745 | Protein containing methyl-CpG-binding domain. |
| AT4G00416 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G01460 | Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes. |
| AT5G24825 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGG |
| AT1G19371 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
| AT1G29265 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAUUUGCCCUG |
| AT1G71002 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection. |
| AT1G19464 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAGGUAUGAUUGACUUCAAA |
| AT1G23060 | hypothetical protein;(source:Araport11) |
| AT2G38720 | microtubule-associated protein 65-5;(source:Araport11) |
| AT1G27920 | microtubule-associated protein 65-8;(source:Araport11) |
| AT4G35920 | Encodes an integral plasma membrane protein. Functionally complements the yeast mid1 mutant, a deficiency of Ca2+ influx. Involved in Ca2+ influx and mechanical sensing in roots. An over-expression line showed increased Ca2+ uptake than the wild type plant. The primary root of a knock-out mutant failed to penetrate a harder agar medium from a softer medium. |
| AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
| AT5G57170 | Chemokine-like MDL protein; modulates flowering time and innate immunity. |
| AT1G61560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G42560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO9 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO10. The gene is expressed during early seedling growth, in cotyledon vascular system, in flowers (with strong expression in anthers) in siliques and fruit abscission zone; not expressed in roots, or in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT1G54220 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT5G55090 | member of MEKK subfamily |
| AT3G07980 | MAP3K epsilon protein kinase 2 is functionally redundant with MAP3Ke1. Required for pollen development but not essential. |
| AT4G08480 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT1G35310 | MLP-like protein 168;(source:Araport11) |
| AT1G33520 | Has single homolog in Arabidopsis, also homologs in human, mouse and C. elegans; contains one G-patch domain (known to mediate RNA-protein interactions) and two KOW domains (may bind RNA and/or protein); localized to the nucleus; mutant suppresses high SA levels and constitutive disease resistance in snc1 npr1 background; required for basal resistance against Pseudomonas syringae maculicola ES4326 and R gene-mediated resistance specified by RPM1, PPS4 and RPP4; |
| AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT2G28390 | SAND family protein;(source:Araport11) |
| AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT1G53500 | encodes a putative NDP-L-rhamnose synthase, an enzyme required for the synthesis of the pectin rhamnogalacturonan I, the major component of Arabidopsis mucilage. Gene is involved in seed coat mucilage cell development. Mutant analyses suggest that MUM4 is required for complete mucilage synthesis, cytoplasmic rearrangement and seed coat development. |
| AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
| AT5G58230 | Encodes a WD-40 repeat containing protein that functions in chromatin assembly as part of the CAF1 and FIE complex. Mutants exhibit parthenogenetic development that includes proliferation of unfertilized endosperm and embryos. In heterozygous plants 50% of embryos abort. Of the aborted embryos the early aborted class are homozygous and the later aborting lass are heterozygotes in which the defective allele is maternally transmitted. Other phenotypes include defects in ovule morphogenesis and organ initiation,as well as increased levels of heterochromatic DNA. MSI1 is needed for the transition to flowering. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. In the ovule, the MSI1 transcripts are accumulated at their highest level before fertilization and gradually decrease after fertilization. MSI is biallelically expressed, the paternall allele is expressed in the endosperm and embryo and is not imprinted. MSI1 forms a complex with RBR1 that is required for activation of the imprinted genes FIS2 and FWA. This activation is mediated by MSI1/RBR1 mediated repression of MET1. |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G61720 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G48060 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G44780 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT2G42680 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is developmentally regulated. The mRNA is cell-to-cell mobile. |
| AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores. |
| AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT3G02940 | Encodes a putative transcription factor (MYB107). |
| AT5G58850 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119). |
| AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
| AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
| AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
| AT5G52260 | Member of the R2R3 factor gene family. |
| AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
| AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT5G06100 | Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity. |
| AT5G57620 | MYB36 is a transcriptional regulator that acts to promote differentiation of the endodermis during root development. It promotes the development the Casparian band in part by regulating the expression of genes involved in localizing lignin biosynthetic machinery to the Casparian band. MYB36 binds to and regulates the expression of factors involved in producing the Casparian band including CASP1, PER64, and ESB1. |
| AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
| AT1G57560 | Member of the R2R3 factor gene family. |
| AT4G01680 | Encodes a putative transcription factor (MYB55). |
| AT5G59780 | Encodes a putative transcription factor (MYB59). In roots it is involved in K+/NO3- transport and expression of the NPF7.3 transporter. |
| AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
| AT5G11050 | Member of R2R3-MYB transcription factor gene family. |
| AT3G12720 | Member of the R2R3 factor gene family. |
| AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
| AT4G05100 | Member of the R2R3 factor gene family. |
| AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT2G26960 | Member of the R2R3 factor gene family.Expressed in microspores and required for progression into pollen mitosis I. |
| AT3G08500 | Encodes a putative R2R3-type MYB transcription factor (MYB83). |
| AT5G26660 | myb domain protein 86;(source:Araport11) |
| AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT5G18240 | Encodes MYR1 (MYR1). |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G14180 | Myzus persicae-induced lipase 1;(source:Araport11) |
| AT2G05320 | beta-1,2-N-acetylglucosaminyltransferase II;(source:Araport11) |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
| AT5G64060 | NAC domain containing protein 103;(source:Araport11) |
| AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
| AT3G29035 | Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile. |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT2G24430 | NAC domain containing protein 38;(source:Araport11) |
| AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
| AT1G03490 | NAC domain containing protein 6;(source:Araport11) |
| AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT5G04400 | NAC domain protein;(source:Araport11) |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT5G14490 | NAC domain containing protein 85;(source:Araport11) |
| AT1G74390 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
| AT1G56080 | NAI1 interacting protein, involved in ER body formation. |
| AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT2G23050 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT3G12700 | Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression. |
