37 senescence-associated transcription factors (Sen-TFs) ChIP-seq or DAP-seq data
| WRKY55 Targets | Description |
| AT1G44760 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT3G14280 | LL-diaminopimelate aminotransferase;(source:Araport11) |
| AT4G13690 | RNA-binding protein;(source:Araport11) |
| AT2G32905 | B3 domain protein, putative (DUF313);(source:Araport11) |
| AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
| AT3G48640 | transmembrane protein;(source:Araport11) |
| AT1G67590 | Remorin family protein;(source:Araport11) |
| AT2G15650 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.0e-227 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT4G03020 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G28830 | mucin-like protein, putative (DUF1216);(source:Araport11) |
| AT3G42780 | hypothetical protein;(source:Araport11) |
| AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
| AT1G74820 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G04490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G03370 | C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11) |
| AT1G67060 | peptidase M50B-like protein;(source:Araport11) |
| AT5G63040 | transmembrane protein;(source:Araport11) |
| AT3G32917 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.0e-114 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT1G07580 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT4G17260 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT3G60940 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT3G47800 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G31355 | pseudogene of Translation protein SH3-like family protein;(source:Araport11) |
| AT5G14130 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G58090 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G51400 | PLAC8 family protein;(source:Araport11) |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT1G04390 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT1G67240 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.5e-23 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT3G14430 | GRIP/coiled-coil protein;(source:Araport11) |
| AT5G44306 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G40920 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G33200 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 28%25 identity and 4.2e-16 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
| AT5G62580 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G17590 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G03460 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G13500 | hypothetical protein;(source:Araport11) |
| AT1G30550 | S-adenosyl-L-methionine-dependent methyltransferase superfamily protein;(source:Araport11) |
| AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
| AT3G02710 | Encodes a protein with a putative role in mRNA splicing. |
| AT1G17300 | hypothetical protein;(source:Araport11) |
| AT3G27845 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G41790 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0.00017 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G43480 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G55365 | hypothetical protein;(source:Araport11) |
| AT3G14470 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G47480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G17410 | Nucleoside diphosphate kinase family protein;(source:Araport11) |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G19530 | Encodes a TIR-NB-LRR resistance protein. Transient expression in tobacco induces cell death. |
| AT3G24580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G02440 | transmembrane protein;(source:Araport11) |
| AT3G04181 | hypothetical protein;(source:Araport11) |
| AT3G63240 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G43200 | pseudogene of target of trans acting-siR480/255 protein;(source:Araport11) |
| AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G21840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G46340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G11490 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT1G67238 | other_RNA;(source:Araport11) |
| AT2G42020 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G33020 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G35690 | hypothetical protein (DUF241);(source:Araport11) |
| AT5G44090 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G10730 | Protein kinase superfamily protein |
| AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT3G06070 | hypothetical protein;(source:Araport11) |
| AT4G35500 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G06650 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT1G31540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G04645 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G40020 | Myosin heavy chain-related protein;(source:Araport11) |
| AT2G27420 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G09670 | loricrin-like protein;(source:Araport11) |
| AT2G43540 | transmembrane protein;(source:Araport11) |
| AT2G33900 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G51620 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G12270 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G28375 | transmembrane protein;(source:Araport11) |
| AT5G42785 | transmembrane protein;(source:Araport11) |
| AT5G13250 | RING finger protein;(source:Araport11) |
| AT5G53380 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G22845 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT2G21110 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G10450 | 14-3-3 family protein;(source:Araport11) |
| AT5G23155 | None;(source:Araport11) |
| AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G28710 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G48650 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G21160 | eukaryotic translation initiation factor 2 (eIF-2) family protein;(source:Araport11) |
| AT1G34044 | pseudogene of 50S ribosomal protein L34;(source:Araport11) |
| AT5G54460 | wound-responsive protein-like protein;(source:Araport11) |
| AT5G60760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G35640 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G34570 | Essential protein Yae1, N-terminal;(source:Araport11) |
| AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT2G34360 | MATE efflux family protein;(source:Araport11) |
| AT2G12500 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.8e-208 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G35860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10) |
| AT3G62455 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-232 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G50140 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G22185 | pseudogene of F-box protein (DUF295);(source:Araport11) |
| AT1G67720 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G20470 | transmembrane protein;(source:Araport11) |
| AT3G42230 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 1.0e-42 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT3G44805 | TRAF-like superfamily protein;(source:Araport11) |
| AT1G11730 | Galactosyltransferase family protein;(source:Araport11) |
| AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G05320 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G54520 | hypothetical protein;(source:Araport11) |
| AT5G17140 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT4G29870 | Oligosaccharyltransferase complex/magnesium transporter family protein;(source:Araport11) |
| AT1G35990 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-23 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G28672 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G12010 | nuclease;(source:Araport11) |
| AT1G37037 | transposable_element_gene;(source:Araport11) |
| AT5G29060 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT1G76920 | F-box family protein;(source:Araport11) |
| AT3G19870 | AP-5 complex subunit beta-like protein;(source:Araport11) |
| AT2G40745 | hypothetical protein;(source:Araport11) |
| AT5G35460 | membrane protein;(source:Araport11) |
| AT5G27925 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.0e-249 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G40925 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G57570 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G07260 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT4G23970 | hypothetical protein;(source:Araport11) |
| AT3G58630 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT5G02650 | hypothetical protein;(source:Araport11) |
| AT2G38090 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G24320 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT5G58150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G33910 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT3G44850 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G37352 | Pseudogene of AT2G25010 |
| AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G45290 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G51330 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT5G03580 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G32435 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase GI:4335720 from (Arabidopsis thaliana);(source:TAIR10) |
| AT5G32619 | Encodes a defensin-like (DEFL) family protein. |
| AT2G07483 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 7.6e-13 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT4G01210 | glycosyl transferase family 1 protein;(source:Araport11) |
| AT3G57120 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G08680 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT2G01260 | hypothetical protein (DUF789);(source:Araport11) |
| AT5G49780 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G05380 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;(source:Araport11) |
| AT4G03920 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-40 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G04972 | hypothetical protein;(source:Araport11) |
| AT2G01034 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0. P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT2G02330 | pseudogene of phloem protein 2-B7;(source:Araport11) |
| AT2G30090 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G42110 | hypothetical protein;(source:Araport11) |
| AT5G55100 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G40310 | Exonuclease family protein;(source:Araport11) |
| AT1G33102 | hypothetical protein;(source:Araport11) |
| AT5G37210 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G59160 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G33131 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32610.1);(source:TAIR10) |
| AT2G24600 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT1G22060 | sporulation-specific protein;(source:Araport11) |
| AT1G23830 | transmembrane protein;(source:Araport11) |
| AT4G39060 | LOW protein: coatomer subunit alpha-1-like protein;(source:Araport11) |
| AT1G35745 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.5e-62 P-value blast match to GB:CAA38906 Tam3-transposase (hAT-element) (Antirrhinum majus);(source:TAIR10) |
| AT4G27740 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT5G33382 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-126 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT1G19450 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G02710 | zinc/iron-chelating domain protein;(source:Araport11) |
| AT4G01670 | hypothetical protein;(source:Araport11) |
| AT1G21300 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-15 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G60380 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT1G74140 | Rhomboid-related intramembrane serine protease family protein;(source:Araport11) |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G63560 | Receptor-like protein kinase-related family protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF26 (InterPro:IPR002902); BEST Arabidopsis thaliana protein match is: Receptor-like protein kinase-related family protein (TAIR:AT1G63600.1) |
| AT5G41020 | myb family transcription factor;(source:Araport11) |
| AT4G23470 | PLAC8 family protein;(source:Araport11) |
| AT1G57670 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G33154 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-36 P-value blast match to GB:CAB39733 rotease, reverse transcriptase, ribonuclease H, integrase (Gypsy_Ty3-element) (Drosophila buzzatii);(source:TAIR10) |
| AT5G08300 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
| AT1G64050 | hypothetical protein;(source:Araport11) |
| AT5G48990 | encodes an F-box protein that interacts with SKP1 and likely to be involved in ubiquitin-mediated protein degradation. |
| AT2G39960 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
| AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
| AT3G47670 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G78530 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G38630 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G31460 | Ribosomal L28 family;(source:Araport11) |
| AT4G01460 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G36930 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G62350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G14820 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G56270 | RPB1a;(source:Araport11) |
| AT5G16160 | hypothetical protein;(source:Araport11) |
| AT3G58975 | pseudogene of F-box family protein |
| AT1G16170 | ephrin-A3 protein;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G18450 | PLAC8 family protein;(source:Araport11) |
| AT5G58720 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
| AT3G30300 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G26010 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G15860 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-43 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT4G16195 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G46550 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT4G13820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G65870 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G59050 | G patch domain protein;(source:Araport11) |
| AT4G09190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G74610 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
| AT1G42580 | transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT3G47680.1);(source:TAIR10) |
| AT4G16162 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
| AT3G28350 | Pseudogene of AT3G28350; unknown protein |
| AT1G56020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT5G51630 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G43580 | Sphingomyelin synthetase family protein;(source:Araport11) |
| AT4G30910 | Cytosol aminopeptidase family protein;(source:Araport11) |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT2G01818 | PLATZ transcription factor family protein;(source:Araport11) |
| AT5G45700 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G54620 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G01513 | hypothetical protein;(source:Araport11) |
| AT5G51320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42556.1);(source:TAIR10) |
| AT2G41000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G57650 | ATP binding protein;(source:Araport11) |
| AT3G55690 | hypothetical protein;(source:Araport11) |
| AT5G37730 | hypothetical protein;(source:Araport11) |
| AT2G27315 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
| AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G29613 | hypothetical protein;(source:Araport11) |
| AT5G54720 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G16400 | transmembrane protein;(source:Araport11) |
| AT5G35339 | pseudogene of Polynucleotidyl transferase;(source:Araport11) |
| AT3G14740 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G51645 | Natural antisense transcript overlaps with AT1G51640;(source:Araport11) |
| AT1G80060 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT3G58180 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G59455 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT5G01950 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G18840 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G29520 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G60615 | Encodes a defensin-like (DEFL) family protein. |
| AT4G09850 | hypothetical protein;(source:Araport11) |
| AT1G09360 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G49790 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
| AT4G20000 | VQ motif-containing protein;(source:Araport11) |
| AT5G14480 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G11740 | ankyrin repeat family protein;(source:Araport11) |
| AT5G37610 | Eukaryotic porin family protein;(source:Araport11) |
| AT1G35181 | transmembrane protein;(source:Araport11) |
| AT3G47590 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G31710 | Vacuolar ATPase assembly integral membrane protein VMA21-like domain-containing protein;(source:Araport11) |
| AT5G25615 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.0e-122 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT5G66600 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G43520 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G05085 | hypothetical protein;(source:Araport11) |
| AT2G34315 | avirulence induced family protein;(source:Araport11) |
| AT5G38340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G33555 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to hypothetical protein GB:AAD26889 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06632 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.9e-05 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G38035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.9e-71 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G21430 | Papain family cysteine protease;(source:Araport11) |
| AT1G69030 | BSD domain-containing protein;(source:Araport11) |
| AT1G27200 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G08072 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.5e-36 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G15060 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT3G27230 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G44180 | syntaxin-related family protein;(source:Araport11) |
| AT1G02575 | transmembrane protein;(source:Araport11) |
| AT1G03590 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT2G36480 | pre-mRNA cleavage complex 2 Pcf11-like protein;(source:Araport11) |
| AT1G20270 | 2-oxoglutarate-dependent dioxygenase |
| AT2G41830 | Uncharacterized protein;(source:Araport11) |
| AT3G11310 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G12910 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G23530 | Zinc-finger domain of monoamine-oxidase A repressor R1;(source:Araport11) |
| AT3G44096 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.8e-23 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G39280 | phenylalanyl-tRNA synthetase, putative / phenylalanine-tRNA ligase;(source:Araport11) |
| AT4G36150 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G11125 | hypothetical protein;(source:Araport11) |
| AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G52200 | PLAC8 family protein;(source:Araport11) |
| AT4G01890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G57035 | U-box domain-containing protein kinase family protein;(source:Araport11) |
| AT1G31983 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G48200 | transmembrane protein;(source:Araport11) |
| AT4G32340 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT5G55055 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT5G52480 | RNI-like superfamily protein;(source:Araport11) |
| AT3G57100 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT3G42090 | transposable_element_gene;(source:Araport11);contains domain LIN-9 RELATED (PTHR21689);(source:TAIR10) |
| AT3G27950 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G38260 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT4G13500 | transmembrane protein;(source:Araport11) |
| AT3G62735 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT3G08820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G77910 | transmembrane protein;(source:Araport11) |
| AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G33100 | protein phosphatase;(source:Araport11) |
| AT5G62340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G43590 | Chitinase family protein;(source:Araport11) |
| AT4G06474 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein;(source:TAIR10) |
| AT3G14830 | epstein-barr nuclear antigen;(source:Araport11) |
| AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G50730 | hypothetical protein;(source:Araport11) |
| AT4G28915 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT3G46850 | Subtilase family protein;(source:Araport11) |
| AT3G15518 | hypothetical protein;(source:Araport11) |
| AT1G68400 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT5G28495 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.8e-77 P-value blast match to gb|AAL06416.1|AF378057_1 reverse transcriptase (Sorghum bicolor) (Gypsy_Ty3-family);(source:TAIR10) |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
| AT5G13890 | plant viral-response family protein (DUF716);(source:Araport11) |
| AT2G14635 | ARABIDILLO protein;(source:Araport11) |
| AT5G58820 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G66780 | MATE efflux family protein;(source:Araport11) |
| AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
| AT2G07400 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-53 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT4G20770 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G76610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G49032 | hypothetical protein;(source:Araport11) |
| AT1G74070 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G04800 | glycine-rich protein;(source:Araport11) |
| AT5G29635 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 7.7e-111 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT1G22420 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G13050 | proline-rich receptor-like kinase;(source:Araport11) |
| AT4G26120 | Ankyrin repeat family protein / BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G24390 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G42792 | transposable_element_gene;(source:Araport11);Mutator-related transposase, temporary automated functional assignment;(source:TAIR10) |
| AT4G24265 | homeobox protein;(source:Araport11) |
| AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G57590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G52170 | DNA binding protein;(source:Araport11) |
| AT3G05810 | IGR motif protein;(source:Araport11) |
| AT1G60320 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G63740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G60110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G10280 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G11590 | golgin family A protein;(source:Araport11) |
| AT3G33215 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to unknown protein GB:AAD20653 (Arabidopsis thaliana) and similar to putative reverse transcriptase GB:AAD15474 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G13440 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11) |
| AT3G22180 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G26530 | PIN domain-like family protein;(source:Araport11) |
| AT1G53380 | hypothetical protein (DUF641);(source:Araport11) |
| AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G02420 | dihydroflavonol 4-reductase/flavanone protein;(source:Araport11) |
| AT3G19250 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G10220 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
| AT1G64385 | transmembrane protein;(source:Araport11) |
| AT5G09510 | Ribosomal protein S19 family protein;(source:Araport11) |
| AT4G31210 | DNA topoisomerase, type IA, core;(source:Araport11) |
| AT4G09540 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
| AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT2G21460 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-303 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT4G09830 | nuclear receptor family 2 group C protein;(source:Araport11) |
| AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
| AT3G30835 | pseudogene of lysyl-tRNA synthetase 1;(source:Araport11) |
| AT2G42100 | Actin-like ATPase superfamily protein;(source:Araport11) |
| AT2G20835 | hypothetical protein;(source:Araport11) |
| AT3G48080 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G56070 | hypothetical protein;(source:Araport11) |
| AT3G50140 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
| AT1G50575 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G57010 | calmodulin-binding family protein;(source:Araport11) |
| AT2G36040 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30610.1);(source:TAIR10) |
| AT1G35300 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.1e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G36930 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT1G32970 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G44093 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-162 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
| AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
| AT4G26130 | cotton fiber protein;(source:Araport11) |
| AT1G64250 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.2e-20 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G42320 | Zn-dependent exopeptidases superfamily protein;(source:Araport11) |
| AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G44125 | Natural antisense transcript overlaps with AT1G44120;(source:Araport11) |
| AT5G57370 | U4/U6.U5 small nuclear ribonucleoprotein;(source:Araport11) |
| AT1G45229 | transmembrane protein;(source:Araport11) |
| AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G11900 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G14905 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G54148 | sarcosine dehydrogenase-2C protein;(source:Araport11) |
| AT2G40630 | Uncharacterized conserved protein (UCP030365);(source:Araport11) |
| AT2G18115 | pseudogene of glycine-rich protein;(source:Araport11) |
| AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G22440 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT5G43960 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G24610 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G71691 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G06630 | protein kinase family protein;(source:Araport11) |
| AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT4G17540 | dynamin;(source:Araport11) |
| AT5G54145 | hypothetical protein;(source:Araport11) |
| AT4G26480 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT1G24068 | other_RNA;(source:Araport11) |
| AT4G04925 | transmembrane protein;(source:Araport11) |
| AT1G64130 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G22530 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT1G51970 | B3 domain protein;(source:Araport11) |
| AT4G08097 | hypothetical protein;(source:Araport11) |
| AT5G37240 | hypothetical protein;(source:Araport11) |
| AT5G54040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G11370 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G22790 | Low affinity potassium transport system protein;(source:Araport11) |
| AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT3G15604 | hypothetical protein;(source:Araport11) |
| AT4G15775 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT2G43390 | hypothetical protein;(source:Araport11) |
| AT3G47110 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
| AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
| AT4G22285 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
| AT3G48208 | Encodes a Plant thionin family protein |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G45590 | Ribosomal protein L35;(source:Araport11) |
| AT5G59330 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT4G00893 | F-box/kelch-repeat protein;(source:Araport11) |
| AT2G22335 | pseudogene of cytochrome P450 family protein |
| AT2G41020 | WW domain-containing protein;(source:Araport11) |
| AT2G42390 | kinase C substrate, heavy chain-like protein;(source:Araport11) |
| AT3G15240 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G05790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G42980 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G11810 | transmembrane protein;(source:Araport11) |
| AT1G52060 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G44020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G11190 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G38950 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G01120 | hypothetical protein (DUF674);(source:Araport11) |
| AT2G03510 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G00165 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G55700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
| AT3G45200 | hypothetical protein;(source:Araport11) |
| AT3G42550 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G61150 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT3G50620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G01410 | NHL domain-containing protein;(source:Araport11) |
| AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
| AT5G22560 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT2G38890 | hypothetical protein;(source:Araport11) |
| AT3G46370 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G35736 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G49030 | PLAC8 family protein;(source:Araport11) |
| AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G80610 | hypothetical protein;(source:Araport11) |
| AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G19230 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT3G10430 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G65750 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-18 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G03930 | kinase-like protein;(source:Araport11) |
| AT5G52965 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
| AT2G27590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G04480 | endoribonuclease;(source:Araport11) |
| AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668);(source:Araport11) |
| AT4G02250 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G41640 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT3G29220 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
| AT3G63095 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT1G73440 | calmodulin-like protein;(source:Araport11) |
| AT3G59590 | jacalin lectin family protein;(source:Araport11) |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G29570 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT4G07950 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
| AT5G18210 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G22530 | Unknown protein, knockout shows increased sensitivity to Al stress. |
| AT3G60450 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G26747 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT5G12930 | inactive rhomboid protein;(source:Araport11) |
| AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G52950 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT3G24260 | paired amphipathic helix Sin3-like protein;(source:Araport11) |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G61280 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT2G43795 | corepressor;(source:Araport11) |
| AT3G59260 | pirin;(source:Araport11) |
| AT3G19360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT5G40960 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G27425 | Encodes a ECA1 gametogenesis related family protein |
| AT2G36440 | hypothetical protein;(source:Araport11) |
| AT2G47120 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G19420 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT3G19390 | Granulin repeat cysteine protease family protein;(source:Araport11) |
| AT1G43660 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10) |
| AT1G77525 | defensin-like protein;(source:Araport11) |
| AT4G14840 | spindle assembly abnormal protein;(source:Araport11) |
| AT3G04990 | intracellular protein transporter;(source:Araport11) |
| AT1G65483 | hypothetical protein;(source:Araport11) |
| AT5G32925 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-105 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
| AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT1G75970 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT1G35570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
| AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT1G01150 | Homeodomain-like protein with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G50659 | other_RNA;(source:Araport11) |
| AT2G28960 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G33847 | hypothetical protein;(source:Araport11) |
| AT5G64850 | sorbin/SH3 domain protein;(source:Araport11) |
| AT1G54355 | Natural antisense transcript overlaps with AT1G54350;(source:Araport11) |
| AT5G43240 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G14560 | Its transcript is targeted by miR824. |
| AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G36210 | transmembrane/coiled-coil protein (DUF726);(source:Araport11) |
| AT1G15840 | hypothetical protein;(source:Araport11) |
| AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G36580 | Pyruvate kinase family protein;(source:Araport11) |
| AT4G32360 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
| AT3G12040 | Encodes a 3-methyladenine-DNA glycosylase. Arabdiopsis cDNA complements the methyl methanesulfonate-sensitive phenotype of an Escherichia coli double mutant deficient in 3-methyladenine glycosylases (DNA-3-methyladenine glycosidases I and II, EC 3.2.2.20 and 3.2.2.21, respectively, encoded by tag and alkA). |
| AT3G52520 | hypothetical protein;(source:Araport11) |
| AT4G20920 | double-stranded RNA-binding domain (DsRBD)-containing protein;(source:Araport11) |
| AT4G17140 | pleckstrin homology (PH) domain-containing protein;(source:Araport11) |
| AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G48710 | DEK domain-containing chromatin associated protein;(source:Araport11) |
| AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
| AT2G09800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-162 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G47950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-238 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT5G49138 | Natural antisense transcript overlaps with AT5G49130;(source:Araport11) |
| AT3G17225 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G30170 | Peroxidase family protein;(source:Araport11) |
| AT5G43040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G46192 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G01220 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT5G55610 | isopentenyl-diphosphate delta-isomerase;(source:Araport11) |
| AT5G38250 | Protein kinase family protein;(source:Araport11) |
| AT3G46260 | kinase-like protein;(source:Araport11) |
| AT5G65170 | VQ motif-containing protein;(source:Araport11) |
| AT3G13403 | Encodes a defensin-like (DEFL) family protein. |
| AT5G65380 | MATE efflux family protein;(source:Araport11) |
| AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G10190 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G13030 | hAT transposon superfamily protein;(source:Araport11) |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT5G67020 | hypothetical protein;(source:Araport11) |
| AT5G53135 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-199 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G30757 | transmembrane protein;(source:Araport11) |
| AT4G21926 | hypothetical protein;(source:Araport11) |
| AT3G05675 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G70590 | F-box family protein;(source:Araport11) |
| AT2G01560 | Plant protein 1589 of unknown function;(source:Araport11) |
| AT5G01200 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT4G37620 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10) |
| AT5G19350 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G15830 | hypothetical protein;(source:Araport11) |
| AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
| AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G77131 | Annotated as pseudogene of PGSIP, glycogenin glucosyltransferase.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G30150 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G28770 | Tetraspanin family protein;(source:Araport11) |
| AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
| AT2G34190 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G47020 | MraZ;(source:Araport11) |
| AT1G68875 | hypothetical protein;(source:Araport11) |
| AT1G47470 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
| AT1G10990 | transmembrane protein;(source:Araport11) |
| AT5G28491 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G76780 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G53750 | CBS domain-containing protein;(source:Araport11) |
| AT1G55221 | Pseudogene of AT1G55240 |
| AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT5G59662 | Natural antisense transcript overlaps with AT5G59660;(source:Araport11) |
| AT3G29000 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G23700 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G27473 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G52220 | chromosome transmission fidelity-like protein;(source:Araport11) |
| AT1G07020 | hypothetical protein;(source:Araport11) |
| AT5G54370 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
| AT1G53770 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G53100 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G15500 | RNA-binding protein;(source:Araport11) |
| AT5G38220 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G77655 | hypothetical protein;(source:Araport11) |
| AT4G08160 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT2G31240 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G02510 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G11640 | transmembrane protein;(source:Araport11) |
| AT2G20010 | Gls protein (DUF810);(source:Araport11) |
| AT1G10890 | arginine/glutamate-rich 1 protein;(source:Araport11) |
| AT4G22640 | LTPG protein |
| AT5G36937 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
| AT5G11325 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT5G02910 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT3G20620 | F-box family protein-like protein;(source:Araport11) |
| AT5G47570 | NADH dehydrogenase ubiquinone 1 beta subcomplex subunit;(source:Araport11) |
| AT1G50890 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G21330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10) |
| AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
| AT3G60540 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
| AT2G03100 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-225 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G17490 | epidermal patterning factor-like protein;(source:Araport11) |
| AT2G36860 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT1G50740 | Transmembrane proteins 14C;(source:Araport11) |
| AT4G37432 | Natural antisense transcript overlaps with AT4G37430;(source:Araport11) |
| AT5G50190 | other_RNA;(source:Araport11) |
| AT2G15130 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G56160 | Sodium Bile acid symporter family;(source:Araport11) |
| AT1G66910 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G77765 | transmembrane protein;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G34035 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT4G37700 | hypothetical protein;(source:Araport11) |
| AT5G12060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G46195 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.8e-38 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G36360 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G57230 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G36680 | Modifier of rudimentary (Mod(r)) protein;(source:Araport11) |
| AT5G07800 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G34602 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.3e-71 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G38550 | Jacalin lectin family protein gene |
| AT4G22370 | transmembrane protein;(source:Araport11) |
| AT2G36255 | Encodes a defensin-like (DEFL) family protein. |
| AT1G31220 | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide |
| AT4G31980 | PPPDE thiol peptidase family protein;(source:Araport11) |
| AT5G23610 | DYAD protein;(source:Araport11) |
| AT1G51310 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase;(source:Araport11) |
| AT1G72060 | serine-type endopeptidase inhibitor;(source:Araport11) |
| AT5G48500 | pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11) |
| AT5G10920 | L-Aspartase-like family protein;(source:Araport11) |
| AT3G44798 | other_RNA;(source:Araport11) |
| AT3G43890 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G29810 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G60200 | hypothetical protein;(source:Araport11) |
| AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
| AT1G76070 | hypothetical protein;(source:Araport11) |
| AT4G28100 | transmembrane protein;(source:Araport11) |
| AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G36240 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT5G42220 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G04900 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
| AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
| AT3G25960 | Pyruvate kinase family protein;(source:Araport11) |
| AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G49500 | Signal recognition particle, SRP54 subunit protein;(source:Araport11) |
| AT5G64880 | transmembrane protein;(source:Araport11) |
| AT4G04296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-13 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G57200 | glycosyltransferase-like protein;(source:Araport11) |
| AT4G21910 | MATE efflux family protein;(source:Araport11) |
| AT2G43610 | Chitinase family protein;(source:Araport11) |
| AT1G65940 | pseudogene of Dof-type zinc finger domain-containing protein;(source:Araport11) |
| AT4G11405 | pre-tRNA tRNA-Thr (anticodon: TGT);(source:Araport11, TAIR10) |
| AT4G20730 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
| AT3G43540 | initiation factor 4F subunit (DUF1350);(source:Araport11) |
| AT1G33230 | TMPIT-like protein;(source:Araport11) |
| AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G49960 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
| AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G12880 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G57110 | exonuclease V;(source:Araport11) |
| AT2G33845 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G39580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G07485 | hypothetical protein;(source:Araport11) |
| AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G05360 | hypothetical protein;(source:Araport11) |
| AT2G37700 | Fatty acid hydroxylase superfamily;(source:Araport11) |
| AT2G23321 | hypothetical protein;(source:Araport11) |
| AT2G33707 | Encodes a defensin-like (DEFL) family protein. |
| AT3G07450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G06702 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G41140 | Myosin heavy chain-related protein;(source:Araport11) |
| AT1G78170 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT3G21940 | Receptor protein kinase-like protein;(source:Araport11) |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT3G59310 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G57510 | cotton fiber protein;(source:Araport11) |
| AT3G43715 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G36120 | filament-like protein (DUF869);(source:Araport11) |
| AT4G08555 | hypothetical protein;(source:Araport11) |
| AT4G32390 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G30780 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G07280 | hypothetical protein;(source:Araport11) |
| AT5G63300 | Ribosomal protein S21 family protein;(source:Araport11) |
| AT1G43140 | Cullin family protein;(source:Araport11) |
| AT2G25409 | hypothetical protein;(source:Araport11) |
| AT5G66455 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT3G02065 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G75163 | snoRNA;(source:Araport11) |
| AT3G60440 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
| AT1G43775 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
| AT2G42835 | Natural antisense transcript overlaps with AT2G42830;(source:Araport11) |
| AT5G18661 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G21780 | hypothetical protein;(source:Araport11) |
| AT5G39090 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G34847 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-27 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G13210 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT5G59670 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G59300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G32275 | Expressed protein;(source:Araport11) |
| AT3G46190 | TRAF-like family protein;(source:Araport11) |
| AT1G66990 | pseudogene of suppressor of npr1-1 constitutive 4;(source:Araport11) |
| AT4G27875 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT2G27330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G39390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G28327 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT3G05260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G26270 | BRCT domain DNA repair protein;(source:Araport11) |
| AT3G30708 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.3e-90 P-value blast match to gb|AAL06420.1|AF378078_1 reverse transcriptase (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT3G60710 | F-box family protein. |
| AT1G80230 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT5G64190 | neuronal PAS domain protein;(source:Araport11) |
| AT1G79570 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT1G70100 | neurofilament heavy protein;(source:Araport11) |
| AT1G13820 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G05152 | other_RNA;(source:Araport11) |
| AT2G44925 | hypothetical protein;(source:Araport11) |
| AT1G02260 | Divalent ion symporter;(source:Araport11) |
| AT3G46360 | transmembrane protein;(source:Araport11) |
| AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT3G04300 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G39952 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G03000 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30650 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G04110 | pseudogene of expressed protein;(source:Araport11) |
| AT2G22030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT5G65320 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G15405 | other_RNA;(source:Araport11) |
| AT3G25030 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G71810 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G25415 | hypothetical protein (DUF239);(source:Araport11) |
| AT2G38790 | hypothetical protein;(source:Araport11) |
| AT4G36230 | transmembrane protein;(source:Araport11) |
| AT1G30190 | cotton fiber protein;(source:Araport11) |
| AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT2G25190 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT5G07215 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.9e-34 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT2G04740 | ankyrin repeat family protein;(source:Araport11) |
| AT1G53370 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G15870 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G67411 | GRAS family transcription factor;(source:Araport11) |
| AT5G34480 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-49 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT4G16140 | proline-rich family protein;(source:Araport11) |
| AT3G29680 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G01516 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G43910 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT4G00905 | NC domain-containing protein-like protein;(source:Araport11) |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G48220 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
| AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G52870 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT2G24170 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT1G35435 | Encodes a defensin-like (DEFL) family protein. |
| AT1G05790 | lipase class 3 family protein;(source:Araport11) |
| AT3G10880 | tropomyosin;(source:Araport11) |
| AT5G52540 | keratin-associated protein, putative (DUF819);(source:Araport11) |
| AT5G59080 | hypothetical protein;(source:Araport11) |
| AT3G10185 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
| AT3G51350 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G72070 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45660 | Encodes a member of the NAXT NPF subfamily. |
| AT1G61890 | MATE efflux family protein;(source:Araport11) |
| AT1G53815 | F-box family protein;(source:Araport11) |
| AT3G42796 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-31 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G51530 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G44820 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT1G14688 | E3 ubiquitin ligase;(source:Araport11) |
| AT4G11580 | RNI-like superfamily protein;(source:Araport11) |
| AT3G49200 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT1G07135 | glycine-rich protein;(source:Araport11) |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G53895 | hypothetical protein;(source:Araport11) |
| AT1G44740 | hypothetical protein;(source:Araport11) |
| AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G01710 | methyltransferase;(source:Araport11) |
| AT1G30320 | Remorin family protein;(source:Araport11) |
| AT4G06534 | transmembrane protein;(source:Araport11) |
| AT3G44280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
| AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
| AT1G80510 | Encodes a close relative of the amino acid transporter ANT1 (AT3G11900). |
| AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G15350 | G14 enzyme |
| AT1G66060 | hypothetical protein (DUF577);(source:Araport11) |
| AT1G69550 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT5G28641 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-21 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G26380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G11340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G24090 | homer protein;(source:Araport11) |
| AT2G28570 | hypothetical protein;(source:Araport11) |
| AT5G33070 | Encodes a defensin-like (DEFL) family protein. |
| AT4G17440 | chromogranin (DUF1639);(source:Araport11) |
| AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
| AT1G06700 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61050 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT1G26450 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT3G23510 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT5G05310 | TLC ATP/ADP transporter;(source:Araport11) |
| AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
| AT4G30500 | transmembrane protein (DUF788);(source:Araport11) |
| AT2G02103 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT1G05450 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT4G15070 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G24200 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G11930 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT2G16895 | pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G48960 | Ribosomal protein L13e family protein;(source:Araport11) |
| AT1G69430 | Son of sevenless protein;(source:Araport11) |
| AT5G58610 | PHD finger transcription factor;(source:Araport11) |
| AT5G66675 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G29120 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT1G22850 | SNARE associated Golgi protein family;(source:Araport11) |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT1G67270 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT4G21950 | hypothetical protein;(source:Araport11) |
| AT5G09290 | Inositol monophosphatase family protein;(source:Araport11) |
| AT1G64035 | pseudogene of serpin 2;(source:Araport11) |
| AT4G10925 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT2G27340 | N-acetylglucosaminylphosphatidylinositol de-N-acetylase family protein;(source:Araport11) |
| AT5G15260 | ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT1G10455 | B3 DNA-binding domain protein;(source:Araport11) |
| AT1G11572 | Encodes a Plant thionin family protein |
| AT1G04490 | hypothetical protein (DUF3527);(source:Araport11) |
| AT1G05140 | Peptidase M50 family protein;(source:Araport11) |
| AT4G36010 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G07820 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G10720 | BSD domain-containing protein;(source:Araport11) |
| AT1G76660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G23650 | Homeodomain-like transcriptional regulator;(source:Araport11) |
| AT3G62510 | disulfide isomerase-like protein;(source:Araport11) |
| AT4G08340 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT3G05150 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G30730 | hypothetical protein;(source:Araport11) |
| AT1G70949 | hypothetical protein;(source:Araport11) |
| AT1G27385 | phosphoribosylformylglycinamidine synthase;(source:Araport11) |
| AT2G39160 | hypothetical protein;(source:Araport11) |
| AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G09645 | transmembrane protein;(source:Araport11) |
| AT1G55830 | coiled-coil protein;(source:Araport11) |
| AT3G47040 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT5G32678 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G22790 | hypothetical protein;(source:Araport11) |
| AT4G10520 | Subtilase family protein;(source:Araport11) |
| AT1G21286 | Pseudogene of AT1G21245; wall-associated kinase-related protein |
| AT5G36010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G52410.1);(source:TAIR10) |
| AT2G35658 | transmembrane protein;(source:Araport11) |
| AT2G25520 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
| AT1G33475 | SNARE-like superfamily protein;(source:Araport11) |
| AT3G13280 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G09876 | hypothetical protein;(source:Araport11) |
| AT3G20380 | TRAF-like family protein;(source:Araport11) |
| AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT3G13560 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G33140 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT3G21540 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G32000 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
| AT5G40620 | transmembrane protein;(source:Araport11) |
| AT1G09620 | ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
| AT3G18790 | pre-mRNA-splicing factor ISY1-like protein;(source:Araport11) |
| AT1G73970 | obscurin-like protein;(source:Araport11) |
| AT5G35610 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT5G28610 | LOW protein: ATP-dependent RNA helicase DRS1-like protein;(source:Araport11) |
| AT1G53110 | proton pump-interactor;(source:Araport11) |
| AT3G23160 | plant/protein (DUF668);(source:Araport11) |
| AT5G13260 | myosin;(source:Araport11) |
| AT4G08375 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.4e-244 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT1G50660 | actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11) |
| AT2G39795 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT1G23690 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
| AT1G74750 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G58600 | Adaptin ear-binding coat-associated protein 1 NECAP-1;(source:Araport11) |
| AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT5G28635 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-162 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G53080 | Legume lectin family protein;(source:Araport11) |
| AT5G09270 | transmembrane protein;(source:Araport11) |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G61540 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT3G45935 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT1G80690 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT2G35250 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G42690 | transcription factor, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G03285 | other_RNA;(source:Araport11) |
| AT4G27620 | intracellular protein transporter;(source:Araport11) |
| AT1G54923 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30816.1);(source:TAIR10) |
| AT3G60470 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G37476 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-18 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G10116 | COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family;(source:Araport11) |
| AT2G30060 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G28200 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, various predicted proteins, Arabidopsis thaliana;(source:TAIR10) |
| AT5G13470 | hypothetical protein;(source:Araport11) |
| AT4G29590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G37290 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G27037 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G11670 | MATE efflux family protein;(source:Araport11) |
| AT2G23710 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
| AT1G56130 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT5G24490 | 30S ribosomal protein;(source:Araport11) |
| AT5G13655 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G35985 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT5G03370 | acylphosphatase family;(source:Araport11) |
| AT4G08750 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G08760.1);(source:TAIR10) |
| AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G49170 | hypothetical protein;(source:Araport11) |
| AT3G01230 | splicing regulatory glutamine/lysine-rich-like protein;(source:Araport11) |
| AT1G44050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G47295 | hypothetical protein;(source:Araport11) |
| AT3G62280 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G43675 | similarity to non-LTR retroelement protein |
| AT2G38870 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT5G64401 | hypothetical protein;(source:Araport11) |
| AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
| AT5G57970 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
| AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G11925 | Encodes a Stigma-specific Stig1 family protein |
| AT1G52070 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT4G27400 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
| AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G52110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT1G03210 | Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11) |
| AT2G43620 | Chitinase family protein;(source:Araport11) |
| AT1G06240 | diiron containing four-helix bundle family ferritin protein, putative (Protein of unknown function DUF455);(source:Araport11) |
| AT4G39570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G51220 | ubiquinol-cytochrome C chaperone family protein;(source:Araport11) |
| AT2G24140 | myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT4G12270 | Copper amine oxidase family protein;(source:Araport11) |
| AT4G07940 | pre-mRNA-splicing factor CWC22-like protein, putative (DUF3245);(source:Araport11) |
| AT1G69900 | Actin cross-linking protein;(source:Araport11) |
| AT3G55960 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
| AT1G01130 | CBL-interacting Serine/Threonine-kinase;(source:Araport11) |
| AT5G38975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-15 P-value blast match to GB:CAA30503 pol polypeptide (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
| AT1G61400 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G05430 | RNA-binding protein;(source:Araport11) |
| AT2G29520 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT5G13980 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT2G33970 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G18485 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G02870 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G36903 | pseudogene of protein related to self-incompatibility |
| AT5G65120 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT4G15563 | F-box-like protein;(source:Araport11) |
| AT3G29340 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT5G40410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G52285 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT2G13975 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
| AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
| AT5G63380 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At5g63380 preferentially activates fatty acids with increased chain length (C9:0 to C8:0) and thus shares characteristics with long-chain fatty acyl-CoA synthases. Also able to catalyze the conversion of OPDA to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT1G25510 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G40065 | other_RNA;(source:Araport11) |
| AT2G15670 | transmembrane protein;(source:Araport11) |
| AT1G60560 | SWIM zinc finger family protein;(source:Araport11) |
| AT1G18810 | phytochrome kinase substrate-like protein;(source:Araport11) |
| AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
| AT4G06538 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G36630 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
| AT5G23700 | coiled-coil protein;(source:Araport11) |
| AT1G58390 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT5G61260 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT3G47230 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10) |
| AT3G55080 | SET domain-containing protein;(source:Araport11) |
| AT1G71170 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
| AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT2G32295 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT2G30820 | aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit;(source:Araport11) |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT4G04200 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
| AT1G74640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G27300 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G28950 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT4G22020 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G26720 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
| AT5G67220 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT2G02060 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G29624 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G03852 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G04790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G14095 | hypothetical protein;(source:Araport11) |
| AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. |
| AT3G03280 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G42380 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.0e-31 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G58770 | hypothetical protein;(source:Araport11) |
| AT3G25510 | disease resistance protein (TIR-NBS-LRR class) family protein;(source:Araport11) |
| AT5G20860 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G10890 | myosin heavy chain-like protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT2G04510 | pseudogene of ribonuclease H;(source:Araport11) |
| AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT4G00350 | MATE efflux family protein;(source:Araport11) |
| AT3G55605 | Mitochondrial glycoprotein family protein;(source:Araport11) |
| AT1G24733 | pseudogene of CCoAMT (caffeoyl-CoA 3-O-methyltransferase) |
| AT5G17110 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT3G01350 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72141 | transmembrane protein;(source:Araport11) |
| AT5G57000 | DEAD-box ATP-dependent RNA helicase;(source:Araport11) |
| AT3G60420 | phosphoglycerate mutase family protein;(source:Araport11) |
| AT2G15780 | Cupredoxin superfamily protein;(source:Araport11) |
| AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT4G02655 | transmembrane protein;(source:Araport11) |
| AT4G34265 | hypothetical protein;(source:Araport11) |
| AT3G12650 | transmembrane protein;(source:Araport11) |
| AT3G27997 | pseudogene of expressed protein;(source:Araport11) |
| AT1G01930 | zinc finger protein-like protein;(source:Araport11) |
| AT1G02020 | nitroreductase family protein;(source:Araport11) |
| AT4G08953 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-22 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G02160 | Bromodomain transcription factor;(source:Araport11) |
| AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G62330 | Zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT3G11860 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G29715 | pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT4G00342 | hypothetical protein;(source:Araport11) |
| AT1G53610 | transmembrane protein;(source:Araport11) |
| AT5G27495 | Encodes a defensin-like (DEFL) family protein. |
| AT1G27921 | Natural antisense transcript overlaps with AT1G27920;(source:Araport11) |
| AT4G03113 | transmembrane protein;(source:Araport11) |
| AT3G54750 | downstream neighbor of Son;(source:Araport11) |
| AT3G21130 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G52480 | transmembrane protein;(source:Araport11) |
| AT5G47250 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT4G07800 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G13250.1);(source:TAIR10) |
| AT1G26620 | T-box transcription factor, putative (DUF863);(source:Araport11) |
| AT3G11300 | hypothetical protein;(source:Araport11) |
| AT3G13820 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G19810 | pseudogene of cell division cycle 48C;(source:Araport11) |
| AT3G58940 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G42690 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT4G04130.1);(source:TAIR10) |
| AT1G04425 | other_RNA;(source:Araport11) |
| AT2G24750 | pseudogene of glutamate receptor 2.2;(source:Araport11) |
| AT1G54500 | RBD1 is a thylakoid membrane-bound iron-binding protein that is required for the proper assembly of photosystem II in Arabidopsis. It is found in all oxygenic photoautotrophic organisms (plants, algae and cyanobacteria). |
| AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
| AT2G46735 | death domain associated protein;(source:Araport11) |
| AT3G09385 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G05894 | hypothetical protein;(source:Araport11) |
| AT1G67480 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G42100 | transposable_element_gene;(source:Araport11);similar to AT hook motif-containing protein-related [Arabidopsis thaliana] (TAIR:AT1G35940.1);(source:TAIR10) |
| AT5G27095 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G39040 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G73230 | Nascent polypeptide-associated complex NAC;(source:Araport11) |
| AT5G26330 | Cupredoxin superfamily protein;(source:Araport11) |
| AT1G27750 | nucleic acid binding protein;(source:Araport11) |
| AT5G27770 | Ribosomal L22e protein family;(source:Araport11) |
| AT5G28823 | hypothetical protein;(source:Araport11) |
| AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G14910 | Rab3 GTPase-activating protein non-catalytic subunit;(source:Araport11) |
| AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
| AT4G26542 | Natural antisense transcript overlaps with AT4G26540;(source:Araport11) |
| AT1G24485 | ER protein carbohydrate-binding protein;(source:Araport11) |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G02270 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G47400 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G11720 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G12043 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G53775 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G05240 | cation-transporting ATPase;(source:Araport11) |
| AT1G49015 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT3G45690 | Encodes a member of the NAXT NPF subfamily. |
| AT3G45620 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT5G44065 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G29024 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G21745 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
| AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G42255 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
| AT3G33530 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G54240 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
| AT1G22200 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
| AT4G20480 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT1G26860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
| AT3G04270 | two-component response regulator ARR22-like protein;(source:Araport11) |
| AT3G45910 | hypothetical protein;(source:Araport11) |
| AT1G13470 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G55410 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G15610 | hypothetical protein (DUF1685);(source:Araport11) |
| AT2G35810 | ureidoglycolate hydrolase;(source:Araport11) |
| AT1G20230 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G15940 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G15534 | hypothetical protein;(source:Araport11) |
| AT1G07190 | Lon protease;(source:Araport11) |
| AT5G65650 | sugar transporter, putative (DUF1195);(source:Araport11) |
| AT1G34150 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G61898 | transmembrane protein;(source:Araport11) |
| AT1G80450 | VQ motif-containing protein;(source:Araport11) |
| AT3G59230 | RNI-like superfamily protein;(source:Araport11) |
| AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT4G21323 | Subtilase family protein;(source:Araport11) |
| AT1G24267 | bZIP transcription factor, putative (DUF1664);(source:Araport11) |
| AT1G17830 | hypothetical protein (DUF789);(source:Araport11) |
| AT1G21520 | hypothetical protein;(source:Araport11) |
| AT4G28990 | RNA-binding protein-like protein;(source:Araport11) |
| AT4G26940 | Galactosyltransferase family protein;(source:Araport11) |
| AT5G08690 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
| AT3G44700 | transmembrane protein;(source:Araport11) |
| AT2G16870 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G19110 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G41810 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G34590.1);(source:TAIR10) |
| AT5G38750 | asparaginyl-tRNA synthetase family;(source:Araport11) |
| AT3G16060 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT5G28600 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT3G44516 | Pseudogene of AT1G31990; unknown protein |
| AT1G62050 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G53120 | RNA-binding S4 domain-containing protein;(source:Araport11) |
| AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G10695 | methionyl-tRNA synthetase;(source:Araport11) |
| AT5G22050 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G27705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-58 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G03341 | cold-regulated protein;(source:Araport11) |
| AT1G15830 | hypothetical protein;(source:Araport11) |
| AT1G32928 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT1G79060 | TPRXL;(source:Araport11) |
| AT5G55600 | Agenet and bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
| AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G57785 | hypothetical protein;(source:Araport11) |
| AT1G54700 | hypothetical protein;(source:Araport11) |
| AT3G51710 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT2G24735 | other_RNA;(source:Araport11) |
| AT4G24600 | hypothetical protein;(source:Araport11) |
| AT4G29548 | hypothetical protein;(source:Araport11) |
| AT2G36885 | translation initiation factor;(source:Araport11) |
| AT5G54870 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
| AT1G52800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
| AT3G57950 | cotton fiber protein;(source:Araport11) |
| AT5G14860 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G05914 | Potential natural antisense gene, locus overlaps with AT2G05915 |
| AT3G58890 | RNI-like superfamily protein;(source:Araport11) |
| AT2G01810 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G23700 | Itga6 (Protein of unknown function, DUF547);(source:Araport11) |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G54905 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-08 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G36350 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT1G79190 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT5G52530 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G26990 | Drought-responsive family protein;(source:Araport11) |
| AT1G63580 | Encodes a plasma membrane-localized protein with two DUF26 domains and a GPI anchor domain. |
| AT1G02380 | transmembrane protein;(source:Araport11) |
| AT1G15740 | Leucine-rich repeat family protein;(source:Araport11) |
| AT5G66558 | Natural antisense transcript overlaps with AT5G66560;(source:Araport11) |
| AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G52540 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G27150 | Target gene of MIR2111-5p. |
| AT4G16980 | arabinogalactan-protein family;(source:Araport11) |
| AT2G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G10820 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G29033 | glycine-rich protein;(source:Araport11) |
| AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
| AT1G01350 | Zinc finger (CCCH-type/C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT5G63085 | Encodes a Plant thionin family protein |
| AT5G17740 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT1G67620 | Lojap-related protein;(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT3G01345 | Expressed protein;(source:Araport11) |
| AT5G51795 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
| AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G23600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G02550 | hypothetical protein;(source:Araport11) |
| AT2G23210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G25150 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT1G61160 | retrotransposon gag;(source:Araport11) |
| AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT3G57470 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
| AT3G56300 | Cysteinyl-tRNA synthetase, class Ia family protein;(source:Araport11) |
| AT3G58370 | TRAF-like family protein;(source:Araport11) |
| AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
| AT5G12410 | THUMP domain-containing protein;(source:Araport11) |
| AT1G40104 | hypothetical protein;(source:Araport11) |
| AT5G28280 | pseudogene of sterol desaturase domain-containing protein;(source:Araport11) |
| AT2G17340 | pantothenate kinase;(source:Araport11) |
| AT5G41109 | hypothetical protein;(source:Araport11) |
| AT1G52050 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G16225 | Target SNARE coiled-coil domain protein;(source:Araport11) |
| AT1G05660 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G11540 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT2G06760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.4e-38 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT3G43522 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative Ta11-like non-LTR retroelement protein;(source:TAIR10) |
| AT3G58530 | RNI-like superfamily protein;(source:Araport11) |
| AT2G39580 | zinc finger C3H1 domain protein;(source:Araport11) |
| AT1G02360 | Chitinase family protein;(source:Araport11) |
| AT5G07650 | Actin-binding FH2 protein;(source:Araport11) |
| AT3G30705 | transmembrane protein;(source:Araport11) |
| AT3G28918 | hypothetical protein;(source:Araport11) |
| AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT1G58130 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G26055 | transmembrane protein;(source:Araport11) |
| AT4G11200 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30370.1);(source:TAIR10) |
| AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G10560 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT5G52750 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT1G61360 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G38790 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT4G16267 | Encodes a Plant thionin family protein [pseudogene] |
| AT3G07190 | B-cell receptor-associated protein 31-like protein;(source:Araport11) |
| AT5G29030 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
| AT3G28157 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT1G35660 | erythroid differentiation factor-like protein;(source:Araport11) |
| AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G44940 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G65481 | transmembrane protein;(source:Araport11) |
| AT2G12640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.7e-25 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G22122 | hypothetical protein;(source:Araport11) |
| AT5G28580 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.3e-33 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT2G37975 | Yos1-like protein;(source:Araport11) |
| AT2G35120 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
| AT5G41540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G45605 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.0e-230 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G43211 | hypothetical protein;(source:Araport11) |
| AT1G80850 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G19055 | hypothetical protein;(source:Araport11) |
| AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT3G49270 | extensin-like protein;(source:Araport11) |
| AT2G44030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G43740 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G54290 | hemerythrin HHE cation-binding domain protein;(source:Araport11) |
| AT5G37750 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G63900 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G45020 | Glutathione S-transferase family protein;(source:Araport11) |
| AT1G47880 | pseudogene of receptor like protein 6;(source:Araport11) |
| AT2G40200 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G20990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G27390 | transmembrane protein;(source:Araport11) |
| AT5G07910 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G43850 | hypothetical protein;(source:Araport11) |
| AT3G01960 | hypothetical protein;(source:Araport11) |
| AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G44900 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G48268 | pseudogene of F-box family protein |
| AT5G38440 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G52440 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G15610 | transmembrane protein;(source:Araport11) |
| AT1G79980 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
| AT1G20430 | hypothetical protein;(source:Araport11) |
| AT1G77370 | Glutaredoxin family protein;(source:Araport11) |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G39920 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT2G32160 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G00920 | COP1-interacting protein-like protein;(source:Araport11) |
| AT5G47790 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT5G67000 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G70185 | other_RNA;(source:Araport11) |
| AT1G12890 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G57840 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G03972 | pseudogene of heat shock protein |
| AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G08310 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G04030 | eisosome protein;(source:Araport11) |
| AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT5G15270 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT3G28530 | UDP-glucose 4-epimerase;(source:Araport11) |
| AT3G02900 | Low-density receptor-like protein;(source:Araport11) |
| AT5G46295 | transmembrane protein;(source:Araport11) |
| AT3G46600 | GRAS family transcription factor;(source:Araport11) |
| AT5G53030 | hypothetical protein;(source:Araport11) |
| AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT1G66920 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G41380 | CCT motif family protein;(source:Araport11) |
| AT3G26860 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G53350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT3G56750 | plant/protein;(source:Araport11) |
| AT3G13370 | formin-like protein;(source:Araport11) |
| AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT5G41890 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G32375 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G33890 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G27900 | coiled-coil protein;(source:Araport11) |
| AT5G48770 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G27435 | fiber (DUF1218);(source:Araport11) |
| AT4G36510 | hypothetical protein;(source:Araport11) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G07901 | hypothetical protein;(source:Araport11) |
| AT5G57820 | zinc ion binding protein;(source:Araport11) |
| AT1G10330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G15680 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G11320 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 1.7e-199 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT2G07788 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.5e-221 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G52360 | Coatomer, beta subunit;(source:Araport11) |
| AT1G50910 | hypothetical protein;(source:Araport11) |
| AT1G08940 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT4G19870 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G50850 | Putative methyltransferase family protein;(source:Araport11) |
| AT5G66540 | U3 small nucleolar ribonucleoprotein;(source:Araport11) |
| AT1G13520 | hypothetical protein (DUF1262);(source:Araport11) |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT1G03820 | E6-like protein;(source:Araport11) |
| AT2G11210 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-93 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
| AT5G51620 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT4G05018 | transmembrane protein;(source:Araport11) |
| AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
| AT4G03364 | Pseudogene of AT4G05230; ubiquitin family protein |
| AT5G28927 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT5G42830 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G16950 | krueppel-like factor;(source:Araport11) |
| AT3G44060 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G17390 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT5G36905.1);(source:TAIR10) |
| AT2G32450 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
| AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G15310 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32621.1);(source:TAIR10) |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G59070 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT5G24352 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT3G19320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT5G17270 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT5G24610 | cyclic AMP-responsive element-binding protein;(source:Araport11) |
| AT3G21470 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT3G60760 | hypothetical protein;(source:Araport11) |
| AT3G58720 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G15020 | hypothetical protein;(source:Araport11) |
| AT2G16410 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G15550.1);(source:TAIR10) |
| AT2G21780 | hypothetical protein;(source:Araport11) |
| AT1G45832 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.3e-80 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT3G49140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G74680 | Exostosin family protein;(source:Araport11) |
| AT3G10195 | Encodes a defensin-like (DEFL) family protein. |
| AT3G46280 | kinase-like protein;(source:Araport11) |
| AT5G61940 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G07473 | hypothetical protein;(source:Araport11) |
| AT5G09960 | sorbin/SH3 domain protein;(source:Araport11) |
| AT3G54980 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
| AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G43570 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G42645 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-127 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G42760 | DUF1685 family protein;(source:Araport11) |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G36180 | EF hand calcium-binding protein family;(source:Araport11) |
| AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G52610 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G80865 | hypothetical protein;(source:Araport11) |
| AT5G48900 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G25400 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G25820 | Exostosin family protein;(source:Araport11) |
| AT5G51790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G04230 | rRNA-processing EFG1-like protein (DUF2361);(source:Araport11) |
| AT1G42350 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-102 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G63200 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G01680 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G23760 | Copper transport protein family;(source:Araport11) |
| AT4G11385 | hypothetical protein;(source:Araport11) |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
| AT4G26375 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT1G78922 | transmembrane protein;(source:Araport11) |
| AT1G11112 | hypothetical protein;(source:Araport11) |
| AT5G10460 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT2G13125 | hypothetical protein;(source:Araport11) |
| AT1G23201 | GCK domain protein;(source:Araport11) |
| AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
| AT1G72600 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
| AT2G18200 | transmembrane protein;(source:Araport11) |
| AT2G31860 | pseudogene of poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
| AT4G06750 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.0e-60 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT4G03130 | BRCT domain-containing DNA repair protein;(source:Araport11) |
| AT2G14160 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G52030 | F-box family protein with WD40/YVTN repeat doamin;(source:Araport11) |
| AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G28090 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT4G12115 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT3G58930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G44070 | Glycosyl hydrolase family 35 protein;(source:Araport11) |
| AT3G09080 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G19400 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT4G10865 | transposable_element_gene;(source:Araport11);non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G54035 | pseudogene of epithiospecifier protein |
| AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G20970 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT4G01245 | hypothetical protein;(source:Araport11) |
| AT2G02210 | transposable_element_gene;(source:Araport11);pseudogene, Ulp1 protease family, contains Pfam profile PF02902: Ulp1 protease family, C-terminal catalytic domain;(source:TAIR10) |
| AT5G62610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G32628 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to mutator-like transposase, putative;(source:TAIR10) |
| AT1G75810 | transmembrane protein;(source:Araport11) |
| AT3G45851 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT2G13146 | Pseudogene of AT2G12905 |
| AT5G64590 | NYN domain protein;(source:Araport11) |
| AT3G58640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
| AT5G04730 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT2G29995 | PSY3-like protein;(source:Araport11) |
| AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT1G67680 | SRP72 RNA-binding domain-containing protein;(source:Araport11) |
| AT3G26770 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G46535 | hypothetical protein;(source:Araport11) |
| AT2G28440 | proline-rich family protein;(source:Araport11) |
| AT2G32520 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G27730 | heparan-alpha-glucosaminide N-acetyltransferase-like protein (DUF1624);(source:Araport11) |
| AT2G32291 | Pseudogene of AT2G31470; F-box family protein |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G16360 | NC domain-containing protein-like protein;(source:Araport11) |
| AT1G69460 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT5G15820 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G08240 | transmembrane protein;(source:Araport11) |
| AT3G61820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G37530 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G06540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G25330 | SAWADEE protein;(source:Araport11) |
| AT1G66890 | 50S ribosomal-like protein;(source:Araport11) |
| AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
| AT5G48605 | Encodes a defensin-like (DEFL) family protein. |
| AT1G31390 | TRAF-like family protein;(source:Araport11) |
| AT1G11320 | GDSL esterase/lipase;(source:Araport11) |
| AT3G55780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G54530 | hypothetical protein;(source:Araport11) |
| AT1G36700 | pseudogene of Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G66860 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT3G12150 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT4G08860 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G27870.1);(source:TAIR10) |
| AT3G18620 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
| AT4G35130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G48570 | secE/sec61-gamma protein transport protein;(source:Araport11) |
| AT5G59500 | protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase;(source:Araport11) |
| AT1G75670 | DNA-directed RNA polymerase;(source:Araport11) |
| AT3G57350 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
| AT4G11900 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G21070 | Fe(3+) dicitrate transport system permease;(source:Araport11) |
| AT1G28140 | integral membrane family protein;(source:Araport11) |
| AT2G31018 | hypothetical protein;(source:Araport11) |
| AT2G03900 | pseudogene of zinc transporter 7 precursor;(source:Araport11) |
| AT5G58280 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G39170 | MEF2BNB-like protein;(source:Araport11) |
| AT4G34420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G59725 | DNAJ heat shock family protein;(source:Araport11) |
| AT4G23610 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G25870 | hypothetical protein;(source:Araport11) |
| AT1G44920 | transmembrane protein;(source:Araport11) |
| AT4G36791 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G06180 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G42783 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-172 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G55750 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins);(source:Araport11) |
| AT4G28706 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT3G21030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-16 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT3G27200 | Cupredoxin superfamily protein;(source:Araport11) |
| AT5G18900 | 2-oxoglutarate-dependent dioxygenase |
| AT3G01270 | Pectate lyase family protein;(source:Araport11) |
| AT5G23110 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G54955 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05145.1);(source:TAIR10) |
| AT2G06985 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G43826 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G22410 | Class-II DAHP synthetase family protein;(source:Araport11) |
| AT4G10980 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-44 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G08540 | ribosomal RNA small subunit methyltransferase J;(source:Araport11) |
| AT4G21865 | hypothetical protein;(source:Araport11) |
| AT4G28070 | AFG1-like ATPase family protein;(source:Araport11) |
| AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT2G13940 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.4e-197 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G33985 | membrane insertase, putative (DUF1685);(source:Araport11) |
| AT4G38660 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G07170 | Similar to human splicing factor 3b, 14 kda subunit, SF3b14b. |
| AT3G33157 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G03845 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT3G09050 | 8-amino-7-oxononanoate synthase;(source:Araport11) |
| AT3G12030 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
| AT1G75720 | WEB family protein (DUF827);(source:Araport11) |
| AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G50770 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT4G15960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G36770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.3e-41 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G43755 | non-LTR retrolelement reverse transcriptase-like protein;(source:Araport11) |
| AT1G74300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G42190 | transposable_element_gene;(source:Araport11);similar to cysteine-type peptidase [Arabidopsis thaliana] (TAIR:AT3G42820.1);(source:TAIR10) |
| AT1G55430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G17147 | VQ motif-containing protein;(source:Araport11) |
| AT4G12423 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G36640 | transmembrane protein;(source:Araport11) |
| AT4G08039 | Encodes a defensin-like (DEFL) family protein. |
| AT5G26700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G11960 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT1G18940 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT5G66370 | metal ion-binding protein;(source:Araport11) |
| AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
| AT4G11521 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G30350 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G61910 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT1G35200 | pseudogene of Ribosomal protein L4/L1 family;(source:Araport11) |
| AT5G44220 | F-box family protein;(source:Araport11) |
| AT2G14590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27606.1);(source:TAIR10) |
| AT3G49950 | GRAS family transcription factor;(source:Araport11) |
| AT5G37480 | maltase-glucoamylase, intestinal protein;(source:Araport11) |
| AT4G19570 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G09060 | hypothetical protein;(source:Araport11) |
| AT4G27850 | Glycine-rich protein family;(source:Araport11) |
| AT3G62370 | heme binding protein;(source:Araport11) |
| AT3G21650 | Encodes protein phosphatase 2A (PP2A) B'zeta subunit. Targeted to mitochondria. |
| AT5G23510 | hypothetical protein;(source:Araport11) |
| AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT1G71300 | Vps52 / Sac2 family;(source:Araport11) |
| AT1G67670 | hypothetical protein;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT5G44875 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.3e-87 P-value blast match to Q9SLM0 /314-478 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G30280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G19750 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT3G50200 | hypothetical protein (DUF247);(source:Araport11) |
| AT4G01975 | transposable_element_gene;(source:Araport11);pseudogene, similar to B, blastp match of 51%25 identity and 4.5e-98 P-value to GP|22830897|dbj|BAC15771.1||AB087616 B {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G35170 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT4G01700 | Chitinase family protein;(source:Araport11) |
| AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G23520 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G19902 | pseudogene of Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G30120 | pseudogene of mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G04200 | dyggve-melchior-clausen syndrome protein;(source:Araport11) |
| AT3G01380 | sulfatase and phosphatidylinositolglycan class N domain-containing protein;(source:Araport11) |
| AT1G68470 | Exostosin family protein;(source:Araport11) |
| AT1G77200 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G16040 | transmembrane protein;(source:Araport11) |
| AT5G54050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G02240 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile. |
| AT3G21310 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
| AT3G32195 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.8e-102 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT3G28940 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT3G28670 | oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT2G46915 | DUF3754 family protein, putative (DUF3754);(source:Araport11) |
| AT3G12970 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT2G03821 | hypothetical protein;(source:Araport11) |
| AT5G62140 | ATP-dependent Clp protease ATP-binding subunit;(source:Araport11) |
| AT2G38350 | hypothetical protein;(source:Araport11) |
| AT4G36945 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT3G53490 | valine-tRNA ligase;(source:Araport11) |
| AT1G56120 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G37442 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.7e-44 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G42083 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), contains Pfam profile PF03078: ATHILA ORF-1 family;(source:TAIR10) |
| AT1G73740 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G27771 | pseudogene of (SAUR) auxin-responsive family protein |
| AT4G27657 | hypothetical protein;(source:Araport11) |
| AT5G36297 | pseudogene of aspartyl protease family protein |
| AT3G58910 | F-box family protein;(source:Araport11) |
| AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT2G20921 | hypothetical protein;(source:Araport11) |
| AT5G38260 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G41450 | N-acetyltransferase;(source:Araport11) |
| AT4G33160 | F-box family protein;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G17150 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
| AT5G12000 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G14870 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G07430 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G10220 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.3e-151 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT2G47680 | zinc finger (CCCH type) helicase family protein;(source:Araport11) |
| AT3G24005 | pseudogene of heat shock protein 60;(source:Araport11) |
| AT2G28810 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT3G49370 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT4G11216 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
| AT2G30100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT1G17360 | LOW protein: protein phosphatase 1 regulatory subunit-like protein;(source:Araport11) |
| AT3G32043 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G20298 | pseudogene of exonuclease family protein |
| AT5G47229 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G63770 | Peptidase M1 family protein;(source:Araport11) |
| AT5G54920 | polyadenylate-binding protein interacting protein;(source:Araport11) |
| AT2G35360 | ubiquitin family protein;(source:Araport11) |
| AT5G14330 | transmembrane protein;(source:Araport11) |
| AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
| AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G34140 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT1G61600 | DUF1262 family protein (DUF1262);(source:Araport11) |
| AT1G17230 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G03920 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT1G56540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G66530 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT3G17550 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT4G29750 | CRS1 / YhbY (CRM) domain-containing protein;(source:Araport11) |
| AT3G15970 | NUP50 (Nucleoporin 50 kDa) protein;(source:Araport11) |
| AT2G42320 | nucleolar protein gar2-like protein;(source:Araport11) |
| AT2G28755 | UDP-D-glucuronate carboxy-lyase-like protein;(source:Araport11) |
| AT5G23903 | transmembrane protein;(source:Araport11) |
| AT2G04090 | MATE efflux family protein;(source:Araport11) |
| AT5G51730 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G17740 | hypothetical protein;(source:Araport11) |
| AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT2G23148 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G21700 | DUF2921 family protein, putative (DUF2921);(source:Araport11) |
| AT2G02205 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G27670 | transmembrane protein;(source:Araport11) |
| AT1G26773 | hypothetical protein;(source:Araport11) |
| AT5G22545 | hypothetical protein;(source:Araport11) |
| AT5G28630 | glycine-rich protein;(source:Araport11) |
| AT2G34300 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G26380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G19240 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT3G17920 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT4G07630 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03078: ATHILA ORF-1 family;(source:TAIR10) |
| AT3G55470 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G04750 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G48960 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT4G19865 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G66250 | kinectin-like protein;(source:Araport11) |
| AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT5G48440 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT5G49430 | WD40/YVTN repeat and Bromo-WDR9-I-like domain-containing protein;(source:Araport11) |
| AT3G57250 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
| AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
| AT3G22250 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G26940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT3G22430 | RNA recognition motif XS domain protein;(source:Araport11) |
| AT1G08710 | F-box protein that is induced in roots by drought stress. |
| AT5G27950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G15320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G61660 | hypothetical protein;(source:Araport11) |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G62580 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT2G15220 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT3G33130 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-256 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G60260 | ELMO/CED-12 family protein;(source:Araport11) |
| AT5G55670 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G45850 | hypothetical protein (DUF688);(source:Araport11) |
| AT5G65490 | suppressor-like protein;(source:Araport11) |
| AT1G67920 | hypothetical protein;(source:Araport11) |
| AT5G35450 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT3G25240 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT5G21090 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G11830 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G04850 | Auxin-responsive family protein;(source:Araport11) |
| AT4G09770 | TRAF-like family protein;(source:Araport11) |
| AT5G07150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G13760 | no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
| AT1G72131 | pseudogene of proton-dependent oligopeptide transporter |
| AT3G03405 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G25597 | transmembrane protein;(source:Araport11) |
| AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G10750 | FBD domain family;(source:Araport11) |
| AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G56260 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
| AT2G15840 | pseudogene of hypothetical protein;(source:Araport11) |
| AT1G24148 | hypothetical protein;(source:Araport11) |
| AT4G12150 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G54780 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G15920 | Phox (PX) domain-containing protein;(source:Araport11) |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
| AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
| AT4G28340 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT3G50050 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G02070 | zinc ion-binding protein;(source:Araport11) |
| AT5G53710 | hypothetical protein;(source:Araport11) |
| AT5G67620 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G56370 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G05350 | PLAC8 family protein;(source:Araport11) |
| AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
| AT4G21250 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT3G61198 | other_RNA;(source:Araport11) |
| AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT2G05280 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-30 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G51200 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT3G50180 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT4G06481 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam domain PF03078: ATHILA ORF-1 family;(source:TAIR10) |
| AT1G73200 | testis-expressed sequence 2-like protein (DUF2404);(source:Araport11) |
| AT2G04495 | transmembrane protein;(source:Araport11) |
| AT1G22040 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G09780 | TRAF-like family protein;(source:Araport11) |
| AT4G17430 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G63340 | hypothetical protein;(source:Araport11) |
| AT1G03290 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT5G22490 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT3G12940 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G56310 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G36960 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G48540 | receptor-like protein kinase-related family protein;(source:Araport11) |
| AT4G04480 | F-box protein with a domain protein;(source:Araport11) |
| AT3G55170 | Ribosomal L29 family protein;(source:Araport11) |
| AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G43440 | encodes a protein whose sequence is similar to ACC oxidase |
| AT5G56240 | hapless protein;(source:Araport11) |
| AT1G33870 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G30650 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G10175.1);(source:TAIR10) |
| AT2G41342 | hypothetical protein;(source:Araport11) |
| AT1G13240 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT2G25355 | PNAS-3-like protein;(source:Araport11) |
| AT3G19660 | hypothetical protein;(source:Araport11) |
| AT1G12190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G62450 | DNA mismatch repair protein;(source:Araport11) |
| AT1G09520 | hypothetical protein;(source:Araport11) |
| AT1G11280 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT3G29771 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G07310 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G63230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT3G26115 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G13000 | transmembrane protein, putative (DUF707);(source:Araport11) |
| AT1G11470 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G41827 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-11 P-value blast match to GB:CAB39733 rotease, reverse transcriptase, ribonuclease H, integrase (Gypsy_Ty3-element) (Drosophila buzzatii);(source:TAIR10) |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G21060 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT3G60480 | StAR lipid transfer-like protein;(source:Araport11) |
| AT3G52870 | IQ calmodulin-binding motif family protein;(source:Araport11) |
| AT3G29034 | transmembrane protein;(source:Araport11) |
| AT1G22800 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G34868 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-131 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G26680 | transcriptional factor B3 family protein;(source:Araport11) |
| AT4G24175 | kinesin-like protein;(source:Araport11) |
| AT5G11416 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G14180 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G14878 | other_RNA;(source:Araport11) |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT1G53366 | hypothetical protein;(source:Araport11) |
| AT4G22610 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G29690 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G26740 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT2G40765 | transmembrane protein;(source:Araport11) |
| AT3G10035 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT1G23910 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G07070 | transposable_element_gene;(source:Araport11) |
| AT1G65385 | pseudogene of serpin 3;(source:Araport11) |
| AT5G28660 | NHL domain-containing protein;(source:Araport11) |
| AT1G45010 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT3G26240 | Cysteine/Histidine-rich C1 domain family protein. Accumulation of this protein is regulated by a cis-Natural Antisense RNA (cis-NAT). |
| AT3G10250 | histidine-tRNA ligase;(source:Araport11) |
| AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT5G44973 | Encodes a defensin-like (DEFL) family protein. |
| AT4G24330 | hypothetical protein (DUF1682);(source:Araport11) |
| AT1G03400 | A single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers. |
| AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G54780 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT1G36970 | transmembrane protein, putative (DUF1985);(source:Araport11) |
| AT2G27650 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT3G33030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-50 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G27660 | hypothetical protein;(source:Araport11) |
| AT2G23330 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G23100 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G30450 | glycine-rich protein;(source:Araport11) |
| AT2G17064 | Pseudogene of AT2G17080 |
| AT5G59760 | hypothetical protein (DUF1635);(source:Araport11) |
| AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G36600 | Late embryogenesis abundant (LEA) protein;(source:Araport11) |
| AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G59680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G04140 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G01925 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G27100 | Actin cross-linking protein;(source:Araport11) |
| AT1G68140 | zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11) |
| AT1G09195 | Ppx-GppA phosphatase;(source:Araport11) |
| AT5G35207 | transposable_element_gene;(source:Araport11);pseudogene, similar to simiar to ribosomal protein, blastp match of 45%25 identity and 6.7e-47 P-value to GP|19571128|dbj|BAB86552.1||AP003566 simiar to ribosomal protein {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G76994 | hypothetical protein;(source:Araport11) |
| AT3G50130 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G27220 | Frigida-like protein;(source:Araport11) |
| AT2G10950 | BSD domain-containing protein;(source:Araport11) |
| AT1G50130 | pseudogene of ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
| AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G04235 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.2e-38 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G47740 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G60970 | SNARE-like superfamily protein;(source:Araport11) |
| AT5G28253 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-60 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G37860 | SPT2 chromatin protein;(source:Araport11) |
| AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT3G24710 | NADPH-dependent diflavin oxidoreductase;(source:Araport11) |
| AT4G08230 | glycine-rich protein;(source:Araport11) |
| AT3G57980 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT3G16750 | hypothetical protein;(source:Araport11) |
| AT4G13960 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G02670 | hypothetical protein;(source:Araport11) |
| AT1G28400 | GATA zinc finger protein;(source:Araport11) |
| AT5G49560 | Putative methyltransferase family protein;(source:Araport11) |
| AT4G05610 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, putative retrotransposon-like orf - Arabidopsis thaliana,PID:g4309868;(source:TAIR10) |
| AT4G10140 | transmembrane protein;(source:Araport11) |
| AT2G40113 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT4G21902 | hypothetical protein;(source:Araport11) |
| AT5G06430 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
| AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G58760 | Integrin-linked protein kinase family;(source:Araport11) |
| AT3G54925 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G57850 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G16565 | threonyl and alanyl tRNA synthetase second additional domain-containing protein;(source:Araport11) |
| AT5G62710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT1G63530 | hypothetical protein;(source:Araport11) |
| AT2G44260 | DUF946 family protein (DUF946);(source:Araport11) |
| AT3G58877 | hypothetical protein;(source:Araport11) |
| AT5G02502 | Oligosaccaryltransferase;(source:Araport11) |
| AT2G41810 | imidazolonepropionase (Protein of unknown function, DUF642);(source:Araport11) |
| AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
| AT1G05400 | hypothetical protein;(source:Araport11) |
| AT3G59570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G70450 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
| AT2G40205 | Ribosomal protein L41 family;(source:Araport11) |
| AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G61345 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
| AT2G31800 | Integrin-linked protein kinase family;(source:Araport11) |
| AT3G52105 | DIS3-exonuclease-like protein;(source:Araport11) |
| AT3G09510 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT4G00280 | ER protein carbohydrate-binding protein;(source:Araport11) |
| AT1G04555 | transmembrane protein;(source:Araport11) |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT2G47200 | hypothetical protein;(source:Araport11) |
| AT5G48620 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT1G34070 | Copia-like polyprotein/retrotransposon;(source:Araport11) |
| AT5G19100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G05752 | hypothetical protein;(source:Araport11) |
| AT5G65340 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G61770 | J domain protein. The mRNA is cell-to-cell mobile. |
| AT5G32702 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-150 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT4G08347 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G17043 | hypothetical protein;(source:Araport11) |
| AT2G37880 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
| AT3G30213 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G14230 | ankyrin;(source:Araport11) |
| AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT1G73930 | polarity axis stabilization protein;(source:Araport11) |
| AT5G25600 | putative nucleic-acid protein;(source:Araport11) |
| AT4G29270 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT2G20690 | A synthetic gene encoding the catalytic domain of the Arabidopsis thaliana gene At2g20690 was recombinant expressed in E. coli demonstrating the molecular function of riboflavin synthase. The mRNA is cell-to-cell mobile. |
| AT4G36105 | polyamine-modulated factor 1-binding protein;(source:Araport11) |
| AT5G38230 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 8.5e-53 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT5G67455 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
| AT5G25070 | neurofilament light protein;(source:Araport11) |
| AT1G28695 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT3G09032 | josephin-like protein;(source:Araport11) |
| AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
| AT2G27660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G19160 | transglutaminase family protein;(source:Araport11) |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G20360 | F-box family protein;(source:Araport11) |
| AT3G22920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G23510 | OBP32pep protein;(source:Araport11) |
| AT1G23520 | hypothetical protein (DUF220);(source:Araport11) |
| AT3G13070 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
| AT3G58220 | TRAF-like family protein;(source:Araport11) |
| AT4G39170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G29030 | Apoptosis inhibitory protein 5 (API5);(source:Araport11) |
| AT1G53635 | hypothetical protein;(source:Araport11) |
| AT2G05910 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT1G59770 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.2e-49 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G16560 | Per1-like family protein;(source:Araport11) |
| AT3G42360 | transposable_element_gene;(source:Araport11);pseudogene, similar to Putative 22 kDa kafirin cluster;(source:TAIR10) |
| AT4G25740 | RNA binding Plectin/S10 domain-containing protein;(source:Araport11) |
| AT4G01740 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
| AT4G35370 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G26445 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G35710 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT5G37250 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G75200 | flavodoxin family protein / radical SAM domain-containing protein;(source:Araport11) |
| AT4G35070 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
| AT5G28696 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.2e-184 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G01310 | hypothetical protein;(source:Araport11) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT5G41860 | transmembrane protein;(source:Araport11) |
| AT1G32780 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT2G42770 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT3G07300 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT1G63205 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT3G61962 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G38550 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
| AT5G49680 | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
| AT2G47950 | myelin transcription factor-like protein;(source:Araport11) |
| AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G31820 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G38255 | hypothetical protein (DUF239);(source:Araport11) |
| AT3G03670 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G28900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G61530 | small G protein family protein / RhoGAP family protein;(source:Araport11) |
| AT1G47970 | nucleolin;(source:Araport11) |
| AT4G32970 | BRISC/BRCA1-A complex protein;(source:Araport11) |
| AT1G71240 | chromosome-partitioning protein, putative (DUF639);(source:Araport11) |
| AT3G44150 | Expp1 protein;(source:Araport11) |
| AT2G04680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G15480 | fiber (DUF1218);(source:Araport11) |
| AT5G41660 | transmembrane protein;(source:Araport11) |
| AT3G17190 | hypothetical protein;(source:Araport11) |
| AT5G41810 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT4G28088 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G18690 | transmembrane protein;(source:Araport11) |
| AT5G28288 | Encodes a defensin-like (DEFL) family protein. |
| AT5G02615 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
| AT3G18460 | PLAC8 family protein;(source:Araport11) |
| AT2G17070 | hypothetical protein (DUF241);(source:Araport11) |
| AT2G04042 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-26 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
| AT2G01060 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G08350 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT4G22754 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT3G17350 | wall-associated receptor kinase carboxy-terminal protein;(source:Araport11) |
| AT5G37130 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
| AT2G41835 | zinc finger (C2H2 type, AN1-like) family protein;(source:Araport11) |
| AT2G15300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT1G21395 | transmembrane protein;(source:Araport11) |
| AT4G14610 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G25490 | Protein kinase family protein;(source:Araport11) |
| AT5G52380 | |
| AT4G40011 | hypothetical protein;(source:Araport11) |
| AT3G07195 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT1G69950 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.0e-71 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT1G04840 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G29000 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G34770 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.2e-131 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT1G54445 | Encodes a defensin-like (DEFL) family protein. |
| AT4G18660 | delay of germination protein;(source:Araport11) |
| AT2G46380 | extra-large G-like protein, putative (DUF3133);(source:Araport11) |
| AT3G52535 | Natural antisense transcript overlaps with AT3G52540;(source:Araport11) |
| AT5G23250 | Succinyl-CoA ligase, alpha subunit;(source:Araport11) |
| AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT1G35430 | transmembrane protein;(source:Araport11) |
| AT3G62990 | myelin transcription factor-like protein;(source:Araport11) |
| AT3G30740 | pseudogene of Ribosomal protein S25 family protein;(source:Araport11) |
| AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G53710 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT2G11462 | hypothetical protein;(source:Araport11) |
| AT5G51520 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G03020 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT1G50732 | transmembrane protein;(source:Araport11) |
| AT1G47655 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT5G44910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT1G35340 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT1G74790 | catalytics;(source:Araport11) |
| AT3G01160 | pre-rRNA-processing ESF1-like protein;(source:Araport11) |
| AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G52410 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT3G30187 | pseudogene of no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
| AT3G43825 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.3e-106 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G04046 | Encodes a defensin-like (DEFL) family protein. |
| AT3G60850 | hypothetical protein;(source:Araport11) |
| AT5G28570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G12725.1);(source:TAIR10) |
| AT3G44400 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G11402 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
| AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G74290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G32020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT4G03380 | hypothetical protein;(source:Araport11) |
| AT3G22060 | contains Pfam profile: PF01657 Domain of unknown function that is usually associated with protein kinase domain Pfam:PF00069, however this protein does not have the protein kinase domain |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G33110 | MATE efflux family protein;(source:Araport11) |
| AT1G59710 | actin cross-linking protein (DUF569);(source:Araport11) |
| AT5G45910 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G48657 | defense protein-like protein;(source:Araport11) |
| AT3G26440 | transmembrane protein, putative (DUF707);(source:Araport11) |
| AT3G21080 | ABC transporter-like protein;(source:Araport11) |
| AT3G28695 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G73655 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G00390 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT3G04854 | hypothetical protein;(source:Araport11) |
| AT3G62499 | YTH family protein;(source:Araport11) |
| AT1G33610 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G43980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G28703 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G58280 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
| AT1G21370 | transmembrane protein;(source:Araport11) |
| AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
| AT4G26620 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
| AT1G20490 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G28894 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G60760 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G21950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G28295 | hypothetical protein;(source:Araport11) |
| AT2G40995 | Encodes a defensin-like (DEFL) family protein. |
| AT3G04980 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT5G10605 | methyltransferase;(source:Araport11) |
| AT4G33310 | hypothetical protein;(source:Araport11) |
| AT3G45095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-140 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G26470 | embryonic stem cell-specific 5-hydroxymethylcytosine-binding protein;(source:Araport11) |
| AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G39450 | F-box family protein;(source:Araport11) |
| AT5G53090 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G07500 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-70 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G47550 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G39540 | Gibberellin-regulated family protein;(source:Araport11) |
| AT1G53633 | hypothetical protein;(source:Araport11) |
| AT5G22390 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
| AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT5G30380 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
| AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G40510 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
| AT4G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G07140 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT3G25990 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G00005 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT5G52030 | TraB family protein;(source:Araport11) |
| AT1G12380 | hypothetical protein;(source:Araport11) |
| AT4G39320 | microtubule-associated protein-like protein;(source:Araport11) |
| AT1G41840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-23 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT2G26050 | hypothetical protein (DUF1644);(source:Araport11) |
| AT3G25400 | dCTP pyrophosphatase-like protein;(source:Araport11) |
| AT3G04360 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT3G05950 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G24690 | plant/protein, putative (DUF3411);(source:Araport11) |
| AT3G17400 | F-box family protein;(source:Araport11) |
| AT3G51330 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G31310 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G17960 | Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments. |
| AT2G28605 | Encodes a PsbP domain-OEC23 like protein localized in thylakoid (peripheral-lumenal side). |
| AT4G08640 | ATP binding protein;(source:Araport11) |
| AT3G22030 | Receptor protein kinase-like protein;(source:Araport11) |
| AT1G80280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT2G32870 | TRAF-like family protein;(source:Araport11) |