| AT1G55370 | NDH-dependent cyclic electron flow 5;(source:Araport11) |
| AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
| AT2G35960 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not altered in response to cucumber mosaic virus or spermine. |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT1G32340 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not detected under normal conditions and in response to cucumber mosaic virus or spermine. |
| AT1G74360 | NILR1 encodes a serine/threonine kinase involved in defense response to nematodes. |
| AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT1G03470 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the nuclear membrane and the vacuolar membrane. |
| AT2G30500 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT3G51050 | NERD1 is a single copy locus encoding a protein of unknown function that is localized to the nucleus. Single mutants show defects in root hair growth, root meristem function, cell elongation. NERD1 appears to act synergistically with the exocyst in root development. |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT3G61970 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G08100 | Encodes a high-affinity nitrate transporter. |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT4G28600 | encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits. |
| AT4G13750 | Encodes NO VEIN (NOV), a plant-specific nuclear factor required for leaf vascular development, cellular patterning and stem cell maintenance in the root meristem, as well as for cotyledon outgrowth and separation. nov mutations affect many aspects of auxin-dependent development without directly affecting auxin perception. |
| AT5G37810 | NOD26-like intrinsic protein 4;(source:Araport11) |
| AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT4G19660 | Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
| AT1G15960 | member of Nramp2 family |
| AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
| AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
| AT5G01180 | Encodes a dipeptide transporter expressed in pollen and ovules during early seed development. GFP-tagged PTR5 localizes to the plasma membrane. |
| AT1G06670 | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins The mRNA is cell-to-cell mobile. |
| AT2G34720 | nuclear factor Y, subunit A4;(source:Araport11) |
| AT3G14020 | nuclear factor Y, subunit A6;(source:Araport11) |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT1G31817 | Ribosomal L18p/L5e family protein;(source:Araport11) |
| AT1G29940 | Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A). |
| AT1G63020 | Encodes one of two alternative largest subunits of a putative plant-specific RNA polymerase IV (aka RNA polymerase D). Required for posttranscriptional gene silencing. |
| AT2G27810 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT5G18870 | Similar to N terminal region of NSH1 nucleoside hydrolase. |
| AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11) |
| AT2G42070 | Encodes a plastid-localized Nudix hydrolase that has FAD pyrophosphohydrolase activity. Negative feedback regulation of the metabolism of flavins through the hydrolysis of FAD by AtNUDX23 in plastids is involved in the flavin homeostasis in plant cells. |
| AT2G04450 | Encodes a protein with NADH pyrophosphatase activity. Although this protein was also shown to have ADP-ribose diphosphatase activity in vitro, mutant analyses suggest that NUDX6 is involved in NADH metabolism in vivo. |
| AT5G47240 | nudix hydrolase homolog 8;(source:Araport11) |
| AT5G44160 | NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis. |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
| AT3G50410 | Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an important roles in plant growth and development. |
| AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
| AT3G27660 | Encodes oleosin4 (Plant Cell, 2006, 18:1961), a protein found in oil bodies, involved in seed lipid accumulation. Functions in freezing tolerance of seeds. Note: also referred to as OLE3 in Plant Journal 2008, 55:798. |
| AT4G27730 | oligopeptide transporter |
| AT5G02120 | Encodes a one helix protein homologous to cyanobacterial high-light inducible proteins. The protein is localized to the thylakoid membrane and its transcript is transiently induced by exposure to high light conditions. The mRNA is cell-to-cell mobile. |
| AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
| AT1G08070 | Encodes a chloroplast RNA editing factor. |
| AT2G02980 | Encodes a chloroplast RNA editing factor. |
| AT1G16390 | organic cation/carnitine transporter 3;(source:Araport11) |
| AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT2G31020 | OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11) |
| AT2G31030 | OSBP(oxysterol binding protein)-related protein 1B;(source:Araport11) |
| AT4G12460 | OSBP(oxysterol binding protein)-related protein 2B;(source:Araport11) |
| AT5G59420 | OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11) |
| AT2G30400 | ovate family protein 2;(source:Araport11) |
| AT5G58360 | ovate family protein 3;(source:Araport11) |
| AT1G06920 | Encodes OFP4, a member of the plant specific ovate family proteins. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. OFP4 interacts with KNAT7 to regulate secondary cell wall formation. |
| AT2G18500 | ovate family protein 7;(source:Araport11) |
| AT1G21900 | Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER. |
| AT5G18660 | Encodes a protein with 3,8-divinyl protochlorophyllide a 8-vinyl reductase activity. Mutants accumulate divinyl chlorophyll rather than monovinyl chlorophyll. |
| AT1G01860 | dimethyladenosine transferase |
| AT5G52780 | Chloroplast NAD(P)H dehydrogenase complex assembly factor. |
| AT4G37050 | Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid (ABA) or phosphate deficiency in roots. |
| AT4G29800 | PATATIN-like protein 8;(source:Araport11) |
| AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
| AT1G22530 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT1G11810 | Paternally expressed gene. |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT5G15080 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G01300 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G14720 | PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
| AT2G26440 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G47500 | predicted to encode a pectin methylesterase |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT2G47670 | PMEI6 pectin methylesterase inhibitor functions in establishing a patter of homogalacturonan methylesterification of seed coat cell wall proteins . |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT3G06430 | Encodes PPR2, a pentatricopeptide repeat protein. Binds to plastid 23S rRNA and plays an important role in the first mitotic division during gametogenesis and in cell proliferation during embryogenesis. |
| AT2G03380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
| AT1G47750 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G18160 | Peroxin 3-1;(source:Araport11) |
| AT5G56290 | Encodes the peroxisomal targeting signal type 1 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS1 consensus sequence (tripeptide SKL or a conserved variant) at the extreme C terminus. The protein has several domains, including C-terminal tetratricopeptide repeat motifs which act in binding the C-terminal "SKL" targeting signal. The mechanism of transport has been worked out in other organisms: The receptor recognizes and binds cytosolic PTS1-containing proteins. The PEX5-PTS1 complex binds a PEX14/PEX13 receptor complex at the peroxisome membrane and is translocated into the peroxisome matrix in a process dependent on PEX2,PEX10, and PEX12. In the peroxisome matrix, PEX5 releases its cargo and is recycled to the cytosol in a process dependent on PEX1, PEX4, PEX6 and PEX22. It is also involved, in conjunction with PEX7, in PTS1- and PTS2-dependent peroxisomal protein import. RNAi experiments suggest that PEX5 is necessary for the maintenance of both glyoxysomal and leaf peroxisomal functions. |
| AT1G29260 | Encodes the peroxisomal targeting signal type 2 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS2 consensus sequence (RLX5HL or a variant) within the first 30 or so amino acids. RNAi experiments suggest that PEX7 is necessary for the maintenance of glyoxysomal but not leaf peroxisomal function. The mRNA is cell-to-cell mobile. |
| AT1G04710 | EC2.3.1.16 thiolase. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
| AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT2G02230 | phloem protein 2-B1;(source:Araport11) |
| AT1G80110 | phloem protein 2-B11;(source:Araport11) |
| AT2G02250 | phloem protein 2-B2;(source:Araport11) |
| AT2G02280 | phloem protein 2-B4;(source:Araport11) |
| AT2G02300 | phloem protein 2-B5;(source:Araport11) |
| AT2G02340 | phloem protein 2-B8;(source:Araport11) |
| AT3G26570 | low affinity phosphate transporter |
| AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
| AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT5G57190 | Encodes the minor form of the two non-mitochondrail phosphatidylserine decarboxylase. The gene expression level is very low. Located at the tonoplast. |
| AT5G65690 | Encodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent). The mRNA is cell-to-cell mobile. |
| AT3G14940 | Encodes a cytosolic phosphoenolpyruvate carboxylase (PEPC) that has activity when expressed in E.coli. Its mRNA is most abundantly expressed in roots and siliques. PPC3 belongs to the plant-type PEPC family. It can form an enzymatically active complex with a castor bean ortholog of PPC4, which encodes a bacterial-type PEPC. The mRNA is cell-to-cell mobile. |
| AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
| AT5G47810 | phosphofructokinase 2;(source:Araport11) |
| AT4G29460 | Encodes one of the four Arabidopsis phospholipase PLA2 parologs: AT2G06925 (PLA2-ALPHA), AT2G19690 (PLA2-BETA), AT4G29460 (PLA2-GAMMA) and AT4G29470 (PLA2-DELTA). Involved in pollen development and germination and tube growth. |
| AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT2G38670 | Encodes a mitochondrial ethanolamine-phosphate cytidylyltransferase, involved in phosphatidylethanolamine (PE) biosynthesis. |
| AT1G25520 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT4G03280 | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT1G67740 | PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts where it is processed into two integral membrane proteins with identical topology (PsbY-1 and PsbY-2). The protein appears to bind manganese. Important for the redox control of cytochrome b559. |
| AT2G30170 | Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens. |
| AT2G34420 | Photosystem II type I chlorophyll a/b-binding protein |
| AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT1G06680 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. Phosphorylation of this protein is dependent on calcium. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the stroma. The mRNA is cell-to-cell mobile. |
| AT5G20360 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G24120 | MYB-CC protein involved in regulation of response to phosphate starvation. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT5G53890 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation. |
| AT1G05320 | myosin heavy chain, embryonic smooth protein;(source:Araport11) |
| AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
| AT5G12130 | integral membrane TerC family protein;(source:Araport11) |
| AT1G66520 | formyltransferase;(source:Araport11) |
| AT1G80770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT1G20925 | Member of family of proteins that are similar to PIN auxin transporter. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT3G18660 | Plants expressing an RNAi construct specifically targeting PGSIP1 was shown to have a dramatically reduced amount of starch. Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT5G42340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G62560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
| AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT1G66840 | Encodes a coiled-coil protein WEB2 (weak chloroplast movement under blue light 2, also named PMI2/plastid movement impaired 2). Involved in chloroplast avoidance movement under intermediate and high light intensities. WEB2, together with another coiled-coil protein WEB1 (AT2G26570), maintains the chloroplast photorelocation movement velocity. |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT5G65220 | Ribosomal L29 family protein;(source:Araport11) |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G09210 | plastid transcriptionally active 13;(source:Araport11) |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT2G38140 | plastid-specific ribosomal protein 4 (PSRP4) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT5G65158 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT1G51190 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
| AT1G01780 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. The mRNA is cell-to-cell mobile. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT4G31805 | Encodes POLAR, a scaffold protein associated with cellular asymmetry of meristemoids. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
| AT3G42880 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G22200 | Genetically redundant with POP3;mediates pollen tube guidance. Double mutants are self sterile; gamma-aminobutyrate transaminase subunit precursor; nuclear gene for mitochondrial product. Encodes gamma-aminobutyrate transaminase that uses pyruvate instead of alpha-ketoglutarate as cosubstrate. Mutations in POP2/HER1 render roots resistant to the inhibitory growth effects of the volatile organic compound E-2-hexenal implicated in plant defense. |
| AT1G34140 | polyadenylate-binding protein, putative / PABP, putative, non-consensus splice donor TA at exon 1; similar to polyadenylate-binding protein (poly(A)-binding protein) from (Triticum aestivum) GI:1737492, (Nicotiana tabacum) GI:7673355, {Arabidopsis thaliana} SP:P42731; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Only member of the class IV PABP family. |
| AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
| AT2G31320 | Encodes a poly(ADP-ribose) polymerase. |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
| AT2G16130 | polyol/monosaccharide transporter 2;(source:Araport11) |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT5G53180 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT1G32530 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G06090 | homolog of prePIP1 |
| AT5G05380 | prenylated RAB acceptor 1.B3;(source:Araport11) |
| AT5G07110 | Encodes PRA1.B6, an isoform of the PRA1 (Prenylated Rab acceptors) family. PRAs bind to prenylated Rab proteins and possibly aids in targeting Rabs to their respective compartments. PRA1.B6 localizes to the Golgi apparatus and its ER-to-Golgi trafficking and localization to the Golgi apparatus are regulated by multiple sequence motifs in both the C- and N-terminal cytoplasmic domains. |
| AT1G17700 | prenylated RAB acceptor 1.F1;(source:Araport11) |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT5G58750 | Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases). |
| AT2G39890 | Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem. |
| AT5G38560 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT2G23096 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
| AT3G55480 | Encodes PAT2, a putative beta-subunit of adaptor protein complex 3 (AP-3) that can partially complement the corresponding yeast mutant. Mediates the biogenesis and function of lytic vacuoles. |
| AT5G38900 | Thioredoxin superfamily protein;(source:Araport11) |