| AT3G22070 | proline-rich family protein;(source:Araport11) |
| AT3G02060 | DEAD/DEAH box helicase;(source:Araport11) |
| AT5G25860 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G53660 | Nucleotide/sugar transporter family protein |
| AT5G59210 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G51490 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G12710 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G17152 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G41550 | Rho termination factor;(source:Araport11) |
| AT3G51340 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G33175 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G37036 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 6.6e-26 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT4G36530 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G42330 | hypothetical protein;(source:Araport11) |
| AT5G41685 | Mitochondrial outer membrane translocase complex, subunit Tom7;(source:Araport11) |
| AT3G55590 | Glucose-1-phosphate adenylyltransferase family protein;(source:Araport11) |
| AT4G03480 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G58412 | Encodes a Plant thionin family protein |
| AT1G13510 | hypothetical protein (DUF1262);(source:Araport11) |
| AT3G21351 | transmembrane protein;(source:Araport11) |
| AT1G35710 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G05650 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G38100 | SABATH family methyltransferase. |
| AT2G31345 | transmembrane protein;(source:Araport11) |
| AT2G16250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G64680 | beta-carotene isomerase D27;(source:Araport11) |
| AT1G28640 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G24095 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT5G59990 | CCT motif family protein;(source:Araport11) |
| AT2G05133 | Pseudogene of AT2G37680 |
| AT1G21290 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-25 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G38970 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G01800 | Ribosome recycling factor;(source:Araport11) |
| AT2G32470 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G54450 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G39430 | DUF1336 family protein, putative (DUF1336);(source:Araport11) |
| AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT1G16100 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT1G15930 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT4G37483 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G35740 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT2G19250 | pseudogene of ALBINA 1;(source:Araport11) |
| AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT4G37022 | hypothetical protein;(source:Araport11) |
| AT5G42110 | hypothetical protein;(source:Araport11) |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G07190 | transmembrane protein, putative (DUF1985);(source:Araport11) |
| AT4G23364 | Pseudogene of AT4G23340; oxidoreductase, 2OG-Fe(II) oxygenase family protein |
| AT1G42740 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42120.1);(source:TAIR10) |
| AT2G25910 | 3-5 exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein;(source:Araport11) |
| AT2G40600 | appr-1-p processing enzyme family protein;(source:Araport11) |
| AT3G03440 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G44820 | axoneme-associated protein MST101(2) protein;(source:Araport11) |
| AT1G11145 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G48660 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT2G11640 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10) |
| AT4G36660 | polyol transporter, putative (DUF1195);(source:Araport11) |
| AT3G27510 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G68680 | SH3/FCH domain protein;(source:Araport11) |
| AT4G27852 | Natural antisense transcript overlaps with AT4G27850 and AT4G27860;(source:Araport11) |
| AT1G71910 | hypothetical protein;(source:Araport11) |
| AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G07510 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42110.1);(source:TAIR10) |
| AT5G11940 | Subtilase family protein;(source:Araport11) |
| AT5G46260 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G59020 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT2G25740 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT2G23200 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G06002 | Natural antisense transcript overlaps with AT1G06000;(source:Araport11) |
| AT2G07600 | pseudogene of NADH-Ubiquinone oxidoreductase (complex I);(source:Araport11) |
| AT1G20795 | F-box family protein;(source:Araport11) |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680;(source:Araport11) |
| AT1G28970 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G79740 | hAT transposon superfamily;(source:Araport11) |
| AT3G20260 | DUF1666 family protein (DUF1666);(source:Araport11) |
| AT2G33390 | hypothetical protein;(source:Araport11) |
| AT2G44870 | replicase polyprotein 1ab protein;(source:Araport11) |
| AT2G38780 | cytochrome C oxidase subunit;(source:Araport11) |
| AT5G38275 | pseudogene of PR5-like receptor kinase;(source:Araport11) |
| AT1G62695 | transposable_element_gene;(source:Araport11);pseudogene, similar to Unknown protein, blastp match of 30%25 identity and 1.6e-09 P-value to GP|22773232|gb|AAN06838.1||AC099401 Unknown protein {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT1G49100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G18940 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
| AT1G16600 | pseudogene of camelliol C synthase 1;(source:Araport11) |
| AT5G28830 | calcium-binding EF hand family protein;(source:Araport11) |
| AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G13225 | snoRNA;(source:Araport11) |
| AT5G18500 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G66340 | hypothetical protein;(source:Araport11) |
| AT3G07900 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G63830 | PLAC8 family protein;(source:Araport11) |
| AT5G25451 | Pseudogene of AT5G25440; protein kinase family protein |
| AT5G27980 | Seed maturation protein;(source:Araport11) |
| AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G32875 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-79 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G01960 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G19239 | Pseudogene of AT5G01080; beta-galactosidase |
| AT1G48210 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G21010 | C2 domain-containing protein. Possible pseudogene of AT2G20990. |
| AT3G53235 | hypothetical protein;(source:Araport11) |
| AT1G52810 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G27520 | cryptic loci regulator;(source:Araport11) |
| AT3G07273 | hypothetical protein;(source:Araport11) |
| AT1G80930 | MIF4G domain-containing protein / MA3 domain-containing protein;(source:Araport11) |
| AT5G45240 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G36940 | myotubularin-like protein;(source:Araport11) |
| AT3G62220 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G39270 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G56590 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G15053 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT1G70430 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G04500 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G72880 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
| AT3G47530 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G15540 | 2-oxoglutarate-dependent dioxygenase-like protein;(source:Araport11) |
| AT2G27720 | 60S acidic ribosomal protein family;(source:Araport11) |
| AT1G77530 | O-methyltransferase family protein;(source:Araport11) |
| AT5G43770 | proline-rich family protein;(source:Araport11) |
| AT2G13170 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-88 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G19796 | other_RNA;(source:Araport11) |
| AT1G20890 | caveolin-1 protein;(source:Araport11) |
| AT1G19380 | sugar, putative (DUF1195);(source:Araport11) |
| AT3G32904 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT3G05685 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G23340 | carboxyl-terminal proteinase, putative (DUF239);(source:Araport11) |
| AT5G21050 | hyccin;(source:Araport11) |
| AT4G40050 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
| AT4G34150 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
| AT3G30216 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains some similarity to polyproteins;(source:TAIR10) |
| AT3G57960 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
| AT1G26100 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT5G24080 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT2G17360 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT1G11880 | transferases, transferring hexosyl groups;(source:Araport11) |
| AT4G01170 | hypothetical protein;(source:Araport11) |
| AT1G80290 | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
| AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G33870 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G65845 | transmembrane protein;(source:Araport11) |
| AT5G44418 | pseudogene of cytochrome P450;(source:Araport11) |
| AT2G07791 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G41170 | F-box family protein;(source:Araport11) |
| AT3G29773 | pseudogene of nuclease;(source:Araport11) |
| AT2G10330 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-176 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT2G15170 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT5G53050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G24320 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
| AT5G28560 | hypothetical protein;(source:Araport11) |
| AT5G41612 | Natural antisense transcript overlaps with AT5G41610;(source:Araport11) |
| AT1G48640 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
| AT5G56452 | FBD-like domain family protein;(source:Araport11) |
| AT4G16840 | transmembrane protein;(source:Araport11) |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
| AT2G05360 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G69980 | structural polyprotein;(source:Araport11) |
| AT5G01350 | UvrABC system C protein;(source:Araport11) |
| AT5G01732 | Natural antisense transcript overlaps with AT5G01730;(source:Araport11) |
| AT5G07322 | other_RNA;(source:Araport11) |
| AT3G63450 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G32220 | Ribosomal L27e protein family;(source:Araport11) |
| AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT1G05136 | hypothetical protein;(source:Araport11) |
| AT1G56720 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G26147 | hypothetical protein;(source:Araport11) |
| AT2G46560 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G59865 | transmembrane protein;(source:Araport11) |
| AT4G18460 | D-Tyr-tRNA(Tyr) deacylase family protein;(source:Araport11) |
| AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT4G04745 | hypothetical protein;(source:Araport11) |
| AT3G15650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G17365 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G16270 | transmembrane protein;(source:Araport11) |
| AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G58225 | hypothetical protein;(source:Araport11) |
| AT4G31985 | Ribosomal protein L39 family protein;(source:Araport11) |
| AT4G10720 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G73650 | 3-oxo-5-alpha-steroid 4-dehydrogenase (DUF1295);(source:Araport11) |
| AT5G17340 | Putative membrane lipoprotein;(source:Araport11) |
| AT1G64610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G26934 | hypothetical protein;(source:Araport11) |
| AT1G51920 | transmembrane protein;(source:Araport11) |
| AT1G33850 | Ribosomal protein S19 family protein;(source:Araport11) |
| AT1G24159 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT1G05291 | GPI inositol-deacylase C, putative (DUF1218);(source:Araport11) |
| AT1G23350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G47965 | hypothetical protein;(source:Araport11) |
| AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G42010 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G01050 | zinc ion binding / nucleic acid binding protein;(source:Araport11) |
| AT5G47920 | transcription elongation factor;(source:Araport11) |
| AT3G32047 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT5G38310 | hypothetical protein;(source:Araport11) |
| AT5G01130 | hypothetical protein (DUF674);(source:Araport11) |
| AT4G26483 | nicotianamine synthase;(source:Araport11) |
| AT2G17590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G23360 | filament-like protein (DUF869);(source:Araport11) |
| AT5G28623 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G44570.1);(source:TAIR10) |
| AT3G61117 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G15250 | TPRXL;(source:Araport11) |
| AT3G41979 | 5.8SrRNA |
| AT3G62010 | metal ion-binding protein;(source:Araport11) |
| AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT1G18735 | Natural antisense transcript overlaps with AT1G18730;(source:Araport11) |
| AT3G62200 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT3G05610 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G03110 | protamine P1 family protein;(source:Araport11) |
| AT1G29465 | transmembrane protein;(source:Araport11) |
| AT2G30615 | F-box/LRR protein;(source:Araport11) |
| AT1G29179 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT4G02340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G44757 | pseudogene of transmembrane protein;(source:Araport11) |
| AT3G01175 | transmembrane protein;(source:Araport11) |
| AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G23840 | transmembrane protein;(source:Araport11) |
| AT5G67510 | Translation protein SH3-like family protein;(source:Araport11) |
| AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G07160 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G24065 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G48655 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G48440 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G01510 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
| AT1G55980 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G14230 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT4G14290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G78915 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
| AT1G65850 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G01930 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G19590 | DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G58420 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT5G08670 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
| AT4G27020 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
| AT5G62130 | Per1-like family protein;(source:Araport11) |
| AT4G19930 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G17580 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
| AT5G10130 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G58400 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G21660 | UBX domain-containing protein;(source:Araport11) |
| AT5G64640 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G37220 | Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT3G54270 | sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
| AT5G43196 | Pseudogene of AT5G43210; endo/excinuclease amino terminal domain-containing protein |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT4G31650 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT5G47170 | hypothetical protein;(source:Araport11) |
| AT4G18250 | receptor Serine/Threonine kinase-like protein;(source:Araport11) |
| AT2G44390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G45238 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G15160 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.8e-86 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G62640 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT5G46080 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G62780 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
| AT4G05060 | PapD-like superfamily protein;(source:Araport11) |
| AT5G46840 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G50090 | PADRE protein. |
| AT3G29075 | glycine-rich protein;(source:Araport11) |
| AT2G30190 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
| AT4G28420 | Tyrosine transaminase family protein;(source:Araport11) |
| AT5G48730 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G09690 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT5G40981 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G02930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G04500 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G35540 | transmembrane protein;(source:Araport11) |
| AT3G28850 | Glutaredoxin family protein;(source:Araport11) |
| AT3G18560 | hypothetical protein;(source:Araport11) |
| AT1G30945 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G57340 | DnaJ heat shock amino-terminal domain protein (DUF1977);(source:Araport11) |
| AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT2G06822 | Pseudogene of AT2G06822 |
| AT2G11135 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04273.1);(source:TAIR10) |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT5G48175 | transmembrane protein;(source:Araport11) |
| AT4G01870 | tolB protein-like protein;(source:Araport11) |
| AT3G29515 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.6e-11 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G04036 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.6e-169 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT2G21020 | pseudogene of NOD26-like intrinsic protein 3;(source:Araport11) |
| AT1G15620 | transmembrane protein;(source:Araport11) |
| AT2G43180 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT3G46350 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT4G14060 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G03826 | transmembrane protein;(source:Araport11) |
| AT5G51580 | hypothetical protein;(source:Araport11) |
| AT3G61010 | Ferritin/ribonucleotide reductase-like family protein;(source:Araport11) |
| AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT5G48140 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G04830 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT1G67410 | Exostosin family protein;(source:Araport11) |
| AT3G58820 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G42955 | inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein (DUF784);(source:Araport11) |
| AT3G33163 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G38250 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G55928 | nuclear speckle splicing regulatory-like protein (DUF2040);(source:Araport11) |
| AT4G12870 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
| AT5G06480 | Immunoglobulin E-set superfamily protein;(source:Araport11) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT3G21450 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G26430 | Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters. |
| AT5G47600 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT2G41470 | agamous-like MADS-box protein;(source:Araport11) |
| AT5G60250 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G21905 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT3G11920 | glutaredoxin-like protein;(source:Araport11) |
| AT5G33251 | pseudogene of Beta-galactosidase related protein;(source:Araport11) |
| AT3G49400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G01670 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G26200 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT5G34832 | pseudogene of hypothetical protein;(source:Araport11) |
| AT5G61450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G78995 | hypothetical protein;(source:Araport11) |
| AT1G54820 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G57535 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G49770 | Leucine rich receptor kinase. |
| AT2G18560 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G09665 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT2G16905 | pseudogene of MATE efflux family protein;(source:Araport11) |
| AT2G29360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G45638 | other_RNA;(source:Araport11) |
| AT2G41178 | Natural antisense transcript overlaps with AT2G41180;(source:Araport11) |
| AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G51120 | zinc finger CCCH domain-containing protein 44;(source:Araport11) |
| AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G64460 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G12030 | phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11) |
| AT4G31115 | DUF1997 family protein, putative (DUF1997);(source:Araport11) |
| AT4G34310 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G19755 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-08 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G30310 | FGGY family of carbohydrate kinase;(source:Araport11) |
| AT2G29600 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G24644 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G19390 | Uncharacterized protein family (UPF0114);(source:Araport11) |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT4G27270 | Quinone reductase family protein;(source:Araport11) |
| AT1G20310 | syringolide-induced protein;(source:Araport11) |
| AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT1G79070 | SNARE-associated protein-like protein;(source:Araport11) |
| AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT5G04045 | Encodes a defensin-like (DEFL) family protein. |
| AT1G18335 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G33940 | Serine/Threonine-kinase ULK4-like protein;(source:Araport11) |
| AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G56470 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G09735 | S1FA-like DNA-binding protein;(source:Araport11) |
| AT3G33187 | Encodes a defensin-like (DEFL) family protein. |
| AT5G66580 | PADRE protein. |
| AT4G30640 | RNI-like superfamily protein;(source:Araport11) |
| AT1G55604 | Pseudogene of AT1G26762 |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
| AT5G57565 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G03965 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
| AT2G29065 | GRAS family transcription factor;(source:Araport11) |
| AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT5G49555 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT5G11225 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT5G24620 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT2G04070 | Expression in rosette leaves is activated by high concentration of boron. |
| AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT5G35810 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
| AT4G32870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G02730 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT5G44990 | Glutathione S-transferase family protein;(source:Araport11) |
| AT4G05170 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G22280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
| AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G58520 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
| AT5G54710 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G30490 | craniofacial development-like protein;(source:Araport11) |
| AT5G16170 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G23260 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G11550 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G03010 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G05350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G45180 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT5G38700 | cotton fiber protein;(source:Araport11) |
| AT1G49000 | transmembrane protein;(source:Araport11) |
| AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G59780 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G35470 | ribosome maturation factor;(source:Araport11) |
| AT5G41330 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT2G03955 | Encodes a defensin-like (DEFL) family protein. |
| AT2G04860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G07155 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.9e-17 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT1G30060 | COP1-interacting protein-like protein;(source:Araport11) |
| AT1G14260 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
| AT5G32520 | transposable_element_gene;(source:Araport11);pseudogene, expressed protein, predicted proteins, Arabidopsis thaliana and others;(source:TAIR10) |
| AT2G26970 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G58037 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G00955 | wall-associated receptor kinase-like protein;(source:Araport11) |
| AT1G33190 | pseudogene of auxin response factor 14;(source:Araport11) |
| AT5G13940 | aminopeptidase;(source:Araport11) |
| AT1G69660 | TRAF-like family protein;(source:Araport11) |
| AT1G56480 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G62840 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT3G44205 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.5e-40 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G69150 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G67910 | hypothetical protein;(source:Araport11) |
| AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G09490 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G45730 | hypothetical protein;(source:Araport11) |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G61545 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G04970 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G42910 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G28250.1);(source:TAIR10) |
| AT3G13950 | ankyrin;(source:Araport11) |
| AT4G14370 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G14010 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT3G50710 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G35545 | Natural antisense transcript overlaps with AT1G35550 and AT1G35540;(source:Araport11) |
| AT1G60830 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G50170 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G21810 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G06270 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to MURA transposase of maize Mutator transposon;(source:TAIR10) |
| AT1G11220 | cotton fiber, putative (DUF761);(source:Araport11) |
| AT1G12667 | Encodes a Plant thionin family protein |
| AT3G26950 | transmembrane protein;(source:Araport11) |
| AT5G35995 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
| AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT3G06620 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT1G55440 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G04220 | Target of miR825/825. Mutants have decreased resistance to fungal pathogens. |
| AT3G53960 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G25020 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT1G55930 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
| AT4G00500 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G43352 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-09 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G33760 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G26330 | DNA binding protein;(source:Araport11) |
| AT1G33320 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G08050 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G60660 | spindle/kinetochore-associated-like protein;(source:Araport11) |
| AT5G51980 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G02700 | NC domain-containing protein-like protein;(source:Araport11) |
| AT1G68935 | hypothetical protein;(source:Araport11) |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT1G64910 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G07475 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to En/Spm-like transposon protein;(source:TAIR10) |
| AT3G57400 | transmembrane protein;(source:Araport11) |
| AT5G57340 | ras guanine nucleotide exchange factor Q-like protein;(source:Araport11) |
| AT3G09960 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT4G08395 | hypothetical protein;(source:Araport11) |
| AT2G02960 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G06503 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.2e-53 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT2G37830 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
| AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G39950 | flocculation protein;(source:Araport11) |
| AT3G27999 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G00780 | TRAF-like family protein;(source:Araport11) |
| AT1G48625 | pseudogene of F-box family protein |
| AT1G03660 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT5G41765 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT1G66880 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G10950 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
| AT5G11242 | pseudogene of ribosomal protein |
| AT5G25050 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G60966 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT5G39370 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
| AT3G15760 | cytochrome P450 family protein;(source:Araport11) |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G08180 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT3G50640 | hypothetical protein;(source:Araport11) |
| AT2G23820 | Metal-dependent phosphohydrolase;(source:Araport11) |
| AT5G17410 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT5G05230 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G25880 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G29240 | PPR containing protein (DUF179);(source:Araport11) |
| AT1G14940 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
| AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
| AT3G21770 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G04700 | carboxylate clamp-TPR protein (DUF1685);(source:Araport11) |
| AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G47940 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G12870 | transmembrane protein;(source:Araport11) |
| AT5G40860 | transmembrane protein;(source:Araport11) |
| AT2G07704 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-50 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G19990 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT5G46325 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT3G06520 | agenet domain-containing protein;(source:Araport11) |
| AT4G08691 | hypothetical protein;(source:Araport11) |
| AT3G42916 | transposable_element_gene;(source:Araport11);transposon protein -related, temporary automated functional assignment;(source:TAIR10) |
| AT4G24530 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G15800 | hypothetical protein;(source:Araport11) |
| AT5G07610 | F-box family protein;(source:Araport11) |
| AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
| AT4G27810 | hypothetical protein;(source:Araport11) |
| AT1G33600 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G50805 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT1G70280 | NHL domain-containing protein;(source:Araport11) |
| AT4G25680 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT3G56720 | pre-mRNA-splicing factor;(source:Araport11) |
| AT3G49610 | B3 domain protein (DUF313);(source:Araport11) |
| AT2G37780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G26805 | B3 domain protein;(source:Araport11) |
| AT1G55535 | transmembrane protein;(source:Araport11) |
| AT3G45770 | Polyketide synthase, enoylreductase family protein;(source:Araport11) |
| AT2G29628 | hypothetical protein;(source:Araport11) |
| AT3G62310 | RNA helicase family protein;(source:Araport11) |
| AT3G50650 | GRAS family transcription factor;(source:Araport11) |
| AT2G10960 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G38560 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT5G36990 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.5e-61 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G31230 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G18840 | LOW protein: PPR containing-like protein;(source:Araport11) |
| AT5G62770 | membrane-associated kinase regulator, putative (DUF1645);(source:Araport11) |
| AT4G13760 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G36370 | hypothetical protein;(source:Araport11) |
| AT1G62045 | ankyrin repeat protein;(source:Araport11) |
| AT4G32140 | EamA-like transporter family;(source:Araport11) |
| AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT5G21080 | Uncharacterized protein;(source:Araport11) |
| AT5G03795 | Exostosin family protein;(source:Araport11) |
| AT3G20370 | TRAF-like family protein;(source:Araport11) |
| AT5G06125 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT5G39770 | Represents a non-function pseudogene homologous to AtMSU81 (At4g30870). |
| AT1G10610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G08165 | hypothetical protein;(source:Araport11) |
| AT2G29020 | Rab5-interacting family protein;(source:Araport11) |
| AT3G01870 | hypothetical protein (DUF946);(source:Araport11) |
| AT5G03377 | pseudogene of acylphosphatase family protein |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT1G43835 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT5G14050 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72690 | neurofilament heavy protein;(source:Araport11) |
| AT5G20060 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G48330 | SsrA-binding protein;(source:Araport11) |
| AT1G59790 | Cullin family protein;(source:Araport11) |
| AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT3G44840 | SABATH methyltransferase |
| AT3G23190 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT3G56550 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G57760 | hypothetical protein;(source:Araport11) |
| AT5G11500 | coiled-coil protein;(source:Araport11) |
| AT2G39640 | glycosyl hydrolase family 17 protein;(source:Araport11) |
| AT2G31130 | hypothetical protein;(source:Araport11) |
| AT1G03100 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G43980 | Ribosomal protein S14p/S29e family protein;(source:Araport11) |
| AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT4G04320 | malonyl-CoA decarboxylase family protein;(source:Araport11) |
| AT3G05425 | hypothetical protein;(source:Araport11) |
| AT1G17145 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT2G15325 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT4G05040 | ankyrin repeat family protein;(source:Araport11) |
| AT1G15885 | hypothetical protein;(source:Araport11) |
| AT4G14385 | histone acetyltransferase subunit NuA4-domain protein;(source:Araport11) |
| AT5G25750 | hypothetical protein;(source:Araport11) |
| AT4G14390 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G60980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT5G38910 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G80400 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G07910 | reactive oxygen species modulator-like protein;(source:Araport11) |
| AT5G59410 | Rab5-interacting family protein;(source:Araport11) |
| AT5G29550 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.4e-126 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G29210 | hypothetical protein;(source:Araport11) |
| AT2G05190 | pseudogene of cytochrome P450;(source:Araport11) |
| AT3G45990 | Cofilin/tropomyosin-type actin-binding protein family;(source:Araport11) |
| AT5G60000 | transmembrane protein;(source:Araport11) |
| AT5G32630 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, various predicted helicase proteins, Arabidopsis thaliana and others;(source:TAIR10) |
| AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
| AT3G54740 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G03565 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G21360 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
| AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G50835 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
| AT5G44350 | ethylene-responsive nuclear protein-like protein;(source:Araport11) |
| AT1G51300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G23620 | pseudogene of OBP32pep protein;(source:Araport11) |
| AT2G25305 | Encodes a defensin-like (DEFL) family protein. |
| AT4G17700 | hypothetical protein;(source:Araport11) |
| AT2G27320 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT4G36500 | hypothetical protein;(source:Araport11) |
| AT5G61470 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
| AT5G58110 | chaperone binding / ATPase activator;(source:Araport11) |
| AT3G50040 | hypothetical protein;(source:Araport11) |
| AT5G55430 | hypothetical protein;(source:Araport11) |
| AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G59765 | None;(source:Araport11) |
| AT1G10020 | formin-like protein (DUF1005);(source:Araport11) |
| AT5G34800 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
| AT4G31200 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
| AT1G68735 | Encodes a defensin-like (DEFL) family protein. |
| AT3G07920 | Translation initiation factor IF2/IF5;(source:Araport11) |
| AT1G70050 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT1G69250 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT3G08840 | D-alanine-D-alanine ligase family;(source:Araport11) |
| AT3G18510 | ATP-dependent helicase/nuclease subunit;(source:Araport11) |
| AT5G67350 | hypothetical protein;(source:Araport11) |
| AT1G14170 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT2G28990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G15870 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT5G54170 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G30480 | hypothetical protein;(source:Araport11) |
| AT1G19240 | transmembrane protein;(source:Araport11) |
| AT1G03890 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT3G42950 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G60410 | hypothetical protein (DUF1639);(source:Araport11) |
| AT1G27210 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G27150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G77270 | hypothetical protein;(source:Araport11) |
| AT4G14226 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G09870 | histidine acid phosphatase family protein;(source:Araport11) |
| AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT3G05755 | pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10) |
| AT1G31274 | Pseudogene of AT5G26622; beta-galactosidase |
| AT4G24140 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G47150 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G40260 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G43610 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT1G34300 | lectin protein kinase family protein;(source:Araport11) |
| AT1G28840 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT4G32215 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.1e-09 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
| AT5G27970 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G03165 | hypothetical protein;(source:Araport11) |
| AT1G64405 | hypothetical protein;(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G15340 | glycine-rich protein;(source:Araport11) |
| AT5G22610 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G22415 | hypothetical protein;(source:Araport11) |
| AT3G58420 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G10720 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G23850 | transmembrane protein;(source:Araport11) |
| AT1G62305 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G47490 | HNH endonuclease;(source:Araport11) |
| AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G37474 | Encodes a defensin-like (DEFL) family protein. |
| AT2G01130 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G62270 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G35930 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G69325 | Remorin family protein;(source:Araport11) |
| AT3G29785 | Pol-like polyprotein/retrotransposon;(source:Araport11) |
| AT1G28250 | transmembrane protein;(source:Araport11) |
| AT1G24440 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G29340 | NAD-dependent epimerase/dehydratase family protein;(source:Araport11) |
| AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
| AT4G08330 | hypothetical protein;(source:Araport11) |
| AT5G22690 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
| AT2G19806 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT4G04985 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G30000 | PHF5-like protein;(source:Araport11) |
| AT1G78060 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G47830 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G77650 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G48420 | hypothetical protein;(source:Araport11) |
| AT5G59170 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G34854 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G04730 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT3G24080 | KRR1 family protein;(source:Araport11) |
| AT2G47720 | hypothetical protein;(source:Araport11) |
| AT4G21880 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G06400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G48180 | CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase;(source:Araport11) |
| AT1G01570 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT3G09110 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G33118 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G22580 | Exostosin family protein;(source:Araport11) |
| AT5G17100 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT5G51950 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G37072 | pseudogene of Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT4G16260 | Encodes a putative beta-1,3-endoglucanase that interacts with the 30C02 cyst nematode effector. May play a role in host defense. |
| AT1G74280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G26550 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT4G28440 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G11170 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G77190 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
| AT4G16765 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G32460 | hypothetical protein;(source:Araport11) |
| AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT2G13910 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G55646 | TPRXL;(source:Araport11) |
| AT5G20790 | transmembrane protein;(source:Araport11) |
| AT3G60286 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G33550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G11160 | Translation initiation factor 2, small GTP-binding protein;(source:Araport11) |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT5G42620 | metalloendopeptidase / zinc ion binding protein;(source:Araport11) |
| AT2G22220 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT3G42180 | Exostosin family protein;(source:Araport11) |
| AT3G49340 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G01225 | josephin-like protein;(source:Araport11) |
| AT1G13550 | hypothetical protein (DUF1262);(source:Araport11) |
| AT3G50160 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G20360 | TRAF-like family protein;(source:Araport11) |
| AT5G66490 | hypothetical protein;(source:Araport11) |
| AT5G24180 | Lipase class 3-related protein;(source:Araport11) |
| AT3G28480 | Oxoglutarate/iron-dependent oxygenase;(source:Araport11) |
| AT5G22700 | LOW protein: F-box/FBD/LRR-like protein;(source:Araport11) |
| AT1G13485 | hypothetical protein;(source:Araport11) |
| AT5G16040 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G17450 | B-block binding subunit of TFIIIC;(source:Araport11) |
| AT1G02610 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G38680 | 5-nucleotidase / magnesium ion binding protein;(source:Araport11) |
| AT5G10800 | RNA recognition motif (RRM)-containing protein;(source:Araport11) |
| AT1G75730 | hypothetical protein;(source:Araport11) |
| AT5G53620 | RNA polymerase II degradation factor;(source:Araport11) |
| AT2G20550 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT5G53592 | FBD-like domain family protein;(source:Araport11) |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G31215 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G48490 | hypothetical protein;(source:Araport11) |
| AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G16660 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-268 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G61810 | Glycosyl hydrolase family 17 protein;(source:Araport11) |
| AT5G44970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT5G07790 | hypothetical protein;(source:Araport11) |
| AT5G03905 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G78480 | Prenyltransferase family protein;(source:Araport11) |
| AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
| AT3G29170 | transmembrane protein (DUF872);(source:Araport11) |
| AT3G05440 | C2 domain-containing protein;(source:Araport11) |
| AT4G31100 | wall-associated kinase;(source:Araport11) |
| AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G24470 | filament-like protein (DUF869);(source:Araport11) |
| AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
| AT3G11230 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT1G31920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G17140 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G30020 | PA-domain containing subtilase family protein;(source:Araport11) |
| AT3G48020 | hypothetical protein;(source:Araport11) |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G55450 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G30733 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT2G12720 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.6e-66 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G35340 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT2G02630 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G23170 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G29260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G73350 | ankyrin repeat protein;(source:Araport11) |
| AT4G32560 | paramyosin-like protein;(source:Araport11) |
| AT1G20100 | DNA ligase-like protein;(source:Araport11) |
| AT5G24230 | Lipase class 3-related protein;(source:Araport11) |
| AT2G37730 | glycosyltransferase (DUF604);(source:Araport11) |
| AT4G24610 | pesticidal crystal cry8Ba protein;(source:Araport11) |
| AT1G80880 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G13620 | hypothetical protein;(source:Araport11) |
| AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G02520 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G25680 | SLH domain protein;(source:Araport11) |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
| AT5G44230 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G54700 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT3G01360 | plant viral-response family protein (DUF716);(source:Araport11) |
| AT4G31410 | E3 ubiquitin-protein ligase, putative (DUF1644);(source:Araport11) |
| AT4G25510 | hypothetical protein;(source:Araport11) |
| AT1G55100 | transposable_element_gene;(source:Araport11);pseudogene, putative ATP synthase beta subunit;(source:TAIR10) |
| AT2G42060 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G30872 | other_RNA;(source:Araport11) |
| AT3G48630 | hypothetical protein;(source:Araport11) |
| AT3G30859 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.6e-42 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G43895 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT1G69050 | hypothetical protein;(source:Araport11) |
| AT5G57500 | Galactosyltransferase family protein;(source:Araport11) |
| AT4G09875 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT4G38030 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT2G24165 | pseudogene of receptor like protein 30;(source:Araport11) |
| AT3G57890 | Tubulin binding cofactor C domain-containing protein;(source:Araport11) |
| AT3G17780 | B-cell receptor-associated-like protein;(source:Araport11) |
| AT5G56590 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G23520 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
| AT1G78330 | pseudogene of Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
| AT3G11960 | Cleavage and polyadenylation specificity factor (CPSF) A subunit protein;(source:Araport11) |
| AT1G69350 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G07880 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G11090.1);(source:TAIR10) |
| AT2G37690 | phosphoribosylaminoimidazole carboxylase, putative / AIR carboxylase;(source:Araport11) |
| AT2G33350 | CCT motif family protein;(source:Araport11) |
| AT5G37872 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.4e-54 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G33550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G12502 | Natural antisense transcript overlaps with AT3G12500;(source:Araport11) |
| AT5G12880 | proline-rich family protein;(source:Araport11) |
| AT2G12950 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.9e-105 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT1G76120 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G47160 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G00356 | Encodes a defensin-like (DEFL) family protein. |
| AT3G30718 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.7e-111 P-value blast match to F21A17 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family);(source:TAIR10) |
| AT2G37800 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
| AT5G07360 | Amidase family protein;(source:Araport11) |
| AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G14920 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;(source:Araport11) |
| AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G48860 | hypothetical protein;(source:Araport11) |
| AT2G47640 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT4G08099 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-34 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
| AT2G12400 | plasma membrane fusion protein;(source:Araport11) |
| AT3G55790 | transmembrane protein;(source:Araport11) |
| AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
| AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
| AT3G45400 | exostosin family protein;(source:Araport11) |
| AT2G14255 | Ankyrin repeat family protein with DHHC zinc finger domain-containing protein;(source:Araport11) |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G23760 | Cox19-like CHCH family protein;(source:Araport11) |
| AT2G03580 | F-box family protein-like protein;(source:Araport11) |
| AT1G32172 | other_RNA;(source:Araport11) |
| AT5G22480 | ZPR1 zinc-finger domain protein;(source:Araport11) |
| AT3G15710 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT2G04515 | transmembrane protein;(source:Araport11) |
| AT5G27890 | hypothetical protein;(source:Araport11) |
| AT4G11000 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G47900 | filament-like protein (DUF869);(source:Araport11) |
| AT1G74370 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G10770 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
| AT1G66310 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G57690 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G04130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G32915 | glutamyl-tRNA(Gln) amidotransferase subunit C;(source:Araport11) |
| AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT5G13590 | hypothetical protein;(source:Araport11) |
| AT1G17277 | transposable_element_gene;(source:Araport11);similar to zinc ion binding [Arabidopsis thaliana] (TAIR:AT1G78355.1);(source:TAIR10) |
| AT4G29560 | fanconi anemia group E protein FANCE protein;(source:Araport11) |
| AT3G27416 | transmembrane protein;(source:Araport11) |
| AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G40020 | Nucleolar histone methyltransferase-related protein;(source:Araport11) |
| AT3G16840 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G50340 | hypothetical protein;(source:Araport11) |
| AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
| AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT4G16630 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G23413 | pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT3G59450 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G30405 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-154 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT4G11630 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT1G50820 | aminotransferase-like, mobile domain protein;(source:Araport11) |
| AT5G25920 | hypothetical protein;(source:Araport11) |
| AT2G16930 | Ribosomal protein L27 family protein;(source:Araport11) |
| AT3G14240 | Subtilase family protein;(source:Araport11) |
| AT3G48650 | pseudogene of pectinesterase;(source:Araport11) |
| AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
| AT5G27020 | hypothetical protein;(source:Araport11) |
| AT1G45760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-37 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G11790 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT5G24260 | prolyl oligopeptidase family protein;(source:Araport11) |
| AT5G57210 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G40070 | MADS-box family protein;(source:Araport11) |
| AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT4G17590 | NOL1/NOP2/sun family protein;(source:Araport11) |
| AT1G78940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT1G62421 | hypothetical protein;(source:Araport11) |
| AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G60570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G24530 | AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11) |
| AT4G29735 | transmembrane protein;(source:Araport11) |
| AT4G14780 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G14760 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G09580 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
| AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
| AT1G45242 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G05400 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G07840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
| AT1G65810 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G40045 | transmembrane protein;(source:Araport11) |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT2G31290 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT3G21965 | pseudogene of Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT5G45000 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G18270 | hypothetical protein;(source:Araport11) |
| AT2G03690 | Ubiquinone biosynthesis protein COQ4 homolog. |
| AT2G39430 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT1G02990 | hypothetical protein;(source:Araport11) |
| AT1G29355 | hypothetical protein;(source:Araport11) |
| AT1G19860 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G51870 | protein kinase family protein;(source:Araport11) |
| AT3G12950 | Trypsin family protein;(source:Araport11) |
| AT3G22750 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
| AT2G10770 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G10760 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G23870 | pseudogene of Terpenoid cyclases family protein;(source:Araport11) |
| AT2G24880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G23000 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT3G52510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G51110 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G60370 | Encodes an immunophilin, FKBP20-2, that belongs to the FK-506 binding protein (FKBP) subfamily functioning as peptidyl-prolyl isomerases (PPIases) in protein folding. FKBP20-2 has a unique pair of cysteines at the C terminus and was found to be reduced by thioredoxin (Trx) (itself reduced by NADPH by means of NADP-Trx reductase). The FKBP20-2 protein, which contains only two of the five amino acids required for catalysis, showed a low level of PPIase activity that was unaffected on reduction by Trx. Genetic disruption of the FKBP20-2 gene provide evidence that FKBP20-2 participates specifically in the accumulation of the PSII supercomplex in the chloroplast thylakoid lumen by means of a mechanism that has yet to be determined. |
| AT5G53700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G15715 | Proteinase inhibitor I25, cystatin, conserved region;(source:Araport11) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G13495 | other_RNA;(source:Araport11) |
| AT1G53550 | F-box family protein;(source:Araport11) |
| AT4G35785 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G03740 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G21850 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G62760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G33817 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-100 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G17230 | plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G13140 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G15150 | glycine-rich protein;(source:Araport11) |
| AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT3G42353 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to Mutator-like transposase;(source:TAIR10) |
| AT2G18630 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT2G36670 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
| AT1G50380 | Prolyl oligopeptidase family protein;(source:Araport11) |
| AT4G31790 | Tetrapyrrole (Corrin/Porphyrin) Methylase;(source:Araport11) |
| AT5G03660 | transcriptional activator (DUF662);(source:Araport11) |
| AT2G22460 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G55132 | Encodes a defensin-like (DEFL) family protein. |
| AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
| AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT3G56870 | hypothetical protein;(source:Araport11) |
| AT2G41050 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT1G06135 | transmembrane protein;(source:Araport11) |
| AT1G07220 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT5G22040 | ubiquitin carboxyl-terminal hydrolase;(source:Araport11) |
| AT3G50800 | PADRE protein. |
| AT2G27770 | DUF868 family protein (DUF868);(source:Araport11) |
| AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G75510 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
| AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT3G13525 | snoRNA;(source:Araport11) |
| AT3G29140 | hypothetical protein;(source:Araport11) |
| AT1G28900 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT4G12840 | GTPase Der (DUF707);(source:Araport11) |
| AT3G50376 | pseudogene of NLI interacting factor (NIF) family protein |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G32030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G26730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G20480 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G19925 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT2G11910 | hypothetical protein;(source:Araport11) |
| AT4G14819 | hypothetical protein (DUF1677);(source:Araport11) |
| AT5G41420 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G05500 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
| AT4G03820 | transmembrane protein, putative (DUF3537);(source:Araport11) |
| AT5G24070 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G51690 | DNA helicase homolog PIF1. |
| AT5G45510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G55207 | hypothetical protein;(source:Araport11) |
| AT4G28360 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
| AT1G36445 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBa0026J14.30, blastp match of 62%25 identity and 5.5e-108 P-value to GP|20146463|dbj|BAB89243.1||AP004231 OSJNBa0026J14.30 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT2G34120 | Cytochrome C oxidase polypeptide VIB family protein;(source:Araport11) |
| AT4G25570 | Encodes cytochrome b561. |
| AT2G14850 | SPT module subunit, interacts with HAG1. |
| AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT5G06950 | Transcription factor of the B-ZIP family that has high affinity for C-box motifs. Interacts with NPR1 and may regulate PR gene expression. Phosphorylated by a CK2-like protein in vitro. Phosphorylation is enhanced by salicylic acid treatment. |
| AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G21170 | Encodes AKINbeta1, a subunit of the SnRK1 kinase (Sucrose non-fermenting-1-related protein kinase). Involved in regulation of nitrogen and sugar metabolism. As part of the regulatory subunit, it binds maltose which promotes kinase activity. Acts as a global regulator of genes involved in carbon, lipid and nitrogen metabolism. |
| AT3G07030 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT4G03070 | Encodes a possible 2-oxoglutarate-dependent dioxygenase that is involved in glucosinolate biosynthesis. The gene is expressed in all ecotypes examined but the enzymatic activity has not been determined experimentally. In Col, there is one copy of this gene (aka AOP1.1) but Ler contains two copies, AOP1.1 and a tightly linked AOP1.2. |
| AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
| AT5G53540 | Encodes a P-loop NTPase APP1. The disruption of APP1 is accompanied by a reduction in ROS level, a rise in the rate of cell division in the quiescent center (QC) and the promotion of root distal stem cell (DSC) differentiation. |
| AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
| AT2G43130 | encodes a protein belonging to the Rab/Ypt family of small GTPases, which are implicated in intracellular vesicular traffic. |
| AT4G32200 | meiotic asynaptic mutant 2, homologue of ASY1 |
| AT1G24140 | Expression induced by fungal and bacterial pathogens. |
| AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
| AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT4G15415 | B' regulatory subunit of PP2A (AtB'gamma) |
| AT1G01980 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30730 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20830 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). It is involved in plant immunity. Overexpressing plants are more resistant to B. cinerea. |
| AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT5G26130 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G01610 | Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture. |
| AT3G58580 | Encodes a protein that is involved in mRNA processing and localized to cytoplasmic p-bodies. Double mutants with CCR4a show decreased sensitivity to high concentrations of sucrose. Involved in starch and sucrose metabolism. |
| AT4G22330 | AtCES1 encodes a nuclear and endoplasmic reticulum localized Acyl-CoA independent ceramide synthase that is involved in sphingolipid metabolism, disease resistance, nutrient limitation, and response to salt stress. Facilitates adaptation to environmental stresses by regulating autophagy. |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT1G08150 | member of Putative Na+/H+ antiporter family |
| AT1G22810 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity. |
| AT3G11730 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
| AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT5G61500 | autophagy-related (ATG) gene |
| AT4G24990 | geranylgeranylated protein ATGP4 |
| AT4G37900 | Protein of unknown function that contains DUF1399 domain and putative RNA binding motif. Expressed in many plant tissues and is involved in many aspects of plant growth and development as well as response to salt stress. |
| AT3G62760 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G48605 | Encodes a protein similar to yeast HAL3, which regulates the cell cycle and tolerance to salt stress through inhibition of the PPZ1 type-1 protein phosphatase. AtHAL3b mRNA levels are induced by salt stress. HAL3B presumably encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis as indicated by functional complementation of a double mutant hal3 aaBb. |