| AT4G32190 | Encodes a plastid-located coiled coil-containing protein that is required for normal starch granule initiation in Arabidopsis chloroplasts. Mutants lacking MRC have fewer starch granules per chloroplast than the wild type. Interacts with PTST2 (At1g27070), which is also required for normal starch granule initiation (DOI:10.1105/tpc.18.00219). |
| AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
| AT2G02800 | Encodes protein kinase APK2b. |
| AT5G19680 | PP1 Regulatory Subunit3. Interacts with members of the Type One Protein Phosphatases (TOPP) family.Facilitates the nuclear localization of TOPP4 which is required for its activity in mediating ABA responses. |
| AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
| AT1G68820 | Putative C3HC4 zinc-finger ubiquitin E3 ligase, negative regulator in ABA and drought stress response. May act as a positive role in regulating the high temperature by mediating the degradation of unknown target proteins. |
| AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
| AT3G25840 | Spliceosome-associated kinase involved in alternative splicing. May influence alternative splicing patterns by phosphorylating a subset of splicing regulators. |
| AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
| AT1G49350 | PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT1G30755 | elongation factor G, putative (DUF668);(source:Araport11) |
| AT1G35750 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT4G08840 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G01410 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G78160 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G44750 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G32770 | purple acid phosphatase 13;(source:Araport11) |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT3G07130 | Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination. |
| AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT5G36150 | putative pentacyclic triterpene synthase 3;(source:Araport11) |
| AT2G26040 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
| AT3G25140 | Quasimodo1, encodes a glycosyltransferase, involved in homogalacturonan biosynthesis; mutant shows cell adhesion defect and lower wall uronic acid content. The mRNA is cell-to-cell mobile. |
| AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
| AT5G43160 | QWRF motif protein (DUF566);(source:Araport11) |
| AT5G09550 | GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11) |
| AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11) |
| AT5G45750 | RAB GTPase homolog A1C;(source:Araport11) |
| AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
| AT5G47520 | RAB GTPase homolog A5A;(source:Araport11) |
| AT4G17160 | RAB GTPase homolog B1A;(source:Araport11) |
| AT3G16100 | RAB GTPase homolog G3C;(source:Araport11) |
| AT4G39890 | RAB GTPase homolog H1C;(source:Araport11) |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G45970 | Encodes a Rac-like protein ARAC2. A member of ROP GTPase gene family. |
| AT5G21900 | Contributes to UV tolerance through nucleotide excision repair. |
| AT3G46930 | Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses. |
| AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT1G23147 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
| AT3G63130 | Encodes a RAN GTPase activating protein involved in nuclear import, cell plate formation and mitotic spindle formation. Associates with nuclear envelope membranes. |
| AT1G35470 | Encodes a homologue of human RanBPM that belongs to the uncharacterized family of plant SPRY, LisH, CTLH and CRA domain-containing proteins. |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
| AT3G05890 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT1G71390 | receptor like protein 11;(source:Araport11) |
| AT1G71400 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile. |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G25470 | receptor like protein 21;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT2G33060 | receptor like protein 27;(source:Araport11) |
| AT3G11010 | receptor like protein 34;(source:Araport11) |
| AT3G11080 | receptor like protein 35;(source:Araport11) |
| AT3G28890 | receptor like protein 43;(source:Araport11) |
| AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
| AT1G34290 | receptor like protein 5;(source:Araport11) |
| AT5G27060 | receptor like protein 53;(source:Araport11) |
| AT5G45770 | receptor like protein 55;(source:Araport11) |
| AT1G47890 | receptor like protein 7;(source:Araport11) |
| AT1G58190 | receptor like protein 9;(source:Araport11) |
| AT5G67280 | receptor-like kinase;(source:Araport11) |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT1G19090 | receptor-like serine/threonine kinase (RKF2) |
| AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
| AT2G48110 | Encodes a novel protein of unknown function with homologs in non-seed plants. Sequence analysis predicts membrane spanning domains and a putative protein-protein interaction domain. Semi-dominant mutations display defects in phenylpropanoid accumulation suggesting a role in phenylpropanoid metabolism. It has been shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Required for expression of some dark-upregulated genes. |
| AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT3G06550 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Mutants show reduced cell wall polysaccharide acetylation and increased resistance to Botrytis cinerea. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT1G20920 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G79950 | Encodes a homologue of human Regulator of Telomere Elongation Helicase1 (RTEL1). Plays a central role in the preservation of genome stability. |
| AT4G02260 | Displays guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity but not guanosine-3',5'-bis(diphosphate) 3'-diphosphate synthase activity. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
| AT3G48430 | Relative of Early Flowering 6 (REF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a positive regulator of flowering in an FLC-dependent pathway. REF6 mutants have hyperacetylation of histone H4 at the FLC locus. REF6 interacts with BES1 in a Y2H assay and in vitro. REF6 may play a role in brassinoteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. It is most closely related to the JHDM3 subfamily of JmjN/C proteins. The mRNA is cell-to-cell mobile. |
| AT1G77470 | Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent. |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT2G16210 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT4G31615 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT1G74810 | HCO3- transporter family;(source:Araport11) |
| AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
| AT3G07040 | Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1. |
| AT1G11330 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile. |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT2G01760 | member of Response Regulator: B- Type |
| AT5G04890 | Specifically restricts the long-distance movement of tobacco etch potyvirus (TEV) without involving either hypersensitive cell death or systemic acquired resistance. Multidomain protein containing an N-terminal region with high similarity to plant small heat shock proteins (HSPs). |
| AT4G28430 | Reticulon family protein;(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
| AT3G09600 | Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response. |
| AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT2G12646 | Plant AT-rich sequence and zinc-binding transcription factor (PLATZ) family protein which plays central role in mediating RGF1 signalling. Controls root meristem size through ROS signalling. |
| AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT3G51300 | Encodes a pollen-specific Rop GTPase, member of the Rho family of small GTP binding proteins that interacts with RIC3 and RIC4 to control tip growth in pollen tubes. These three proteins promote the proper targeting of exocytic vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1 GTPase activator protein. |
| AT3G48040 | Encodes a member of the Rop subfamily of Rho GTPases in Arabidopsis that contains a putative farnesylation motif. It is localized to the plasma membrane and involved in the negative regulation of ABA signalling. |
| AT1G20090 | Member of the Rho GTPase family. Functions to organize the microtubular cytoskeleton in combination with RIC1 and RIC4. These interactions affect pavement cell morphogenesis and pollen tube growth. ROP2 expression is stimulated by brassinosteroid treatment. Inhibit light-induced stomatal opening. The mRNA is cell-to-cell mobile. |
| AT4G28950 | A member of ROP GTPase gene family. |
| AT1G25290 | Predicted to be a plastid rhomboid protease. Mutants show defects in phosphatidic acid metabolism. |
| AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
| AT2G02990 | Encodes a member of the ribonuclease T2 family that responds to inorganic phosphate starvation, and inhibits production of anthocyanin. Also involved in wound-induced signaling independent of jasmonic acid. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
| AT2G01290 | Cytosolic ribose-5-phosphate isomerase. Knockout mutation causes chloroplast dysfunction, late flowering and premature cell death. |
| AT3G25920 | encodes a plastid ribosomal protein CL15, a constituent of the large subunit of the ribosomal complex |
| AT1G69620 | putative 60S ribosomal protein L34 The mRNA is cell-to-cell mobile. |
| AT3G44590 | cytosolic ribosomal protein gene, part of bL12 family |
| AT4G29430 | ribosomal protein S15A E;(source:Araport11) |
| AT1G79850 | nuclear-encoded 30S chloroplast ribosomal protein S17 |
| AT3G16780 | Ribosomal protein L19e family protein;(source:Araport11) |
| AT3G01650 | Encodes RGLG1 (RING domain ligase 1), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. ABA inhibits myristoylation and induces shuttling of the RGLG1 to promote nuclear degradation of PP2CA. |
| AT3G45570 | RING/U-box protein with C6HC-type zinc finger domain-containing protein;(source:Araport11) |
| AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
| AT3G11770 | RICE1 is a 23kDa protein with 3?- 5? exoribonuclease activity. It is expressed ubiquitously and localized to the cytoplasm. When RICE1 and its paralog RICE2 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage. |
| AT1G29720 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G29740 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT5G14610 | DEAD box RNA helicase family protein;(source:Araport11) |
| AT1G14790 | Encodes RNA-dependent RNA polymerase. While not required for virus-induced post-transcriptional gene silencing (PTGS), it can promote turnover of viral RNAs in infected plants. Nomenclature according to Xie, et al. (2004). Involved in the production of Cucumber Mosaic Virus siRNAs. |
| AT4G11130 | Encodes RNA-dependent RNA polymerase that is required for endogenous siRNA (but not miRNA) formation. Nomenclature according to Xie, et al. (2004). |
| AT4G00660 | RNAhelicase-like 8;(source:Araport11) |
| AT3G20420 | double-stranded RNA binding / ribonuclease III. Required for 3' external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo. Localizes in the nucleus and cytoplasm. |
| AT5G45150 | RNAse THREE-like protein 3;(source:Araport11) |
| AT3G54280 | ROOT GROWTH DEFECTIVE 3;(source:Araport11) |
| AT3G51460 | Encodes RHD4 (ROOT HAIR DEFECTIVE4), a phosphatidylinositol-4-phosphate phosphatase required for root hair development. The mRNA is cell-to-cell mobile. |
| AT1G66470 | ROOT HAIR DEFECTIVE6;(source:Araport11) |
| AT1G05990 | EF hand calcium-binding protein family;(source:Araport11) |
| AT1G16440 | Member of AGC VIIIa Kinase gene family. Invovled in the maintenance of (p)ppGpp level to accustom plastidial gene expression to darkness. |
| AT5G45710 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G51451 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT3G45890 | Encodes RUS1 (root UVB sensitive 1), a protein that contains DUF647 (domain of unknown function 647), a domain highly conserved in eukaryotes. The primary root of rus1 is hypersensitive to very low-fluence-rate (VLF) UVB. |
| AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G01700 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
| AT5G05940 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G02010 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Required for periodic formation of secondary cell wall pits. |
| AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
| AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT2G37080 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
| AT5G60210 | Encodes RIP5 (ROP interactive partner 5), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
| AT3G25230 | Encodes a a high molecular weight member of the FK506 binding protein (FKBP) family. It has three FKBP12-like domains, tetratricopeptide repeats, and a putative calmodulin binding domain. Modulates thermotolerance by interacting with HSP90.1 and affecting the accumulation of HsfA2-regulated sHSPs. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G53232 | ROTUNDIFOLIA like 1;(source:Araport11) |
| AT3G14362 | ROTUNDIFOLIA like 10;(source:Araport11) |
| AT1G17235 | This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation. |
| AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
| AT5G16023 | Encodes a plant peptide that could be involved in the coordination of socket cell development in wild-type plants. |
| AT5G26760 | Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation. |
| AT1G11350 | S-domain-1 13;(source:Araport11) |
| AT2G41530 | Encodes a protein with S-formylglutathione hydrolase activity. |
| AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
| AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
| AT5G41920 | Encodes a GRAS family transcription factor that is involved in bundle sheath cell fate specification. |
| AT1G63100 | Transcription factor belonging to the GRAS family which controls the mitotic cell cycle and division plane orientation. |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
| AT1G03550 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
| AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile. |
| AT4G26740 | Encodes caleosin, a 27-kDa protein found within seed lipid bodies. Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27. Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT3G23800 | selenium-binding protein 3;(source:Araport11) |
| AT5G14930 | encodes an acyl hydrolase involved in senescence . |
| AT2G29350 | Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis. |
| AT5G56760 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT2G23000 | serine carboxypeptidase-like 10;(source:Araport11) |
| AT2G12480 | serine carboxypeptidase-like 43;(source:Araport11) |
| AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
| AT3G10450 | serine carboxypeptidase-like 7;(source:Araport11) |
| AT4G11640 | Serine racemase, which is a bifunctional PLP-dependent enzyme catalyzing racemization of serine and dehydration of serine to pyruvate in the same way as mammalian serine racemases. similar to mammalian serine racemases. |
| AT1G09140 | Encodes a serine-arginine rich RNA binding protein involved in regulation of splicing (including splicing of itself). Exists as 3 alternative spliced forms that are differentially expressed. AT1G09140.1 predominantly accumulates in the cytosol in light grown plants.Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT4G15410 | serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B prime gamma;(source:Araport11) |
| AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
| AT5G17240 | SET domain group 40;(source:Araport11) |
| AT4G27910 | Encodes a SET domain containing protein, putative H3K4 methyltransferase. Involved in bolting/flowering time together with ATX1 and ATX3. |
| AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
| AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT1G31935 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
| AT5G52290 | Encodes a protein with similarity to XPF endonucleases. Loss of function mutations have defects in meiosis- specifically a reduction in the number of chiasmata. As a result both pollen and embryo sacs are abnormal and plants have severely reduced fertility. |
| AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
| AT5G24740 | Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root. |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT1G07500 | SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
| AT3G27630 | SMR7 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
| AT2G22300 | Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
| AT2G35510 | Encodes a WWE domain-containing protein with 76% similarity to RCD1. The protein also contains a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
| AT1G70440 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
| AT3G01320 | Encodes SIN3-like 1, a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT2G02350 | encodes a protein containing an F-box domain and physically interacts with SCF subunit SKP1/ASK1. The protein also exhibits similarity in sequence to phloem protein 2 (PP2) from cucumber. |
| AT3G60010 | SKP1-like 13;(source:Araport11) |
| AT3G61415 | SKP1-like 21;(source:Araport11) |
| AT3G60020 | SKP1-like 5;(source:Araport11) |
| AT3G53060 | SKP1-like 6;(source:Araport11) |
| AT2G17030 | Encodes a SKP1/ASK-interacting protein. |
| AT1G55570 | SKU5 similar 12;(source:Araport11) |
| AT1G55560 | SKU5 similar 14;(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT1G62262 | Predicted to encode a protein with similarity to the SLAC1 protein involved in ion homeostasis in guard cells. |
| AT5G18020 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34780 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G31320 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G42410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G20220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G43040 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G40430 | Encodes a homolog of yeast NOP53 that is an important regulator of cell division during organ growth. |
| AT5G55170 | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
| AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
| AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
| AT2G40130 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT3G16600 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
| AT5G02600 | Encodes a phloem mobile metal binding protein necessary for phloem function and root meristem maintenance. |
| AT5G06140 | Homolog of yeast retromer subunit VPS5. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. In roots it co-localizes with the PIN2 auxin efflux carrier. Involved in endocytic sorting of membrane proteins including PIN2, BOR1 and BRI1. |
| AT1G15240 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT2G15900 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT2G28150 | DUF966 domain containing protein, expressed during embryogenesis. |
| AT2G23510 | BAHD acyltransferase which transfers acyl-groups from different acyl-donors specifically to amines. Catalyzes the multisite acylation of spermidine. Uses caffeoyl/feruoyl/sinapoyl-CoA with the N1 and N10 positions of spermidine. |
| AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
| AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT3G58490 | Encodes a long-chain base 1-phosphate (LCBP) phosphatase that is expressed in the endoplasmic reticulum. |
| AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
| AT4G16340 | Encodes SPIKE1 (SPK1), the lone DOCK family guanine nucleotide exchange factor (GEF) in Arabidopsis. SPK1 is a peripheral membrane protein that accumulates at, and promotes the formation of, a specialized domain of the endoplasmic reticulum (ER) termed the ER exit site (ERES). SPK1 promotes polarized growth and cell-cell adhesion in the leaf epidermis. Mutant has seedling lethal; cotyledon, leaf-shape, trichome defects. |
| AT4G34650 | Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function. |
| AT3G57920 | Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. |
| AT5G18830 | Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c. |
| AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
| AT5G56040 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
| AT3G56480 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G04110 | Initially identified as a mutation affecting stomatal development and distribution. Encodes a protein similar to serine proteases. |
| AT1G51840 | kinase-like protein;(source:Araport11) |
| AT1G51850 | Malectin-like receptor-like kinase involved in MAMP mediated stomatal immunity. Interacts with BAK1/FLS2 signaling complex and subsequently phosphorylates and activates SLAC1. |
| AT3G13065 | STRUBBELIG-receptor family 4;(source:Araport11) |
| AT4G22130 | STRUBBELIG-receptor family 8;(source:Araport11) |
| AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT3G04740 | encodes a protein with similarities to subunits of the Mediator complex, required for RNA polymerase II recruitment at target promoters in response to specific activators. Lines carrying loss of function mutations in the gene have reduced cell numbers in aerial organs. On the other hand, lines overexpressing the gene have increased number of small cells in clusters, suggesting cell division is more unsynchronized in the overexpressors.Required for expression of CBF-controlled cold-responsive genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes. Required for expression of some dark-upregulated genes. |
| AT1G17770 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A paternally expressed imprinted gene. |
| AT5G51750 | subtilase 1.3;(source:Araport11) |
| AT5G59090 | subtilase 4.12;(source:Araport11) |
| AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
| AT5G10020 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
| AT1G77210 | AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose. |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
| AT3G10370 | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion. |
| AT1G22150 | sulfate transporter Sultr1;3 |
| AT5G19600 | Encodes sulfate transporter Sultr3;5. |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
| AT5G20840 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G16890 | Encodes a Toll Interleukin1 receptor-nucleotide binding-Leu- rich repeat-type resistance gene (TIR-NB-LRR-type) involved in the salicylic acid-dependent defense response pathway. Mutant plants constitutively express pathogenesis-related (PR) genes and are pathogen resistant. Resistance signaling in snc1 requires EDS1, MOS3 and PAD4. |
| AT1G65660 | Encodes a CCHC zinc finger protein that may function as a step II splicing factor. In an epigenetic allele of SMP1 (in which SMP1 and SMP2 mRNA is reduced) organs are smaller and contain fewer cells. |
| AT5G43130 | TBP-associated factor 4;(source:Araport11) |
| AT1G68800 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Transcription level and mutant phenotype are weaker than its homolog BRC1 (At3G18550). |
| AT3G45150 | TCP domain protein 16;(source:Araport11) |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT1G72010 | Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT1G58100 | Encodes TCP8, belongs to the TCP transcription factor family known to bind site II elements in promoter regions. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT4G32700 | Encodes a DNA polymerase required for microhomology mediated repair of DNA double strand breaks and is required for T-DNA integration. The protein contains two conserved functional domains: an N-terminal superfamily II DNA/RNA helicase domain and a C-terminal prokaryotic-type DNA polymerase I domain. Required for regulated cell division and differentiation in meristems. Mutant plants show morphological defects, such as short roots, serrated leaves, and fasciation, as well as defective patterns of cell division and differentiation in the meristem. Mutant plants had 2.5 to 4.5-fold higher expression of ATGR1, ATBRCA1 and RAD51 genes. TEB is required for normal progression of DNA replication and for correct expression of genes during development. |