| AT4G03520 | Encodes a redox activated co-chaperone, chloroplast localized thioredoxin, similar to prokaryotic types. |
| AT3G20040 | Hexokinase;(source:Araport11) |
| AT1G34360 | translation initiation factor 3 (IF-3) family protein;(source:Araport11) |
| AT1G28210 | DnaJ homolog AtJ1 (atj) |
| AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
| AT5G55460 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
| AT4G29170 | A homolog of yeast, mouse and human mnd1delta protein. Null mutants exhibit normal vegetative and flower development; however, during prophase I, chromosomes become fragmented resulting in random distribution of the fragments between polyads. Both male and female meiosis are defective and strong accumulation of AtRAD51 was observed in the inflorescence nuclei of mutant plants. Similarly to its yeast and animal homologues, AtMnd1 might play a role in DSB repair during meiosis. |
| AT4G24970 | MORC7 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC4, it appears to repress the expression of genes involved in defense against pathogens. |
| AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
| AT2G31450 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G07620 | GTP-binding protein Obg/CgtA;(source:Araport11) |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT1G35537 | Encodes a defensin-like peptide with antifungal activity. |
| AT3G47380 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. |
| AT3G14300 | pectinesterase family protein;(source:Araport11) |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G27000 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G23310 | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. |
| AT4G16830 | Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. The mRNA is cell-to-cell mobile. |
| AT1G08600 | The Arabidopsis ATRX harbours a N-terminal ADD domain and a C-terminal helicase domain and is devoid of the large central region involved in DAXX interaction in mammals. Arabidopsis ATRX mutant alleles are viable, but with reduced fertility. Their combination with mutants for the H3.3 chaperone HIRA impairs plant survival. ATRX loss affects cellular histone H3.3 pools and modulates the H3.1/H3.3 balance. Notably, at a genome-wide scale, loss of ATRX leads to a reduced H3.3 level at genes characterized by elevated H3.3 occupancy and high expression, including the 45S ribosomal DNA (45S rDNA) loci. Indeed, expression of specific 45S rDNA sequence variants is altered by ATRX loss (DOI:10.1105/tpc.16.00877) |
| AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
| AT4G14160 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT3G20920 | Encodes an endoplasmic reticulum localized protein with similarity to yeast Sec62p. Mutants display growth defects and significantly reduced fertility. AtSec62 does not complement the thermosensitive phenotype of yeast Sec62 mutants. |
| AT4G00238 | STKL1 is a DUF domain containing DNA binding protein that may be involved in mediating certain glucose responses. Binds to promoter of PGR, a putative plasma membrane glucose response regulator. |
| AT3G18370 | C2 domain-containing protein;(source:Araport11) |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G80420 | Encodes a component of plant break excision repair and functions at several stages during active DNA demethylation in Arabidopsis. |
| AT3G62830 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT4G12490 | Encodes a member of the AZI family of lipid transfer proteins. Contains a PRR domain that appears to be required for localization to the chloroplast. |
| AT5G24240 | Encodes PI4Kc3, localizes to the nucleus and has autophosphorylation activity, but no lipid kinase activity. Overexpression mutants display late-flowering phenotype. |
| AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G21340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G20990 | Involved in molybdenum cofactor (Moco) biosynthesis, inserting Mo into Molybdopterin. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT1G79900 | encodes a mitochondrial ornithine transporter that exports ornithine from the mitochondria to the cytosol |
| AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT2G41130 | Encodes STC8 (salt tolerant callus 8)/bHLH106 (basic helix-loop-helix transcription factor bHLH106). Knockout lines are more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. |
| AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
| AT5G43650 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
| AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
| AT5G61140 | Encodes a predicted protein with 30% identity with MER3/RCK. Similar to yast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
| AT3G10800 | Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment. It is cleaved by S2P to allow translocation to the nucleus. The mRNA is cell-to-cell mobile. |
| AT4G02640 | Encodes a basic leucine zipper (bZIP) transcription factor AtbZIP10. AtbZIP10 shuttles between the nucleus and the cytoplasm. It binds consensus G- and C-box DNA sequences. AtbZIP10 acts antagonistically with LSD1 in both pathogen-induced hypersensitive response and basal defense responses. |
| AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
| AT2G24300 | Calmodulin-binding protein;(source:Araport11) |
| AT1G02150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G12060 | Double Clp-N motif protein;(source:Araport11) |
| AT2G45770 | chloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids. |
| AT1G56190 | One of a pair of plastid localized phosphoglycerate kinases involved in galactolipid biosynthesis. Functions redundantly with AT3g12780 (PGK1) in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal. |
| AT5G08650 | Critical for chloroplast protein synthesis under suboptimal conditions. Essential translation factor that promotes the efficiency of chloroplast protein synthesis. |
| AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
| AT1G17760 | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex. |
| AT2G35660 | Encodes a member of a novel gene family with homology to known proteins involved in hydroxylation and oxidation of an aromatic ring. |
| AT4G00070 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G52140 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G59620 | Encodes CW9. |
| AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT4G27120 | ER-resident adaptor protein. Part of complex with C53 and UFL1, the E3 ligase that mediates ufmylation. Involved in the pathway that links ribosome-associated quality control with selective autophagy at the ER. |
| AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT2G40340 | Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT1G47530 | MATE efflux family protein;(source:Araport11) |
| AT3G19780 | hypothetical protein;(source:Araport11) |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
| AT1G18100 | Encodes a member of the FT and TFL1 family of phosphatidylethanolamine-binding proteins. It is expressed in seeds and up-regulated in response to ABA. Loss of function mutants show decreased rate of germination in the presence of ABA. ABA dependent regulation is mediated by both ABI3 and ABI5. ABI5 promotes MFT expression, primarily in the radicle-hypocotyl transition zone and ABI3 suppresses it in the seed. |
| AT4G26910 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
| AT1G18070 | Translation elongation factor EF1A/initiation factor IF2gamma family protein;(source:Araport11) |
| AT2G32580 | transmembrane protein, putative (DUF1068);(source:Araport11) |
| AT5G11480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G30580 | GTP binding protein;(source:Araport11) |
| AT1G56050 | GTP-binding protein-like protein;(source:Araport11) |
| AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT4G23170 | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. The mRNA is cell-to-cell mobile. |
| AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT1G12160 | Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates. |
| AT3G52750 | Nuclear gene that encodes a plastidial division protein (FtsZ2-2). FtsZ2-2 is involved in chloroplast morphology and internal organisation in addition to participating in chloroplast partition |
| AT5G13480 | Encodes a protein with similarity to yeast Pfs2p, an mRNA processing factor. Involved in regulation of flowering time; affects FCA mRNA processing. Homozygous mutants are late flowering, null alleles are embryo lethal. |
| AT3G06440 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced root hair growth and reduced seed coat mucilage. |
| AT1G27120 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. |
| AT3G13040 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT1G29670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT1G17890 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT5G11010 | Nuclear-localizing protein. |
| AT3G60210 | GroES-like family protein;(source:Araport11) |
| AT1G28480 | Encodes GRX480, a member of the glutaredoxin family that regulates protein redox state. GRX480 interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. GRX480 transcription is SA-inducible and requires NPR1. Maybe involved in SA/JA cross-talk. It has also been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT3G62930 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT5G57440 | A member of haloacid dehalogenase-like hydrolase family, HAD-type phosphosugar phosphatase. |
| AT4G10670 | Homologous to yeast SPT16, a general chromatin factor required for transcription |
| AT1G27440 | IRX10 was identified as MUCI69 in a reverse genetic screen for MUCILAGE-RELATED genes. Mutations in this gene did not disrupt mucilage properties, likely due to the presence of the functionally redundant IRX10-L. |
| AT4G36710 | GRAS family transcription factor;(source:Araport11) |
| AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile. |
| AT2G22800 | Encodes homeobox protein HAT9. |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT2G31250 | Glutamyl-tRNA reductase family protein;(source:Araport11) |
| AT3G14930 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT3G55350 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
| AT5G26690 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G08570 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G10465 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G55650 | HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
| AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
| AT3G18035 | A linker histone like protein |
| AT5G59250 | Encodes a chloroplast localized H+/glucose antiporter. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT3G48870 | Encodes a nuclear encoded protein with similarity to Clpa regulatory subunit of CLP protease complex. The protein is localized to the chloroplast stroma. May function redundantly with TIC complex in chloroplast protein import. |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT3G24810 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT5G05300 | IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens. |
| AT5G58100 | Encodes a membrane protein involved in pollen nexine and sexine development. |
| AT1G56460 | HIT zinc finger and PAPA-1-like domain-containing protein;(source:Araport11) |
| AT2G26190 | IQM4 is a plastid localized, Ca2+ independent calmodulin binding protein that is involved in promoting seed dormancy. |
| AT2G17520 | Encodes a endoribonuclease/protein kinase IRE1-like protein that is predicted to form a type I transmembrane protein structure and contain kinase/endoribonuclease domains at their C-terminal halves. The transcript levels for several ER-stress responsive genes, including six protein disulfide isomerases (PDIs), BiP2, and AtbZIP60 are not affected in ire1-2 null mutants. The mRNA is cell-to-cell mobile. |
| AT1G32130 | The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT3G08960 | Ran effector. |
| AT3G23670 | Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT2G28060 | Component of the regulatory subunit of SNF1-related protein kinase. As part of the regulatory complex it binds maltose which promotes kinase activity. |
| AT4G16850 | 6-transmembrane (6TM) protein that underlies a QTL for petal size with increased expression correlating to increased petal size. |
| AT3G24750 | Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root |
| AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
| AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G15093 | catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11) |
| AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
| AT5G19290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G77420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G39410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G39420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G47630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G21350 | RNA polymerase transcriptional regulation mediator-like protein;(source:Araport11) |
| AT1G23360 | Encodes a 2-phytyl-1,4-naphthoquinone methyltransferase that catalyzes the final step in phylloquinone (vitamin K1) biosynthesis. |
| AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
| AT4G32060 | Encodes an EF-hand protein with homology to constituents of the mitochondrial Ca2+ uniporter machinery in mammals. MICU binds Ca2+ and localizes to the mitochondria in Arabidopsis. It is a negative regulator of mitochondrial calcium uptake. Mutants display elevated matrix calcium at steady state and modified calcium transient kinetics in vivo. |
| AT5G24020 | Encodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor. |
| AT1G78830 | In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance. |
| AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
| AT1G62010 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G21150 | mTERF protein involved in mitochondrial development; required for salt tolerance. |
| AT1G62110 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G07900 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT3G24570 | contributes to osmotic stress tolerance |
| AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
| AT4G17880 | MYC4 is bHLH transcriptional regulator. It functions as a JAZ-interacting transcription factor that acts together with MYC2 and MYC3 to activate JA-responses. It also functions in blue light mediated secondary cell wall biogenesis via regulation of NST1 expression. MYC4 directly binds to NST1 promoter and activates its expression. |
| AT5G06560 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G02290 | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl. |
| AT4G09320 | nucleoside diphosphate kinase type 1 (NDPK1) gene, complete The mRNA is cell-to-cell mobile. |
| AT5G13950 | nuclear factor kappa-B-binding protein;(source:Araport11) |
| AT3G20610 | non-race specific disease resistance protein;(source:Araport11) |
| AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G24600 | late embryogenesis abundant protein, group 2;(source:Araport11) |
| AT5G41835 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-43 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G10300 | GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1. |
| AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G22540 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72130 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT2G38100 | Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos. |
| AT1G67900 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G11475 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10. |
| AT5G41010 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
| AT4G21710 | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
| AT5G09920 | Non-catalytic subunit specific to DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB4) |
| AT3G22320 | Non-catalytic subunit common to DNA-dependent RNA polymerases I, II, III and IV; homologous to budding yeast RPB5. |
| AT3G57080 | Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB5. |
| AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT3G20760 | Nse4, component of Smc5/6 DNA repair complex;(source:Araport11) |
| AT5G60980 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT3G61050 | Encodes a novel transcriptional regulator, a calcium-dependent lipid-binding protein containing a C2 domain, that binds specifically to the promoter of THAS1 (thalianol synthase 1). It can bind ceramide and is involved in drought and salt tolerance. |
| AT2G40520 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT3G51620 | PAP/OAS1 substrate-binding domain superfamily;(source:Araport11) |
| AT3G61690 | Putative TNAase |
| AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G76405 | outer envelope pore 21B-like protein;(source:Araport11) |
| AT1G65080 | Structurally distinct member of Oxa1 superfamily , has tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2b.Involved in maturation of mitochondrial cytochrome c. |
| AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT3G18940 | clast3-like protein;(source:Araport11) |
| AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
| AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G32730 | Encodes a putative c-myb-like transcription factor with three MYB repeats. |
| AT4G24710 | Encodes an AAA+ ATPase that mediates meiotic chromosome remodeling and crossover maturation. |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
| AT1G49290 | Paternally expressed gene that is localized around the sperm nuclei of pollen. PEG2 acts as a sponge for siRNA854 during endosperm development, this action is necessary to induce triploid seed abortion. |
| AT1G60400 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT2G39550 | encodes the beta subunit of geranylgeranyl transferase (GGT-IB), involved in both ABA-mediated and auxin signaling pathways. |
| AT3G27110 | PGM48 is a member of a plant specific clade of metallo-endopeptidase proteins. It is found in plastoglobules. Analysis of over-expression and loss of function phenotypes suggests PGM48 may have a role in positively regulating senescence. |
| AT4G14450 | A member of a small family of proline/serine rich proteins of unknown function. It interacts with defense related MAP kinase MPK6. It's expression is induced by PAMP elicitors. May play a role in response to pathogens. |
| AT5G12150 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
| AT4G27320 | Contains a universal stress protein domain. Protein is phosphorylated in response to Phytophthora infestans zoospores and xylanase. |
| AT4G22990 | Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
| AT5G10410 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G65370 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G57200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT1G33340 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G10900 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
| AT1G60890 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
| AT1G61850 | Encodes a non-specific lipase that hydrolyzes phospholipids as well as galactolipids, at both sn-1 and sn-2 positions. Involved in basal jasmonic acid biosynthesis by releasing the precursor fatty acid from membrane lipids. Mutant plants were impacted in resistance to fungus B. cinerea. |
| AT3G17340 | Ran effector. |
| AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
| AT3G27400 | Encodes a pectate lyase involved in response to nematodes. |
| AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
| AT5G11560 | catalytics;(source:Araport11) |
| AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
| AT1G76140 | Putative prolyl oligopeptidase. |
| AT5G52800 | primase/polymerase protein |
| AT5G44574 | transmembrane protein;(source:Araport11) |
| AT5G44575 | hypothetical protein;(source:Araport11) |
| AT5G44578 | transmembrane protein;(source:Araport11) |
| AT1G04080 | Encodes a U1 small nuclear ribonucleoprotein (snRNP) factor involved in alternative splicing. |
| AT2G22420 | Encodes a cell wall-localized class III peroxidase that is directly regulated by the MADS-box transcription factor AGL15 and is involved in lignified tissue formation. |
| AT5G39580 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G64100 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G61390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G68940 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G51270 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G05230 | Signal peptidase subunit;(source:Araport11) |
| AT1G67530 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G18560 | Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression. |
| AT1G66700 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes PXMT1, a methyltransferase that methylates 1,7-paraxanthine. |
| AT3G46060 | small GTP-binding protein (ara-3) The mRNA is cell-to-cell mobile. |
| AT2G05635 | DEAD helicase |
| AT3G05480 | Involved in the regulation of DNA damage repair and homologous recombination. |
| AT5G49470 | Encodes a protein with similarity to RAF MAP Kinase that is expressed in most plant tissues. Based on loss of function and gain of function phenotypes, RAF10 appears to be involved in ABA response. |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT3G06220 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
| AT5G14070 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen. |
| AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT2G01250 | Cytosolic ribosomal 60S subunit protein. |
| AT1G32415 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
| AT3G02250 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
| AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
| AT2G25420 | WD40 domain protein which interacts with ROS1 in the base excision repair pathway through DNA methylation. |
| AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
| AT1G61930 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G09460 | transcription factor bHLH143;(source:Araport11) |
| AT5G64000 | 3'(2'),5'-bisphosphate nucleotidase |
| AT2G47820 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
| AT4G11740 | Isolated as a suppressor of a dominant mutant in the Ara4 gene that was expressed in yeast ypt1 mutant strains. A novel protein with a small region of similarity to coil-coiled domain of yeast VSP27 protein. |
| AT1G32940 | Subtilase family protein;(source:Araport11) |
| AT5G51340 | SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage. |
| AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
| AT1G47710 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT3G45100 | encodes Arabidopsis homolog of a conserved protein involved in the first step of the GPI biosynthetic pathway. |
| AT2G47860 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT4G23570 | Closely related to SGT1B, may function in SCF(TIR1) mediated protein degradation. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. AtSGT1a is induced upon pathogen infection and can function in R gene-mediated resistance. |
| AT4G11260 | Functions in plant disease resistance signaling, SCF(TIR1) mediated degradation of Aux/IAA proteins and HSP90 mediated degradation of R resistance proteins. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. |
| AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT1G17600 | SOC3 is a TIR-NB-leucine-rich repeat (TNL) protein.Mutants suppress loss of chs2 phenotype of auto-activation of immunity. When the TIR domain of SOC3 interacts with CHS2 the binding results in temperature activation of cell death, the suppressors inhibit this interaction. |
| AT3G22760 | CXC domain containing TSO1-like protein 1. The gene is expressed in stamens, pollen mother cells, and immature ovules. Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G44568 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G22890 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65486 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65490 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65500 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65510 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT4G08810 | Calcium binding protein involved in cryptochrome and phytochrome coaction |
| AT1G71890 | Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation. |
| AT5G43990 | Encodes SUVR2, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
| AT1G30020 | SVB family gene. |
| AT4G24130 | ABA responsive SVB family gene. |
| AT3G48740 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G50800 | Encodes a member of the SWEET sucrose efflux transporter family proteins, together with RPG1, it is involved in pollen development. Together with SWEET14, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
| AT5G53190 | Nodulin MtN3 family protein;(source:Araport11) |
| AT4G10850 | Nodulin MtN3 family protein;(source:Araport11) |
| AT2G14880 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT3G03590 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
| AT1G73140 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
| AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
| AT4G23050 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT3G02950 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
| AT5G55220 | Contains with HP22 a protein that is related to the bacterial trigger factor chaperone. Plants depleted of either HP22 or HP65b or even both were increasingly delayed in leaf senescence and retained much longer stromal chloroplast constituents than wild-type plants. |
| AT1G55900 | component of a translocase in the mitochondrial inner membrane |
| AT4G22300 | Formerly known as SOBER1, this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. This locus is now known as TIPSY1 and AT4G22305 corresponds to SOBER1. |
| AT4G12650 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT5G25100 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT3G04210 | TN13 is a TIR-NBS protein involved in immune response. It co localizes with the ER and perinuclear membranes and interacts with MOS6. It also associates with the CC-NBS-LRR resistance protein RPS5 and contributes to RPS5-triggered immunity. |
| AT5G27840 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580). |
| AT1G02510 | Encodes AtTPK4, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK4 is targeted to the plasma membrane. In contrast other members of the AtTPK proteins are located in tonoplast. AtTPK4 forms a voltage-independent K+ channel that is blocked by extracellular calcium ions. May form homomeric ion channels in vivo. |
| AT5G07170 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
| AT5G37478 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT2G17930 | Component of the SPT module of the SAGA complex. |
| AT5G02280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT5G16280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT1G08115 | U1A small nuclear RNA |
| AT1G60900 | Putative U2A65 splicing factor which functions in abscisic acid mediated flowering via regulating the precursor messenger RNA splicing of ABI5 and FLC in shoot apex. Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65a. |
| AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT4G02890 | Polyubiquitin gene containing 4 ubiquitin repeats. |
| AT5G16310 | Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1;(source:Araport11) |
| AT5G26310 | UGT72E3 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl alcohol as well as sinapic acid. The enzyme is thought to be involved in lignin- and phenylpropanoid metabolism. A knockdown mutant line (72E3KD) was obtained using RNAi silencing. No reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype, in contrast with the knockdown line constructed for UGT72E2 displayed a twofold reduction in the these phenylpropanoid 4-O-glucosides. Can influence the kinetics of lignin deposition by regulating monolignol flow to the cell wall as well as the potential of this compartment to incorporate monomers into the growing lignin polymer. |
| AT4G27560 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
| AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT4G26710 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT1G50360 | member of Myosin-like proteins |
| AT5G22950 | SNF7 family protein;(source:Araport11) |
| AT4G05000 | Vacuolar protein sorting-associated protein VPS28 family protein;(source:Araport11) |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT4G01250 | AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence. |
| AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
| AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G23810 | member of WRKY Transcription Factor; Group III |
| AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
| AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT3G04490 | Ran effector. XPO4 coordinates the nuclear accumulation of TOPLESS and TOPLESS-Related transcription corepressors, which plays a role in regulating salicylic acid-mediated defense feedback and modulating the strength of immunity induced by cpr5, a nucleoporin mutant. |
| AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT3G07430 | YLMG is located in thylakoid membranes. It is involved in chloroplast division and more specifically the proper distribution of nucleoids. The function is conserved between cyanobacteria and chloroplasts.The mRNA is cell-to-cell mobile. |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT4G21160 | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
| AT2G45120 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G60580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G38600 | Proline-rich spliceosome-associated (PSP) family protein / zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
| AT4G33020 | member of Fe(II) transporter isolog family |
| AT3G57700 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57640 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57740 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G58350 | Putative serine esterase family protein;(source:Araport11) |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G44318 | Aldolase superfamily protein;(source:Araport11) |
| AT5G14220 | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. |
| AT2G20960 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT1G12010 | Encodes a protein that appears to have 1-amino-cyclopropane-1-carboxylic acid oxidase activity based on mutant analyses. The mRNA is cell-to-cell mobile. |
| AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
| AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
| AT4G11280 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile. |
| AT3G21500 | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity. |
| AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
| AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT5G06290 | Encodes a 2-Cys peroxiredoxin (2-Cys PrxB) that contains two catalytic Cys residues. The mRNA is cell-to-cell mobile. |
| AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G22630 | Encodes 20S proteasome beta subunit PBD1 (PBD1). |
| AT1G09100 | Encodes RPT5b (Regulatory Particle 5b), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype. |
| AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
| AT4G03415 | Encodes a myristoylated 2C-type protein phosphatase that interacts with AGB1 and is localized to the plasma membrane. |
| AT3G10540 | master regulator of AGC kinases |
| AT4G33510 | Enzyme catalyzing the first committed step in aromatic amino acid biosynthesis The mRNA is cell-to-cell mobile. |
| AT2G17370 | Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds. |
| AT4G14440 | encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT3G52160 | Encodes KCS15, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT4G34250 | Encodes KCS16, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G07720 | Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G71160 | Encodes KCS7, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G15090 | Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
| AT4G24770 | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Required for editing and stability of specific chloroplast mRNAs. |
| AT1G47290 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT2G26260 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT4G23800 | Encodes a protein containing three copies of the HMG (high mobility group)-box domain. The two Arabidopsis 3xHMG-box proteins are: AT4G11080 (3xHMG-box1) and AT4G23800 (3xHMG-box2). Interacts with mitotic and meiotic chromosomes. |
| AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
| AT1G65060 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. mRNA levels are not induced in response to wounding or to fungal infection by P. parasitica. mRNA is expressed in flowers, to a lesser degree in mature leaves and siliques and marginally in seedling roots and bolting stems of mature plants. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, cinnamic acid and 5-OH-ferulic acid. At4CL3 was unable to use sinapic acid as substrate. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT1G64190 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT3G02360 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT5G41670 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
| AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT1G01100 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT5G47700 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT1G04620 | Encodes a 7-hydroxymethyl chlorophyll a reductase, an enzyme of the chlorophyll cycle that converts 7-hydroxymethyl chlorophyll a to chlorophyll a. |
| AT1G21710 | Encodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme. |
| AT5G46800 | Seedling lethal mutation; Mitochondrial Carnitine Acyl Carrier-Like Protein |
| AT2G19490 | recA DNA recombination family protein;(source:Araport11) |
| AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT4G26080 | Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure. |
| AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
| AT2G40220 | Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings. |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
| AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
| AT4G38480 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G55870 | Encodes a poly(A)-specific ribonuclease, AtPARN. Expression of AtPARN is upregulated by ABA or stress treatment. Mutant is hypersensitivity to salicylic acid as well as ABA. Functions with AGS1 to regulate the poly(A) status of mitochondrial mRNA. |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G64940 | ABC1K8 is a member of an atypical protein kinase family that is induced by heavy metals. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K7 in mediating lipid membrane changes in response to stress. The mRNA is cell-to-cell mobile. |
| AT2G40090 | member of ATH subfamily |
| AT3G23560 | Member of the multidrug and toxic compound extrusion (MATE) family, protects roots from inhibitory compounds. |
| AT3G10572 | APEM9 is required for both PTS1- and PTS2-dependent protein transport. APEM9 interacts with PEX6 in BiFC assay and mating-based Split ubiquitin system. BiFC data shows that APEM9 is required for peroxisomal localization of PEX1-PEX6 complex. These results indicate that APEM9 functions like mammalian PEX26 and yeast PEX15. |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
| AT3G19290 | bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediates ABA-dependent stress responses.ABF4 acts through SnRK2 pathway and binds to ABA response elements of the promoters of NYE1 and regulates their expression to promote chlorophyll degradation. |
| AT1G67080 | Encodes a protein involved in the photoprotection of PSII. An aba4-1 mutant completely lacks neoxanthin,a component of the chromophore of the peripheral antenna system in PSII. ABA4 is required for neoxanthin biosynthesis, an intermediary step in abscisic acid biosynthesis, but no catalytic activity has been detected for the ABA4 protein. |
| AT1G45249 | Leucine zipper transcription factor that binds to the abscisic acid (ABA)?responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment. |
| AT2G27150 | Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis. |
| AT5G19530 | Encodes a spermine synthase. Required for internode elongation and vascular development, specifically in the mechanism that defines the boundaries between veins and nonvein regions. This mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function. |
| AT3G61510 | Encodes a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. The gene is transcriptionally active but enzymatically inactive. The predicted amino-acid sequence of ACS1 is missing the highly conserved tripeptide, Thr-Asn-Pro (TNP), between Ile204 and Ser205. Introduction of TNP into ACS1 restores the ACS activity. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT5G51290 | Encodes a ceramide kinase that plays a role in modulating cell death. |
| AT4G14400 | encodes a novel protein with putative ankyrin and transmembrane regions. It is a member of one of the largest uncharacterized gene families in higher plants. The gene is involved in resistance to Pseudomonas syringae. |
| AT5G46110 | Encodes a chloroplast triose phosphate / 3-phosphoglycerate translocator that transports triose phosphates derived from the Calvin cycle in the stroma to the cytosol for use in sucrose synthesis and other biosynthetic processes. A tpt mutant has altered acclimation responses. The mRNA is cell-to-cell mobile. |
| AT1G75010 | Encodes ARC3 (Accumulation and Replication of Chloroplast 3), a chloroplast division factor functioning in the initiation of chloroplast division. ARC3 is a chimera of the prokaryotic FtsZ and part of the eukaryotic phosphatidylinositol-4-phosphate 5-kinase (PIP5K). Located on the outer surface of the chloroplast in a ring-like structure at the early stage of chloroplast division. The arc3 mutant has a small number of abnormally large chloroplasts in the cell. |
| AT4G25650 | Similar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. |
| AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
| AT1G36180 | acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile. |
| AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
| AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
| AT1G76990 | ACT domain repeat 3;(source:Araport11) |
| AT3G01990 | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. |
| AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile. |
| AT1G49240 | Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen. |
| AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
| AT3G12110 | Encodes an actin that is expressed predominantly during reproductive development. |
| AT2G30910 | actin-related protein C1A;(source:Araport11) |
| AT1G33560 | Encodes a NBS-LRR disease resistance protein that possesses N-terminal kinase subdomains. Activation tagged mutant of ADR1 showed elevated levels of SA and reactive oxygen species in addition to number of defense gene transcripts. Exhibits resistance to number of microbial pathogens. |
| AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
| AT1G11390 | Atypical kinase which functions in plant salt stress tolerance by regulating reactive oxygen species (ROS). |
| AT1G66120 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G30520 | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT1G55320 | Encodes a protein with similarity to acyl activating enzymes. AAE18 is localized to the peroxisome where it may be involved in metabolism of auxin precursors to active auxins. |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT5G16240 | Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT3G02610 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
| AT1G06090 | Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation. |
| AT3G02630 | One of seven acyl acyl carrier proteins. Expressed primarily in developing seeds.Involved in fatty acid metabolism. Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD1 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT4G14570 | Encodes an acylamino acid-releasing enzyme (AARE) catalyzing the N-terminal hydrolysis of N[alpha]-acylpeptides to release N[alpha]-acylated amino acids The mRNA is cell-to-cell mobile. |
| AT2G42690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G50860 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
| AT4G01100 | Adenine nucleotide transporter. Located in mitochondrion. Expressed in a broad range of tissues, but predominantly in root tips. Loss of function mutants exhibit reduced root growth and respiration. |
| AT4G12440 | adenine phosphoribosyl transferase 4;(source:Araport11) |
| AT3G57610 | encoding adenylosuccinate synthetase (AdSS), the enzyme involved in the first step of the formation of the purine nucleotide AMP (conversion of IMP to adenylo-succinate) |
| AT4G11940 | Encodes a nuclear localized dosage sensitive paternally expressed imprinted gene. It is a member of a family of molecular chaperones called J-domain. Loss of ADM function suppresses seed abortion of triploid embryos and also partially rescues the effect of mea mutations. |
| AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT3G03120 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. |
| AT1G02440 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. |
| AT5G13490 | Encodes mitochondrial ADP/ATP carrier |
| AT4G33300 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. |
| AT4G18960 | Floral homeotic gene encoding a MADS domain transcription factor. Specifies floral meristem and carpel and stamen identity. Binds CArG box sequences. It is the only C function gene. It interacts genetically with the other homeotic genes to specify the floral organs. |
| AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
| AT5G13790 | AGL15 (AGAMOUS-Like 15) is a member of the MADS domain family of regulatory factors. Although AGL15 is preferentially expressed during embryogenesis, AGL15 is also expressed in leaf primordia, shoot apical meristems and young floral buds, suggesting that AGL15 may play a role during post-germinative development. Transgenic plants that ectopically express AGL15 show delays in the transition to flowering, perianth abscission and senescence and fruit and seed maturation. Role in embryogenesis and gibberellic acid catabolism. Targets B3 domain transcription factors that are key regulators of embryogenesis.AGL15 binds the HAE promoter in floral receptacles and represses HAE expression. AGL15 is phosphorylated in a MKK4/5 dependent manner in floral receptacles. Serines 231 and 257 are phosphorylated in floral receptacles. AGL15 also directly regulates the expression of the peroxidase PRX17, linking it to lignified tissue expression. |
| AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
| AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
| AT4G24540 | Encodes a MADS-box protein involved in flowering. Regulates the expression of SOC1 and is also upregulated by SOC1. Binds with IMK3 kinase domain. Phosphorylated by IMK3; likely to be a target for IMK3 kinase domain. |
| AT5G26880 | Root Specific |
| AT1G01530 | AGAMOUS-like 28;(source:Araport11) |
| AT2G34440 | AGL29 MADS box gene. |
| AT5G65050 | Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function. |
| AT5G26630 | MADS-box transcription factor family protein;(source:Araport11) |
| AT5G62165 | Encodes a MADS box transcription factor. Expressed in quiescent center. Involved in floral transition. |
| AT2G14210 | MADS box gene, transcription factor |
| AT3G04100 | AGAMOUS-like 57;(source:Araport11) |
| AT1G29962 | AGAMOUS-like 64;(source:Araport11) |
| AT1G77980 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. |
| AT3G30260 | Agamous-like transcription factor. A target of SPL10, AGL79 knockdowns show defects in leaf shape, shoot branching, and flowering time. |
| AT5G39750 | AGAMOUS-like 81;(source:Araport11) |
| AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
| AT3G66656 | AGAMOUS-like 91;(source:Araport11) |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
| AT5G39810 | AGAMOUS-like 98;(source:Araport11) |
| AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
| AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
| AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
| AT4G37750 | ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis. |
| AT5G10510 | Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation. |
| AT3G12740 | Physically interacts with ALA3, and is required for the phospholipid translocase activity of ALA3. The mRNA is cell-to-cell mobile. |
| AT1G72330 | Encodes for alanine aminotransferase ALAAT2. |
| AT1G50200 | Alanyl-tRNA synthetase;(source:Araport11) |
| AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
| AT3G66658 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT3G43600 | Encodes an aldehyde oxidase. AAO2 does not appear to act on abscisic aldehyde in vitro but it is possible that it may function in abscisic acid biosynthesis when the activity of At2g27150 (AAO3), the primary abscisic aldehyde oxidase, is lost. |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT3G42790 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT5G26210 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT3G25780 | Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis that encode this enzyme. mRNA expression is upregulated in senescing leaves. Note: Nomenclature for Arabidopsis allene oxide cyclase 3 (AOC3, AT3G25780) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC3 (AT3G25780) is also referred to as AOC2 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile. |
| AT3G52720 | Encodes an alpha carbonic anhydrase (CAH1) located in the chloroplast stroma. Most chloroplast proteins are encoded by the nuclear genome and imported with the help of sorting signals that are intrinsic parts of the polypeptides. CAH1 takes an alternative route through the secretory pathway, and becomes N-glycosylated before entering the chloroplast. Glycosylation and intra-molecular disulfide bridge fromation are necessary for the correct folding, ER export, trafficking and activity of the protein. |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT5G22770 | AP-2 complex subunit alpha-1. Part of endomembrane trafficking system. |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT3G29320 | Encodes a plastidic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for maltooligosaccharides, such as maltoheptaose. The mRNA is cell-to-cell mobile. |
| AT3G46970 | Encodes a cytosolic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for branched polysaccharides, such as glycogen. |
| AT5G11720 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
| AT3G10740 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 51 of glycoside hydrolases. It may be involved in cell wall modification. |
| AT3G56190 | Encodes one of two alpha-SNAPs (soluble NSF attachment protein) in Arabidopsis |
| AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT1G62020 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. Required for the acceptance of compatible pollen. |
| AT3G54720 | Encodes glutamate carboxypeptidase. Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1. |
| AT1G08430 | Encodes a Al-activated malate efflux transporter. It is essential for aluminum tolerance but does not represent the major Al tolerance QTL. Staurosporine and calyculin A both block all changes in AtALMT1 gene expression (as a result malate release is totally inhibited). AtALMT1 transcription was clearly induced by indole-3-acetic acid, abscisic acid, low pH, hydrogen peroxide and flg22. STOP1 and CAMTA2 transcription factors are involved in Al-inducible expression of AtALMT1 and both proteins bind to the AtALMT1 promoter. |
| AT4G17970 | Anion transporter involved in stomatal closure. Gene has 3 splicing variants. |
| AT5G27610 | protein ALWAYS EARLY 1;(source:Araport11) |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT1G77380 | Amino acid permease which transports basic amino acids. |
| AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
| AT5G49630 | Is a high affinity amino acid transporter capable of transporting aspartate and tryptophan. May be involved in the amino acid uptake from xylem. |
| AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
| AT1G26130 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT4G13510 | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile. |
| AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
| AT3G24300 | Encodes a plasma membrane localized ammonium transporter. |
| AT2G38290 | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
| AT2G39090 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
| AT2G04660 | a highly conserved ubiquitin-protein ligase involved in cell cycle regulation |
| AT5G54610 | Induced in response to Salicylic acid. Belongs to the ankyrin repeat protein family. |
| AT5G66055 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT5G02620 | Encodes a member of the ankyrin repeat protein. Localized in the endoplasmic reticulum. |
| AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. The mRNA is cell-to-cell mobile. |
| AT3G63270 | A mutation in ANTAGONIST OF LHP1 1 (ALP1) suppresses the phenotype of lhp1 mutant plants. ALP1 interacts genetically with several PcG and trxG components and antagonizes PcG silencing. The interaction has a negative effect on polycomb-mediated gene repression since double mutant combinations of clf alp1 or lhp1 alp1 show supression of the clf and lhp1 single mutant phenotypes. ALP1 domestication probably occured at the root of angiosperm diversification coincident with mutation of conserved residues important for endonuclease activity. |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G14530 | Encodes a low molecular weight nuclear WDR protein which displays functional homology to the Swd2 protein, an essential subunit of the yeast histone methylation COMPASS complex. APRF1 acts upstream of FLC and promotes flowering under long day conditions. |
| AT5G61160 | anthocyanin 5-aromatic acyltransferase 1;(source:Araport11) |
| AT1G25220 | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
| AT2G21120 | Encodes a putative magnesium transporter that was identified through a forward genetic screen, directly isolating antiviral RNAi-defective (avi) mutant using a Cucumber Mosaic Virus (CMV) mutant. Compared to Wildtype Col-0, avi2 mutant showed severe disease symptom after viral infection and viral accumulation was significantly increased while viral siRNAs and virus-activated endogenous siRNAs (vasiRNAs) were reduced in avi2 mutant. Detailed genetic study indicated that AVI2 modulated RNAi-mediated antiviral immunity by regulating the biogenesis of secondary viral siRNAs and vasiRNAs in Arabidopsis. |
| AT3G04690 | Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip. |
| AT4G13040 | Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation. |
| AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
| AT5G01310 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT2G14750 | Encodes adenosine-5'-phosphosulfate kinase. Provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. Essential for pollen viability. The mRNA is cell-to-cell mobile. |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT4G38220 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT2G44900 | ARABIDILLO-1 and its homolog, ARABIDILLO -2, are unique among Arabidopsis Arm-repeat proteins in having an F-box motif and fall into a phylogenetically distinct subgroup from other plant Arm-repeat proteins Similar to arm repeat protein in rice and armadillo/beta-catenin repeat family protein / F-box family protein in Dictyostelium. ARABIDILLO-1 promote lateral root development. Mutant plants form fewer lateral roots, while ARABIDILLO-1-overexpressing lines produce more lateral roots than wild-type seedlings. |
| AT2G01440 | Encodes an ortholog of the bacterial RecG translocase, an organellar protein with multiple roles in mtDNA maintenance. The protein is targeted to mitochondria and plastids and is required for recombination-dependent repair and for suppression of ectopic recombination in mitochondria, most likely because of its role in recovery of stalled replication forks. |
| AT1G52930 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
| AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT1G77360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G33920 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G06750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G65530 | Encodes a protein kinase involved in mediating resistance to fungi and also trichome branch number. Kinase activity is increased by ROP6 which also affects its sub-cellular localization (becomes localized to the cell periphery_ |
| AT5G51300 | Encodes a nuclear localized splicing factor homolog that is involved in alternative splicing of some mRNAs. |
| AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G15975 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46495 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G25410 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09110 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18930 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35910 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05910 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G78440 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. |
| AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
| AT5G15550 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G22500 | Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus. |
| AT1G49230 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35000 | ATL9 is an E3 ligase-like protein that is induced by chitin oligomers and contributes to fungal resistance.It differs from other members of the ATL family in that it has a PEST domain. It is a short lived protein that is subject to proteosome mediated degradation. It is expressed in many aerial tissues in a pattern that varies with developmental stage. |
| AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
| AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
| AT3G01700 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
| AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
| AT2G46330 | Encodes arabinogalactan protein (AGP16). |
| AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
| AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
| AT4G40090 | arabinogalactan protein 3;(source:Araport11) |
| AT1G35230 | Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile. |
| AT5G14380 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6 function results in decreased fertility due to defects in pollen tube growth. |
| AT5G36925 | hypothetical protein;(source:Araport11) |
| AT1G60860 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD2 belongs to the class 1, together with AGD1, AGD3, and AGD4. |
| AT3G53710 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT5G46750 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. The mRNA is cell-to-cell mobile. |
| AT1G59980 | ARG1-like 2;(source:Araport11) |
| AT4G08900 | Encodes an arginase, likely to be involved in polyamine biosynthesis in pollen. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT3G61860 | encodes an arginine/serine-rich splicing factor. transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G52040 | Encodes an arginine/serine-rich splicing factor. Transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS41 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis. |
| AT3G53500 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT1G31280 | Encodes Argonaute gene that binds viral siRNAs and is involved in antiviral defense response. Regulates innate immunity.Mutants have increased susceptibility to Potato virus X and tobacco rattle virus. |
| AT1G31290 | ARGONAUTE 3;(source:Araport11) |
| AT2G27040 | AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation, abnormal ovule/megagametophyte develoment and increased susceptibility to bacterial pathogens including Tobacco rattle virus. |
| AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT5G63750 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G27720 | IBR domain containing protein;(source:Araport11) |
| AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G63760 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
| AT1G65430 | IBR domain-containing protein;(source:Araport11) |
| AT5G19330 | Encodes an armadillo repeat protein involved in the abscisic acid response. The protein interacts with a transcription factor, ABF2, which controls ABA-dependent gene expression via the G-box-type ABA-responsive elements. |
| AT1G01950 | Encodes a member of the armadillo/beta-catenin repeat kinesin motor family. Mutants have twisted roots due to abnormal cell file rotation; the phenotype is dependent on microtubules. |
| AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT3G09640 | Encodes a cytosolic ascorbate peroxidase APX2. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT4G32320 | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT5G08100 | Encodes an asparaginase that catalyzes the degradation of L-asparagine to L-aspartic acid and ammonia. |
| AT5G10240 | Encodes asparagine synthetase (ASN3). |
| AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. They also exhibit abnormal responses to MAMPs possibly because the glycan properties of FL22 are affected. |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT2G22250 | Encodes a prokaryotic-type plastidic aspartate aminotransferase with glutamate/aspartate-prephenate aminotransferase (PAT) activity. |
| AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
| AT1G10600 | associated molecule with the SH3 domain of STAM 2;(source:Araport11) |
| AT2G42440 | Lateral organ boundaries (LOB) domain family protein;(source:Araport11) |
| AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
| AT2G33793 | Encodes a protein component of the pre-synaptic chromosome axis. Mutants show quantitative defects in meiotic recombination. Interacts with ASY1/ASY3. |
| AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
| AT3G61310 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT1G63480 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
| AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
| AT5G51590 | Member of the 29 AT-hook family TFs involved in the development of root xylem. |
| AT1G63470 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT5G62260 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
| AT3G43240 | Interacts with CHR11, CHR17, and RTL1, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
| AT3G17300 | COMPLEX 1 LYR-like protein;(source:Araport11) |
| AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
| AT1G48980 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G40820 | Encodes a Arabidopsis ortholog of the ATR protein kinase that is involved in a wide range of responses to DNA damage and plays a central role in cell-cycle regulation. Dominant loss of function alleles identified as suppressors of ALS also exhibit increased tolerance to aluminum. This may be due to the inhibition of terminal differentiation of the root apex upon exposure to Al. |
| AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT3G17100 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
| AT4G00355 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
| AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
| AT2G41700 | ATP-binding cassette A1;(source:Araport11) |
| AT5G61740 | ABC2 homolog 14;(source:Araport11) |
| AT2G36910 | Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR1.Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AT3G28860. PGP1 mediates cellular efflux of IAA and interacts with PIN genes that may confer an accelerated vectoral component to PGP-mediated transport. The non-polar localization of PGP1 at root and shoot apices, where IAA gradient-driven transport is impaired, may be required to confer directionality to auxin transport in those tissues. The mRNA is cell-to-cell mobile. |
| AT1G02520 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile. |
| AT1G02530 | P-glycoprotein 12;(source:Araport11) |
| AT3G28345 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT3G28380 | P-glycoprotein 17;(source:Araport11) |
| AT3G28415 | ABC transporter family protein;(source:Araport11) |
| AT4G28630 | Half-molecule ABC transporter ATM1. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT4G28620 | Half-molecule ABC transporter ATM2. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT5G39040 | Encodes a member of TAP subfamily of ABC transporters that is located in the vacuole. Mutants are hypersensitive to aluminum and the gene product may be important for intracellular movement of some substrate, possibly chelated Al, as part of a mechanism of aluminum sequestration. |
| AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
| AT5G46540 | P-glycoprotein 7;(source:Araport11) |
| AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT1G30420 | member of MRP subfamily |
| AT3G13080 | encodes an ATP-dependent MRP-like ABC transporter able to transport glutathione-conjugates as well as chlorophyll catabolites. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT4G30300 | member of NAP subfamily |
| AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
| AT3G54540 | ABCF4 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein GCN20. AT3G54540 is not a homolog of the yeast bZIP transcription factor GCN4. |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
| AT1G51460 | ABCG13 encodes a member of the ATP-binding cassette (ABC) transporter family protein. Mutants show defects in petal elongation resulting in a folded petal phenotype. |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G53510 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). Phloem-expressed and plasma membrane-localized jasmonate transporter which together with JAT3 and GLR3.3 involved in regulating long-distance translocation of JA, which is important for driving the loading, translocation of JA in the phloem pathway by a self-propagation mode, contributing to wound-induced systemic response/resistance. |
| AT3G25620 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT5G60740 | ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species. |
| AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT4G15236 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT2G13610 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G21580 | cobalt ion transmembrane transporter;(source:Araport11) |
| AT1G67940 | member of NAP subfamily The mRNA is cell-to-cell mobile. |
| AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress. |
| AT1G60810 | One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase |
| AT1G09430 | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity. |
| AT4G14680 | Encodes one of three A. thaliana ATP-sulfurylases. APS is the first enzyme of sulfate assimilation that catalyzes the formation of adenosine-5'-phosphosulfate from ATP and sulfate. |
| AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
| AT2G24540 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G56430 | TIM domain protein. Associates with components of mitochondrial complex I and III. May be involved in biogenesis of respiratory chain components. |
| AT5G61440 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. The mRNA is cell-to-cell mobile. |
| AT3G63380 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT3G21180 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT1G27770 | Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor. |
| AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
| AT5G50230 | autophagy-related (ATG) gene |
| AT3G60640 | Autophagy protein. |
| AT3G06420 | Autophagy protein. |
| AT5G66930 | meiotically up-regulated protein;(source:Araport11) |
| AT4G30790 | Encodes autophagy-related 2 (ATG11) |
| AT5G05150 | autophagy-related protein 18E;(source:Araport11) |
| AT4G36520 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G30280 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G49980 | auxin F-box protein 5;(source:Araport11) |
| AT5G43700 | Auxin inducible protein similar to transcription factors. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT1G05180 | Encodes a subunit of the RUB1 activating enzyme that regulates the protein degradation activity of Skp1-Cullin-Fbox complexes, primarily, but not exclusively, affecting auxin responses. Acts alongside AS1 to exclude BP expression from leaves. Promotes degradation of the cytokinin response repressor ARR5. Affects expression of key DNA repair and meiotic genes, signifcant role in DNA repair. |