| AT3G09290 | encodes activation factor TAC1 which mediates telomerase activity |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT3G47620 | Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT2G03840 | TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development. |
| AT2G01960 | Member of TETRASPANIN family |
| AT2G23810 | Member of TETRASPANIN family |
| AT4G30430 | Member of TETRASPANIN family |
| AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G65160 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G12430 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G33400 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT1G77920 | bZIP transcription factor family protein;(source:Araport11) |
| AT2G46280 | Encodes a homolog of mammalian TGF-beta receptor interacting protein. Co-immunoprecipitates with BRI1 and can be phosphorylated in vitro by BRI1 at specific sites (Thr-14, Thr-89, and either Thr-197 or Ser-198). May therefore be a cytoplasmic BRI1 substrate and involved in brassinosteroid regulated plant growth and development.The encoded protein has two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT4G24180 | Root-specific expression activated in response to rhizobacteria and ACC. Role in induced systemic resistance. |
| AT5G26000 | member of Glycoside Hydrolase Family 1. encodes one of two known functional myrosinase enzymes in Arabidopsis. The enzyme catalyzes the hydrolysis of glucosinolates into compounds that are toxic to various microbes and herbivores. |
| AT1G72260 | Encodes a thionin which is a cysteine rich protein having antimicrobial properties. Thi2.1 is expressed in response to a variety of pathogens and induced by ethylene and jasmonic acid. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
| AT2G18990 | thioredoxin-like/ATP-binding protein;(source:Araport11) |
| AT5G16400 | Encodes an f-type thioredoxin (Trx-f2) localized in chloroplast stroma. |
| AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
| AT3G06730 | Encodes a plastidial thioredoxin (TRX) isoform that defines a branch of plastidial TRXs lying between x- and y-type TRXs and thus was named TRX z. Possesses disulfide reductase activity in vitro. TRX z was previously named as Trx p (thioredoxin putative and plastidic) before its thioredoxin activity was confirmed (Meng et al., PNAS 2010, 107:3900). Knockout mutant of TRX z has a severe albino phenotype and is inhibited in chloroplast development. Two fructokinase-like proteins (FLN1 and FLN2), members of the pfkB-carbohydrate kinase family, are potential TRX z targets. |
| AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT3G07800 | Encodes a thymidine kinase that salvages DNA precursors. |
| AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
| AT1G08260 | Similar to POL2A, DNA polymerase epsilon catalytic subunit. Essential for Arabidopsis growth. Null homozygotes are embryo lethal, partial loss of function alleles show embryo patterning defects such as root pole displacement. Delayed progression through cell cycle results in embryos with smaller numbers of larger cells. |
| AT2G27120 | Encodes a protein with similarity to DNA polymerase epsilon catalytic subunit. Based on yeast two hybrid analysis, not predicted to be a subunit of the DNA polymerase epsilon complex. No phenotype observed in homozygous mutant embryos or plants but in combination with TIL1-1/til1-1 heterozygotes arrest earlier than til1 homozygotes suggesting TIL2 functions redundantly with TIL1. |
| AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT4G23020 | hypothetical protein;(source:Araport11) |
| AT3G61380 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT4G00440 | GPI-anchored adhesin-like protein, putative (DUF3741);(source:Araport11) |
| AT5G51850 | hypothetical protein;(source:Araport11) |
| AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
| AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein;(source:Araport11) |
| AT4G00770 | DUF4378 domain protein;(source:Araport11) |
| AT4G35300 | tonoplast monosaccharide transporter2;(source:Araport11) |
| AT1G15750 | Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. |
| AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
| AT5G13420 | Transaldolase which contributes to reactive oxygen species homeostasis in response to Glc during early seedling growth. |
| AT3G05540 | Encodes TCTP2, a homolog of Translationally Controlled Tumor Protein. Enhances in vitro plant regeneration. |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT1G49410 | translocase of the outer mitochondrial membrane 6;(source:Araport11) |
| AT3G55120 | Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems. Co-expressed with CHS. |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT1G78090 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G22210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G03780 | Encodes a protein whose sequence is similar to human telomere proteins. This belongs to TRFL family 2, which do not show DNA binding in vitro. |
| AT3G12560 | Encodes a telomeric DNA-binding protein. |
| AT5G53770 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G19160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G01080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G01360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
| AT5G49340 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G30900 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G20590 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G19835 | TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly. |
| AT2G45730 | eukaryotic initiation factor 3 gamma subunit family protein;(source:Araport11) |
| AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
| AT5G19200 | Encodes one of the Arabidopsis proteins (At3g06060/TSC10A and At5g19200/TSC10B) with significant similarity to the yeast 3-ketodihydrosphinganine (3-KDS) reductase, Tsc10p. Both TSC10A and TSC10B are bona fide 3-KDS reductase as shown by complementation experiment in yeast. |
| AT1G52410 | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. The mRNA is cell-to-cell mobile. |
| AT3G27060 | Encodes one of the 3 ribonucleotide reductase (RNR) small subunit genes. TSO2 transcription occurs predominantly at the S-phase of the cell cycle and its expression pattern is consistent with its role in dNDP biosynthesis during DNA replication in actively dividing cells. Critical for cell cycle progression, DNA damage repair and plant development. |
| AT2G47770 | Encodes a membrane-bound protein designated AtTSPO (Arabidopsis thaliana TSPO-related). AtTSPO is related to the bacterial outer membrane tryptophan-rich sensory protein (TspO) and the mammalian mitochondrial 18 kDa Translocator Protein (18 kDa TSPO), members of the TspO/MBR domain-containing membrane proteins. Mainly detected in dry seeds, but can be induced in vegetative tissues by osmotic or salt stress or abscisic acid treatment. Located in endoplasmic reticulum and the Golgi stacks. It is degraded through the autophagy pathway. |
| AT1G20010 | beta tubulin |
| AT3G05580 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with TOPP8 (AT5G27840). |
| AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
| AT3G13855 | U6;(source:Araport11) |
| AT5G46315 | U6-29;(source:Araport11) |
| AT1G55060 | Ubiquitin-like gene, believed to be a pseudogene because of amino acid substitutions in 3 of the 5 ubiquitin repeats found in the UBQ12 gene product |
| AT3G09790 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. |