| AT5G62000 | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. The mRNA is cell-to-cell mobile. |
| AT4G23980 | Encodes auxin response factor 9 (ARF9). The mRNA is cell-to-cell mobile. |
| AT3G26810 | Auxin F box protein, the dominant auxin receptor in roots. |
| AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
| AT2G34680 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. |
| AT5G13160 | Mutant is defective in perception of Pseudomonas syringae avirulence gene avrPphB. Encodes a putative serine-threonine kinase. |
| AT3G10960 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21890 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
| AT5G48250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT5G48380 | Encodes a BAK1-interacting receptor-like kinase named BIR1. Negatively regulates multiple plant resistance signaling pathways, one of which is the SOBIR1(AT2G31880)-dependent pathway. |
| AT3G45260 | BIB is a member of the BIRD family of zinc finger proteins that includes JKD. BIB functions redundantly with JKD to retain SHR in the nucleus and thereby restrict SHR movement in root tissues. |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT4G15370 | Encodes an oxidosqualene cyclase that primarily produces the tetracyclic triterpene baruol in vitro and when expressed in yeast. It can also make 22 other minor triterpenoid products with varying numbers of rings. |
| AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G54620 | bZIP transcription factor-like protein mRNA |
| AT2G18160 | Encodes a b-ZIP transcription factor. |
| AT2G21230 | bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1. |
| AT3G30530 | basic leucine-zipper 42;(source:Araport11) |
| AT1G13600 | basic leucine-zipper 58;(source:Araport11) |
| AT4G37730 | basic leucine-zipper 7;(source:Araport11) |
| AT1G14685 | Encodes a member of the BASIC PENTACYSTEINE (BPC) proteins. BPC proteins are plant-specific transcription factors present throughout land plants. BPC transcription factor family is integral for a wide range of processes that support normal growth and development.Along with BPC1, BPC2 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
| AT4G38910 | Encodes a basic pentacysteine protein that is localized to the nucleus and specifically binds in vitro to GA dinucleotide repeats. |
| AT2G35550 | basic pentacysteine 7;(source:Araport11) |
| AT2G40070 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
| AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
| AT2G17770 | Encodes a paralog of bZIP transcription factor FD. This protein interacts with FD and FT. |
| AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
| AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
| AT1G68180 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G01980 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G52670 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT4G02660 | Beige/BEACH and WD40 domain-containing protein;(source:Araport11) |
| AT1G77890 | One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis. |
| AT4G08540 | One of a pair of paralogs (the other is AT1G77890)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex,but is not essential for PI3P biosynthesis. |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT1G65880 | Encodes a benzoate-CoA ligase. Involved in the biosynthesis of benzoyloxyglucosinolate in Arabidopsis seeds. |
| AT1G30760 | Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. The mRNA is cell-to-cell mobile. |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
| AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
| AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
| AT1G45191 | beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1 |
| AT5G28510 | beta glucosidase 24;(source:Araport11) |
| AT3G03640 | Encodes beta-glucosidase (GLUC). |
| AT3G60120 | beta glucosidase 27;(source:Araport11) |
| AT5G24540 | beta glucosidase 31;(source:Araport11) |
| AT2G32860 | beta glucosidase 33;(source:Araport11) |
| AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
| AT3G57270 | encodes a member of glycosyl hydrolase family 17 |
| AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
| AT5G20340 | Encodes a putative beta 1,3-glucanase. |
| AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT2G45880 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
| AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
| AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
| AT4G26140 | putative beta-galactosidase |
| AT1G72990 | beta-galactosidase 17;(source:Araport11) |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT1G45130 | beta-galactosidase 5;(source:Araport11) |
| AT5G65940 | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT1G24470 | Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene. |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT5G09730 | Encodes a protein similar to a beta-xylosidase located in the extracellular matrix. It is able to degrade terminal arabinosyl residues and likely participates in the in-vivo hydrolysis of arabinan. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT2G01170 | Encodes a bidirectional amino acid transporter that can transport ala, arg, glu and lys, GABA but not pro with both export and import activity. Its expression is localized in the vascular tissues suggesting a function in amino acids export from the phloem into sink tissue. |
| AT3G02260 | Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance. |
| AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT3G60860 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. The mRNA is cell-to-cell mobile. |
| AT4G22840 | Sodium Bile acid symporter family;(source:Araport11) |
| AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
| AT2G41370 | Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP2 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP2 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP3 expression is restricted to pedicel axils by BP and PNY; promotes KNAT6 (At1g23380) expression. |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
| AT5G11250 | Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET. |
| AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT3G19540 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT1G49840 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT1G73830 | Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
| AT1G55510 | branched-chain alpha-keto acid decarboxylase E1 beta |
| AT1G50110 | Encodes a cytosolic branched-chain aminotransferase that acts on Leu, Ile, Val and also on Met. Together with BCAT4 and BCAT3, it is involved in methionine salvage and glucosinolate biosynthesis. |
| AT2G42160 | Encodes a RING domain containing protein BRIZ1. BRIZ1 (At2g42160) and BRIZ2 (At2g26000) proteins form a heteromeric E3 ligase complex required for seed germination and post-germination growth. |
| AT4G15400 | Encodes BIA1, a member of the BAHD acyltransferase family. Plays a role in controlling brassinosteroids levels, particularly in the root and hypocotyl in darkness. |
| AT5G47950 | BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. BIA2 may function in BR homeostasis by regulating the pool of bioactive BR. |
| AT5G01060 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT1G50990 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT5G46570 | Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT1G63500 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT3G09240 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT3G15120 | Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions. |
| AT1G54180 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT1G03445 | encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid. |
| AT4G03080 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT5G14270 | Bromodomain protein that functions as a negative regulator of sugar and ABA signaling. |
| AT5G62040 | BFT is a member of The FLOWERING LOCUS T (FT)/TERMINAL FLOWER 1 (TFL1) gene family that encodes regulators involved in control of flower development. |
| AT1G03457 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
| AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT2G21480 | BUSP2 plays a smaller role than BUSP1 in pollen tube growth. bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule but single busp2 mutants are fertile. BUSP2 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth. |
| AT5G18930 | S-adenosylmethionine decarboxylase family member. |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
| AT1G59835 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
| AT1G70810 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G01840 | Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
| AT1G64980 | Encodes a putative nucleotide-diphospho-sugar transferase required for pollen germination and tube growth. |
| AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
| AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
| AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
| AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
| AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
| AT5G04870 | A calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense.Phosphorylates, in vivo, the transcription factor ORE1, a master regulator of senescence. |
| AT5G23060 | Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium. |
| AT3G51850 | member of Calcium Dependent Protein Kinase The mRNA is cell-to-cell mobile. |
| AT5G12180 | member of Calcium Dependent Protein Kinase |
| AT4G36070 | member of Calcium Dependent Protein Kinase |
| AT4G04720 | member of Calcium Dependent Protein Kinase |
| AT4G04710 | member of Calcium Dependent Protein Kinase |
| AT4G38230 | member of Calcium Dependent Protein Kinase |
| AT4G04700 | member of Calcium Dependent Protein Kinase |
| AT1G76040 | member of Calcium Dependent Protein Kinase |
| AT4G04695 | member of Calcium Dependent Protein Kinase. Involved in response to salicylic acid. |
| AT3G57530 | Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. AtCPK32 has autophosphorylation activity and can phosphorylate ABF4 in vitro |
| AT4G23650 | Encodes calcium dependent protein kinase 3 (CPK3), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK3 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK6 is also a member of the Arabidopsis CDPK family. |
| AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT3G16030 | lectin protein kinase family protein;(source:Araport11) |
| AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
| AT2G41110 | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile. |
| AT3G56800 | encodes a calmodulin |
| AT5G21274 | Encodes a calmodulin isoform. Expressed in leaves. |
| AT3G51920 | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT5G42380 | calmodulin like 37;(source:Araport11) |
| AT5G44460 | Calcium sensor. |
| AT5G58940 | Arabidopsis thaliana calmodulin-binding receptor-like kinase mRNA The mRNA is cell-to-cell mobile. |
| AT2G11520 | high overall homology to CRCK1 |
| AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
| AT5G12480 | calmodulin-domain protein kinase CDPK isoform 7 (CPK7) |
| AT3G20410 | calmodulin-domain protein kinase CDPK isoform 9 (CPK9) |
| AT3G10660 | predicted to encode calcium-dependent protein kinase and is localized to the ER. Protein is myristoylated in a cell-free extract. Changing the proposed myristoylated site, G residue in the amino terminal, to A prevented the meristoylation . The G to A mutation decreased AtCPK2 membrane association by approximately 50%. |
| AT3G22930 | Encodes a calmodulin-like protein. |
| AT5G39670 | Calmodulin like protein involved in negative regulation of pattern triggered immunity. |
| AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
| AT3G56690 | encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined. |
| AT5G26920 | Encodes a calmodulin-binding protein CBP60g (calmodulin binding protein 60-like.g). The calmodulin-binding domain is located near the N-terminus; calmodulin binding is dependent on Ca(2+). Inducible by both bacterial pathogen and MAMP (microbe-associated molecular pattern) treatments. Bacterial growth is enhanced in cbp60g mutants. cbp60g mutants also show defects in salicylic acid (SA) accumulation and SA signaling. |
| AT1G78955 | Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system. |
| AT4G34580 | Encodes COW1 (can of worms1), a phosphatidylinositol transfer protein essential for root hair tip growth. The N-terminus of the COW1 protein is 32% identical to an essential phosphatidylinositol transfer protein (PITP), the yeast Sec14 protein (sec14p) while the C-terminus is 34.5% identical to a late nodulin of Lotus japonicus, Nlj16. Expression of COW1 complements the growth defect associated with Sec14p dysfunction in yeast. GFP fused to the COW1 protein specifically accumulates at the site of root hair outgrowth. |
| AT3G59090 | tobamovirus multiplication protein;(source:Araport11) |
| AT5G02630 | Lung seven transmembrane receptor family protein;(source:Araport11) |
| AT5G27210 | Protein of unknown function, transmembrane-40;(source:Araport11) |
| AT4G33730 | Member of CAP protein superfamily. Encoding a small 11 AA peptide (PAGNYIGARPY) involved in negative regulation of salt tolerance. |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT3G27740 | Encodes carbamoyl phosphate synthetase (CPS) small subunit (carA), also named as VEN6. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
| AT1G29900 | Encodes carbamoyl phosphate synthetase (CPS) large subunit (CARB), also named as VEN3. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
| AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
| AT3G01500 | Encodes a putative beta-carbonic anhydrase betaCA1. Together with betaCA4 (At1g70410) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. Activated by OXS2 under the treatment of salt. |
| AT5G62180 | Carboxyesterase that binds stringolactones. |
| AT3G63520 | Encodes a protein with 9-cis-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-trans-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-cis-double or allenic bonds. The mRNA is cell-to-cell mobile. |
| AT4G26100 | Encodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization (member of CKL-B group). |
| AT5G57015 | Member of CKL gene family (member of CKL-B group). |
| AT4G28860 | Member of CKL gene family (CKL-A group) |
| AT4G28540 | Member of CKL gene family (CKL-C group). |
| AT3G60250 | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
| AT4G20390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G16300 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G39530 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G39518 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G37200 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
| AT1G73875 | Deadenylase. |
| AT5G11350 | Deadenylase. |
| AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
| AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT3G13320 | low affinity calcium antiporter CAX2 The mRNA is cell-to-cell mobile. |
| AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
| AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
| AT5G22910 | member of Putative Na+/H+ antiporter family |
| AT1G64170 | member of Putative Na+/H+ antiporter family |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
| AT5G01690 | member of Putative Na+/H+ antiporter family |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT1G06970 | member of Putative Na+/H+ antiporter family |
| AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
| AT3G10600 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
| AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
| AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT1G65320 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
| AT2G16940 | Splicing factor which interacts with IRR and SR45 to mediate pre-mRNA splicing to facilitate protein function, however not contributing to target specificity. |
| AT2G33590 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The expression pattern of AtCRL1 indicates that CRL1 has a role in embryogenesis and seed germination. AtCRL1 is induced by ABA, drought and heat, and is highly expressed in seeds. The mRNA is cell-to-cell mobile. |
| AT2G33600 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. Its expression pattern suggests that AtCRL2 is involved in the synthesis and/or maintenance of vascular tissue. |
| AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT1G27820 | Deadenylase. |
| AT1G27890 | Deadenylase. |
| AT1G61470 | Deadenylase. |
| AT3G44240 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
| AT3G50530 | CDPK-related kinase |
| AT1G50180 | Host immune receptor which recognizes the conserved effectors AvrE and HopAA1. |
| AT3G52600 | Cell wall invertase expressed in flowers and ovary placental tissues. Reduced expression is correlated with decreased ovule production suggesting a link between sugar sensing and ovule initiation. |
| AT3G13784 | cell wall invertase 5;(source:Araport11) |
| AT1G22880 | cellulase 5;(source:Araport11) |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose.Mutants are defective in seed coat mucilage.Involved in the regulation of mucilage composition and/or mucilage synthesis. |
| AT1G44120 | CELLULOSE SYNTHASE INTERACTIVE 2;(source:Araport11) |
| AT5G16190 | encodes a gene similar to cellulose synthase |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G23990 | encodes a protein similar to cellulose synthase |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
| AT1G23480 | encodes a gene similar to cellulose synthase |
| AT2G32610 | encodes a gene similar to cellulose synthase |
| AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
| AT1G32180 | encodes a gene similar to cellulose synthase |
| AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
| AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
| AT3G07330 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT1G06830 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. CEPD1 is a non secreted polypeptide that is highly similar to CEPD2 which is another member of a novel family related to glutaredoxins. It is induced by nitrogen starvation. It acts downstream of the CEP1 peptide in systemic N-demand signalling .The RNA is expressed in the phloem of cotelydon and leaf vasculature but the peptide is graft transmissible, traveling from the shoot to the root. |
| AT3G23840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G62080 | Encodes a charged multi-vesicular body protein (CHMP7) homolog, that is an ESCRT-III-related protein and functions in the endosomal sorting pathway in humans. The Brassica homolog has been shown to be involved in plant growth and leaf senescence. |
| AT3G60680 | DUF641 family protein (DUF641);(source:Araport11) |
| AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
| AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
| AT2G43570 | chitinase;(source:Araport11) |
| AT1G29930 | Subunit of light-harvesting complex II (LHCII),which absorbs light and transfers energy to the photosynthetic reaction center. The mRNA is cell-to-cell mobile. |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
| AT5G49910 | Stromal heat shock protein involved in protein import into chloroplast. The mRNA is cell-to-cell mobile. |
| AT1G35680 | Encodes a chloroplast ribosomal protein L21 that is required for chloroplast development and embryogenesis. The mRNA is cell-to-cell mobile. |
| AT1G09340 | Encodes CHLOROPLAST RNA BINDING (CRB), a putative RNA-binding protein. CRB is important for the proper functioning of the chloroplast. Mutations in CRB also affects the circadian system, altering the expression of both oscillator and output genes. The mRNA is cell-to-cell mobile. |
| AT1G10500 | Involved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues. |
| AT2G45350 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-E subfamily) with 11 pentatricopeptide (PPR) repeats. The protein is involved in RNA editing of the initiation codon of ndhD in the chloroplast. |
| AT2G47910 | Encodes a chloroplast thylakoid membrane protein. Required for the assembly/accumulation of the NAD(P)H dehydrogenase complex of the photosynthetic electron transport chain. |
| AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
| AT1G05490 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
| AT1G80740 | ecotype Kl-0 chromomethylase (CMT1). A plant line expressing an RNAi construct directed against DMT4 has reduced agrobacterium-mediated tumor formation. |
| AT5G40090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
| AT4G37970 | cinnamyl alcohol dehydrogenase 6;(source:Araport11) |
| AT2G17570 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT1G68110 | An ENTH (Epsin NH2 terminal homology)/ANTH/VHS superfamily protein with adenylate cyclase activity and a role in clathrin assembly and endocytosis. |
| AT4G32285 | Putative clathrin assembly protein, component of TPLATE complex that functions in clathrin-mediated endocytosis. |
| AT2G20760 | Clathrin light chain protein;(source:Araport11) |
| AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile. |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
| AT5G65480 | CCL1 is induced by WUS and binds to the kinase domains of BAM1 and CLV1. Localizes to lipid rich plasma membrane rafts. Likely to be involved in WUS/CLV signaling pathway. |
| AT1G73165 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
| AT1G49005 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT1G73965 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT1G63245 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
| AT2G01505 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G66145 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT3G24225 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. Regulates root meristem size in a SCR and SHR-independent pathway. |
| AT3G25905 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT2G31085 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
| AT2G23950 | Encodes an LLR receptor kinase that is expressed in protophloem and is required for CLE peptide sensing in roots. One of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that acts as a co-regulator and has essential roles in regulating CLV3-mediated stem cell homeostasis. |
| AT5G51660 | cleavage and polyadenylation specificity factor 160;(source:Araport11) |
| AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
| AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
| AT5G55130 | putative molybdopterin synthase sulphurylase (cnx5) |
| AT3G02210 | COBRA-like protein 1 precursor;(source:Araport11) |
| AT5G60950 | COBRA-like protein 5 precursor;(source:Araport11) |
| AT3G16860 | COBRA-like protein 8 precursor;(source:Araport11) |
| AT2G30920 | The enzyme encoded by this gene has been shown to complement the Saccharomyces cerevisiae coq3 mutation and, therefore, to have hexaprenyldihydroxybenzoate methyltransferase activity. It is however likely that, in Arabidopsis, the enzyme catalyzes the methylation of nonaprenyldihydroxybenzoate as it is the prevalent polyprenoid in this plant species. The enzyme is a mitochondrial-localized methyltransferase involved in ubiquinone biosynthesis. |
| AT1G59840 | cofactor assembly of complex C;(source:Araport11) |
| AT3G50830 | cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. |
| AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT1G16670 | Encodes a cold-activated plasma membrane protein cold-responsive protein kinase that phosphorylates 14-3-3 proteins. The phosphorylated 14-3-3 proteins shuttle from the cytosol to the nucleus, where they interact with and destabilize the key cold-responsive C-repeat-binding factor (CBF) proteins, modulate CBF stability and the response to cold stress. |
| AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT5G42860 | CC2 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
| AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
| AT2G21385 | Encodes a chloroplast stroma localized protein that is found only in the green plant lineage. It is involved in assembly of the chloroplast ATP synthase complex. |
| AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
| AT5G16300 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT4G24840 | oligomeric golgi complex subunit-like protein;(source:Araport11) |
| AT5G15840 | Encodes a protein showing similarities to zinc finger transcription factors, involved in regulation of flowering under long days. Acts upstream of FT and SOC1. |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT3G07650 | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. The mRNA is cell-to-cell mobile. |
| AT3G21290 | Nuclear-localized intrinsically disordered protein involved in promoting miRNA activity. |
| AT5G05170 | Encodes a cellulose synthase isomer. CESA3 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA3, along with CESA1 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The xylem cells in primary root have reduced cell expansion and higher than normal lignification. |
| AT5G14250 | Encodes subunit 3 of the COP9 signalosome. |
| AT5G17880 | Encodes a TIR-NBS-LRR protein CSA1 that functions in photomorphogenic development. csa1 mutants display a constitutive shade-avoidance (CSA) phenotype (long stem) under high red:far-red rations (i.e. in the absence of a shade signal). csa1 mutation can be complemented by RPS4, a TIR-NBS-LRR protein that confers resistance against bacterium Pseudomonas syringae. |
| AT3G01490 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
| AT5G50000 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
| AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
| AT1G61620 | Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile. |
| AT4G00930 | Encodes COP1-interacting protein CIP4.1. |
| AT4G27430 | Positive regulator of light-regulated genes. Novel nuclear protein which requires light for its high level expression. The mRNA is cell-to-cell mobile. |
| AT1G22920 | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. Required for the recovery of AUX/IAA repressor levels following recurrent heat stress to regulate auxin homeostasis. |
| AT5G56280 | one of two genes encoding subunit 6 of COP9 signalosome complex. Protein contains a MPR1p and PAD1p N-terminal (MPN) domain at the N-terminal region and belongs to the Mov34 superfamily. Mutant and antisense expression result in a number of developmental defects and in ubiquitin/proteasome-mediated protein degradation. |
| AT4G26430 | one of two genes encoding subunit 6 of COP9 signalosome complex |
| AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
| AT1G31690 | Copper amine oxidase family protein;(source:Araport11) |
| AT3G43670 | Copper amine oxidase family protein;(source:Araport11) |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT4G23600 | Encodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. |
| AT2G39940 | Encodes a protein containing Leu-rich repeats and a degenerate F-box motif. Associates with AtCUL1, AtRbx1, and the Skp1-like proteins ASK1 and ASK2 to assemble SCF COI1 ubiquitin-ligase complexes in planta. A single amino acid substitution in the F-box motif of COI1 abolishes the formation of the SCF(COI1) complexes and results in loss of the JA response. Required for wound- and jasmonates-induced transcriptional regulation. Amino acid mutations in COI1 distinctively affect jasmonate-regulated male fertility.CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala could not inhibit the root length and restoration of fertility in coi1-1 mutants. |
| AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
| AT3G59420 | Encodes a membrane localized protein with similarity to receptor kinases which is involved in epidermal cell differentiation. Flowers of mutants have disorganized ovule integument growth and abnormal sepal margins. In the roots, mutants initiate more lateral roots but fewer laterals actually emerge due to defects in lateral root formation. Mutants also display disorganized columella. The root phenotypes can be traced to abnormalities in asymmetric divisions in the pericycle and root apex. Conflicting data regarding the role of the kinase domain- which may or may not be required for function. Complementation studies indicate that the C-terminal domain is also not required for signaling function. May be regulated by protein turnover which is mediated by endocytic processes. ACR4 phosphorylates the PROTEIN PHOSPHATASE 2A-3 (PP2A-3) catalytic subunit of the PP2A phosphatase holoenzyme and PP2A |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
| AT3G28630 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT5G19380 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
| AT1G03880 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G44120 | Encodes a 12S seed storage protein. The Landsberg erecta genome contains another copy of 12S globulin gene, CRA2, which is located tandemly with CRA1. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G07340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G10610 | RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). |
| AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
| AT4G02570 | Encodes a cullin that is a component of SCF ubiquitin ligase complexes involved in mediating responses to auxin and jasmonic acid. Homozygous auxin-resistant mutants arrest growth soon after germination, lacking a root and hypocotyl. Heterozygotes display a variety of phenotypes consistent with impaired auxin response. |
| AT5G53950 | Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2. Together with CUC3-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates the axillary meristem initiation, directly binding to the DA1 promoter. |
| AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
| AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
| AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
| AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT2G46430 | Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance. |
| AT4G30560 | member of Cyclic nucleotide gated channel family. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT3G17700 | cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile. |
| AT5G54250 | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
| AT2G46440 | Member of Cyclic nucleotide gated channel family. Positive regulator of resistance against avirulent fungal pathogen. The mRNA is cell-to-cell mobile. |
| AT2G24610 | member of Cyclic nucleotide gated channel family |
| AT4G30360 | member of Cyclic nucleotide gated channel family |
| AT1G17330 | cGMP-activated phosphodiesterase responsible for UVA induced decrease in cGMP. |
| AT1G44110 | Cyclin A1;(source:Araport11) |
| AT1G15570 | A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues. |
| AT1G34460 | B1 type cyclin |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT2G22490 | encodes a D-type cyclin whose transcription level is regulated by sucrose but not phytohormones or nitrate. Protein physically interacts with CDC2A. CycD2 kinase activity is regulated by sequestration of CycD2 protein in a form inaccessible to immunoprecipitation and probably not complexed to CDC2A. |
| AT4G34160 | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
| AT5G67260 | Encode CYCD3;2, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs and mediating cytokinin effects in apical growth and development. With PPD and NINJA, it plays a crucial role in leaf morphogenesis. |
| AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
| AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
| AT5G10440 | Encodes a cyclin involved in cell proliferation during stomatal cell lineage development. |
| AT4G03270 | Cyclin D6, involved in cortex/endodermis asymmetric stem cell division. |
| AT5G27620 | core cell cycle genes The mRNA is cell-to-cell mobile. |
| AT2G01905 | cyclin J18 (cycJ18) |
| AT2G44740 | cyclin p4;(source:Araport11) |
| AT1G27630 | cyclin T 1;(source:Araport11) |
| AT5G63370 | CDKG1 interacts with the splicing factor RSZ33 to regulate proper splicing of Cals5 Pre-mRNA. |
| AT1G67580 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
| AT3G44600 | Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3. |
| AT5G13690 | Encodes an enzyme that is predicted to act as an alpha-N-acetylglucosaminidase (NAGLU). An naglu mutant arrests early in seed development but does not appear to have male or female gametophytic defects. Transcript levels for this gene are increased during reproductive development. |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
| AT4G11320 | Papain family cysteine protease;(source:Araport11) |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT5G28020 | Encodes cysteine synthase CysD2. |
| AT4G23180 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile. |
| AT4G23190 | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23230 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23240 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23280 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23310 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21400 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11470 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G04500 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23130 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23140 | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23150 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
| AT1G56060 | CYSTM3 is a mitochondrial protein that is induced by salt stress and is a negative regulator of salt stress. |
| AT4G22340 | cytidinediphosphate diacylglycerol synthase 2;(source:Araport11) |
| AT2G45150 | cytidinediphosphate diacylglycerol synthase 4;(source:Araport11) |
| AT3G60620 | cytidinediphosphate diacylglycerol synthase 5;(source:Araport11) |
| AT1G26340 | encodes a member of the cytochromes b5 family of proteins that localizes to the outer envelope of the chloroplast. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro. |
| AT2G46650 | member of Cytochromes b5 The mRNA is cell-to-cell mobile. |
| AT5G53560 | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase. |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT1G02410 | Encodes a member of the cytochrome c oxidase 11 protein family. It is an integral mitochondrial protein and likely plays an important role as a mitochondrial chaperone in COX complex assembly, affecting plant growth and pollen germination. |
| AT1G69750 | cytochrome c oxidase 19-2;(source:Araport11) |
| AT2G35030 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. The mRNA is cell-to-cell mobile. |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT5G04330 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT4G15310 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT4G15398 | cytochrome P450 pseudogene |
| AT2G45510 | member of CYP704A |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
| AT5G42580 | a member of the cytochrome P450 family |
| AT3G20090 | cytochrome P450, family 705, subfamily A, polypeptide 18;(source:Araport11) |
| AT3G20100 | member of CYP705A The mRNA is cell-to-cell mobile. |
| AT4G15350 | member of CYP705A |
| AT3G20110 | member of CYP705A |
| AT3G20130 | Encodes a member of the CYP705A family of cytochrome P450 enzymes. Mutants show altered gravitropic responses. |
| AT3G20140 | member of CYP705A |
| AT1G28430 | member of CYP705A |
| AT4G15360 | member of CYP705A |
| AT3G20960 | cytochrome P450, family 705, subfamily A, polypeptide 33;(source:Araport11) |
| AT4G15380 | member of CYP705A |
| AT5G47990 | Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses. |
| AT2G05180 | member of CYP705A |
| AT4G22690 | member of CYP706A The mRNA is cell-to-cell mobile. |
| AT5G44620 | member of CYP706A |
| AT4G12330 | member of CYP706A |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT5G48000 | Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation. |
| AT2G46960 | member of CYP709B |
| AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
| AT2G30750 | Putative cytochrome P450; together with CYP71A13 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
| AT3G48290 | putative cytochrome P450 |
| AT3G48280 | putative cytochrome P450 |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT3G26190 | putative cytochrome P450 |
| AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26230 | putative cytochrome P450 |
| AT3G26220 | cytochrome P450 monooxygenase |
| AT3G53290 | missing N-term 80 AA not found between end of 71B5 and start of this sequence probably a pseudogene, from http://drnelson.utmem.edu/biblioD.html |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G28850 | member of CYP710A |
| AT3G14610 | putative cytochrome P450 |
| AT3G14620 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT1G75130 | member of CYP721A |
| AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
| AT3G52970 | member of CYP76G |
| AT5G04660 | encodes a protein with cytochrome P450 domain |
| AT3G10570 | member of CYP77A |
| AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
| AT2G46660 | Encodes a member of CYP78A cytochrome P450 monooxygenase protein family that is required in the sporophytic tissue of the mother plant to promote seed growth. |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT4G39950 | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
| AT2G22330 | Encodes a cytochrome P450. Involved in tryptophan metabolism. Converts Trp to indole-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
| AT5G36220 | member of CYP81D family of cytochrome p450s. This gene was originally called CYP91A1, but was later renamed to CYP81D1. |
| AT4G37340 | member of CYP81D |
| AT4G37320 | member of CYP81D |
| AT2G23190 | member of CYP81D |
| AT4G37370 | member of CYP81D |
| AT4G37400 | member of CYP81F |
| AT5G10600 | member of CYP81K |
| AT4G31950 | member of CYP82C |
| AT4G31940 | The gene encodes a cytochrome P450 enzyme, CYP82C. It is involved in the early Fe deficiency response.CYP82C4 hydroxylates fraxetin to generate sideretin (5-hydroxyfraxetin). Fraxetin and sideretin are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.The mRNA is cell-to-cell mobile. |
| AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1;(source:Araport11) |
| AT3G25180 | Encodes a cytochrome P450 monooxygenase (CYP82G1) that catalyzes the production of two volatile homoterpenes, TMTT and DMNT, although it is only likely to produce TMTT in planta. TMTT can be involved in attracting predatory insects to protect Arabidopsis plants from herbivorous pests. Homoterpene synthesis is also stimulated by fungal elicitors which increase the transcript levels of CYP82G1. |
| AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT1G12740 | encodes a protein with cytochrome P450 domain |
| AT1G64940 | member of CYP89A |
| AT1G05160 | Encodes an ent-kaurenoic acid hydroxylase, a member of the CYP88A cytochrome p450 family. |
| AT1G64950 | member of CYP89A The mRNA is cell-to-cell mobile. |
| AT3G01900 | member of CYP94B |
| AT2G23180 | member of CYP96A |
| AT5G02900 | member of CYP96A |
| AT1G65340 | member of CYP96A |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
| AT2G21910 | member of CYP96A |
| AT4G15110 | member of CYP97B |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G56970 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside. |
| AT4G29740 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT2G40730 | kinase family with ARM repeat domain-containing protein;(source:Araport11) |
| AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
| AT5G43330 | predicted to encode a cytosolic malate dehydrogenase. The mRNA is cell-to-cell mobile. |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G02850 | DAAR1 encodes a PLP-independent racemase that catalyzes the conversion from L-Ile to D-allo-Ile. |
| AT3G17090 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G55050 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G51370 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G06580 | Encodes a protein with glycolate dehydrogenase activity, which was shown to complement various subunits of the E. coli glycolate oxidase complex. It has not been ruled out that the enzyme might be involved in other catalytic activities in vivo. |
| AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
| AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
| AT5G66640 | DA1-related protein 3;(source:Araport11) |
| AT5G17890 | Encodes a protein that appears to be involved in defense responses. Contains TIR, NB-LRR and LIM domains. A gain of function allele exhibits cold dependent phenotypes including apparent activation of defense responses and an increased freezing tolerance. The mRNA is cell-to-cell mobile. |
| AT5G66620 | DA1-related protein 6;(source:Araport11) |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT3G60140 | Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT5G03210 | Encodes a small polypeptide contributing to resistance to potyvirus. |
| AT4G31160 | Encodes a DCAF/DWD protein capable of interacting with DDB1 and associating with CUL4, likely as part of a nuclear ubiquitin ligase complex. DCAF1 appears to be required for plant embryogenesis and to affect several other developmental processes including leaf, shoot, and flower development. |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT1G12840 | Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. The mRNA is cell-to-cell mobile. |
| AT1G26110 | Encodes Decapping 5, required for mRNA decapping, P-body formation and translational repression during postembryonic development. |
| AT5G45330 | decapping 5-like protein;(source:Araport11) |
| AT4G33400 | Together with DEM2 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
| AT3G19240 | Together with DEM1 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
| AT2G16390 | Putative chromatin remodeling protein, member of a plant-specific subfamily of SWI2/SNF2-like proteins. Mutations nearly eliminate non-CpG methylation at a target promoter but do not affect rDNA or centromere methylation. Cooperates with PolIVb to facilitate RNA-directed de novo methylation and silencing of homologous DNA. Endogenous targets include intergenic regions near retrotransposon LTRs or short RNA encoding sequences that might epigenetically regulate adjacent genes. May be used to establish a basal yet reversible level of silencing in euchromatin. |
| AT1G55350 | Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm. |
| AT5G10250 | Encodes a protein with an N-terminal BTB/POZ domain and a C-terminal NPH3 family domain. dot3 mutants have defects in shoot and primary root growth and produce an aberrant parallel venation pattern in juvenile leaves. |
| AT3G16550 | Encodes a putative DegP protease. |
| AT1G28320 | Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH. |
| AT5G45380 | urea-proton symporter DEGRADATION OF UREA 3 (DUR3);(source:Araport11) |
| AT5G16710 | DHAR3 protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.Encodes 30-40% of extractable leaf GSH-dependent DHAR activity. Single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions.Makes a minor contribution to glutathione oxidation in response to increased intracellular hydrogen peroxide (catalase deficiency) (PMID:28381499). |
| AT1G64750 | Involved in the maintenance of genome integrity through homologous recombination. This function of DSS1 is performed through its interaction with the BRCA2 protein. |
| AT1G06350 | Fatty acid desaturase family protein;(source:Araport11) |
| AT1G48760 | Encodes the putative delta subunit of the AP(adaptor protein)-3 complex and plays a role in vacuolar function. |
| AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
| AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
| AT2G36490 | A repressor of transcriptional gene silencing. Functions by demethylating the target promoter DNA. Interacts physically with RPA2/ROR1. In the ros1 mutants, an increase in methylation is observed in a number of gene promoters. Among the loci affected by ros1, a few (RD29A and At1g76930) are affected in cytosine methylation in all sequence contexts (CpG, CpNpG or CpNpN), although many others are affected primarily in non-CpG contexts. The ros1 mutant is more susceptible to biotrophic pathogens and is repressed in its responsiveness of salyclic acid-dependent defence genes. |
| AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
| AT3G23550 | MATE efflux family protein;(source:Araport11) |
| AT5G52050 | MATE efflux family protein;(source:Araport11) |
| AT5G38030 | MATE transporter involved in auxin homeostasis in roots. |
| AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
| AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
| AT3G51520 | Encodes a functional acyl-CoA:diacylglycerol acyltransferase with different acyl-CoA substrate preferences and shows higher DAG to TAG conversion rate than AtDGAT1. It increases both C18:2 and C18:3 polyunsaturated fatty acids at the expense of C16:0. |
| AT5G63770 | a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold. |
| AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT4G24570 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile. |
| AT5G12860 | AtpOMT1 encodes dicarboxylate transporter functions both as as an oxaloacetate/malate transporter and as a 2-oxoglutarate/malate transporter. |
| AT5G64280 | dicarboxylate transporter 2.2;(source:Araport11) |
| AT3G03300 | Encodes a Dicer-like protein that functions in the antiviral silencing response in turnip-crinkle virus-infected plants but not in TMV or CMV-strain-Y-infected plants. Involved in the production of ta-siRNAs. Partially antagonizes the production of miRNAs by DCL1. Substitutes for DCL4 to produce viral siRNA when DCL4 is missing or inhibited. Able to produce siRNAs but not miRNAs. |
| AT3G43920 | Encodes a ribonuclease III family protein that is required for endogenous RDR2-dependent siRNA (but not miRNA) formation. |
| AT5G20320 | Encodes an RNase III-like enzyme that catalyzes processing of trans-acting small interfering RNA precursors in a distinct small RNA biogenesis pathway. The protein is also involved in the production of 21-nt primary siRNAs from both inverted-repeat constructs and endogenous sequences, as well as the RDR6-dependent 21-nt secondary siRNAs involved in long-range cell-to-cell signaling. It binds DRB4, a ds-RNA binding protein. |
| AT5G42800 | dihydroflavonol reductase. Catalyzes the conversion of dihydroquercetin to leucocyanidin in the biosynthesis of anthocyanins. Not expressed in roots (qRT-PCR). The mRNA is cell-to-cell mobile. |
| AT1G51360 | Involved in defense against fungal pathogens and located in cytosol. |
| AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT2G37590 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G04130 | Encodes a protein that when expressed together with GYRA generates an active supercoiling DNA gyrase enzyme that shares similar properties to its bacterial counterpart, including sensitivity to gyrase-specific antibiotics. |
| AT5G18140 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G59610 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G08130 | Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. In addition, it is an important component of the active DNA demethylation machinery and is indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. |
| AT1G67630 | DNA polymerase alpha 2;(source:Araport11) |
| AT1G10520 | Encodes a homolog of the mammalian DNA polymerase lambda that is involved in the repair of UV-B induced DNA damage. |
| AT5G55310 | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. |
| AT4G21080 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
| AT4G18650 | A maternally expressed imprinted gene in the endosperm. It's expression is positively regulated by ROS1. |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
| AT5G23780 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT5G14620 | A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues. |
| AT4G12010 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. Co-regulates with WRKY19 basal levels of immunity to root-knot nematodes. |
| AT4G25670 | stress response NST1-like protein;(source:Araport11) |
| AT4G22470 | Encodes a hybrid proline-rich protein that contains two tandem PRD-8CMs (proline-rich domain-eight cysteine motif) that is involved in systemic acquired resistance. |
| AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT3G01330 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. |
| AT1G59660 | Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control. |
| AT1G06770 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. The DRIP1-GFP fusion protein is nuclear-localized. DRIP1 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
| AT1G73330 | encodes a plant-specific protease inhibitor-like protein whose transcript level in root disappears in response to progressive drought stress. The decrease in transcript level is independent from abscisic acid level. |
| AT3G26932 | dsRNA-binding protein 3;(source:Araport11) |
| AT5G41070 | Encodes a double-stranded RNA binding protein. |
| AT1G05540 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G03390 | hypothetical protein (DUF295);(source:Araport11) |
| AT1G68960 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G16080 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G25920 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G53230 | hypothetical protein (DUF295);(source:Araport11) |
| AT3G21520 | Encodes a protein is directly or indirectly involved in membrane fission during breakdown of the ER and the tonoplast during leaf senescence and in membrane fusion during vacuole biogenesis in roots. The mRNA is cell-to-cell mobile. |
| AT4G24310 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT3G02430 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT3G60460 | Encodes an R2R3 myb transcription factor that is required for male gamete formation, specifically for entry of the generative cell into mitosis. Specifically expressed in the male germline. |
| AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
| AT3G03990 | Encodes an alpha/beta hydrolase essential for strigolactone signaling. Degradation of the protein is promoted by strigolactone. The mRNA is cell-to-cell mobile. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT1G50430 | Mutants are defective in Brassinosteroid biosynthesis (delta7-sterol-C7 reduction step) and have a dwarf phenotype. EXO70 interactor and presumed negative secretion regulator. |
| AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
| AT4G03400 | Encodes a GH3-related gene involved in red light-specific hypocotyl elongation. Analysis of sense and antisense transgenic plants suggests that DFL2 is located downstream of red light signal transduction and determines the degree of hypocotyl elongation. |
| AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
| AT1G61210 | DWA3 encodes a DWD(DDB1 binding WD40) protein. Invitro analyses suggest its involvement in the negative regulation of ABA responses.One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT1G60500 | Dynamin related protein 4C;(source:Araport11) |
| AT2G44590 | DYNAMIN-like 1D;(source:Araport11) |
| AT5G42080 | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis. |
| AT2G15690 | Encodes an atypical PPR-DYW protein containing five predicted PPR domains and a C-terminal DYW domain separated by an amino acid sequence that do not clearly correspond to an E domain. It is expressed in both the mitochondrion and chloroplast and is also involved in RNA editing in the mitochondrion and chloroplast as a core member of E+-type PPR editosomes. |
| AT1G29710 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G19180 | Encodes a subunit of a RUB-activating enzyme analogous to the E1 ubiquitin-activating enzyme. ECR1 functions as a heterodimer with AXR1 to activate RUB, a ubiquitin-related protein. |
| AT2G40550 | Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression. Required for sister chromatid cohesion and DNA repair. |
| AT2G36010 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. |
| AT4G12480 | Encodes a putative lipid transfer protein, vernalization-responsive and cold-induced. It is involved in priming the SAR and ISR responses, specifically in propagating the cell-to-cell mobile signal. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. |
| AT1G77300 | Encodes a protein with histone lysine N-methyltransferase activity required specifically for the trimethylation of H3-K4 in FLC chromatin (and not in H3-K36 dimethylation). Acts as an inhibitor of flowering specifically involved in the autonomous promotion pathway. EFS also regulates the expression of genes involved in carotenoid biosynthesis and nitrogen assimilation.Modification of histone methylation at the CRTISO locus reduces transcript levels 90%. The increased shoot branching seen in some EFS mutants is likely due to the carotenoid biosynthesis defect having an effect on stringolactones.Required for ovule, embryo sac, anther and pollen development. |
| AT2G03500 | Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression. |
| AT5G19700 | Encodes a MATE transporter involved in leaf senescence and iron homeostasis. |
| AT4G14690 | Encodes an early light-induced protein. ELIPs are thought not to be directly involved in the synthesis and assembly of specific photosynthetic complexes, but rather affect the biogenesis of all chlorophyll-binding complexes. A study (PMID 17553115) has shown that the chlorophyll synthesis pathway was downregulated as a result of constitutive ELIP2 expression, leading to decreased chlorophyll availability for the assembly of pigment-binding proteins for photosynthesis. |
| AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
| AT4G28365 | early nodulin-like protein 3;(source:Araport11) |
| AT4G32490 | early nodulin-like protein 4;(source:Araport11) |
| AT3G18590 | early nodulin-like protein 5;(source:Araport11) |
| AT3G20570 | early nodulin-like protein 9;(source:Araport11) |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT4G13840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
| AT3G60500 | Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis. |
| AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
| AT1G80350 | encodes a p60 katanin protein that is expressed throughout the plant. Required for the specification of cell fates from early in development (in the meristem) through differentiation and for normal postmitotic organization of cortical microtubules into transverse arrays in root epidermis cells. Mutants display cytoskeletal defects. |
| AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
| AT2G21340 | Encodes a homolog of the multidrug and toxin extrusion transporter ENHANCED DISEASE SUSCEPTIBILITY5 that is constitutively expressed in green tissues independent of pathogen infection and is expressed in the chloroplast envelope. Unlike EDS5, it does not contribute to pathogen-induced SA accumulation. |
| AT5G20480 | Encodes a predicted leucine-rich repeat receptor kinase (LRR-RLK). Functions as the receptor for bacterial PAMP (pathogen associated molecular patterns) EF-Tu. |
| AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
| AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
| AT4G16355 | Produces a long non-coding RNA that enhances resistance against Pseudomonas syringe pv. tomato DC3000. It directly interacts with Mediator subunit 19a and enhances the expression of innate immune response genes, like PR1. |
| AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
| AT1G17455 | ELF4-like 4;(source:Araport11) |
| AT5G64890 | elicitor peptide 2 precursor;(source:Araport11) |
| AT5G64905 | elicitor peptide 3 precursor;(source:Araport11) |
| AT5G09978 | elicitor peptide 7 precursor;(source:Araport11) |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT5G26742 | DEAD box RNA helicase (RH3);(source:Araport11) |
| AT5G22640 | EMB1211 is a MORN (multiple membrane occupation and recognition nexus) motif containing protein involved in embryo development and chloroplast biogenesis. The mRNA is cell-to-cell mobile. |
| AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
| AT1G56200 | Encodes a chloroplast localized protein that is essential for chloroplast development. |
| AT1G06150 | Encodes a LHW-like protein with 79% amino acid identity to LHW. |
| AT5G37510 | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. The mRNA is cell-to-cell mobile. |
| AT2G37920 | copper ion transmembrane transporter;(source:Araport11) |
| AT5G27720 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT3G61780 | embryo defective 1703;(source:Araport11) |
| AT3G07060 | NHL domain-containing protein;(source:Araport11) |
| AT2G28880 | ADCS encodes a protein that has two functional domains. The N-terminal domain has glutamine amidotransferase activity while the C-terminal domain has aminodeoxychorismate synthase (ADCS) activity. These two domains act together to catalyze the transformation of chorismate to 4-amino-4-deoxychorismate. This reaction is required for 4-aminobenzoate (pABA) production and ultimately for folate biosynthesis. The putative target peptide of ADCS can direct GFP to the chloroplast. |
| AT1G21390 | embryo defective 2170;(source:Araport11) |
| AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
| AT2G25660 | Translocon at the inner-envelope membrane of chloroplasts which binds to the outer-membrane channel TOC75. |
| AT2G18510 | Essential gene (embryo lethal) that is similar to component of splicosome. Regulates embryonic pattern formation through Pol II-Mediated transcription of WOX2 an PIN7 (DOI:10.1016/j.isci.2019.09.004). JANUS positively regulates PLT1 expression in the root meristem by recruiting RNA polymerase II (Pol II) to PLT1 and by interacting with PLT1. Nuclear accumulation of JANUS in root meristem depends on IMB4. (DOI:10.1105/tpc.20.00108 ) |
| AT4G39620 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G70070 | Allelic to ISE2(increased size exclusion limit of plasmodesmata 2). Mutants maintain dilated plasmodesmata at the embryonic torpedo stage. |
| AT2G41720 | Encodes a pentatricopeptide repeat protein that is essential for trans-splicing of a chloroplast small ribosomal subunit transcript. |
| AT3G20440 | Encodes BE1, a putative glycoside hydrolase. Involved in organogenesis and somatic embryogenesis by regulating carbohydrate metabolism. Mutation in BE1 has pleotrophic effect on the whole plant development. |
| AT5G02250 | Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis. |
| AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT4G14590 | embryo defective 2739;(source:Araport11) |
| AT5G39680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G63420 | Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA. |
| AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
| AT5G15540 | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
| AT4G27010 | ribosome 60S biogenesis amino-terminal protein;(source:Araport11) |
| AT1G67320 | DNA primase, large subunit family;(source:Araport11) |
| AT5G40480 | embryo defective 3012;(source:Araport11) |
| AT2G36000 | Encodes an mTERF protein localized in the chloroplast stroma. |
| AT4G00620 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT4G20740 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G14320 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT5G51200 | Originally identified as EDS4, enhanced disease sensitive phenotype and subsequently cloned and identified as NUCLEOPORIN205. Affects circadian clock and downstream genes including those involved in defense response. |
| AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G01960 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
| AT1G55420 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G18080 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G34860 | DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development. |
| AT3G10000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G00140 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G13890 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
| AT2G48140 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G00310 | Putative membrane lipoprotein;(source:Araport11) |
| AT1G10745 | Encodes a Maternally expressed gene (MEG) family protein |
| AT5G64360 | EIP9 interacts with EMF1 to regulate flowering. It functions partially redundantly with SDJ2 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
| AT1G71220 | Encodes UDP-glucose:glycoprotein glucosyltransferase. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
| AT5G62500 | Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT5G67270 | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT5G05460 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
| AT3G11040 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT2G38960 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO2 is mainly present in the Ox2 redox state. |
| AT3G09030 | EAP3 is a cytolsolic BTB/POZ-domain protein involved in trafficking of PEN3. |
| AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
| AT5G05190 | hypothetical protein (DUF3133);(source:Araport11) |
| AT3G48090 | Component of R gene-mediated disease resistance in Arabidopsis thaliana with homology to eukaryotic lipases. |
| AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
| AT1G74710 | Encodes a protein with isochorismate synthase activity. Mutants fail to accumulate salicylic acid. Its function may be redundant with that of ICS2 (AT1G18870). |
| AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
| AT1G11300 | The annotation for At1g11300 in TAIR10 is incorrect. This locus has been split into two At1g11300 (symbol: EGM1) and At1g11305 (symbol: EGM2) (Olivier Loudet, personal communication, 2013-04-03). See Comment field for revised annotation. |
| AT1G63650 | Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY. |
| AT4G31820 | A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development. |
| AT3G13437 | Brassicaceae specific gene. Overexpression results in Verticillium wilt resistance. |
| AT4G16210 | enoyl-CoA hydratase/isomerase A;(source:Araport11) |
| AT2G20875 | Encodes a secretory peptide EPF1 involved in stomatal development. EPF1 is related to EPF2 which controls asymmetric cell divisions during stomatal devlopment. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT3G13898 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G05520 | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290). |
| AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
| AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
| AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile. |
| AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
| AT2G25820 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
| AT5G57090 | Encodes an auxin efflux carrier that is similar to bacterial membrane transporters. Root-specific role in the transport of auxin. Acts downstream of CTR1 and ethylene biosynthesis, in the same pathway as EIN2 and AUX1, and independent from EIN3 and EIN5/AIN1 pathway. In the root, the protein localizes apically in epidermal and lateral root cap cells and predominantly basally in cortical cells. Functions may be regulated by phosphorylation status. EIR1 expression is induced by brassinolide treatment in the brassinosteroid-insensitive br1 mutant. Gravistimulation results in asymmetric PIN2 distribution, with more protein degraded at the upper side of the gravistimulated root. Membrane sterol composition is essential for the acquisition of PIN2 polarity. Its expression is downregulated at hypoxic conditions. RAP2.12 overexpression inhibits this downregulation. |
| AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
| AT3G23240 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3. |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G07310 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting. |
| AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G20310 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G43410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Expression of ERF96 is induced by pathogens, JA and ethylene and over expression leads to increased resistance to resistance to necrotrophic pathogens. It is a nuclear localized, transcriptional activator that binds to GCC elements that is involved in positive regulation of ABA responses. |
| AT2G40940 | Ethylene receptor, subfamily 1. Has histidine kinase activity. |
| AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
| AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
| AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT1G05010 | Encodes 1-aminocyclopropane-1-carboxylate oxidase |
| AT3G20770 | Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. EIN3 interacts with MYC2, MYC3 and MYC4 to inhibit jasmonate-induced expression of wound-responsive genes and herbivory-inducible genes, and plant defense against generalist herbivores. |
| AT1G73730 | Encodes a putative transcription factor involved in ethylene and sulfate starvation signalling. Isolated DNA binding domain has been shown to bind DNA in vitro. |
| AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G16750 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
| AT3G19760 | Encodes an RNA helicase that may be a component of the Exon Junction Complex. Subcellular localization is modulated by stress. Under normal conditions it is localized to the nuceloplasm but under hyopoxic conditions it localizes to the nucleolus and splicing speckles. |
| AT1G13020 | Encodes eIF4B2, eukaryotic initiation factor 4B2. |
| AT5G25780 | member of eIF3b - eukaryotic initiation factor 3b |
| AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile. |
| AT2G39050 | Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae. |
| AT5G27700 | Cytosolic ribosomal protein. Similar to EVR1 and redundant with EVR1. Also enhances VAR2 mutant varigation, but to a lesser extent than evr1. |
| AT5G58190 | evolutionarily conserved C-terminal region 10;(source:Araport11) |
| AT1G48110 | evolutionarily conserved C-terminal region 7;(source:Araport11) |
| AT1G10180 | LOW protein: exocyst complex component-like protein;(source:Araport11) |
| AT1G76850 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile. |
| AT5G58430 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. Targeted by AvrPtoB to manipulate the defense molecule secretion machinery. |
| AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G13150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and, together with EXO70C2, is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane. |
| AT5G13990 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane and is not found to colocalize with or interact with core exocyst subunits. |
| AT3G29400 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G61010 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G39380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G59730 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. The mRNA is cell-to-cell mobile. |
| AT4G08950 | Phosphate-responsive 1 family protein;(source:Araport11) |
| AT5G09440 | EXORDIUM like 4;(source:Araport11) |
| AT2G35150 | Encodes EXORDIUM LIKE 7. |
| AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G03220 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G39280 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G39300 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G45960 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G17020 | Encodes a member of the exportin protein family (XPO1A) which functions as receptors for nuclear export. Binds to a variety of proteins having leucine rich export signals.Along with XPO1B involved with development of the male and female gametophytes. Sensitive to heat and oxidative stress. |
| AT3G03110 | Encodes a member of the exportin family (XPO1B)which function as receptors for nuclear transport.Along with XPO1A involved in the development of male and female gametophytes. |
| AT5G35190 | proline-rich extensin-like family protein;(source:Araport11) |
| AT1G23720 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT4G08370 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G21310 | Encodes extensin 3. |
| AT1G70990 | Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility. |
| AT1G76930 | Encodes an Arabidopsis extensin gene that belongs to cell-wall hydroxyproline-rich glycoproteins. The cross-link of extensins enforces cell wall strength. Transgenic plants overexpressing this gene show an increase in stem thickness. |
| AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
| AT1G55660 | FOF2, is the F-box protein family. Overexpression of FOF2 results in delayed transitions to flowering under both LD and SD conditions.FOF2 expression is induced by ABA during seed germination where it acts through ABI3 and ABI5 to modulate germination. |
| AT5G21040 | Encodes an F-box containing protein that interacts physically with BHLH32 and appears to be involved in mediating phosphate starvation responses. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
| AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT2G17036 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G24255 | LOW protein: F-box/kelch-repeat protein;(source:Araport11) |
| AT4G35733 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G16290 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G05970 | F-box protein (DUF295);(source:Araport11) |
| AT2G24080 | F-box protein (DUF295);(source:Araport11) |
| AT4G17565 | F-box protein (DUF295);(source:Araport11) |
| AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
| AT5G38270 | F-box family protein;(source:Araport11) |
| AT1G15910 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
| AT1G13790 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT3G24140 | Encodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors. It fulfills its role through recruitment of the Arabidopsis Retinoblastoma homologue, RETINOBLASTOMA-RELATED (RBR). Both transcript and protein are expressed in and are required for halting divisions at the end of the stomatal lineage. It also has a role in the promotion of guard cell fate and in controlling the transition from guard mother cell to guard cell. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G35530 | Encodes FANCM, a highly conserved helicase that functions as a major factor limiting meiotic crossover formation. It is not directly involved in the repair of DNA lesions but suppresses spontaneous somatic homologous recombination via a RecQ helicase (At-RECQ4A)-independent pathway. |
| AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
| AT4G19990 | FAR1-related sequence 1;(source:Araport11) |
| AT2G27110 | FAR1-related sequence 3;(source:Araport11) |
| AT1G76320 | FAR1-related sequence 4;(source:Araport11) |
| AT4G38180 | FAR1-related sequence 5;(source:Araport11) |
| AT3G06250 | Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS12 and NINJA glucosinolate biosynthesis. |
| AT3G59470 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. FRF1 has been shown to bind the RB-box in vitro. The RB-box contributes to restricting SHOOTMERISTEMLESS expression to the shoot apical meristem. |
| AT3G44860 | Encodes a farnesoic acid carboxyl-O-methyltransferase. The mRNA is cell-to-cell mobile. |
| AT3G44870 | Encodes a protein with 93% identity to a farnesoic acid methyl transferase. SABATH family methyltransferase. |
| AT4G33360 | Encodes an NAD+-dependent dehydrogenase that oxidizes farnesol more efficiently than other prenyl alcohol substrates. |
| AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
| AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
| AT5G63910 | Encodes a farnesylcysteine lyase (EC 1.8.3.5) involved in a salvage /detoxification pathway of farnesylcysteine (FC) residues that are liberated during the degradation of prenylated proteins. Because FC is a competitive inhibitor of prenylcysteine methyltransferases involved in the down-regulation of ABA signaling, fcly mutants with elevated FC levels are hypersensitive to ABA. The protein also appears to be glycosylated when translated in vitro in the presence of microsomal membranes and it likely requires FAD for enzymatic activity. |
| AT5G64630 | Chromatin Assembly Factor-1 (CAF-1) p60 subunit. Involved in organization of the shoot and root apical meristems. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. |
| AT1G33390 | Over-expression of this gene results in stem fasciation. The predicted amino acid sequence reveals the presence of two domains (DEXH-box or DEAD-box helicase and DUF1065 domain) and fragments of two more domains (HrpA domain and HA2 domain). |
| AT5G55730 | Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development. |
| AT5G44130 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
| AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G03870 | fasciclin-like arabinogalactan-protein 9 (Fla9). Possibly involved in embryogenesis and seed development. |
| AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
| AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
| AT4G30950 | Chloroplastic enzyme responsible for the synthesis of 16:2 and 18:2 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation resulted in reduced level of unsaturated fatty acids leading to susceptibility to photoinhibition. |
| AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. The mRNA is cell-to-cell mobile. |
| AT3G57280 | Encodes a chloroplast inner envelope localized member of the Tmemb_14 gene family. FAX1 is involved in fatty acid and lipid homeostasis and likely functions as a fatty acid transporter that exports fatty acids from the plastid. The mRNA is cell-to-cell mobile. |
| AT2G38550 | Mediates fatty acid transport from plastid. |
| AT3G20510 | Encodes a member of the Tmemb_14 family that is predicted to be localized to the membranes of the secretory pathway. The mRNA is cell-to-cell mobile. |
| AT2G34770 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
| AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
| AT3G44550 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
| AT5G63560 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G13985 | FBD-associated F-box protein;(source:Araport11) |
| AT1G57790 | F-box family protein;(source:Araport11) |
| AT2G30766 | Functions in iron homeostasis, activates iron deficiency response genes such as bHLH38, bHLH39, IRT1, and FRO2. |
| AT1G47400 | Involved in regulation of iron deficiency response genes. Overexpression results in hyperaccumulation of Fe and Mn. |
| AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
| AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
| AT2G27510 | ferredoxin 3;(source:Araport11) |
| AT5G23440 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 1;(source:Araport11) |
| AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
| AT1G26870 | NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
| AT3G27120 | Encodes a conserved AAA-ATPase that acts as a negative regulator of meiotic CO formation. |
| AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT2G21070 | This gene is predicted to an encode a nuclear-localized protein that is involved in regulating the period of circadian rhythms without affecting their amplitude or robustness. FIONA1 seems to act as a central oscillator-associated component, but its transcript levels are not regulated in a circadian or light-dependent manner. FIONA1 also appears to be involved in photoperiod-dependent flowering. |
| AT5G48580 | Endoplasmic reticulum (ER) localized immunophilin protein which possesses PPIase activity. Positively regulates plant immunity in response to Phytophthora infection. Host target of PcAvr3a12 during early P. capsici infection. Involved in ER stress sensing and is required for ER stress-mediated plant immunity. |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
| AT5G63595 | flavonol synthase 4;(source:Araport11) |
| AT2G19190 | Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6. |
| AT4G28300 | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. The mRNA is cell-to-cell mobile. |
| AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
| AT1G43800 | Δ9 stearoyl-ACP desaturase which together with FAB2, AAD1, and AAD5 redundantly participates in oil storage during the maturation phase. |
| AT5G25260 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking. |
| AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
| AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT1G35460 | Encodes a bHLH transcription factor involved in CFL1-mediated regulation of cuticle development. Overexpression leads to abnormal cuticle development. |
| AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
| AT3G04610 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT2G20650 | Encodes a putative RING E3 ubiquitin ligase based on its 84.5% amino acid identity with FLY1, which possesses this activity in vitro. It is predicted to be localized to the endomembrane system based on protein topology.The mucilage of fly2 mutant seeds hydrated in water resembles wild type seed mucilage. |
| AT4G15060 | FBD, F-box/LRR protein;(source:Araport11) |
| AT5G66380 | Encodes a folate transporter that is located in the chloroplast envelope and is able to mediate exogenous folate uptake when expressed in E. coli. However, this is not the sole folate transporter for chloroplasts as null mutants of this gene have no discernible phenotype when grown under folate-sufficient conditions and contained wild-type levels of folates in leaves. |
| AT4G27760 | Encodes an oxidoreductase required for vegetative shoot apex development. Mutants display disruptions in leaf positioning and meristem maintenance. |
| AT3G63300 | Encodes a pleckstrin homology domain- and DUF828-containing protein. Mutants have defects in leaf vascular pattering, with vascular bundles that fail to meet distally in both the cotyledons and leaves. Necessary to the formation of the closed leaf vascular pattern characteristic of dicot leaves in response to auxin. Redundant with FKD2. FKD1 may influence PIN1 localization in an auxin dependent manner. proposed to be a key component of the auxin canalization pathway. FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT3G07540 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
| AT5G07770 | Actin-binding FH2 protein;(source:Araport11) |
| AT5G07780 | Encodes a class II formin that nucleates actin assembly, binds to the barbed-end of actin filaments and antagonizes the effect of FH1 on actin dynamics. The mRNA is cell-to-cell mobile. |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
| AT1G34260 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
| AT3G48480 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT4G17060 | Encodes one of the FRI interacting proteins: FRIGIDA INTERACTING PROTEIN 1 (FIP1)/At2g06005, FIP2/ At4g17060. FRI (At4G00650) is a major determinant of natural variation in Arabidopsis flowering time. |
| AT1G63930 | EXO70 interactor and presumed negative secretion regulator. |
| AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
| AT2G31390 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT4G38970 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
| AT4G26520 | Aldolase superfamily protein;(source:Araport11) |
| AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
| AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
| AT1G06430 | encodes a FtsH protease that is localized to the chloroplast |
| AT2G03220 | member of Glycosyltransferase Family- 37 |
| AT1G49710 | Encodes a protein with core α1,3-fucosyltransferase activity. |
| AT1G14100 | member of Glycosyltransferase Family- 37. FUT8 was previously associated to AT1G14110 |
| AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
| AT2G47510 | Encodes a mitochondrial-localized protein. The FUM1 gene appears to be essential, suggesting that FUM1 may play a crucial role as a fumarase in the tricarboxylic acid cycle. |
| AT3G16700 | Fumarylacetoacetate hydrolase homolog. |
| AT4G24740 | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
| AT1G02090 | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT3G61140 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Component of the nuclear-localized COP9 complex. Mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons, first become defective during embryogenesis and exhibit limited seedling development. |
| AT3G13550 | Encodes a protein similar to ubiquitin-conjugating enzyme (E2) variant proteins (UEV); lacks catalytic cysteine residue found in ubiquitin-conjugating enzyme E2. Represses photomorphogenesis and induces skotomorphogenesis in the dark. |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
| AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
| AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G60470 | Predicted to encode a galactinol synthase. |
| AT5G23790 | Predicted to encode a galactinol synthase. |
| AT4G26250 | Predicted to encode a galactinol synthase. |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT2G32740 | galactosyltransferase 13;(source:Araport11) |
| AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G02720 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G49150 | Encodes a transmembrane domain containing protein expressed in sperm cells. Mutants are defective in gamete fusion. Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G48030 | encodes a mitochondrially targeted DNAJ protein involved in female gametophyte development. |
| AT1G47260 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT5G63510 | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT5G26220 | ChaC-like family protein;(source:Araport11) |
| AT4G39640 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
| AT4G12960 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
| AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT1G75750 | GA-responsive GAST1 protein homolog regulated by BR and GA antagonistically. Possibly involved in cell elongation based on expression data The mRNA is cell-to-cell mobile. |
| AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
| AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT1G08000 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT1G08010 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G28340 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G47140 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT3G51080 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G16141 | GATA type zinc finger transcription factor family protein;(source:Araport11) |
| AT2G15740 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
| AT1G72030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G19985 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G73790 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT1G73250 | encodes a bifunctional 3, 5-epimerase-4-reductase in L-fucose synthesis and converts GDP-D-mannose to GDP-L-fucose in vitro along with MUR1 (GDP-D-mannose 4,6-dehydratase). It is expressed in all tissues examined, but most abundantly in roots and flowers. |
| AT5G66280 | GDP-D-mannose 4,6-dehydratase |
| AT1G54010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G14225 | Contains lipase signature motif and GDSL domain. |
| AT1G53920 | Contains lipase signature motif and GDSL domain. |
| AT5G60550 | Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. |
| AT3G02520 | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). |
| AT1G05055 | Member of transcription factor TFIIH complex. Involved in transcription and DNA repair and interacts with AtXPD. |
| AT4G27600 | Encodes a phosphofructokinase B-type carbohydrate kinase family protein, NARA5. Regulates photosynthetic gene expression. |
| AT2G34630 | Encodes a geranyl diphosphate synthase. RNAi lines are dwarf. T-DNA knock-out lines are embryo lethal. |
| AT3G32040 | Chloroplast localized GFDP synthase. |
| AT3G29430 | Chloroplast localized GFDP synthase. |
| AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
| AT5G39100 | germin-like protein (GLP6) |
| AT3G05930 | germin-like protein (GLP8) |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
| AT3G17203 | a pseudogene initially named GA2ox5 and thought to be a member of the gibberellin 2-oxidase enzyme family. It was later shown to have a large DNA insert in the putative gene model. |
| AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
| AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
| AT5G07200 | encodes a gibberellin 20-oxidase. |
| AT1G44090 | Encodes a gibberellin 20-oxidase. |
| AT1G80340 | Encodes a protein with gibberellin 3 β-hydroxylase activity. The protein was heterologously expressed in E. coli and shown to catalyze the hydroxylation of both GA9 and GA20. |
| AT1G79840 | Glabra 2, a homeodomain protein affects epidermal cell identity including trichomes, root hairs, and seed coat. It also down-regulates seed oil content. Expressed in atrichoblasts and required to suppress root hair development. Also expressed abundantly during early seed development. Directly regulated by WER. |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT1G68360 | Encodes a nuclear localized member of the C2H2 family of TFIIIA transcription factors.GIS3 is involved in trichome initiation and development downstream of GA and cytokinin signaling. GIS regulates the expression GIS and GIS2. |
| AT2G41760 | Controls the expression of specific defence-response genes, activates the synthesis pathway for the phytoalexin camalexin and influences basal resistance to Pseudomonas syringae pv tomato (Pst). |
| AT1G65440 | Related to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. It encodes a putative WG/GW-repeat protein involved in the regulation of apical-basal polarity of embryo |
| AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
| AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
| AT5G13110 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is most highly expressed in root. |
| AT5G40760 | Encodes a cytosolic glucose-6-phosphate dehydrogenase that is insensitive to reduction by DTT and whose mRNA is expressed ubiquitously. The mRNA is cell-to-cell mobile. |
| AT1G67490 | Encodes an alpha-glucosidase I enzyme that catalyzes the first step in N-linked glycan processing. Localized to the endoplasmic reticulum (ER). |
| AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
| AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
| AT1G65960 | glutamate decarboxylase (GAD2) The mRNA is cell-to-cell mobile. |
| AT2G02010 | glutamate decarboxylase 4;(source:Araport11) |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT3G07520 | member of Putative ligand-gated ion channel subunit family. Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT2G17260 | Encodes a glutamate receptor. Involved in calcium-programmed stomatal closure. |
| AT5G27100 | member of Putative ligand-gated ion channel subunit family |
| AT2G24720 | member of Putative ligand-gated ion channel subunit family |
| AT5G11210 | member of Putative ligand-gated ion channel subunit family |
| AT2G29120 | member of Putative ligand-gated ion channel subunit family |
| AT1G42540 | member of Putative ligand-gated ion channel subunit family |
| AT2G32400 | Glr5 |
| AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
| AT5G64050 | Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT3G48730 | glutamate-1-semialdehyde 2,1-aminomutase 2;(source:Araport11) |
| AT5G63570 | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile. |
| AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT5G37600 | encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
| AT5G35630 | chloroplastic glutamine synthetase The mRNA is cell-to-cell mobile. |
| AT3G63080 | Encodes glutathione peroxidase. |
| AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
| AT1G02940 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02930 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G02920 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT4G02520 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT1G74590 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G69930 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G27130 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). GSTU13 acts in the pathogen triggered pathway for indole glucosinolate metabolisms that involves also PENETRATION2 myrosinase. It is likely the enzyme that conjugates GSH with unstable indol-3-ylmethyl-ITCs formed upon PEN2-mediated IG hydrolysis, particularly in the branch of this pathway in which 4-substituted IGs are processed. |
| AT3G43800 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
| AT1G53680 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29440 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT3G09270 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G41220 | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G02390 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. It functions in vitro as a maleylacetoacetate isomerase and is likely to be involved in tyrosine catabolism. |
| AT1G12900 | glyceraldehyde 3-phosphate dehydrogenase A subunit 2;(source:Araport11) |
| AT1G42970 | Encodes chloroplast localized glyceraldehyde-3-phosphate dehydrogenase that can use both NADH and NADPH to reduce 1,3-diphosphate glycerate. It forms A2B2 heterotetramers with GapA forms of the GADPH enzyme. These complexes are active in the light under reducing conditions, but show reduced NADPH-dependent activity in response to oxidized thioredoxins and increased NAD(H)/NADP(H) ratios due to the formation of inactive A8B8 hexadecamers. The mRNA is cell-to-cell mobile. |
| AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G06520 | sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile. |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G43300 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT5G45350 | proline-rich family protein;(source:Araport11) |
| AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
| AT5G07510 | encodes a glycine-rich protein that is expressed in low abundance in stems and leaves, and very low abundance in flowers. |
| AT5G07550 | member of Oleosin-like protein family |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G05380 | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
| AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
| AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
| AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
| AT1G23210 | glycosyl hydrolase 9B6;(source:Araport11) |
| AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
| AT2G44290 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G12360 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G22650 | lipid transfer protein;(source:Araport11) |
| AT3G22600 | Glycosylphosphatidylinositol (GPI)-anchored LTPg protein, downregulated in syncytia induced by the beet cyst nematode Heterodera schachtii and root knot nematode Meloidogyne incognita. Infection with bacteria (Pseudomonas syringae) and fungi (Botrytis cinerea) leads to the induction of the gene in leaves. |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT1G32930 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G06130 | glyoxalase 2-4;(source:Araport11) |
| AT1G64185 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
| AT1G17650 | Glyoxylate reductase located in chloroplasts. |
| AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
| AT5G13370 | IBA - specific acyl acid amido synthetase which conjugates glutamine to IBA. It is involved in generating inactive and/or storage forms of IBA in the seedling, root, and silique. May play a role in auxin homeostasis by modulating the levels of IBA for peroxisomal conversion to IAA. |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT1G53130 | Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space. |
| AT3G61570 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC3 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (161 aa) portion of the protein. |
| AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
| AT3G52910 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower. |
| AT2G06200 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower |
| AT4G03190 | Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression. |
| AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
| AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
| AT4G34460 | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. It seems to be involved in the calcium-mediated response to extracellular ATP. |
| AT3G23860 | Encodes a GTP-binding related protein that acts as a negative regulator of pollen germination, pollen tube growth, and gametophyte senescence. |
| AT2G44100 | GDP dissociation inhibitor involved in vesicular membrane traffic |
| AT1G03830 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles. |
| AT5G63220 | golgi-to-ER traffic-like protein;(source:Araport11) |
| AT3G53630 | hypothetical protein;(source:Araport11) |
| AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile. |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT3G47950 | mutant has Slight reduction in root and shoot growth; Exaggerated defects in salt stress; Plasma Membrane H+ ATPase |
| AT2G24520 | plasma membrane H+-ATPase;(source:Araport11) |
| AT5G20140 | Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress. |
| AT4G28490 | Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile. |
| AT1G28440 | HAESA-like 1;(source:Araport11) |
| AT5G65710 | Encodes a protein controlling the separation step of floral organ abscission.Necessary for pathogen-triggered leaf abscission. |
| AT2G35230 | Contains a plant-specific VQ motif. Involved in endosperm growth and seed size determination. IKU1 is expressed in the early endosperm and its progenitor, the central cell.IKU1 interacts with MINI3 in the yeast two-hybrid system. |
| AT3G19700 | Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments. |
| AT3G60630 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT3G18030 | flavin mononucleotide flavoprotein involved in salt and osmotic tolerance HAL3A encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis. HAL3A is predominant over another gene with the presumably same function (HAL3B). |
| AT1G60780 | ?1 adaptin component of heterotetrameric protein complex that regulates protein sorting at the trans-Golgi network/early endosome. The observed pleiotropic cellular and developmental defects in mutants are primarily due to defects in sorting of targets such as KNOLLE. |
| AT4G21150 | ribophorin II (RPN2) family protein;(source:Araport11) |
| AT5G56250 | hapless 8;(source:Araport11) |
| AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
| AT5G20470 | Encodes a headless derivative of myosin XI-K, which likely arose from a partial duplication of the XI-K gene and is developmentally regulated. |
| AT4G13550 | Heat stress inducible plastid monogalactosyldiacylglycerol lipase. |
| AT5G10010 | myosin-H heavy protein;(source:Araport11) |
| AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
| AT1G74310 | Encodes ClpB1, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Involved in refolding of proteins which form aggregates under heat stress. Also known as AtHsp101. AtHsp101 is a cytosolic heat shock protein required for acclimation to high temperature. |
| AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT1G32330 | Member of Heat Stress Transcription Factor (Hsf) family. Negatively regulated by HSP90.2. |
| AT5G03720 | Member of Heat Stress Transcription Factor (Hsf) family. Expression is regulated by DREB2A and in turn HSFA3 regulates the expression of hsps Hsp18.1-CI and Hsp26.5-MII35S. Involved in establishing thermotolerence. |
| AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G17210 | Encodes a heat stable protein with antimicrobial and antifungal activity. |
| AT4G29770 | Target of trans acting-siR480/255. Testing. |
| AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G06330 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G05920 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G03380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G50740 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G37270 | Encodes a P1B-type ATPases that is localized to the chloroplast envelope and is involved in the transport of Cu into chloroplasts. It is essential for growth under high light conditions. |
| AT4G30110 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT1G69720 | Encodes a member (HO3) of the heme oxygenase family. |
| AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
| AT2G16060 | Encodes a class 1 nonsymbiotic hemoglobin induced by low oxygen levels with very high oxygen affinity. It is not likely to be a hemoglobin transporter because of its extremely high affinity for oxygen. Overexpression impairs cold stress-induced nitric oxide (NO) production. |
| AT2G39740 | Encodes HESO1 (HEN1 suppressor 1), a terminal nucleotidyl transferase that uridylates miRNAs and siRNAs at 3′ end. HESO1-mediated 3′ uridylation destabilizes small RNAs in hen1. |
| AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT3G23640 | heteroglycan glucosidase 1;(source:Araport11) |
| AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
| AT1G47840 | Encodes a putative hexokinase. |
| AT5G14570 | Encodes ATNRT2.7, a nitrate transporter that controls nitrate content in seeds. Expression is detected in reproductive organs and peaks in seeds. Localized to the vacuolar membrane. |
| AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT3G09650 | RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit. |
| AT4G37200 | Encodes thioredoxin-like protein with disulfide reductase activity that is involved in the biogenesis of the plastid cytochrome b6f complex. Protein is located in the thylakoid membrane with the C-terminal hydrophilic portion, containing the thioredoxin like domain, extending into the thylakoid lumen. |
| AT3G17040 | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. It binds in the psbT?psbH intercistronic region and blocks the progression of 5′ → 3′ exoribonucleases, which defines the 5′ end of processed psbH transcripts and also stabilizes the downstream RNA segment. In addition, HCF107 binding remodels the structure of the psbH 5′ UTR in a way that can account for its ability to enhance psbH translation. |
| AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
| AT1G48620 | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
| AT2G17560 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT4G35570 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha. |
| AT2G30470 | HSI2 is a member of the ABI3 family of B3 domain proteins and functions as an active repressor of the Spo minimal promoter through the EAR motif. It contains a plant-specific B3 DNA-binding domain. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50?M ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. HSI2 is also an epigenetic repressor as it also contains functional plant homeodomain-like (PHD-L) and zinc-finger Cys- and Trp-containing (CW) domains associated with epigenetic regulation. The PHD-L domain of HSI2 is connected to promoting trimethylation of Lys-27 on histone 3 (H3K27me3), while the CW domain can bind directly to H3K4me3. Through these domains, HSI2 represses the seed maturation program during seed germination by repressing transcription of the core LAFL (LEC1, ABI3, FUS3, and LEC2) seed developmental transcriptional regulators. In developing A. thaliana embryos, HSI2 suppresses expression of a large number of genes, many identified as targets of FUS3. However, the absence of HSI2 had no effect on transcript levels of the LAFL regulators and the levels of measured metabolites and phytohormones (ABA, auxin, and JA derivatives) in developing Arabidopsis embryos. HSI2 likely fine-tunes seed maturation by repressing genes involved in early embryogenesis that are not required later for seed maturation and desiccation. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT1G18370 | Encodes a kinesin HINKEL. Required for cytokinesis in pollen. Mutant has cytokinesis defects; seedling lethal. |
| AT5G62630 | hipl2 protein precursor;(source:Araport11) |
| AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT5G35750 | Encodes histidine kinase AHK2. |
| AT5G10720 | member of Histidine Kinase |
| AT1G03430 | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT5G63890 | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT2G30620 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
| AT5G10400 | Histone superfamily protein;(source:Araport11) |
| AT3G27360 | Histone superfamily protein;(source:Araport11) |
| AT1G79000 | Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation. |
| AT1G16710 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC12 acetylation of the H3 or H4 peptides, suggesting that HAC12 can acetylate any of several lysines present in the peptides. |
| AT1G55970 | HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain. |
| AT3G12980 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14. The mRNA is cell-to-cell mobile. |
| AT3G54610 | Encodes a histone acetyltransferase that plays a role in the determination of the embryonic root-shoot axis. It is also required to regulate the floral meristem activity by modulating the extent of expression of WUS and AG. In addition, it is involved in stem cuticular wax accumulation by modulating CER3 expression via H3K9/14 acetylation. In other eukaryotes, this protein is recruited to specific promoters by DNA binding transcription factors and is thought to promote transcription by acetylating the N-terminal tail of histone H3. The enzyme has indeed been shown to catalyse primarily the acetylation of H3 histone with only traces of H4 and H2A/B being acetylated. Non-acetylated H3 peptide or an H3 peptide that had been previously acetylated on K9 both serve as excellent substrates for HAG1-catalyzed acetylation. However, prior acetylation of H3 lysine 14 blocks radioactive acetylation of the peptide by HAG1. HAG1 is specific for histone H3 lysine 14. |
| AT3G44680 | Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD. |
| AT5G61070 | Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation. |
| AT5G35600 | Encodes a histone deacetylase that is crucial for female gametophyte development and embryogenesis. |
| AT3G54560 | Encodes HTA11, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA9) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
| AT2G44150 | Encodes a protein-lysine N-methyltransferase. Located in ER. |
| AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
| AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
| AT2G18350 | homeobox protein 24;(source:Araport11) |
| AT5G60480 | homeobox protein 26;(source:Araport11) |
| AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
| AT2G33880 | Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling. |
| AT5G46880 | homeobox-7;(source:Araport11) |
| AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
| AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
| AT3G60390 | Encodes homeobox protein HAT3. |
| AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
| AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT1G05230 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Mutants have trichomes that appear glass-like under a dissecting microscope as compared to the wild-type trichomes. The mutations do not affect trichome growth or branch number. |
| AT2G32370 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development. |
| AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT3G11945 | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
| AT1G02145 | homolog of asparagine-linked glycosylation 12;(source:Araport11) |
| AT3G54420 | encodes an EP3 chitinase that is expressed during somatic embryogenesis in 'nursing' cells surrounding the embryos but not in embryos themselves. The gene is also expressed in mature pollen and growing pollen tubes until they enter the receptive synergid, but not in endosperm and integuments as in carrot. Post-embryonically, expression is found in hydathodes, stipules, root epidermis and emerging root hairs. |
| AT3G44530 | Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. It is a part of the HISTONE REGULATOR complex that deposits histones in a DNA synthesis-independent manner and affects both nucleosome occupancy and the maintenance of transcriptional silencing. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2. |
| AT1G56110 | NOP56-like protein |
| AT3G19210 | Encodes RAD54, a member of the SWI2/SNF2 family of DNA-stimulated ATPases. Functions in DNA repair via homologous recombination. |
| AT2G22450 | riboflavin biosynthesis protein;(source:Araport11) |
| AT3G50460 | Homolog of RPW8 |
| AT3G50470 | Homolog of RPW8 |
| AT3G50480 | Homolog of RPW8 |
| AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
| AT1G04050 | Encodes SUVR1, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
| AT3G23100 | A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. Yeast two-hybrid analysis demonstrated a strong interaction between A. thaliana DNA ligase IV and the A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. This interaction is shown to be mediated via the tandem BRCA C-terminal domains of A. thaliana DNA ligase IV protein. |
| AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
| AT1G03380 | yeast autophagy 18 G-like protein;(source:Araport11) |
| AT2G31270 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. Located in nucleus and chloroplast. |
| AT1G10030 | Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor. |
| AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G08110 | Plays a role in the maintenance of genome stability and the repair of aberrant replication intermediates in the root meristem. Is involved with RAD1, FAN1, and RECQ4A in the repair of DNA CLs. |
| AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
| AT3G08950 | Encodes HCC1, homologue of the copper chaperone SCO1 (synthesis of cytochrome c oxidase 1) from the yeast Saccharomyces cerevisiae. SCO1 encodes a mitochondrial protein that is essential for the correct assembly of complex IV in the respiratory chain. HCC1 is localized in the mitochondrion. A chimeric yeast Sco1-Arabidopsis HCC1 protein complements yeast Sco1 activity. Embryos of hcc1 mutants became arrested at various developmental stages, mostly at the heart stage. |
| AT2G17265 | Encodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts. Mutation of this gene results in higher level of the amino acid homoserine and resistance to downy mildew pathogen Hyaloperonospora arabidopsidis. |
| AT1G12270 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G18360 | Host immune receptor which recognizes the conserved effector HopB1. |
| AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G50950 | Encodes a canonical CC-type NLR protein that is required for the recognition of the T3SE HopZ1a as well as several other Hop effectors from the pathogenic bacteria P. syringae. |
| AT3G57750 | Encodes a pseudokinase that likely acts as a decoy to lure the P. syringae effector acetyltransferase HopZ1a to the ZAR1-resistance complex, resulting in effector-triggered immunity (ETI) activation. It is acetylated by HopZ1a. |
| AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G25790 | Encodes a nuclear localized member of the GARP family of transcription factors. Along with AtNIGT1/HRS1 it is involved in nitrate and phosphate signaling in the root. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
| AT3G63070 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile. |
| AT4G02730 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G34260 | Encodes a WDxR motif-containing protein that is required for gametogenesis, seed and endosperm development. |
| AT1G74520 | Part of the AtHVA22a family. Protein expression is ABA- and stress-inducible. |
| AT2G42820 | HVA22-like protein F;(source:Araport11) |
| AT2G36020 | HVA22-like protein J;(source:Araport11) |
| AT4G36720 | HVA22-like protein K;(source:Araport11) |
| AT3G17609 | Encodes a homolog of HY5 (HYH). Involved in phyB signaling pathway. |
| AT4G17520 | Hyaluronan / mRNA binding family;(source:Araport11) |
| AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
| AT5G08280 | Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. Mutants spontaneously develop chlorotic leaf lesions in the absence of pathogen attack, resembling the phenotype of lesion-mimic mutants. It has been shown to interact with the PPR protein AtECB2 for chloroplast RNA editing. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT1G79870 | Hydroxyphenylpyruvate reductase (HPPR), which catalyzes the reduction of 4-hydroxyphenylpyruvic acid (pHPP) to 4-hydroxyphenyllactic acid (pHPL). Together with HPPR3 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
| AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
| AT4G32120 | Encodes a hydroxyproline O-galactosyltransferase. |
| AT2G25300 | Encodes a hydroxyproline O-galactosyltransferase. |
| AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT5G61460 | Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT5G49230 | Identified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction. |
| AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
| AT5G55510 | PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Acts in the export of proteins from chloroplasts during leaf senescence. |
| AT1G05575 | transmembrane protein;(source:Araport11) |
| AT3G10020 | plant/protein;(source:Araport11) |
| AT3G27220 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G05550 | Hypoxia-responsive family protein;(source:Araport11) |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT1G68100 | member of IAA-alanine resistance protein 1 |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
| AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
| AT5G54140 | encodes a protein similar to IAA amino acid conjugate hydrolase |
| AT4G37550 | Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM. |
| AT4G37560 | Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM. |
| AT1G17210 | IAP-like protein 1;(source:Araport11) |
| AT4G30410 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G32320 | Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C). |
| AT1G64790 | ILITHYIA (ILA) is a HEAT repeat protein involved in plant immunity. The gene is also involved in systemic acquired resistance induced by P. syringae expressing avrRps4. Loss-of-function mutants of ILA caused pleiotropic defects in the mutant plants. The mutant plants are smaller in size and the leaves are serrated and yellow to light green in color. Required for bacterium-triggered stomatal closure. |
| AT2G34900 | Encodes a member of the BET subgroup of bromodomain proteins, a novel class of putative transcription factors. Its expression is induced during seed imbibition and downregulated during germination. Seeds of a loss-of-function mutant allele, imb1, show impaired cotyledon greening during germination in abscisic acid (ABA) and express higher levels of ABI5 protein than the wild type. Moreover, imb1 seeds are deficient in the phytochrome A (phyA)-mediated very-low-fluence response of germination. |
| AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G33880 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33890 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33900 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G33930 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
| AT4G16143 | Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT4G27640 | Nuclear import receptor for GRF-interacting factors (GIFs),roles in ovule development. |
| AT1G48490 | Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network. |
| AT3G12360 | Encodes a protein with an ankyrin motif and transmembrane domains that is involved in salt tolerance. Expressed throughout the plant and localized to the plasma membrane. Loss of function mutations show an increased tolerance to salt based on assaying seedling growth in the presence of salt. In the mutants, induction of genes required for production of reactive oxygen species is reduced suggesting that itn1 promotes ROS production. It interacts with RCN1 in vivo and may regulate its subcellular localization. The mRNA is cell-to-cell mobile. |
| AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
| AT4G02670 | indeterminate(ID)-domain 12;(source:Araport11) |
| AT3G50700 | zinc finger protein, similar to maize Indeterminate1 (ID1) |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT1G21100 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21120 | O-methyltransferase family protein;(source:Araport11) |
| AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT1G52830 | An extragenic dominant suppressor of the hy2 mutant phenotype. Also exhibits aspects of constitutive photomorphogenetic phenotype in the absence of hy2. Mutants have dominant leaf curling phenotype shortened hypocotyls and reduced apical hook. Induced by indole-3-acetic acid. |
| AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT5G25890 | encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene. |
| AT4G32280 | indole-3-acetic acid inducible 29;(source:Araport11) |
| AT1G04100 | Auxin induced gene, IAA10 (IAA10). |
| AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
| AT3G09922 | Encodes a gene product whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
| AT5G64667 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT3G18715 | Similar to Inflorescance deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G52200 | Encodes an inhibitor of protein phosphatase one (PP1). |
| AT5G48820 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT5G67610 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
| AT4G33770 | Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT4G16480 | Encodes a high affinity H+:myo-inositol symporter. The only other compound shown to be transported was pinitol, a methylated derivative of myo-inositol. The mRNA is cell-to-cell mobile. |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
| AT2G31830 | Encodes a 5-inositol-polyphosphate phosphatase, that, in vitro, shows some activity against Ins(1,4,5)P3 and PI(3,4,5)P3, but even higher activity against PI(4,5)P2 |
| AT2G43850 | Integrin-linked protein kinase family;(source:Araport11) |
| AT5G46950 | One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo. |
| AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G62070 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G07240 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
| AT2G26180 | Transient Expression of Pro35S:YFP-IQD5 in leaves of N. benthamiana alters microtubule organization.Member of IQ67 (CaM binding) domain containing family. |
| AT5G26820 | Mutations in MAR1 confer resistance, while MAR1 overexpression causes hypersensitivity to multiple aminoglycoside antibiotics. Localizes to the chloroplast envelope. MAR1 may act as a plastid transporter involved in cellular iron homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G19690 | The gene encodes Fe2+ transporter protein. It is a member of the Zrt/Irt-like protein (ZIP) family of transporters. AtIRT1 has broad specificity for divalent heavy metals, mediating the transport of zinc, manganese, cobalt and cadmium under Fe-deficient conditions. IRT1 is monoubiquitinated to promote endocytic trafficking. The mRNA is cell-to-cell mobile. |
| AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
| AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
| AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT5G67210 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT4G35260 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
| AT2G17130 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
| AT3G02780 | Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that it functions in the mevalonate, but not the MEP biosynthetic pathway. |
| AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
| AT5G19040 | Encodes cytokinin synthase. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT4G13430 | Encodes a methylthioalkylmalate isomerase involved in glucosinolate biosynthesis. |
| AT2G43090 | One of three genes encoding the small subunit of isopropylmalate isomerase, a heterodimer consisting of a large and a small subunit. A function in both leucine biosynthesis and the first cycle of Met chain elongation has been demonstrated for this subunit. The mRNA is cell-to-cell mobile. |
| AT2G14830 | Ist1p;(source:Araport11) |
| AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT4G32350 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
| AT3G16460 | Mannose-binding protein |
| AT1G01260 | bHLH13 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH14 and bHLH17 to negatively regulate jasmonate responses. |
| AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
| AT3G11180 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
| AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
| AT4G00990 | jJumonji-domain-containing H3K9 histone demethylase. Loss of function mutants are susceptible to bacterial infection and early flowering. |
| AT2G29640 | JOSEPHIN-like protein;(source:Araport11) |
| AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
| AT5G11800 | member of Putative potassium proton antiporter family |
| AT4G33530 | potassium transporter |
| AT1G70300 | potassium transporter |
| AT5G09400 | Encodes a potassium uptake permease with a functional adenylate cyclase (AC) center. The first 100 aa of this protein can complement AC-deficient E. coli and display AC activity in vitro. KUP7 is localized to the plasma membrane where it functions in potassium uptake and translocation. |
| AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
| AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G31350 | KAR-UP F-box 1;(source:Araport11) |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT5G08390 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT5G23430 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT3G52890 | KCBP-interacting protein kinase interacts specifically with the tail region of KCBP |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G12360 | encodes a Sec1 protein and expressed throughout the plant. physically interacts with Syntaxin1 and is required for cytokinesis. |
| AT1G26945 | Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity. |
| AT1G05360 | KMS2 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
| AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G06670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G10470 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells. |
| AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
| AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
| AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT4G08150 | A member of class I knotted1-like homeobox gene family (together with KNAT2). Similar to the knotted1 (kn1) homeobox gene of maize. Normally expressed in the peripheral and rib zone of shoot apical meristem but not in the leaf primordia. It is also expressed in the fourth floral whorl, in the region that would become style, particularly in the cell surrounding the transmitting tissue. No expression was detected in the first three floral whorls. Expression is repressed by auxin and AS1 which results in the promotion of leaf fate. |
| AT4G32040 | A member of Class II KN1-like homeodomain transcription factors factors (together with KNAT3 and KNAT4), with greatest homology to the maize knox1 homeobox protein. Regulates photomorphogenic responses and represses late steps in gibberellin biosynthesis. KNAT5 promoter activity showed cell-type specific pattern along longitudinal root axis, primarily in the epidermis of the distal end of primary root elongation zone. |
| AT1G14760 | Encodes a novel Arabidopsis KNOX gene that encodes a MEINOX domain but lacks the homeodomain and interacts with TALE-class homeodomain proteins to modulate their activities |
| AT1G77860 | Mutant has Altered morphology of pollen exine wall; Seven-Path Transmembrane Protein |
| AT1G74910 | KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT1G16970 | Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. |
| AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT1G01220 | Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis. |
| AT3G24090 | Encodes a glutamine-fructose-6-phosphate transaminase that likely plays a role in UDP-N-acetylglucosamine biosynthesis. |
| AT3G45330 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60310 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60320 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
| AT3G45410 | encodes a receptor-like kinase that has serine/threonine kinase activity whose expression is induced by high salt stress. This induction is inhibited by tobacco ethylene receptor. |
| AT3G45420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G45440 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G60280 | Plasma membrane localized receptor kinase. Binds NAD+ and induces expression of disease resistance genes. |
| AT5G59260 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29220 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G53810 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G02410 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G02420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G10530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G55830 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43690 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G59700 | Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000. |
| AT3G59730 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT4G29050 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G08870 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G53380 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
| AT5G21160 | Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover. |
| AT4G35890 | Encodes a cytoplasmic LAM domain containing protein that is involved in leaf senescence. The mRNA is cell-to-cell mobile. |
| AT5G46250 | RNA-binding protein;(source:Araport11) |
| AT5G01190 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G03260 | LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G09360 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
| AT2G30210 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
| AT3G09220 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT3G45130 | lanosterol synthase 1;(source:Araport11) |
| AT1G18850 | PCP2 encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1. |
| AT3G51810 | Encodes a ABA-inducible protein that accumulates during seed maturation, in parallel with its corresponding mRNA but with a 3 d delay. During germination, AtEm1 protein undergoes two successive cleavages before being degraded. Both proteins are more stable than the corresponding mRNA. The gene can be activated by the basic leucine zipper transcription factor ABI5. Expressed predominantly in provascular tissues with the strongest expression in the root tip. |
| AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
| AT1G02820 | Late embryogenesis abundant 3 (LEA3) family protein;(source:Araport11) |
| AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
| AT1G52690 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G63090 | Involved in lateral organ development |
| AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
| AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
| AT4G38360 | LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways. |
| AT3G05500 | Encodes a protein that associates with lipid droplet surfaces and shares sequence homology with family of small rubber particle proteins. The mRNA is cell-to-cell mobile. |
| AT5G38210 | Protein kinase family protein;(source:Araport11) |
| AT1G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G66930 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G51410 | LUC7 N terminus domain-containing protein;(source:Araport11) |
| AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
| AT1G12040 | encodes a a chimeric leucine-rich repeat/extensin protein that regulates root hair morphogenesis and elongation. Null mutants develop root hairs that frequently abort, swell, or branch. Gene is expressed in root hair cells and protein is specifically localized in the wall of the hair proper. The mRNA is cell-to-cell mobile. |
| AT4G22880 | encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation. |
| AT2G24200 | Cytosol aminopeptidase family protein;(source:Araport11) |
| AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
| AT2G32700 | Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion and mediates aluminium sensitivity through PECTIN METHYLESTERASE46-modulated root cell wall pectin methylesterification. |
| AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
| AT2G40100 | Lhcb4:3 protein (Lhcb4.3, light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT5G64813 | The LIP1 gene encodes a small GTPase that influences the light input pathway of the plant circadian network. An MBP:LIP1 fusion protein has GTP hydrolyzing abilities in vitro. In plants, LIP1 seems to play a negative role in regulating circadian period that can be suppressed by light. LIP1 also seems to negatively affect light-pulse-dependent resetting of the clock, especially during the first portion of the subjective evening. LIP1 expression levels are not significantly affected by the circadian clock in seedlings grown under LL conditions. The levels of the YFP:LIP1 protein expressed under the control of the 35S promoter, shows a low amplitude variation, with protein levels peaking near the beginning of subjective night under LL conditions. In hypocotyl epidermal cells of dark and light-grown seedlings, a YFP:LIP1 fusion protein can be seen in the cytoplasm and the nucleus, and does not cluster in nuclear speckles. LIP1 may also be involved in photomorphogenesis. The mRNA is cell-to-cell mobile. |
| AT3G23290 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
| AT1G76570 | Chlorophyll A-B binding family protein;(source:Araport11) |
| AT2G20130 | like COV 1;(source:Araport11) |
| AT1G43130 | like COV 2;(source:Araport11) |
| AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
| AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT5G66450 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon2) and LPPepsilon1, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT2G15050 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G51600 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
| AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile. |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT2G36307 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
| AT2G30340 | Lateral Organ Boundaries domain protein. LOB13 promotes lateral root formation. |
| AT2G31310 | LOB domain-containing protein 14;(source:Araport11) |
| AT2G40470 | LOB-domain containing protein. Involved in regulation of xylem differentiation- acts as a regulator of VND7 which is a master regulator of xylem cell differentiation. |
| AT2G45410 | LOB domain-containing protein 19;(source:Araport11) |
| AT3G26660 | LOB domain-containing protein 24;(source:Araport11) |
| AT3G27650 | LOB domain-containing protein 25;(source:Araport11) |
| AT3G27940 | LOB domain-containing protein 26;(source:Araport11) |
| AT5G35900 | LOB domain-containing protein 35;(source:Araport11) |
| AT1G67100 | LOB domain-containing protein 40;(source:Araport11) |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
| AT1G10920 | Encodes LOV1, a disease susceptibility gene that, paradoxically, is a member of the NBS-LRR resistance gene family. Conditions susceptibility to the fungus Cochliobolus victoriae and victorin-dependent induction of defense-associated proteins. Saturation mutagenesis identified 59 lov mutations that all display reduced susceptibility to vitorin. Mutations in known defense response pathways do not prevent susceptibility to C. victoriae. |
| AT5G19080 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
| AT5G26860 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. The mRNA is cell-to-cell mobile. |
| AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT3G05780 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT2G37210 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950. |
| AT3G53450 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G03270 | lysine decarboxylase family protein;(source:Araport11) |
| AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
| AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
| AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
| AT4G25560 | LAF1 is a R2R3-MYB transcription factor and positive regulator of the phyA photoresponse. Interaction of LAF1 with HFR1 stabilize the proteins against ubiquitination by COP1(AT2G32950) and subsequent degrations. Mutants have an elongated hypocotyl specifically under far-red light but retain wild-type responses to other light wavelengths. |
| AT2G47240 | Encodes an acyl-CoA synthetase that acts on long-chain and very-long-chain fatty acids, involved in cuticular wax and cutin biosynthesis The mRNA is cell-to-cell mobile. |
| AT1G64400 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G23850 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT5G15580 | Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function. |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G02910 | Mutants defective in this gene were shown to have a reduced PSII content (overall reduction in the levels of several PSII subunits) and a disrupted grana stack structure. The N-terminal half of the protein contains two tetratricopeptide repeat (TPR) motifs that are arranged tandemly, each consisting of a 34-residue degenerate consensus sequence. The N-terminal sequence is rich in positive and hydroxylated amino acid residues. |
| AT5G48905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G11760 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G29273 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G29285 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G13095 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G23167 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G14935 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G42473 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G12465 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G47077 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G20208 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30067 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G75830 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT2G02135 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G38330 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT2G14365 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
| AT4G21610 | Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains. |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
| AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
| AT5G40780 | Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. |
| AT2G17120 | Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsCEBiP. |
| AT3G01840 | Encodes a putative LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it was determined to be a pseudo kinase since lack of the ATP-binding P-loop in the kinase domain. |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G33580 | Encodes a putative LysM-containing receptor-like kinase. LYK5 is a major chitin receptor and forms a chitin-induced complex with related kinase CERK1. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G45670 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 20:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
| AT5G65080 | Is upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported. |
| AT4G28580 | Transmembrane magnesium transporter that induces Mg transport from tapetum cell to locule. One of nine family members. Functions in pollen development. |
| AT2G04865 | Encodes a nuclear localized aminotransferase-like protein containing a plant mobile domain. The mRNA is cell-to-cell mobile. |
| AT1G48120 | Encodes a nuclear localized aminotransferase-like protein containing a plant mobile domain. |
| AT1G17930 | Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing. |
| AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT1G68990 | MGP3 (male gametophyte-defective 3) belongs to a small family of nuclear-encoded Phage type RNA polymerases (RPOTs) involved in the transcription of mitochondrial genes in Arabidopsis thaliana. Mutation in MGP 3 significantly retarded pollen tube growth and caused defective embryo development. |
| AT1G66170 | Encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to nuclear euchromatin specifically during diplotene. Required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. |
| AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
| AT4G20900 | Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein. |
| AT1G72250 | Malectin domain kinesin. |
| AT2G22610 | Malectin domain kinesin. Possible role in cell division, with a possible secondary function in the nuclei. |
| AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
| AT5G43710 | Glycosyl hydrolase family 47 protein;(source:Araport11) |
| AT3G59790 | Encodes a member of the MAP Kinase family. Thought to be a pseuedogene, MAPK10 is expressed very transiently during germination and in the leaf tips/hydathodes. Loss of function mutations are late flowering in long days and exhibit abnormal patterning of cotyledon veins. MPK10 interacts with and may be regulated by MPKK2 another map kinase. |
| AT1G01560 | Member of MAP Kinase family. Flg22-induced activation is blocked by AvrRpt2. |
| AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
| AT4G01370 | Encodes a nuclear and cytoplasmically localized MAP kinase involved in mediating responses to pathogens. Its substrates include MKS1 and probably MAP65-1.The MAP65-1 interaction is involved in mediating cortical microtuble organization. Required for male-specific meiotic cytokinesis. The mRNA is cell-to-cell mobile. |
| AT2G43790 | Encodes a MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress.Also involved in ovule development. Homozygous mutants in a MPK3 heterozygous background are female sterile due to defects in integument development.MPK6 appears to be associated with the microsomal compartment and may be involved in mediating secretory processes. The mRNA is cell-to-cell mobile. |
| AT4G29810 | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT3G21220 | Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggesting a role for both proteins in mediating floral organ abscission.MKK5 is part of a positive feedback loop that regulates HAE expression in floral receptacles. |
| AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
| AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
| AT4G26070 | Member of MAP Kinase Kinase. Likely functions in a stress-activated MAPK pathway. Can phosphorylate the MAPK AtMPK4, in response to stress. Gets phosphorylated by MEKK1 in response to wounding. |
| AT1G15400 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT4G08470 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. |
| AT5G11850 | MAP3 kinase involved phosphorylation of a critical Ser171 for OST1/SnRK2.6 activation. |
| AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34090 | maternal effect embryo arrest 18;(source:Araport11) |
| AT2G34790 | Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. |
| AT2G34870 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G46330 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G13610 | DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT3G59350 | Pti-like protein. Interacts with CLV1 and functions in CLE peptide signaling pathway in root development. Membrane localization is dependent on palmytolation. |
| AT4G08850 | MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated. |
| AT5G19520 | mechanosensitive channel of small conductance-like 9;(source:Araport11) |
| AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
| AT5G38990 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39020 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G07290 | AML4 A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML4 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM14. AML4 is expressed during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
| AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
| AT5G52240 | Encodes a protein with similarity to progesterone-binding proteins in animals. Has been shown to bind steroids in vitro. Expressed in aerial portions of the plant excluding mature flowers and siliques. Antisense experiments suggest a role in inhibition of hypocotyl cell elongation. Expression is suppressed light grown seedlings transferred to the dark. The mRNA is cell-to-cell mobile. |
| AT5G15460 | membrane-anchored ubiquitin-fold protein 2;(source:Araport11) |
| AT3G26980 | membrane-anchored ubiquitin-fold protein 4 precursor;(source:Araport11) |
| AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52870 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. The mRNA is cell-to-cell mobile. |
| AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
| AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
| AT5G11880 | Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway. |
| AT4G25110 | Encodes a type I metacaspase. Two Arabidopsis metacaspases, AT1G02170 (MC1) and AT4G25110 (MC2) antagonistically control programmed cell death in Arabidopsis. MC1 is a positive regulator of cell death and requires conserved caspase-like putative catalytic residues for its function. MC2 negatively regulates cell death. This function is independent of the putative catalytic residues. A third type I Arabidopsis metacaspase is MC3 (AT5g64240). |
| AT1G79320 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT1G79310 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT3G12100 | Cation efflux family protein;(source:Araport11) |
| AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
| AT3G25740 | Encodes a plastid localized methionine aminopeptidase. Formerly called MAP1C, now called MAP1B. |
| AT2G44180 | Encodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci. |
| AT2G18030 | Peptide methionine sulfoxide reductase family protein;(source:Araport11) |
| AT4G21830 | methionine sulfoxide reductase B7;(source:Araport11) |
| AT4G21840 | methionine sulfoxide reductase B8;(source:Araport11) |
| AT3G03780 | Encodes a cytosolic methionine synthase, involved in methionine regeneration via the activated methyl cycle (or SAM cycle) |
| AT5G20980 | Encodes a plastidic methionine synthase, involved in methionine de novo synthesis in the chloroplast |
| AT1G26360 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT1G33990 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT2G23550 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT4G00416 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT2G44160 | methylenetetrahydrofolate reductase MTHFR2 mRNA, complete The mRNA is cell-to-cell mobile. |
| AT1G11580 | methylesterase PCR A;(source:Araport11) |
| AT1G18500 | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). The mRNA is cell-to-cell mobile. |
| AT5G49160 | Encodes a cytosine methyltransferase MET1. Required for silencing of FWA paternal allele in endosperm. Two lines with RNAi constructs directed against DMT1 have reduced agrobacterium-mediated tumor formation. The mRNA is cell-to-cell mobile. |
| AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
| AT2G39175 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160a (converted to TAIR10 based on PMID19304749): Chr2: 16339853-16341886 (forward), length: 2034 bp; exon coordinates: exon 1: 16339853 to 16340469, exon 2: 16341621 to 16341886; mature miRNA and miRNA* are located on exon 1. |
| AT5G01747 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA |
| AT1G01183 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC. Accumulation of the pri-miRNA165a transcript is increased by the activity of the miPEP165 peptide which is encoded within the pri-miRNA165a transcript. |
| AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
| AT5G08717 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
| AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
| AT3G63375 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUA |
| AT5G45307 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT1G19371 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
| AT3G11435 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
| AT3G23125 | Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC |
| AT2G38325 | Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC |
| AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
| AT2G34208 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. Also modulates plant responses to salt, ABA, and drought. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAUUUGCCCGG |
| AT4G03455 | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG |
| AT2G41616 | Encodes a microRNA that targets several SET domain-containing genes including SUVH6. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGCUUGGUUUAUGUACACCG |
| AT2G22496 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUGCUAUGUUGCUGCUCAU |
| AT4G14811 | Encodes a microRNA that targets CHX18. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCUUCGUGAAUAUCUGGCA |
| AT3G59884 | Encodes a microRNA that targets several SPX C3HC4 RING zinc finger family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUAGAUGACCAUCAACAAACU |
| AT1G32713 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CAAAUUAAAGCUUCAAGGUAG |
| AT2G02741 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACACUGAAGGACCUAAACUAAC |
| AT4G14504 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AAGAUAAGCGCCUUAGUUCUGA |
| AT4G13494 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU |
| AT5G39693 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUGGUGUUGAGAUAGUUGAC |
| AT2G35630 | Member of the MAP215 family of microtubule-associated proteins required to establish interphase arrays of cortical microtubules.Mutants have defects in cytokinesis during pollen development. Vegetative phenotypes observed in temperature sensitive mutants include left-handed organ twisting, isotropic cell expansion and impairment of root hair polarity. The mRNA is cell-to-cell mobile. |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT4G26760 | microtubule-associated protein 65-2;(source:Araport11) |
| AT5G55230 | Binds and bundles microtubules. Plays a role in stabilizing anti-parallel microtubules in the central spindle at anaphase to early cytokinesis but is not essential at the midline of the phragmoplast at later stages. The timing with which the MAP65-1 was targeted to the spindle appears to be regulated by a phosphorylation sensitive switch. Enhances microtubule polymerization, promotes nucleation and stabilizes microtubules against cold treatment and dilution. |
| AT2G01750 | Encodes a microtubule associated protein (MAP70-3). Expressed in all tissues. |
| AT1G14840 | Encodes a microtubule associated protein (MAP70-4). Expressed in all tissues. |
| AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
| AT5G65970 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO10 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO9. The gene is expressed in root and cotyledon vascular system, in root-shoot junction and lateral root primordia and in developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G26700 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
| AT3G45290 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO3 belongs to the clade IV, with AtMLO2, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in primary root and lateral root primordia, in fruit abscission zone, in vascular system of cotyledons and in trichomes of young leaves,; it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G11000 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO4 belongs to the clade I, with AtMLO11 and AtMLO14. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of root, cotyledons and young leaves, it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G17480 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO8 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO9, and AtMLO10. The gene is expressed during seedling growth, in cotyledons and hypocotyl, and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
| AT5G46280 | Involved in the replication of mungbean yellow mosaic India virus (MYMIV) DNA through an ex vivo system. |
| AT3G14395 | Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones. |
| AT1G65290 | Encodes a member of the mitochondrial acyl carrier protein (ACP) family that forms part of the membrane arm of mitochondrial complex and contributes to the mitochondrial respiratory chain. The mRNA is cell-to-cell mobile. The designations of mtACP-1 and mtACP-2 in Klusch et al. 2021 (DOI:10.1093/plcell/koab092)are flipped with respect to the nomenclature published by Meyer et al. 2007 (DOI:10.1007/s11103-007-9156-9). |
| AT1G09575 | Mitochondrial calcium channel. |
| AT1G66345 | Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I. |
| AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
| AT3G09040 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G30700 | Encodes a pentatricopeptide repeat protein involved in mitochondrial RNA editing. |
| AT1G74120 | Encodes a mitochondrial transcription termination factor mTERF15. Required for mitochondrial nad2 intron 3 splicing and functional complex I activity. |
| AT5G64950 | mTERF family protein which functions in the regulation of mtDNA transcription. |
| AT4G25200 | AtHSP23.6-mito mRNA, nuclear gene encoding mitochondrial |
| AT5G42130 | Encodes a protein belonging to the mitochondrial carrier family and similar to animal mitoferrin but likely NOT to be located in the mitochondria, but rather in chloroplasts. It is likely to be involved in transporting iron into the chloroplast. |
| AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. The mRNA is cell-to-cell mobile. |
| AT1G59580 | encodes a mitogen-activated kinase involved in innate immunity The mRNA is cell-to-cell mobile. |
| AT5G40440 | Encodes a mitogen-activated protein kinase kinase. Activates MPK8 and is a target of MPKKK20. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
| AT1G51660 | Encodes a mitogen-activated map kinase kinase (there are nine in Arabidopsis) involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK5. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggestion a role for both proteins in mediating floral organ abscission. The mRNA is cell-to-cell mobile. |
| AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT5G55090 | member of MEKK subfamily |
| AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT5G66850 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
| AT4G30870 | Encodes an Arabidopsis homolog of the endonuclease MSU81. T-DNA insertion lines of AtMSU81 have a deficiency in homologous recombination in somatic cells but only after genotoxic stress. Crosses with a hyperrecombinogenic mutant of the AtRecQ4A helicase resulted in synthetic lethality in the double mutant. Involved in DNA-Protein crosslink (DPC) repair in independent pathways to WSS1A and TDP1. |
| AT1G54030 | Encodes a vacuolar protein. Mutation causes organizational defects in the endoplasmic reticulum and aberrant protein trafficking in the plant secretory pathway. The mRNA is cell-to-cell mobile. |
| AT5G05680 | Encodes MOS7 (Modifier of snc1,7), homologous to human and Drosophila melanogaster nucleoporin Nup88. Resides at the nuclear envelope. Modulates the nuclear concentrations of certain defense proteins regulates defense outputs. |
| AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT2G28390 | SAND family protein;(source:Araport11) |
| AT4G31780 | Encodes an A-type monogalactosyldiacylglycerol (MGDG) synthase. It represents the isoform responsible for the bulk of MGDG synthesis in Arabidopsis. |
| AT2G26840 | Encodes a Holliday junction resolvase that binds and cleaves the core of Holliday junctions symmetrically. It appears to mediate chloroplast nucleoid segregation during chloroplast division. |
| AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
| AT4G15670 | Encodes a member of the CC-type glutaredoxin (ROXY) family. |
| AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. The mRNA is cell-to-cell mobile. |
| AT1G02740 | MRG1 and MRG2 proteins act as readers of H3K4me3/H3K36me3 marked chromatin. They interact with each other as well as several other protein classes, to modulate the activity of flowering genes. |
| AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G33340 | Encodes MAC3B, a U-box proteins with homology to the yeast and human E3 ubiquitin ligase Prp19. Associated with the MOS4-Associated Complex (MAC). Involved in plant innate immunity. Regulator of flowering time. |
| AT2G33780 | VQ motif-containing protein;(source:Araport11) |
| AT4G14605 | Encodes a putative mitochondrial transcription termination factor whose mutation results in plants that exhibit altered chloroplast morphology and plant growth, and reduced pigmentation of cotyledons, leaves, stems and sepals. |
| AT1G53480 | Encodes MRD1 (mto 1 responding down). Down-regulated in mto1-1 mutant that over-accumulates soluble methionine. |
| AT1G53500 | encodes a putative NDP-L-rhamnose synthase, an enzyme required for the synthesis of the pectin rhamnogalacturonan I, the major component of Arabidopsis mucilage. Gene is involved in seed coat mucilage cell development. Mutant analyses suggest that MUM4 is required for complete mucilage synthesis, cytoplasmic rearrangement and seed coat development. |
| AT2G16780 | Encodes a WD-40 repeat protein similar to yeast MSI1. |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G44780 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT2G35240 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
| AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores. |
| AT4G36180 | LRR-RLK which regulates lateral root development. |
| AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT3G05850 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT3G24320 | Encodes a DNA binding protein that promotes re-arrangements of mitochondrial genome. Mutations affects mitochondrial gene expression, and impairs mitochondrial function. Dual targeting of the protein to mitochondria and chloroplasts caused by alternative translation initiation. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity. |
| AT4G09140 | Encodes a protein with similarity to Mut1 DNA mismatch repair protein, from E.coli. The protein is expressed during prophase I of meiosis, colocalizes with MLH3 throughout pachytene and is dependent on MLH3 for proper localization. |
| AT4G02070 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. |
| AT3G09230 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT3G12820 | Member of the R2R3 factor gene family. |
| AT2G25230 | Encodes a putative transcription factor (MYB100). |
| AT1G69560 | Encodes LOF2 (LATERAL ORGAN FUSION2), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF1 (At1g26780). |
| AT3G02940 | Encodes a putative transcription factor (MYB107). |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
| AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT5G49330 | Member of the R2R3 factor gene family. Together with MYB11 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT1G25340 | putative transcription factor (MYB116) |
| AT2G47460 | MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. |
| AT1G74080 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB122). |
| AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
| AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
| AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
| AT5G40430 | Encodes a putative transcription factor (MYB22). |
| AT5G40330 | Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1. |
| AT2G39880 | Encodes a putative transcription factor (MYB25). |
| AT3G53200 | Member of the R2R3 factor gene family. |
| AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT3G24310 | snapdragon myb protein 305 homolog (myb) |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
| AT3G09370 | C-myb-like transcription factor (MYB3R3) mRNA. It is a target of CDK phosphorylation and blocks cell division in response to DNA damage. |
| AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
| AT4G28110 | Member of the R2R3 factor gene family. Expression is induced in response to desiccation, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion. |
| AT3G48920 | Member of the R2R3 factor gene family. |
| AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
| AT3G18100 | Member of the R2R3 transcription factor gene family. |
| AT1G18570 | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile. |
| AT3G01530 | Member of the R2R3 factor gene family.MYB57 interacts with JAZ proteins, and functions redundantly with MYB21 and MYB24 to regulate stamen development. Promote flavonol biosynthesis through regulation of FLS1 gene expression. |
| AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
| AT1G79180 | Member of the R2R3 factor gene family. |
| AT5G11050 | Member of R2R3-MYB transcription factor gene family. |
| AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
| AT5G14750 | Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC). |
| AT3G12720 | Member of the R2R3 factor gene family. |
| AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT5G52600 | Encodes a nuclear-localized transcription activator that is a member of the R2R3 factor gene family. MYB82 and GL1 can form homodimers and heterodimers at R2R3-MYB domains. At least one of the two introns in MYB82 is essential to the protein?s trichome developmental function. |
| AT3G08500 | Encodes a putative R2R3-type MYB transcription factor (MYB83). |
| AT3G49690 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation. |
| AT5G26660 | myb domain protein 86;(source:Araport11) |
| AT4G37780 | encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family. |
| AT5G10280 | Encodes a putative transcription factor (MYB92). |
| AT3G47600 | Encodes a putative transcription factor (MYB94). |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
| AT5G62320 | Encodes a putative transcription factor (MYB99). |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT5G47390 | Encodes a circadian-regulated transcription factor which specifically controls cell expansion during leaf development by controlling ROS homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
| AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. The mRNA is cell-to-cell mobile. |
| AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
| AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
| AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
| AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
| AT5G43900 | Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner. |
| AT1G04600 | member of Myosin-like proteins |
| AT3G10550 | Has 3'-phosphatase activity against both phosphatidylinositol-3,5-bisphosphate (PtdIns3,5P2) and Phosphatidylinositol-3-phosphate (PtdIns3P). The in vitro activity was higher with PtdIns3,5P2 than with PtdIns3P. |
| AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
| AT5G66910 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.1. |
| AT5G66890 | RPW8 -CNL gene. |
| AT3G57560 | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
| AT2G05320 | beta-1,2-N-acetylglucosaminyltransferase II;(source:Araport11) |
| AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
| AT5G11790 | Plays a role in dehydration stress response. |
| AT2G44170 | pseudogene of myristoyl-CoA:protein N-myristoyltransferase;(source:Araport11) |
| AT1G80410 | Encodes the catalytic subunit of a N-terminal acetyltransferase. |
| AT1G01010 | NAC domain containing protein 1;(source:Araport11) |
| AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
| AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
| AT5G66300 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
| AT5G04410 | NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile. |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT2G17040 | Member of the NAC transcription factor family and more specifically, the ONAC022 subfamily. Involved in leaf and inflorescence stem morphogenesis. The mRNA is cell-to-cell mobile. |
| AT2G24430 | NAC domain containing protein 38;(source:Araport11) |
| AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
| AT3G01600 | NAC domain containing protein 44;(source:Araport11) |
| AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
| AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
| AT5G09330 | NAC domain containing protein 82;(source:Araport11) |
| AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
| AT5G39820 | NAC domain containing protein 94;(source:Araport11) |
| AT5G07710 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G61390 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
| AT1G04280 | Encodes a mitochondrial CaM/Ca2+-dependent NAD+ kinase. |
| AT2G47490 | Encodes a chloroplast-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
| AT1G25380 | Encodes a mitochondrial-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
| AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
| AT5G21430 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G79750 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed. |
| AT4G15545 | NAI1 interacting protein, involved in ER body formation. |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT1G74560 | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP2. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination. |
| AT1G80830 | Thought to be involved in iron homeostasis. Induced in leaves in response to iron deficiency. Transgenic plants accumulate toxic levels of iron. Gene complements yeast iron uptake mutants. |
| AT3G17850 | Protein kinase which together with IRE3 plays an important role in controlling root skewing and maintaining the microtubule network. |
| AT3G11650 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus and spermine. Overexpression of the gene induces the expression of PR-1 gene and shows light-dependent 'speck disease-like' symptom on leaves. The gene product is localized to the chloroplast |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
| AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
| AT1G32340 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not detected under normal conditions and in response to cucumber mosaic virus or spermine. |
| AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
| AT1G74360 | NILR1 encodes a serine/threonine kinase involved in defense response to nematodes. |
| AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
| AT1G03080 | kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT4G24690 | Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile. |
| AT1G10170 | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT2G46870 | Member of the RAV family of DNA binding proteins. Contains B3 domain. Recognizes 5'-CACCTG-'3 motif. |
| AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT4G01500 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G04950 | Encodes a nicotianamide synthase. |
| AT5G56080 | Encodes a protein with nicotianamine synthase activity. Its transcript levels rise in roots in response to zinc deficiency and rise in leaves in response to elevated levels of zinc. |
| AT1G56430 | Encodes a protein with nicotianamine synthase activity. |
| AT2G23420 | nicotinate phosphoribosyltransferase 2;(source:Araport11) |
| AT3G13050 | Encodes a plant nicotinate transporter than can also transport trigonelline (N-methylnicotinate). |
| AT1G42470 | Patched family protein;(source:Araport11) |
| AT3G54500 | Member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK2 along with LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex. Functions as a transcriptional coactivator. |
| AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT3G12200 | Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
| AT1G20640 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT4G19170 | Encodes a chloroplast-targeted member of a family of enzymes similar to nine-cis-epoxycarotenoid dioxygenase that acts as a major regulator of carotenoid degradation during dark-induced leaf senescence.. The mRNA is cell-to-cell mobile. |
| AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT1G37130 | Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940. The mRNA is cell-to-cell mobile. |
| AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
| AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT2G15620 | Involved in the second step of nitrate assimilation. Its expression is induced by nitrate. The mRNA is cell-to-cell mobile. |
| AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
| AT2G43040 | encodes a calmodulin-binding protein that is expressed specifically in pollen and is required for pollen development. |
| AT1G08300 | no vein-like protein;(source:Araport11) |
| AT4G18910 | Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT1G31885 | NOD26-like intrinsic protein 3;(source:Araport11) |
| AT5G37820 | NOD26-like intrinsic protein 4;(source:Araport11) |
| AT1G80760 | Encodes a protein with boron transporter activity. It helps to preferentially direct boron to young developing tissues in the shoot, such as immature leaves, under low boron conditions. This boron channel appears to be impermeable to water, unlike the closely related NIP5;1 boron transporter. This protein also allows the transport of glycerol, urea, and formimide but not larger uncharged solutes such as arabitol and sucrose when it is expressed heterologously. |
| AT4G19030 | an aquaporin whose expression level is reduced by ABA, NaCl, dark, and desiccation. is expressed at relatively low levels under normal conditions. Also functions in arsenite transport and tolerance. |
| AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
| AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT3G20600 | Required for non-race specific resistance to bacterial and fungal pathogens.Mediates systemic acquired resistance (SAR) response. The mRNA is cell-to-cell mobile. |
| AT5G20730 | Encodes an auxin-regulated transcriptional activator. Activates expression of IAA1 and IAA9 in the presence of auxin. Mutants affect blue light and gravitropic and auxin mediated growth responses. Together with AUX19, it is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
| AT1G07230 | non-specific phospholipase C1;(source:Araport11) |
| AT3G03540 | Encodes a nonspecific phospholipase C. Located in the cytosol. Involved in the conversion of phospholipids to glycolipids under phosphate deprivation conditions. |
| AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT1G64280 | This gene is a key regulator of the salicylic acid (SA)-mediated systemic acquired resistance (SAR) pathway. It is similar to the transcription factor inhibitor I kappa B, and contains ankyrin repeats. It confers resistance to the pathogens Pseudomonas syringae and Peronospora parasitica in a dosage-dependent fashion. Although transgenic Arabidopsis plants overexpressing NPR1 acquire enhanced sensitivity to SA and (benzothiadiazole) BTH, they display no obvious detrimental morphological changes and do not have elevated pathogenesis-related gene expression until activated by inducers or pathogens. |
| AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
| AT2G03820 | Encodes a protein involved in the nuclear export of the 60S ribosomal subunit and formation of the secondary cell wall. |
| AT2G35740 | nositol transporter 3;(source:Araport11) |
| AT1G09000 | NPK1-related protein kinase 1S |
| AT3G06030 | NPK1-related protein kinase 3 |
| AT4G19660 | Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
| AT1G15960 | member of Nramp2 family |
| AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
| AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
| AT1G72125 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72120 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
| AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT3G54140 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source |
| AT2G02020 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G13350 | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
| AT1G13400 | Along with JAG, it is involved in stamen and carpel development. Expression is limited to the adaxial side of lateral organs. Activated by AGAMOUS in a cal-1, ap1-1 background. |
| AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT5G09890 | Protein kinase family protein;(source:Araport11) |
| AT5G06510 | nuclear factor Y, subunit A10;(source:Araport11) |
| AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
| AT2G38880 | Encodes a transcription factor from the nuclear factor Y (NF-Y) family, AtNF-YB1. Confers drought tolerance. |
| AT5G47640 | Involved in the regulation of response to nutrient levels. |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT5G27910 | nuclear factor Y, subunit C8;(source:Araport11) |
| AT5G58740 | Member of the family of NudC proteins. Over-expression improves free radical sacenving activity and antioxidant status, promotes root growth and branching under abiotic stress. |
| AT1G06790 | Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III. |
| AT1G32070 | Encodes a acetyltransferase (NSI) that is localized in the nucleus and chloroplast. It interacts with the geminivirus movement protein NSP. This interaction is required for viral infection and systemic spread. Acetylates the viral coat protein (CP) in vitro, but not NSP. NSP inhibits NSI activity in vitro. In the chloroplast NSI functions in the dynamic reorganization thylakoid membrane complexes. NSI is highly transcribed in phloem and in xylem parenchyma cells, and in the apical meristem and guard cells, within young tissues in Arabidopsis, and its expression is turned off as tissues mature.Mutants have reduced melatonin and anthocyanin levels and do not accumulate the PSI-LHCII state transition complex.The protein has distinct lysine acetylation and relaxed N-terminal acetylation specificities on chloroplast proteins as determined by in vitro as well as in vivo analyses using quantitative protein mass spectrometry (PMID:32633465). |
| AT5G23140 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). This mitochondrial CLPP2 assists coordination and homeostasis of respiratory complexes. |
| AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G79150 | binding protein;(source:Araport11) |
| AT1G60420 | Reduce transmission through pollen. The mRNA is cell-to-cell mobile. |
| AT5G63310 | Maintains intracellular dNTP levels except ATP. Plays a role in response to oxidative stress and UV. Involved in phytochrome-mediated light signaling. Participates in auxin-regulated processes, partly through the modulation of auxin transport. H-bonding with His-197 inside the nucleotide-binding pocket is critical for NDPK2 functioning. |
| AT5G56950 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT4G29730 | cell cycle-related repressor genes encoding WD-repeat proteins. |
| AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
| AT1G12880 | nudix hydrolase homolog 12;(source:Araport11) |
| AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
| AT2G01670 | nudix hydrolase homolog 17;(source:Araport11) |
| AT1G14860 | nudix hydrolase homolog 18;(source:Araport11) |
| AT5G20070 | nudix hydrolase homolog 19;(source:Araport11) |
| AT5G19460 | nudix hydrolase homolog 20;(source:Araport11) |
| AT2G42070 | Encodes a plastid-localized Nudix hydrolase that has FAD pyrophosphohydrolase activity. Negative feedback regulation of the metabolism of flavins through the hydrolysis of FAD by AtNUDX23 in plastids is involved in the flavin homeostasis in plant cells. |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT5G06340 | nudix hydrolase homolog 27;(source:Araport11) |
| AT1G79690 | Encodes a dual activity enzyme which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase. |
| AT2G04430 | nudix hydrolase homolog 5;(source:Araport11) |
| AT2G04450 | Encodes a protein with NADH pyrophosphatase activity. Although this protein was also shown to have ADP-ribose diphosphatase activity in vitro, mutant analyses suggest that NUDX6 is involved in NADH metabolism in vivo. |
| AT4G14880 | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi-dominant mutations exhibit early senescence. Required for pollen tube growth and/or fertilization. |
| AT3G22460 | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity. |
| AT2G43750 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasB, the key enzyme for fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Required for pollen tube growth and/or fertilization. |
| AT3G59760 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization. |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
| AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT5G06960 | Encodes a basic leucine zipper (B-ZIP) containing protein that interacts with NPR1 to promote expression of salicylic acid induced genes. Binds the ocs-element. |
| AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
| AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
| AT1G05510 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
| AT5G55930 | oligopeptide transporter |
| AT4G10770 | oligopeptide transporter |
| AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
| AT5G53510 | oligopeptide transporter |
| AT1G17370 | Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA. |
| AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
| AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
| AT5G65620 | Zincin-like metalloproteases family protein;(source:Araport11) |
| AT1G31010 | organellar single-stranded DNA binding protein 4;(source:Araport11) |
| AT1G73530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
| AT5G59200 | Encodes a chloroplast RNA editing factor. |
| AT3G57430 | Encodes a chloroplast RNA editing factor. |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT2G35720 | Encodes OWL1, a J-domain protein involved in perception of very low light fluences. |
| AT4G12620 | Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime. |
| AT5G16690 | Origin Recognition Complex subunit 3. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with all ORC subunits except ORC1b. |
| AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
| AT1G13170 | OSBP(oxysterol binding protein)-related protein 1D;(source:Araport11) |
| AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
| AT5G59420 | OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11) |
| AT1G28120 | Deubiquitinase with preference towards M1 and K48 linkages. |
| AT1G16000 | Member of the Arabidopsis 7-kDa OEP family. Tail-anchored (TA) membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
| AT5G04820 | ovate family protein 13;(source:Araport11) |
| AT2G36050 | ovate family protein 15;(source:Araport11) |
| AT2G32100 | ovate family protein 16;(source:Araport11) |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT3G52540 | ovate family protein 18;(source:Araport11) |
| AT1G06920 | Encodes OFP4, a member of the plant specific ovate family proteins. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. OFP4 interacts with KNAT7 to regulate secondary cell wall formation. |
| AT5G19650 | Transcriptional repressor of KNOX family transcription factors. Encodes pluripotency and stemness, upregulated in LRP cells. |
| AT2G20330 | DDB1-CUL4 ASSOCIATED FACTOR (DCAF) protein. |
| AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
| AT1G25350 | glutamine-tRNA ligase, putative / glutaminyl-tRNA synthetase, putative / GlnRS;(source:Araport11) |
| AT4G39870 | TLD-domain containing nucleolar protein;(source:Araport11) |
| AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
| AT1G12480 | Encodes a membrane protein with 10 predicted transmembrane helices. SLAC1 is a multispanning membrane protein expressed predominantly in guard cells that plays a role in regulating cellular ion homeostasis and S-type anion currents. SLAC1 is important for normal stomatal closure in response to a variety of signals including elevated CO2, ozone, ABA, darkness, and humidity. SLAC1:GFP localizes to the plasma membrane. |
| AT4G24520 | Encodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism. |
| AT4G30210 | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. The mRNA is cell-to-cell mobile. |
| AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT3G28857 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT1G80190 | Similar to the PSF1 component of GINS complex, which in other organism was shown to be involved in the initiation of DNA replication. |
| AT5G10480 | Protein tyrosine phosphatase-like involved in cell division and differentiation. Interacts with CDKA;1 only in its phosphorylated form, preventing dephosphorylation. Overexpression slowed down cell division in suspension cell cultures at the G2-to-M transition and early mitosis and inhibited Arabidopsis seedling growth. Localized in the cytoplasm of dividing cells but moved into the nucleus upon cell differentiation. Based on complementation of yeast mutant PAS2 has acyl-CoA dehydratase activity. It interacts with CER10, a component of the microsomal fatty acid elongase complex, suggesting a role in synthesis of VLCFAs (very long chain fatty acids). |
| AT4G14990 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
| AT4G37060 | Patatin-related phospholipase A. Expressed weakly in roots, cotyledons, and leaves but is transcriptionally induced by auxin. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
| AT2G39220 | Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus. |
| AT4G29800 | PATATIN-like protein 8;(source:Araport11) |
| AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
| AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT1G22530 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT1G11810 | Paternally expressed gene. |
| AT1G75040 | Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment. The mRNA is cell-to-cell mobile. |
| AT2G19990 | Encodes a PR-1-like protein homolog that is differentially expressed in resistant compared to susceptible cultivars by powdery mildew infection. The deduced amino acid sequence has 24 amino acids comprising the signal peptide and 140 amino acids of the mature peptide (15 kDa). Northern blot analysis showed accumulation of the corresponding mRNA 12 h after inoculation of resistant barley cultivars with Erysiphe graminis. Though the Genbank record for the cDNA associated to this gene model is called 'PR-1', the sequence actually corresponds to PR-1-like. Expression of this gene is not salicylic-acid responsive. |
| AT5G12360 | Encodes a protein that protects meiotic centromere cohesion. |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT5G03320 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G06370 | PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway. |
| AT3G55450 | PBS1-like 1;(source:Araport11) |
| AT2G07180 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
| AT4G17660 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G01020 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G04885 | Encodes PCFS4 (Pcf11p-similar protein 4), a homolog of yeast polyadenylation factor Protein 1 of Cleavage Factor (Pcf11p). Regulates FCA (AT4G16280) mRNA polyadenylation. Promotes flowering time. |
| AT1G77510 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner. |
| AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT5G60640 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). However, the level of transcripts for this gene is slightly elevated in atbzip60 mutants. |
| AT3G16110 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G09405 | Pectinacetylesterase family protein;(source:Araport11) |
| AT3G09410 | Pectinacetylesterase family protein;(source:Araport11) |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT1G53840 | encodes a pectin methylesterase |
| AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G00190 | pectin methylesterase 38;(source:Araport11) |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
| AT1G17750 | Encodes PEPR2, a plasma membrane leucine-rich repeat receptor kinase functioning as a receptor for the Pep1 and Pep2 peptides. Pep1 and Pep2 are amino acids that induce the transcription of defense-related genes. |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT5G07460 | ubiquitous enzyme that repairs oxidatively damaged proteins. Methionine sulfoxide reductase activity. Mutant lacking reductase activity showed increased protein oxidation, nitration and glycation of specific amino acid residues during darkness. |
| AT1G31050 | Together with PFA2 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
| AT4G08770 | Encodes a putative apoplastic peroxidase Prx37. Primarily expressed in the vascular bundles. Overexpression renders a dwarf phenotype with smaller plants and delayed development. Plants overexpressing Prx37 also shows an increase in the amount of esterified phenolic material associated with their walls. |
| AT4G11290 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
| AT5G64120 | Encodes a cell wall bound peroxidase that is induced by hypo-osmolarity and is involved in the lignification of cell walls. Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT5G66390 | Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
| AT1G65990 | type 2 peroxiredoxin-related / thiol specific antioxidant / mal allergen family protein;(source:Araport11) |
| AT1G06530 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR2. Involved in mitochondrial morphogenesis. |
| AT5G14520 | Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression. |
| AT2G37040 | Encodes PAL1, a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT4G39230 | encodes a protein whose sequence is similar to phenylcoumaran benzylic ether reductase (PCBER), which catalyzes NADPH-dependent reduction of 8-5' linked lignans such as dehydrodiconiferyl alcohol to give isodihydrodehydrodiconiferyl alcohol. |
| AT2G26820 | phloem protein 2-A3;(source:Araport11) |
| AT5G45090 | phloem protein 2-A7;(source:Araport11) |
| AT5G45070 | phloem protein 2-A8;(source:Araport11) |
| AT1G56250 | Encodes an F-box protein that can functionally replace VirF, regulating levels of the VirE2 and VIP1 proteins via a VBF-containing SCF complex. It is thought to be involved in DNA integration and T-DNA degradation. |
| AT2G02310 | phloem protein 2-B6;(source:Araport11) |
| AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
| AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT5G23630 | A member of the eukaryotic type V subfamily (P5) of P-type ATPase cation pumps; MIA is most similar to the human P5 ATPase ATY2(44% identity) and to Spf1p from S. cerevisiae (41% identity). Highly abundant in the endoplasmic reticulum and small vesicles of developing pollen grains and tapetum cells. T-DNA insertional mutants of MIA suffer from imbalances in cation homeostasis and exhibit a severe reduction in fertility. Mutant microspores fail to separate from tetrads and pollen grains are fragile with an abnormal morphology and altered cell wall structure. MIA is also named PDR2 and was shown to be required for proper expression of SCARECROW (SCR), a key regulator of root patterning, and for stem-cell maintenance in Pi-deprived roots. |
| AT5G43360 | Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G20860 | Encodes Pht1;8, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT2G29650 | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. |
| AT1G35140 | EXL1 is involved in the C-starvation response. Phenotypic changes of an exl1 loss of function mutant became evident only under corresponding experimental conditions. For example, the mutant showed diminished biomass production in a short-day/low light growth regime, impaired survival during extended night, and impaired survival of anoxia stress. |
| AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
| AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
| AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT1G21980 | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
| AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. The mRNA is cell-to-cell mobile. |
| AT3G07960 | Encodes phosphatidylinositol-4-phosphate 5-kinase 6 (PIP5K6). Regulates clathrin-dependent endocytosis in pollen tubes. |
| AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
| AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
| AT4G16700 | Encodes a mitochondrial phosphatidylserine decarboxylase. Expressed mainly in roots and flowers. |
| AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
| AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
| AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile. |
| AT1G12580 | phosphoenolpyruvate carboxylase-related kinase 1;(source:Araport11) |
| AT1G12680 | phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11) |
| AT1G48600 | Encodes a phosphoethanolamine N-methyltransferase that catalyses the last two methylation steps of the three sequential methylations of phosphoethanolamine (PEA) that are required for the synthesis of phosphocholine (PCho) in plants. |
| AT1G17710 | Encodes a phosphoethanolamine/phosphocholine phosphatase. It is likely to be involved in the liberation of inorganic phosphate from intracellular sources. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT4G26270 | phosphofructokinase 3;(source:Araport11) |
| AT1G79550 | Encodes cytosolic phosphoglycerate kinase (PGK3). Expression studies in PGK mutants showed that PGK1 and PGK3 were down-regulated in pgk3.2 and pgk1.1, respectively. These results indicate that the down-regulation of photosynthetic activity could be a plant strategy when glycolysis is impaired to achieve metabolic adjustment and optimize growth. |
| AT2G40850 | phosphoinositide 4-kinase gamma 1;(source:Araport11) |
| AT2G26560 | Encodes a lipid acyl hydrolase with wide substrate specificity that accumulates upon infection by fungal and bacterial pathogens. Protein is localized in the cytoplasm in healthy leaves, and in membranes in infected cells. Plays a role in cell death and differentially affects the accumulation of oxylipins. Contributes to resistance to virus. |
| AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT3G55940 | Phospholipase C family member. Double mutants with PLC5 show defects in seed coat mucilage, leaf serration and over-expression improves drought tolerance. |
| AT1G13680 | Encodes a phospholipase C-like protein that serves as a convergence point for fumonisin B1 and extracellular ATP signalling, and functions in Arabidopsis stress response to fumonisin B1. |
| AT5G58670 | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). |
| AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
| AT4G00240 | member of C2-PLD subfamily |
| AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT1G04010 | phospholipid sterol acyl transferase 1;(source:Araport11) |
| AT1G10700 | Encodes a P-independent phosphoribosyl pyrophosphate (PRPP) synthase. |
| AT2G32260 | phosphorylcholine cytidylyltransferase;(source:Araport11) |
| AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT2G47590 | photolyase/blue light photoreceptor PHR2 (PHR2) mRNA, |
| AT3G12810 | Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile. |
| AT3G47390 | Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant. |
| AT1G25520 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT1G68650 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT2G39470 | PsbP-like protein 2;(source:Araport11) |
| AT4G39710 | FK506-binding protein 16-2;(source:Araport11) |
| AT3G54890 | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
| AT1G03130 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT4G12800 | Encodes subunit L of photosystem I reaction center. |
| AT1G67740 | PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts where it is processed into two integral membrane proteins with identical topology (PsbY-1 and PsbY-2). The protein appears to bind manganese. Important for the redox control of cytochrome b559. |
| AT2G30170 | Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens. |
| AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
| AT2G30570 | Encodes PsbW, a protein similar to photosystem II reaction center subunit W. Loss of PsbW destabilizes the supramolecular organization of PSII. |
| AT1G06680 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. Phosphorylation of this protein is dependent on calcium. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the stroma. The mRNA is cell-to-cell mobile. |
| AT2G06520 | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
| AT1G62390 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT4G14330 | Orphan kinesin with processive motility on single microtubules. |
| AT3G58850 | Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT1G68890 | Homologous to the four eubacterial men genes involved in menanoquinone biosynthesis. Studies of mutants defective in this gene demonstrated its involvement in phylloquinone biosynthesis in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile. |
| AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. The mRNA is cell-to-cell mobile. |
| AT1G03980 | Encodes a protein with phytochelatin synthase activity which binds Cd2+ and Cd-glutathione complexes with high affinity. The protein has been postulated to be involved in Cd2+ tolerance. AtPCS2 expression appears to be less than that of AtPCS1, explaining the inability of endogenous AtPCS2 to substitute for AtPCS1 in the cad1-3 mutant (AtPCS1 null). |
| AT5G48150 | Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. |
| AT2G18790 | Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule. The mRNA is cell-to-cell mobile. |
| AT5G35840 | Encodes the apoprotein of phytochrome;one of a family of photoreceptors that modulate plant growth and development. The mRNA is cell-to-cell mobile. |
| AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
| AT2G20180 | Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression. |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT4G29080 | phytochrome-associated protein 2 (PAP2) |
| AT1G72390 | nuclear receptor coactivator;(source:Araport11) |
| AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
| AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
| AT1G13590 | Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus. |
| AT3G44735 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. |
| AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
| AT4G37720 | Probable phytosulfokines 6 precursor, coding for a unique plant peptide growth factor. |
| AT1G54570 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT3G26840 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT2G25170 | Encodes a SWI/SWF nuclear-localized chromatin remodeling factor of the CHD3 group. Involved in post-germination repression of embryonic development. Acts with GA to establish repression of embryonic genes upon germination. Protein preferentially accumulates in differentiating tissues. Loss of function alleles are associated with expression of embryonic traits in adult plants and derepression of embryonic genes such as PHEROS1. Is an extragenic suppressor of slr2 (SSL2). Mutations in PKL (SSL2) restores lateral root formation in the slr2 mutant slr-1. It was proposed that PKL/SSL2-mediated chromatin remodeling negatively regulates auxin-mediated LR formation in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
| AT5G12130 | integral membrane TerC family protein;(source:Araport11) |
| AT3G48500 | PEP complex component. |
| AT2G01190 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT4G32260 | ATPase, F0 complex, subunit B/B, bacterial/chloroplast;(source:Araport11) |
| AT1G68450 | VQ motif-containing protein;(source:Araport11) |
| AT5G08610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G26510 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT1G70940 | A regulator of auxin efflux and involved in differential growth. PIN3 is expressed in gravity-sensing tissues, with PIN3 protein accumulating predominantly at the lateral cell surface. PIN3 localizes to the plasma membrane and to vesicles. In roots, PIN3 is expressed without pronounced polarity in tiers two and three of the columella cells, at the basal side of vascular cells, and to the lateral side of pericycle cells of the elongation zone. PIN3 overexpression inhibits root cell growth. Protein phosphorylation plays a role in regulating PIN3 trafficking to the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G71090 | Auxin efflux carrier family protein;(source:Araport11) |
| AT1G76520 | Auxin efflux carrier family protein;(source:Araport11) |
| AT1G76530 | Auxin efflux carrier family protein;(source:Araport11) |
| AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
| AT5G16480 | Encodes an atypical dual-specificity phosphatase. |
| AT1G14880 | PLANT CADMIUM RESISTANCE 1;(source:Araport11) |
| AT1G14870 | PCR2 encodes a membrane protein involved in zinc transport and detoxification. |
| AT1G77130 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT1G12970 | Encodes PIRL3, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
| AT2G18660 | Encodes PNP-A (Plant Natriuretic Peptide A). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. PNP-A contains a signal peptide domain and is secreted into the extracellular space. Co-expression analyses using microarray data suggest that PNP-A may function as a component of plant defence response and SAR in particular, and could be classified as a newly identified PR protein. It is stress responsive and can enhance its own expression. |
| AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
| AT5G62190 | Encodes a ATP-dependent RNA unwinding protein targeted to the nucleolus and presumably involved in translation by assisting ribosome maturation. DEAD/DEAH box RNA helicase PRH75 |
| AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
| AT3G46510 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. Can be phosphorylated in vitro by MLPK, ARK1, and ARK2 but not by SD1-29. Involved in ubiquitination of pattern recognition receptor FLS2. |
| AT3G54850 | Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro. Regulator of flowering time. |
| AT5G42340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile. |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. The mRNA is cell-to-cell mobile. |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT1G49780 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G65200 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G62560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01680 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
| AT4G04210 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4) |
| AT2G01650 | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. |
| AT1G14570 | Encodes a nuclear UBX-containing protein that can bridge ubiquitin to AtCDC48A. |
| AT5G19930 | PGR is putative plasma membrane glucose- responsive regulator that is expressed in response to glucose stimulation.RNAi knockdown mutant seeds have enhanced sensitivity to glucose and 2-deoxyglucose. |
| AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
| AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
| AT2G16070 | An integral outer envelope membrane protein (its homolog in A thaliana PDV1), component of the plastid division machinery. Similar to ARC6, PDV2 localizes to a continuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. |
| AT2G33450 | Ribosomal L28 family;(source:Araport11) |
| AT5G65220 | Ribosomal L29 family protein;(source:Araport11) |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT2G34640 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. |
| AT3G09210 | plastid transcriptionally active 13;(source:Araport11) |
| AT2G32180 | plastid transcriptionally active 18;(source:Araport11) |
| AT1G68590 | Ribosomal protein PSRP-3/Ycf65;(source:Araport11) |
| AT1G32440 | encodes a chloroplast pyruvate kinase beta subunit. The enzyme is less active than the other chloroplast pyruvate kinase beta subunit encoded by AT5G52920. Involved in seed oil biosynthesis. Can partially complement the AT5G52920 mutant. |
| AT5G16150 | Encodes a putative plastidic glucose transporter. |
| AT5G52920 | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. The mRNA is cell-to-cell mobile. |
| AT3G58010 | plastoglobulin 34kD;(source:Araport11) |
| AT4G15900 | Mutations confer hypersensitivity to glucose and sucrose and augments sensitivity to cytokinin, ethylene, ABA and auxin. Encodes a nuclear WD40 protein that is imported into the nucleus. Essential for plant innate immunity. Interacts with MOS4 and AtCDC5. It is also predicted to have two DWD motifs. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase, and may affect the stability of AKIN10. |
| AT3G20840 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
| AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT4G39403 | Encodes a 36 amino acid polypeptide that is necessary for correct responses to cytokinins and auxins, correct cell expansion in the root, and for vascular patterning in the leaf. Mutation of PLS results in an enhanced ethylene-response phenotype, defective auxin transport and homeostasis, and altered microtubule sensitivity to inhibitors. |
| AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
| AT2G31865 | poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
| AT4G02390 | Encodes a DNA dependent nuclear poly (ADP-ribose) polymerase (E.C.2.4.2.30), thought to be involved in post-translational modification . |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT4G29720 | polyamine oxidase 5;(source:Araport11) |
| AT1G31820 | Encodes POLYAMINE UPTAKE TRANSPORTER 1, an amino acid permease family protein. |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT2G41850 | ADPG2. |
| AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G48100 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
| AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G16530 | Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT4G07410 | Encodes a WD-40 protein expressed both during embryo development and postembryonically in the SAM and RAM that functions in the auxin pathway, integrating auxin signaling in the organization and maintenance of the SAM and RAM. |
| AT4G39920 | Microtubule-folding cofactor, produces assembly-competent alpha-/beta-tubulin heterodimers. |
| AT2G18740 | Putative temperature-specific splice regulator of development. Only the first splice form (PCP-alpha) has this function as result of C-terminal addition. |
| AT2G31370 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT4G02460 | Encodes a protein similar to PMS1 in yeast, a member of the family of eukaryotic MutL homologs. The protein appears to play a role in DNA mismatch repair and in the suppression of somatic homeologous recombination. |
| AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT3G54920 | Powdery mildew resistant mutant encodes a pectate lyase-like protein The mRNA is cell-to-cell mobile. |
| AT3G52250 | Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile. |
| AT1G44910 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
| AT4G28460 | Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1. |
| AT1G49800 | Homolog of PIP1. |
| AT5G43066 | Homolog of prePIP1. |
| AT5G44585 | Precursor of serine-rich endogenous peptide which regulates defense response and root elongation. Has properties of phytocytokines, activates the phospholipid signaling pathway, regulates reactive oxygen species response, and is perceived in a BAK1 co-receptor-dependent manner. |
| AT5G49510 | prefoldin 3;(source:Araport11) |
| AT2G40380 | prenylated RAB acceptor 1.B2;(source:Araport11) |
| AT5G01640 | prenylated RAB acceptor 1.B5;(source:Araport11) |
| AT5G07110 | Encodes PRA1.B6, an isoform of the PRA1 (Prenylated Rab acceptors) family. PRAs bind to prenylated Rab proteins and possibly aids in targeting Rabs to their respective compartments. PRA1.B6 localizes to the Golgi apparatus and its ER-to-Golgi trafficking and localization to the Golgi apparatus are regulated by multiple sequence motifs in both the C- and N-terminal cytoplasmic domains. |
| AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT1G29850 | Encodes a protein that by its interaction with HAM acetyltransferases plays an important role during DNA damage responses induced by UV-B radiation and participates in programmed cell death programs. |
| AT5G40770 | prohibitin 3 |
| AT2G39890 | Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem. |
| AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots. |
| AT1G10620 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G24400 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G24540 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G34440 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G54970 | encodes a proline-rich protein that is specifically expressed in the root. The mRNA is cell-to-cell mobile. |
| AT2G23096 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
| AT3G06300 | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. The mRNA is cell-to-cell mobile. |
| AT2G17720 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
| AT1G20380 | Putative prolyl oligopeptidase, associated with quantitive disease resistance to S. sclerotiorum. |
| AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
| AT4G16570 | protein arginine methyltransferase 7;(source:Araport11) |
| AT5G47420 | PAWH2 along with PAWH1 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
| AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
| AT5G19680 | PP1 Regulatory Subunit3. Interacts with members of the Type One Protein Phosphatases (TOPP) family.Facilitates the nuclear localization of TOPP4 which is required for its activity in mediating ABA responses. |
| AT5G36250 | Encodes a myristoylated 2C-type protein phosphatase that interacts with the catalytic subunit of SnRK1. The mRNA is cell-to-cell mobile. |
| AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
| AT2G42810 | Encodes a phytochrome-specific type 5 serine/threonine protein phosphatase. It dephosphorylates active Pfr-phytochromes. Controls light signal flux by enhancing phytochrome stability and affinity for a signal transducer. The gene is alternately spliced. This variant is an integral membrane protein localized to the ER and nuclear envelope. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. It also regulates tetrapyrrole biosynthesis through the accumulation of Mg-ProtoIX and acts as a negative regulator of photosynthesis associated nuclear gene expression during chloroplast biogenesis and development. |
| AT5G55260 | Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase. |
| AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
| AT5G39790 | Encodes a chloroplast localized protein that is involved in protein translocation and starch metabolism. PTST helps localize GBSS to the starch granules where GBSS functions in amylose biosynthesis. |
| AT2G32230 | Encodes a protein-only RNase P that is involved in the 5? cleavage of the precursor tRNAs and is able to cleave tRNA-like structures involved in the maturation of plant mitochondrial mRNAs. Mutants show a drastic reduction in the levels of mature plastid tRNA-Phe(GAA) and tRNA-Arg(ACG), limiting plastid gene expression. |
| AT5G02310 | Encodes PROTEOLYSIS6 (PRT6), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Another component of the N-end rule pathway is arginyl-tRNA:protein arginyltransferase (ATE). Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. The mRNA is cell-to-cell mobile. |
| AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT2G42840 | Encodes a putative extracellular proline-rich protein is exclusively expressed in the L1 layer of vegetative, inflorescence and floral meristems and the protoderm of organ primordia. |
| AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
| AT4G31850 | Encodes a protein containing 27 pentatrico-peptide repeat (PPR) motifs. Functions in the stabilization of petL operon RNA and also in the translation of petL. |
| AT3G15340 | Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. |
| AT3G25840 | Spliceosome-associated kinase involved in alternative splicing. May influence alternative splicing patterns by phosphorylating a subset of splicing regulators. |
| AT5G49240 | member of Response Regulator: Pseudo |
| AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT1G34320 | Ikzf5 (DUF668);(source:Araport11) |
| AT1G30755 | elongation factor G, putative (DUF668);(source:Araport11) |
| AT5G08660 | D-lactate dehydrogenase (DUF668);(source:Araport11) |
| AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
| AT4G08840 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT3G24270 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G22240 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT2G32080 | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication |
| AT1G19770 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT1G75470 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G47603 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT4G18205 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT4G18197 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
| AT4G18195 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G13750 | Encodes a purple acid phosphatase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT1G52940 | Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea. |
| AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
| AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT1G77720 | Encodes a predicted protein kinase based on sequence similarity. |
| AT3G17410 | Positively regulates ABA-mediated physiological responses via phosphorylation on RCAR3/ RCAR11. |
| AT3G24160 | Encodes a putative Type 1 membrane protein (PMP). |
| AT5G02950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT5G01890 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. The mRNA is cell-to-cell mobile. |
| AT1G73000 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT3G08860 | Encodes a protein that is predicted to have beta-alanine aminotransferase activity. |
| AT3G53620 | Encodes a soluble protein with inorganic pyrophosphatase activity that is highly specific for Mg-inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
| AT5G01330 | pyruvate decarboxylase |
| AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
| AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
| AT1G13860 | Encodes QUASIMODO2 LIKE1 (QUL1), a paralog of QUASIMODO2 (QUA2). AT1G78240 (QUA2), AT1G13860 (QUL1) and AT2G03480 (QUL2) form a clade with a possible role in plant vasculature development. |
| AT1G15020 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
| AT1G49890 | Together with QWRF1 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT5G43160 | QWRF motif protein (DUF566);(source:Araport11) |
| AT3G06540 | Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro. |
| AT5G09550 | GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11) |
| AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11) |
| AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
| AT1G16920 | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
| AT4G18430 | RAB GTPase homolog A1E;(source:Araport11) |
| AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
| AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
| AT3G07410 | RAB GTPase homolog A5B;(source:Araport11) |
| AT1G05810 | Rab GTPase-like A5A protein;(source:Araport11) |
| AT4G17160 | RAB GTPase homolog B1A;(source:Araport11) |
| AT5G03530 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. CFP:RabC2a appears to co-localize with peroxisomes. |
| AT3G16100 | RAB GTPase homolog G3C;(source:Araport11) |
| AT2G22290 | RAB GTPase homolog H1D;(source:Araport11) |
| AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G06070 | Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus. |
| AT4G15475 | Contributes to UV tolerance through nucleotide excision repair. |
| AT5G21900 | Contributes to UV tolerance through nucleotide excision repair. |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT4G01265 | Pseudogene of AT4G01265; raffinose synthase family protein |
| AT3G25170 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G29780 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT5G58590 | Encodes a Ran-binding protein 1 homolog (RanBP1). |
| AT5G19320 | Encodes RAN GTPase activating protein 2. The protein is localized to the nuclear envelope during interphase. |
| AT5G01770 | Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutations in this gene have no visible effects on embryo or plant development. |
| AT1G02130 | Belongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation. |
| AT5G55080 | A member of RAN GTPase gene family. |
| AT3G21060 | Encodes a structural core component of a COMPASS-like H3K4 histone methylation complex that is also involved in the timing of the floral transition. |
| AT5G08710 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
| AT1G65790 | An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain. |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT1G71400 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile. |
| AT1G74170 | receptor like protein 13;(source:Araport11) |
| AT1G74190 | receptor like protein 15;(source:Araport11) |
| AT1G74200 | receptor like protein 16;(source:Araport11) |
| AT2G15040 | pseudogene of receptor like protein 53;(source:Araport11) |
| AT2G15080 | receptor like protein 19;(source:Araport11) |
| AT1G17240 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G32680 | NLP20 LRR receptor protein involved in PAMP mediated immunity. |
| AT2G33020 | receptor like protein 24;(source:Araport11) |
| AT2G33050 | receptor like protein 26;(source:Araport11) |
| AT2G33080 | receptor like protein 28;(source:Araport11) |
| AT2G42800 | receptor like protein 29;(source:Araport11) |
| AT3G05370 | receptor like protein 31;(source:Araport11) |
| AT3G05650 | receptor like protein 32;(source:Araport11) |
| AT3G05660 | receptor like protein 33;(source:Araport11) |
| AT3G11010 | receptor like protein 34;(source:Araport11) |
| AT3G11080 | receptor like protein 35;(source:Araport11) |
| AT3G23010 | receptor like protein 36;(source:Araport11) |
| AT3G23110 | receptor like protein 37;(source:Araport11) |
| AT3G23120 | receptor like protein 38;(source:Araport11) |
| AT1G28340 | receptor like protein 4;(source:Araport11) |
| AT3G28890 | receptor like protein 43;(source:Araport11) |
| AT4G04220 | receptor like protein 46;(source:Araport11) |
| AT4G13810 | receptor like protein 47;(source:Araport11) |
| AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
| AT1G34290 | receptor like protein 5;(source:Araport11) |
| AT4G13920 | receptor like protein 50;(source:Araport11) |
| AT5G25910 | putative disease resistance protein induced by chitin oligomers. |
| AT5G27060 | receptor like protein 53;(source:Araport11) |
| AT1G45616 | receptor like protein 6;(source:Araport11) |
| AT1G58190 | receptor like protein 9;(source:Araport11) |
| AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
| AT5G67280 | receptor-like kinase;(source:Araport11) |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
| AT4G16860 | Confers resistance to Peronospora parasitica. RPP4 is coordinately regulated by transcriptional activation and RNA silencing. |
| AT4G16950 | Contains a putative nucleotide binding site and leucine-rich repeats. Similar to the plant resistance genes N and L6, and to the toll and interleukin-1 receptors. Confers resistance to Peronospora parasitica.Redundant function together with SIKIC1 and 3 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
| AT5G43470 | Confers resistance to Peronospora parasitica. In arabidopsis ecotype Dijon-17, HRT-mediated signaling is dependent on light for the induction of hypersensitive response and resistance to turnip crinkle virus. |
| AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT5G27680 | RECQ helicase SIM;(source:Araport11) |
| AT5G63540 | Encodes RMI1. Suppresses somatic crossovers. Essential for resolution of meiotic recombination intermediates. |
| AT2G47700 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
| AT1G70630 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G28080 | Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment. |
| AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
| AT4G04340 | Encodes a plasma membrane localized hyperosmolality gated calcium channel that is expressed in guard cells and roots. |
| AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
| AT1G19360 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT3G17170 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
| AT3G26090 | Encodes AtRGS1, a putative membrane receptor for D-glucose. Also functions as a regulator of G-protein signaling. Has GTPase-accelerating activity. Regulates the activity of AtGPA1. Lines over-expressing the gene are more tolerant to dehydration and root elongation. These phenotypes are dependent on ABA. Nuclear localization of the protein is dependent on ABA. RGS1 endocytosis is induced by JA which promotes its dissociation from GPA1. |
| AT4G29040 | RPT2a encodes the 26S proteasome subunit. It is required for root meristem maintenance, and regulates gametogenesis. RPT2a is also shown to regulate gene silencing via DNA methylation. |
| AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
| AT1G43160 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
| AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
| AT1G49480 | Encodes a nuclear-localized DNA-binding protein that interacts with ITN1 at the PM and nuclei in vivo and may regulate ITN's subcellular localization. |
| AT3G57540 | Remorin family protein;(source:Araport11) |
| AT1G77470 | Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent. |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT2G44270 | Encodes ROL5, a repressor of lrx1 mutants that develop aberrant root hairs. ROL5 is a homolog of yeast Ncs6p that affects TOR signaling. The target of rapamycin (TOR) pathway is a major regulator of cell growth in eukaryotes, and inhibition of this pathway by rapamycin reduces cell growth. ROL5 might function as a mitochondrial component of the TOR pathway that influences the plant's response to ROS (reactive oxygen species). |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
| AT2G16210 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT5G67630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G15720 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G15460 | Encodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions. |
| AT1G79670 | Encodes a receptor-like kinase that does not contain an extracellular leucine-rich repeat domain. A novel type of dominant disease-resistance protein that confers resistance to a broad spectrum of Fusarium races. |
| AT3G07040 | Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1. |
| AT1G54470 | Encodes a Cf-like gene in Arabidopsis that confers downy mildew resistance to several isolates of Peronospora parasitica. |
| AT1G11330 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT3G03710 | Encodes a chloroplast polynucleotide phosphorylase (PNPase). Involved in response to phosphorus (P) starvation. Mutants impaired in the expression of this gene have been selected through their resistance to fosmidomycin, a strong inhibitor of DXR, an enzyme of the methylerythritol-dependent IPP biosynthesis pathway. The pathway enzymes were upregulated in the mutant seedlings. |
| AT5G05630 | Encodes POLYAMINE UPTAKE TRANSPORTER 3, an amino acid permease family protein. |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT5G46470 | Encodes RPS6 (RESISTANT TO P. SYRINGAE 6), a member of the TIR-NBS-LRR class resistance protein. The mRNA is cell-to-cell mobile. |
| AT5G45260 | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2. |
| AT1G09090 | NADPH-oxidase AtrbohB plays a role in seed after-ripening. Major producer of superoxide in germinating seeds. AtrbohB pre-mRNA is alternatively spliced in seeds in a hormonally and developmentally regulated manner. ABA caused accumulation of AtrbohB-? mRNA and prevented prevented AtrbohB-a mRNA expression in fresh seeds. |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile. |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT3G16857 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT4G31920 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT1G67710 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Affects ABA-JA crosstalk. |
| AT2G25180 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT4G16110 | Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity. Also involved in cytokinin-dependent inhibition of hypocotyl elongation. |
| AT5G07210 | member of Response Regulator: B- Type |
| AT5G26594 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family . It appears to be expressed in floral buds, mature flowers, and pollen. But, unlike the related ARR22 protein, it does not appear to be expressed at the seed:funiculus junction. |
| AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
| AT5G24660 | response to low sulfur 2;(source:Araport11) |
| AT5G24655 | response to low sulfur 4;(source:Araport11) |
| AT5G65950 | TRAPPIII complex protein which regulates TGN integrity, by altered TGN/EE association of several residents, including SYNTAXIN OF PLANTS 61 (SYP61), and altered vesicle morphology. Involved in regulation of endosomal function and salt stress response. |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT5G25610 | responsive to dehydration 22 (RD22) mediated by ABA |
| AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
| AT2G41945 | Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture. |
| AT2G15280 | Reticulon family protein;(source:Araport11) |
| AT3G10260 | Reticulon family protein;(source:Araport11) |
| AT3G61560 | Reticulon family protein;(source:Araport11) |
| AT4G02960 | a copia-type retrotransposon element containing LTRs and encoding a polyprotein. This retro element exists in two loci in Landsberg erecta but only once in Columbia |
| AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
| AT5G52660 | Encodes RVE6, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. |
| AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
| AT5G15740 | RRT1 is a member of a novel glycosyltransferase famly in plants. It functions as a rhamnosyltransferase, elongating the RG-1 backbone. It functions during seed coat mucilage development. |
| AT3G03450 | Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development. |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
| AT4G01750 | Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT2 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. The mRNA is cell-to-cell mobile. |
| AT1G78570 | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli. |
| AT3G14790 | rhamnose biosynthesis 3;(source:Araport11) |
| AT5G45160 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
| AT1G18600 | Mitochondrion-located rhomboid-like protein |
| AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
| AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
| AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
| AT2G36620 | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
| AT5G40950 | ribosomal protein large subunit 27;(source:Araport11) |
| AT4G29430 | ribosomal protein S15A E;(source:Araport11) |
| AT3G07750 | 3-5-exoribonuclease family protein;(source:Araport11) |
| AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
| AT4G11370 | Encodes a putative RING-H2 finger protein RHA1a. |
| AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
| AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
| AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
| AT2G40830 | Encodes an E3 ubiquitin ligase for the GA-receptor GID1 that functions as a negative regulator of GA signaling in seedlings and seeds by inducing ubiquitin-dependent proteolysis of GID1s. Tyr321 phosphorylation of GARU by TAGK2 inactivates GARU. |
| AT4G14220 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond. The mRNA is cell-to-cell mobile. |
| AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
| AT1G29720 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G29730 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G29740 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT1G72530 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT5G63120 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G41340 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT1G60650 | Encodes one of the zinc finger-containing glycine-rich RNA-binding proteins involved in cold tolerance: AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b), AT5G04280 (AtRZ-1c). It also, along with AtRZ-1c, plays important roles in plant development, pre- mRNA splicing, and general gene expression. |
| AT1G17640 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
| AT5G54900 | RNA-binding protein 45A;(source:Araport11) |
| AT1G49600 | RNA-binding protein 47A;(source:Araport11) |
| AT1G47490 | RNA-binding protein 47C;(source:Araport11) |
| AT1G47500 | RNA-binding protein 47C;(source:Araport11) |
| AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
| AT4G15417 | RNAse II-like 1;(source:Araport11) |
| AT3G20420 | double-stranded RNA binding / ribonuclease III. Required for 3' external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo. Localizes in the nucleus and cytoplasm. |
| AT3G27730 | DNA helicase required for interference-sensitive meiotic crossover events. |
| AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT3G54280 | ROOT GROWTH DEFECTIVE 3;(source:Araport11) |
| AT1G64440 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis. |
| AT4G29180 | root hair specific 16;(source:Araport11) |
| AT5G67400 | root hair specific 19;(source:Araport11) |
| AT5G57280 | Gene encodes a methyltransferase-like protein involved in pre-rRNA processing. |
| AT1G13620 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT2G03830 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT4G28410 | Tyrosine transaminase family protein;(source:Araport11) |
| AT5G01510 | root UVB sensitive protein (Protein of unknown function, DUF647);(source:Araport11) |
| AT2G26290 | root-specific kinase 1;(source:Araport11) |
| AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
| AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G79860 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth Growth. |
| AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G01700 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
| AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
| AT4G28560 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC6 and RIC8 (subfamily group II). Gene is expressed in all tissues examined. |
| AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
| AT1G17235 | This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation. |
| AT5G16023 | Encodes a plant peptide that could be involved in the coordination of socket cell development in wild-type plants. |
| AT2G29125 | ROTUNDIFOLIA like 2;(source:Araport11) |
| AT1G64585 | ROTUNDIFOLIA like 22;(source:Araport11) |
| AT3G46613 | Encodes a small is a member of an angiosperm specific gene family. |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT5G08020 | Encodes a homolog of Replication Protein A. rpa70b mutants are hypersensitive to UV-B radiation and MMS treatments suggesting a role for this protein in DNA damage repair. The mRNA is cell-to-cell mobile. |
| AT2G20310 | Encodes RPM1 Interacting Protein 13 (RIN13), a resistance protein interactor shown to positively enhance resistance function of RPM1. |
| AT3G25070 | Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile. |
| AT1G54440 | Rrp6-like protein, controls RNA-directed DNA methylation by helping with the retention of noncoding RNAs in normal cells. |
| AT5G35910 | Encodes a nuclear-localized RRP6-like protein whose mutation leads to accumulation of an rRNA maturation by-product. |
| AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein;(source:Araport11) |
| AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
| AT4G39460 | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
| AT1G34065 | S-adenosylmethionine carrier 2;(source:Araport11) |
| AT1G61380 | Encodes a membrane localized S-domain receptor kinase that is involved in lipopolysaccharide (LPS) sensing. SD1-29 detected LPS of Pseudomonas and Xanthomonas species for which it serves as a microbe associated molecular pattern triggering innate immunity. Loses of function mutants are hyper susceptible to P.syringae. |
| AT4G32300 | S-domain-2 5;(source:Araport11) |
| AT1G49820 | encodes 5-methylthioribose kinase, involved in methionine cycle The mRNA is cell-to-cell mobile. |
| AT1G12800 | SDP is a chloroplast localized RNA binding protein that is required for plastid rRNA processing. Plants harboring a mutation in SDP have numerous defects including reduced chlorophyll content, poor growth, yellow leaves and abnormal chloroplasts. |
| AT5G22450 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
| AT2G37050 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
| AT2G01980 | Encodes a plasma membrane-localized Na+/H+ antiporter SOS1. Functions in the extrusion of toxic Na+ from cells and is essential for plant salt tolerance. Has 12 predicted transmembrane domains in the N-terminal region and a long cytoplasmic tail of approx. 700 aa at the C-terminal side. SOS1 interacts through its predicted cytoplasmic tail with RCD1, a regulator of oxidative-stress responses, suggesting that SOS1 might function in oxidative-stress tolerance. |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT2G31380 | a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction. |
| AT1G27730 | Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress. |
| AT3G07700 | ABC1K7 is a member of an atypical protein kinase family that is induced by salt stress. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K8 in mediating lipid membrane changes in response to stress. |
| AT5G22270 | hypothetical protein;(source:Araport11) |
| AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
| AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT5G52810 | SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936). |
| AT3G13570 | encodes an SC35-like splicing factor of 30 kD that is localized to the nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT1G55310 | Encodes a SR spliceosome protein that is localized to nuclear specks, interacts with SR45 and the U1-70K protein of the U1 snRNP, has sequence similar to human SC35 protein. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT2G24120 | DNA/RNA polymerases superfamily protein;(source:Araport11) |
| AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
| AT3G12900 | S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil. |
| AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile. |
| AT4G22105 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G14182 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G08695 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G60987 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G05117 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
| AT4G39180 | encodes a protein that complements the function of a sec14(ts) mutant of S. cerevisiae |
| AT1G61250 | Encodes a putative secretory carrier membrane protein (SC3). The mRNA is cell-to-cell mobile. |
| AT3G48460 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G26740 | Encodes caleosin, a 27-kDa protein found within seed lipid bodies. Gene is expressed preferentially in the embryo, has similarity to a rice ABA-responsive gene, EFA27. Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT5G07190 | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT3G57520 | SIP2 encodes a raffinose-specific alpha-galactosidase that catalyzes the breakdown of raffinose into alpha-galatose and sucrose. This enzyme may function in unloading raffinose from the phloem as part of sink metabolism. Although it was originally predicted to act as a raffinose synthase (RS), that activity was not observed for recombinant SIP2. |
| AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
| AT4G14040 | selenium-binding protein 2;(source:Araport11) |
| AT5G13030 | Chloroplast localized homolog of SELO. Loss of function mutants have reduced production of reactive oxygen species (ROS) and higher ROS scavenging. |
| AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
| AT1G66580 | senescence associated gene 24;(source:Araport11) |
| AT3G26680 | involved in a SNM-dependent recombinational repair process of oxidatively induced DNA damage. |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
| AT5G22890 | An unique homologue of STOP1 (AT1G34370) in Arabidopsis genome. Transformation to the stop1-mutant activated several genes that are regulated by STOP1, and conferred proton sensitive phenotype. |
| AT3G53030 | Encodes a protein kinase SRPK4 that specifically targets Arabidopsis Ser/Arg-rich (SR) slicing factors involved in RNA metabolism. In vitro kinase assay showed that SRPK4 phosphorylates the SR protein RSp31. |
| AT5G36180 | serine carboxypeptidase-like 1;(source:Araport11) |
| AT2G22970 | serine carboxypeptidase-like 11;(source:Araport11) |
| AT3G12240 | serine carboxypeptidase-like 15;(source:Araport11) |
| AT3G12220 | serine carboxypeptidase-like 16;(source:Araport11) |
| AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
| AT5G09640 | encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase. |
| AT2G35780 | serine carboxypeptidase-like 26;(source:Araport11) |
| AT2G35770 | serine carboxypeptidase-like 28;(source:Araport11) |
| AT4G15100 | serine carboxypeptidase-like 30;(source:Araport11) |
| AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
| AT2G12480 | serine carboxypeptidase-like 43;(source:Araport11) |
| AT1G28110 | serine carboxypeptidase-like 45;(source:Araport11) |
| AT2G33530 | serine carboxypeptidase-like 46;(source:Araport11) |
| AT1G15000 | serine carboxypeptidase-like 50;(source:Araport11) |
| AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
| AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT5G08160 | Encodes a serine/threonine protein kinase. |
| AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT2G26390 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
| AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
| AT1G11870 | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT2G24740 | Encodes a SU(VAR)3-9 homolog, a SET domain protein (Homology Subgroup V; Orthology Group 1). Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. This protein is a putative histone methyltransferase (predicted to methylate H3K9/20) related to the the Drosophila Su(var)3-9 and mammalian G9a proteins. |
| AT4G30860 | Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. |
| AT4G27910 | Encodes a SET domain containing protein, putative H3K4 methyltransferase. Involved in bolting/flowering time together with ATX1 and ATX3. |
| AT4G15180 | Encodes SET domain containing protein that acts redundantly with ATX4/5 to regulate histone H3-K4 methylation. |
| AT4G25520 | SEUSS-like 1;(source:Araport11) |
| AT4G18060 | SH3 domain-containing protein;(source:Araport11) |
| AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
| AT1G09840 | shaggy-like protein kinase 41;(source:Araport11) |
| AT5G26751 | Encodes a SHAGGY-related kinase involved in meristem organization. It regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase 6.Functions as a positive regulator of salt stress tolerance. Phosphorylates and enhances G6PD6 (At5g40760) activity |
| AT2G42830 | AGAMOUS [AG]-like MADS box protein (AGL5) involved in fruit development (valve margin and dehiscence zone differentiation). A putative direct target of AG. SHP2 has been shown to be a downstream gene of the complex formed by AG and SEP proteins (SEP4 alone does not form a functional complex with AG). |
| AT5G49270 | Involved in successfully establishing tip growth in root hairs. |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT3G54430 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT5G11190 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT2G36810 | Specifically involved in gravity perception and/or gravity signal transduction for the shoot gravitropic response. Effects gravitropism only in inflorescence stems but normal in both hypocotyls and roots. |
| AT1G28560 | Encodes a protein similar to human SNAP50. Mutants display different temperature sensitivities in the dedifferentiation of cells from different organs. Mutation inhibits the dedifferentiation-associated accumulation of U-snRNAs and some other small RNA species encoded by independent-type genes carrying the USE and TATA box. Required for the elevation of cell proliferation competence in hypocotyl dedifferentiation. |
| AT1G29785 | Natural antisense transcript overlaps with AT1G29780. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G09795 | Natural antisense transcript overlaps with AT2G09800. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT1G11185 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G06125 | Unknown gene The mRNA is cell-to-cell mobile. |
| AT5G24735 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
| AT2G03150 | Encodes a nuclear-localized calcium-binding protein RSA1 (SHORT ROOT IN SALT MEDIUM 1), which is required for salt tolerance. |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
| AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
| AT5G24740 | Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root. |
| AT1G66970 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58050 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58170 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT4G16960 | Redundant function together with SIKIC1 and 2 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
| AT1G64860 | Subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme |
| AT2G41180 | VQ motif-containing protein;(source:Araport11) |
| AT1G73990 | Encodes a putative protease SppA (SppA). |
| AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
| AT3G15390 | Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing. |
| AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT5G15020 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT1G24190 | Enhances AtERF7-mediated transcriptional repression. RNAi lines show ABA hypersensitivity. Interacts with ERF7 and HDA19. |
| AT1G70060 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). The mRNA is cell-to-cell mobile. |
| AT1G50170 | encodes sirohydrochlorin ferrochelatase catalyzing the last step of the siroheme biosynthesis |
| AT1G10230 | Involved in protein degradation. One target is PHR1. |
| AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
| AT3G13390 | SKU5 similar 11;(source:Araport11) |
| AT1G55570 | SKU5 similar 12;(source:Araport11) |
| AT1G55560 | SKU5 similar 14;(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT1G41830 | SKU5-similar 6;(source:Araport11) |
| AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT1G62262 | Predicted to encode a protein with similarity to the SLAC1 protein involved in ion homeostasis in guard cells. |
| AT5G48170 | encodes an F-box protein whose protein sequence is similar to SLY1, which belongs to SCF-SLY1 E3 ligase complex. SCF-SLY1 E3 ligase degrades DELLA proteins that are involved in promoting growth. Overexpression of SLY2 can partially compensate sly1-10 mutant phenotype of dwarfism. |
| AT1G55040 | SED1 is a protein of unknown function that is located in the mitochondrion. sed1 mutants are embryo lethal. |
| AT1G76860 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT2G43810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT4G13520 | Encodes a small acid protein (SMAP1) that mediates responses Arabidopsis root to the synthetic auxin 2,4-Dichlorophenoxyacetic acid. The mRNA is cell-to-cell mobile. |
| AT3G56950 | One of the Major Intrinsic Proteins(MIPs) which facilitate the passive transport of small molecules across membranes.Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER. Probably involved in the alleviation of ER stress; the lack of SIP2;1 reduces both pollen germination and pollen tube elongation. |
| AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
| AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
| AT2G18010 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G46690 | Regulates ABA-mediated responses to drought stress. |
| AT4G12410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G36210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G50760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G12955 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G72430 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19020 | Modulates defense against bacterial pathogens and tolerance to oxidative stress. |
| AT5G05540 | small RNA degrading nuclease 2;(source:Araport11) |
| AT5G06210 | Encodes a chloroplast protein involved in the responses to salt and oxidative stresses. |
| AT5G55170 | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT3G52490 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT1G07200 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT1G78290 | encodes a member of SNF1-related protein kinase (SnRK2) family whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress and dehydration. |
| AT3G50500 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. |
| AT2G23030 | encodes a member of SNF1-related protein kinases (SnRK2) |
| AT5G60750 | Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities. |
| AT1G26470 | chromatin modification-like protein;(source:Araport11) |
| AT1G26210 | AtSOFL1 acts redundantly with AtSOFL2 as positive regulator of cytokinin levels. |
| AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT2G37390 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT1G17050 | Encodes one of the two paralogous solanesyl diphosphate synthases - SPS1 (At1g78510) and SPS2 (At1g17050) - that assemble the side-chain of plastoquinone-9 in plastids. |
| AT2G26740 | Encodes a soluble epoxide hydrolase whose expression is induced by auxin and water stress. |
| AT5G61210 | membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation The mRNA is cell-to-cell mobile. |
| AT2G13800 | somatic embryogenesis receptor-like kinase 5;(source:Araport11) |
| AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
| AT5G07120 | Encodes sorting nexin SNX2b. SNX2b is peripherally associated with membranes. Involved in vesicular trafficking from endosomes to the vacuole. |
| AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
| AT3G46110 | DUF966 domain containing protein, expressed during embryogenesis. |
| AT5G59790 | SOK5 is a DUF966 domain containing protein expressed in early embryos. |
| AT4G11110 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA2 primarily regulates seedling development in darkness and has little function in light-grown seedlings or adult plants. |
| AT3G15354 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants. |
| AT4G36930 | Encodes a transcription factor of the bHLH protein family. Mutants have abnormal, unfused carpels and reduced seed dormancy. |
| AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT3G58490 | Encodes a long-chain base 1-phosphate (LCBP) phosphatase that is expressed in the endoplasmic reticulum. |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
| AT4G23496 | Belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
| AT3G45590 | Encodes a catalytic subunit of tRNA splicing endonuclease. |
| AT5G63670 | Transcription elongation factor SPT4 homolog 2. T-DNA mutant is more susceptible to the biotroph Hpa. |
| AT4G34640 | Encodes squalene synthase, which converts two molecules of farnesyl diphosphate (FPP) into squalene via an intermediate: presqualene diphosphate (PSPP). It is generally thought to be one of the key enzymes of sterol biosynthesis, since it catalyzes the first pathway-specific reaction of the sterol branch of the isoprenoid pathway. The mRNA is cell-to-cell mobile. |
| AT2G47070 | member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA. |
| AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
| AT3G57920 | Encodes a putative transcriptional regulator that is involved in the vegetative to reproductive phase transition. Expression is regulated by MIR156b. |
| AT3G15270 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
| AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
| AT4G03430 | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT1G10760 | Encodes an α-glucan, water dikinase required for starch degradation. Involved in cold-induced freezing tolerance. Mutations that eliminate the GWD protein or affect the dikinase domain of the enzyme dramatically reduce both the amount of phosphate in the amylopectin and the rate of starch degradation. Mature leaves of these mutants accumulate amounts of starch up to seven times greater than those in wild-type leaves. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C6 position. |
| AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
| AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
| AT1G34130 | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. |
| AT3G07020 | encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. ugt80a2 mutant plants have reduced steryl glycoside and acyl steryl glycoside levels and reduced seed size. ugt80a2/b1 double mutants have normal levels of celluose and normal cold stress tolerance. |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT1G79200 | Encodes a nuclear localized protein involved in auxin-dependent control of cell proliferation in pistil development. Loss of function mutations have increased cell proliferation in the stigma. |
| AT4G13266 | PGG domain containing transmembrane protein.Functions in the stigma to prevent interspecies pollen from forming pollen tubes. |
| AT3G48860 | coiled-coil protein;(source:Araport11) |
| AT3G57480 | SAP1 is a protein of unknown function whose expression is responsive to abiotic stressors including metals, salt, and ABA. Over expression confers increased tolerance to a variety of abiotic stressors. |
| AT4G34190 | Encodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding. |
| AT1G51840 | kinase-like protein;(source:Araport11) |
| AT1G51850 | Malectin-like receptor-like kinase involved in MAMP mediated stomatal immunity. Interacts with BAK1/FLS2 signaling complex and subsequently phosphorylates and activates SLAC1. |
| AT1G51805 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G25380 | stress-associated protein 10;(source:Araport11) |
| AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
| AT1G74000 | encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis. |
| AT5G06820 | STRUBBELIG-receptor family 2;(source:Araport11) |
| AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
| AT2G22740 | Encodes a SU(VAR)3-9 homolog, a methyltransferase involved in histone methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs but has a preference for the latter two. This is a member of a subfamily of SET proteins that shares a conserved SRA domain. |
| AT4G21650 | Subtilase family protein;(source:Araport11) |
| AT5G59090 | subtilase 4.12;(source:Araport11) |
| AT1G71950 | SPI-1 is a member of the I9 inhibitor family. It is an inhibitor of SBT4.13 subtilase. |
| AT3G10380 | Subunit of the Putative Arabidopsis Exocyst Complex |
| AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
| AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
| AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
| AT3G43190 | Encodes a protein with sucrose synthase activity (SUS4). |
| AT5G37180 | Encodes a protein with sucrose synthase activity (SUS5). |
| AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
| AT5G06170 | sucrose symporter with hight affinity for sucrose (K0.5=0.066 +/- 0.025mM), that can also transport a wide range of glucosides. |
| AT3G19940 | Encodes a hexose-H(+) symporter that catalyzes the high-affinity uptake of glucose, galactose and mannose that is induced under low-glucose conditions in pollen tubes. |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
| AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
| AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
| AT4G02050 | STP7 is a monosaccharide/H+ symporter that transports arabinose and xylose. |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT5G10180 | Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation. |
| AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
| AT5G19600 | Encodes sulfate transporter Sultr3;5. |
| AT5G13550 | Encodes a sulfate transporter. |
| AT3G01910 | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT4G33030 | involved in sulfolipid biosynthesis The mRNA is cell-to-cell mobile. |
| AT1G13430 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
| AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
| AT2G21470 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
| AT4G23950 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins. It is involved in early seed development and nuclear morphology. |
| AT2G31660 | SAD2 (super sensitive to ABA and drought 2) encodes an importin beta-domain family protein likely to be involved in nuclear transport in ABA signaling. Subcellular localization of GFP-tagged SAD2 showed a predominantly nuclear localization, consistent with a role for SAD2 in nuclear transport. Mutation of SAD2 in Arabidopsis alters abscisic acid sensitivity. SAD2 was ubiquitously expressed at low levels in all tissues except flowers. SAD2 expression was not induced by ABA or stress. Loss of function mutations in SAD2 exhibit increased tolerance for UV stress, increased production of UV protective secondary metabolites and suppression of nuclear localization of MYB4 (a repressor of UV stress response genes). Regulates microRNA activity. Defective trichome activity. |
| AT3G07880 | RhoGTPase GDP dissociation inhibitor (RhoGDI) that spatially restricts the sites of growth to a single point on the trichoblast. It regulates the NADPH oxidase RHD2/AtrbohC, which is required for hair growth. |
| AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. Induced in epidermal cells attacked by powdery mildew. The RTY enzyme is expected to function as a dimer (or a higher order multimeric complex), as all RTY-related enzymes with a defined crystal structure are known to form dimers or tetramers. |
| AT5G64340 | Encodes a bHLH(basic helix-loop-helix)-type transcription factor SAC51 [suppressor of acaulis 51]. Upregulation of SAC51 reverses the dwarf phenotype caused by a loss-of-function mutation in ACL5 (Arabidopsis thaliana ACAULIS 5) gene, suggesting that activation of SAC51 may lead to the expression of a subset of genes required for stem elongation. |
| AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
| AT3G43220 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT4G22305 | Encodes SOBER1, a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis. SOBER1 was formerly linked to AT4G22300 but this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. AT4G22300 is now known as TIPSY1 and AT4G22305 corresponds to SOBER1. |
| AT2G31880 | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity. |
| AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G25580 | Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage. |
| AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
| AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
| AT1G66980 | Encodes SNC4 (suppressor of npr1-1, constitutive 4), an atypical receptor-like kinase with two predicted extracellular glycerophosphoryl diester phosphodiesterase domains. |
| AT4G16890 | Encodes a Toll Interleukin1 receptor-nucleotide binding-Leu- rich repeat-type resistance gene (TIR-NB-LRR-type) involved in the salicylic acid-dependent defense response pathway. Mutant plants constitutively express pathogenesis-related (PR) genes and are pathogen resistant. Resistance signaling in snc1 requires EDS1, MOS3 and PAD4. |
| AT1G21580 | Encodes a zinc-finger protein that co-localizes with the exosome-associated RNA helicase HEN2 and functions as a co-factor of nuclear RNA quality control by the nucleoplasmic exosome. |
| AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
| AT2G45070 | Sec61 Beta Subunit |
| AT1G62970 | SDJ3 functions partially redundantly with SDJ1 and SDJ2 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
| AT1G67140 | HEAT repeat-containing protein;(source:Araport11) |
| AT1G21700 | a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). |
| AT5G05490 | Encodes a RAD21-like gene essential for meiosis. Encodes a 627 a.a. protein that is slightly longer in the N-terminus than SYN1 BP5. |
| AT1G08560 | member of SYP11 syntaxin Gene Family |
| AT3G24350 | member of Glycoside Hydrolase Family 17 |
| AT2G18260 | member of SYP11 Gene Family |
| AT3G11820 | Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment. |
| AT3G52400 | syntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway |
| AT1G11250 | member of SYP12 Gene Family |
| AT3G03800 | member of SYP13 Gene Family |
| AT4G02195 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP43, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT3G09740 | syntaxin of plants 71 (SYP71) |
| AT3G61450 | syntaxin of plants 73 (SYP73) |
| AT5G12850 | CCCH-type zinc finger protein with ARM repeat domain-containing protein;(source:Araport11) |
| AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
| AT5G14720 | Membrane-localized protein kinase which regulates thermomorphogenesis. |
| AT1G03780 | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT1G04950 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. Mutants are embryo lethal and transmission of the mutant allele through the male gametophyte is significantly reduced. This is due to reduced pollen tube growth of the mutant. |
| AT2G20562 | Encodes a putative signalling peptide with similarity to TAX1. No known function has been demonstrated yet. |
| AT1G27720 | TBP-associated factor 4B;(source:Araport11) |
| AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT4G34340 | Member of SAGA complex, SPT module, interacts with HAG1. |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT1G72010 | Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT3G15030 | Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation. |
| AT2G20080 | hypothetical protein;(source:Araport11) |
| AT4G32700 | Encodes a DNA polymerase required for microhomology mediated repair of DNA double strand breaks and is required for T-DNA integration. The protein contains two conserved functional domains: an N-terminal superfamily II DNA/RNA helicase domain and a C-terminal prokaryotic-type DNA polymerase I domain. Required for regulated cell division and differentiation in meristems. Mutant plants show morphological defects, such as short roots, serrated leaves, and fasciation, as well as defective patterns of cell division and differentiation in the meristem. Mutant plants had 2.5 to 4.5-fold higher expression of ATGR1, ATBRCA1 and RAD51 genes. TEB is required for normal progression of DNA replication and for correct expression of genes during development. |
| AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
| AT5G60970 | TCP gene involved in heterochronic control of leaf differentiation. Transcription factor which controls thermomorphogenesis by positively regulating PIF4 activity. |
| AT3G27010 | Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes. |
| AT1G69690 | AtTCP15 is involved in the regulation of endoreduplication. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT1G67770 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined. |
| AT5G03840 | Controls inflorescence meristem identity. Involved in the floral initiation process. Ortholog of the Antirrhinum gene CENTRORADIALIS (CEN). Involved in protein trafficking to the protein storage vacuole. TFL1 plays an antagonistic role to FT/TSF in the determination of inflorescence meristem identity. |
| AT1G61120 | Encodes a geranyllinalool synthase that produces a precursor to TMTT, a volatile plant defense C16-homoterpene. GES transcript levels rise in response to alamethicin, a fungal peptide mixture that damages membranes. This transcriptional response is blocked in JA biosynthetic and JA signaling mutants, but GES transcript levels still rise in response to alamethicin in mutants with salicylic acid and ethylene biosynthetic and/or signaling defects. GES transcripts also accumulate in response to a larval infestation. This enzyme does not localize to the plastids, and it may be present in the cytosol or endoplasmic reticulum. The mRNA is cell-to-cell mobile. |
| AT5G23960 | Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in the stigma. |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT5G23030 | Member of TETRASPANIN family |
| AT2G03840 | TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development. |
| AT2G01960 | Member of TETRASPANIN family |
| AT3G17880 | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
| AT3G04710 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT1G08320 | bZIP transcription factor family protein;(source:Araport11) |
| AT3G12250 | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
| AT4G24180 | Root-specific expression activated in response to rhizobacteria and ACC. Role in induced systemic resistance. |
| AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT1G22940 | Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media. |
| AT5G26000 | member of Glycoside Hydrolase Family 1. encodes one of two known functional myrosinase enzymes in Arabidopsis. The enzyme catalyzes the hydrolysis of glucosinolates into compounds that are toxic to various microbes and herbivores. |
| AT5G48375 | Is a myrosinase pseudogene that codes for a truncated and frameshifted protein. Although TGG3 apparently is a pseudogene, its mRNA is expressed specifically in stamen and petal according to RT-PCR analysis. Western analysis shows no band of the size expected for a TGG3 protein. |
| AT5G39950 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT3G02730 | Encodes a type-f thioredoxin. Has a role in the short-term activation of carbon metabolism. Loss affects growth under short-day conditions. |
| AT1G45145 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT1G59730 | Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1. |
| AT3G08710 | Associated to plasma membrane. Moves cell to cell, suggesting a role in intercellular communication. The redox reaction between oxidized AtGPX3 and reduced AtTRXh9 is realized through the forming and breaking of disulfide bonds via the active sites of Cys4 and Cys57 in AtTRXh9. |
| AT1G43560 | thioredoxin Y2;(source:Araport11) |
| AT1G65980 | thioredoxin-dependent peroxidase |
| AT4G09010 | Encodes a thylakoid lumen protein that was initially believed to act as a microsomal ascorbate peroxidase APX4 but to date, no evidence of enzymatic activity has been found. |
| AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
| AT1G53190 | Encodes a RING-type E3 ligase that positively regulates CIN-like TCP activity to promote leaf development by mediating the degradation of the TCP repressor TIE1. |
| AT4G32570 | TIFY domain protein 8;(source:Araport11) |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT5G44920 | Encodes a KASH domain protein that localizes to the nuclear envelope and affects nuclear morphology. |
| AT1G72950 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT5G48780 | disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G72870 | TIR-NBS gene. |
| AT1G72890 | NBS TIR protein. |
| AT1G72910 | Nucleotide-binding, leucine-rich repeat (NLR) gene regulated by nonsense-mediated mRNA decay (NMD) genes UPF1 and UPF3. |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT5G16880 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT1G21380 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT1G76970 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G23020 | hypothetical protein;(source:Araport11) |
| AT5G43880 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
| AT4G25430 | hypothetical protein;(source:Araport11) |
| AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT1G74160 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT5G26910 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
| AT4G00770 | DUF4378 domain protein;(source:Araport11) |
| AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
| AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
| AT1G80080 | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
| AT3G23890 | Encodes a topoisomerase II that is highly expressed in young seedlings. The protein is localized in the nucleus and gene expression levels are increased in proliferative tissues. |
| AT5G57560 | Encodes a cell wall-modifying enzyme, rapidly upregulated in response to environmental stimuli. |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
| AT5G57460 | TPLATE complex subunit involved in clathirin mediated endocytosis. |
| AT2G39675 | Trans-acting siRNA1c primary transcript (TAS1c). Gb: AY922999 |
| AT3G17185 | Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G23230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G60750 | Transketolase;(source:Araport11) |
| AT1G10840 | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
| AT5G43970 | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
| AT4G23430 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G02510 | An integral membrane GTPase that functions as a transit-sequence receptor required for the import of proteins necessary for chloroplast biogenesis. Located in the outer chloroplast membrane. Phosphorylation of the G-domains regulate translocon assembly. The mRNA is cell-to-cell mobile. |
| AT3G17970 | Integral chloroplast outer membrane protein. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G36060 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2. |
| AT3G24660 | member of Receptor kinase-like protein family |
| AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT5G35550 | TT2 encodes a R2R3 MYB domain putative transcription factor that acts as a key determinant in the proanthocyanidin accumulation of developing seed. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
| AT4G09820 | TT8 is a regulation factor that acts in a concerted action with TT1, PAP1 and TTG1 on the regulation of flavonoid pathways, namely proanthocyanidin and anthocyanin biosynthesis. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Also important for important for marginal trichome development. It binds the promoter of both AT3G26790 and AT1G28300.TT8 interacts with JAZ proteins to regulate anthocyanin accumulation. TT8 acts maternally to affect seed FA biosynthesis and inhibits seed FA accumulation by down-regulating a group of genes either critical to embryonic development or important in the FA biosynthesis pathway. TT8 represses the activities of LEAFY COTYLEDON1, LEAFY COTYLEDON2, and FUSCA3, the critical transcriptional factors important for seed development. |
| AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
| AT5G24520 | Required for the accumulation of purple anthocyanins in leaves and stems. Involved in trichome and root hair development. Controls epidermal cell fate specification. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Based on clonal analysis and other methonds TTG1 has been shown to act non-cell autonomously and to move via plasmodesmata between cells.Localization and levels of TTG1 affect patterning of leaf trichomes. Auxin and ethylene responsiveness of TTG1 transcription is lost in myb12 mutants. |
| AT2G16950 | TRN1 is an importin beta protein that functions as a nuclear import receptor for AtGRP7 and in interacts with AGO1 to affect miRNA loading. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G78090 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G03780 | Encodes a protein whose sequence is similar to human telomere proteins. This belongs to TRFL family 2, which do not show DNA binding in vitro. |
| AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
| AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
| AT3G12060 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G40150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
| AT5G01620 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL35 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. The biochemical phenotype can be observed in tbl35 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G48880 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G27695 | TGD5 encodes a small glycine rich protein that is localized to the chloroplast envelope and is a component of the ER to plastid lipid trafficking pathway. TGD5 interacts with other components of this pathway including TGD1, TGD2, TGD3, and TGD4. |
| AT1G45231 | Encodes a trimethylguanosine synthase that is required for chilling tolerance. tgs1 mutant have a striking chilling sensitive phenotype in which leaf and flower development are dramatically disrupted after long-term chilling treatment. |
| AT4G20850 | Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant. |
| AT5G53200 | Encodes a R3MYB transcription inhibitor that regulates trichome patterning. Mutants produce trichome clusters whereas other transcriptional inhibitors involved in this patterning are involved in trichome density regulation. Natural hypofunctional alleles producing trichome development in fruits have been found. |
| AT1G05830 | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1. |
| AT1G78190 | Trm112p-like protein;(source:Araport11) |
| AT3G21300 | RNA methyltransferase family protein;(source:Araport11) |
| AT