| AT2G30110 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. Mutant is able to revert the constitutive defense responses phenotype of snc1, which indicates the gene is involved in defense response. It also indicates that ubiquitination plays a role in plant defense signalling. |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT2G16920 | ubiquitin-conjugating enzyme 23;(source:Araport11) |
| AT3G24515 | ubiquitin-conjugating enzyme 37;(source:Araport11) |
| AT1G11980 | ubiquitin-related protein 3;(source:Araport11) |
| AT4G31670 | ubiquitin-specific protease 18;(source:Araport11) |
| AT4G17895 | Encodes a ubiquitin-specific protease. |
| AT3G14400 | Encodes a ubiquitin-specific protease. |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT2G27860 | Encodes UDP-d-apiose/UDP-d-xylose synthase that requires NAD+ for enzymatic activity and is strongly inhibited by UDP-d-galacturonate. |
| AT1G08200 | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
| AT4G23920 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in growth and cell wall carbohydrate biosynthesis. |
| AT4G10960 | Encodes a protein with UDP-D-glucose 4-epimerase activity. |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
| AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
| AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
| AT2G15480 | UDP-glucosyl transferase 73B5;(source:Araport11) |
| AT1G05530 | Encodes a protein with glucosyltransferase activity with high sequence homology to UGT1 (AT1G05560). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT2 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05890 | Encodes a nicotinate-N-glycosyltransferase. |
| AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
| AT2G23260 | UDP-glucosyltransferase that acts on a number of substrates including IAA and PAA. |
| AT2G23250 | UDP-glucosyl transferase 84B2;(source:Araport11) |
| AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
| AT2G15490 | UDP-glycosyltransferase 73B4;(source:Araport11) |
| AT1G21070 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT4G09810 | Nucleotide-sugar transporter family protein. Can function in yeast as glucose transporter. |
| AT2G28315 | UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and ER. UXT1 functions as a UDP-Xyl transporter. The mRNA is cell-to-cell mobile. |
| AT4G12860 | EF hand calcium-binding protein family;(source:Araport11) |
| AT1G78130 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT2G35035 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT4G01450 | nodulin MtN21-like transporter family protein |
| AT4G30420 | nodulin MtN21-like transporter family protein |
| AT1G70260 | Encodes an endoplasmic reticulum (ER)-localized nodulin MtN21-like transporter family protein that negatively regulates resistance against biotrophic pathogens but not the necrotrophic pathogen, B. cinerea, possibly by regulating ROS production, cell death and PR1 expression. |
| AT4G16620 | nodulin MtN21-like transporter family protein |
| AT5G59920 | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT2G14740 | Encodes a vacuolar sorting receptor that participates in vacuolar sorting in vegetative tissues and in seeds. The mRNA is cell-to-cell mobile. |
| AT3G08560 | vacuolar H+-ATPase subunit E isoform 2;(source:Araport11) |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT1G03950 | vacuolar protein sorting-associated protein 2.3;(source:Araport11) |
| AT2G30290 | VACUOLAR SORTING RECEPTOR 2;(source:Araport11) |
| AT3G52850 | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles. The mRNA is cell-to-cell mobile. |
| AT1G57820 | Encodes a 645-amino acid methylcytosine-binding protein with a PHD domain, two RING finger domains, and an SRA domain that is involved in centromere heterochromatinization. This protein functions as an E3 ubiquitin ligase in vitro. The protein has been shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the former. It plays a role in the establishment/maintenance of chromatin structure during cell division and is localized in the nucleus. Plants over-expressing VIM1/ORTH2 show an inhibition in root growth and a delay in flowering. Both over-expression of GFP:ORTH2 and loss of ORTH2/VIM1 lead to decreased levels of DNA methylation. GFP:ORTH2 over-expressers also have increased levels of FWA transcripts. |
| AT1G57800 | predicted to encode a protein with an N-terminal PHD domain and two RING domains surrounding an SRA domain. Attempts to isolate ORTH3/VIM5 cDNA through RT-PCR were unsuccessful and only one Arabidopsis EST is associated with this locus. A paternally expressed imprinted gene. |
| AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
| AT3G50080 | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
| AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
| AT4G37710 | VQ motif-containing protein;(source:Araport11) |
| AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development. |
| AT1G21240 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
| AT1G16160 | WAK-like kinase The mRNA is cell-to-cell mobile. |
| AT1G21270 | cytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase. |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G35880 | Microtubule-stabilizing protein. |
| AT3G07760 | Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. However in Arabidopsis no morphological branching defect has been observed in mutant lines. |
| AT2G39120 | Encodes a mitochondrial protein essential for the splicing of group II introns in two mitochondrial genes for which splicing factors had not previously been identified: rpl2 and ccmFc. |
| AT1G56510 | TIR-NB-LRR protein that confers resistance to four races of Albugo candida. The mRNA is cell-to-cell mobile. |
| AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT3G22420 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
| AT5G27940 | WPP domain protein 3;(source:Araport11) |
| AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
| AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
| AT2G30590 | Encodes WRKY DNA-binding protein 21 (WRKY21). |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT3G01080 | member of WRKY Transcription Factor; Group I |
| AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT1G20700 | Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
| AT5G59340 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain. |
| AT3G23280 | Encodes a ubiquitin ligase that is a novel player in ethylene signaling involved in negatively regulating apical hook curvature, with alternative splicing controlling dual targeting to the nuclear and cytoplasmic compartments. |
| AT5G64080 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G25820 | Encodes a xyloglucan endotransglycosylase with a clear preference for non-fucosylated xyloglucan polymer. The mRNA is cell-to-cell mobile. |
| AT3G23730 | xyloglucan endotransglucosylase/hydrolase 16;(source:Araport11) |
| AT1G65310 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
| AT1G14720 | member of Glycoside Hydrolase Family 16 |
| AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
| AT1G08465 | Member of the YABBY family of Arabidopsis proteins involved in the abaxial cell fate specification in lateral organs |
| AT3G06290 | Encodes a component of the conserved TREX-2 complex that couples mRNA transcription with nucleo-cytoplasmic export, that is required for prevention of epigenetic gene silencing and has additional roles in regulating siRNAs and DNA methylation. |
| AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
| AT1G56590 | Involved in vesicle trafficking between the trans -Golgi network and vacuoles. |
| AT2G32930 | Encodes a zinc finger protein. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT5G25160 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
| AT1G55910 | member of Putative zinc transporter ZIP2 - like family |
| AT2G37740 | zinc-finger protein 10;(source:Araport11) |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |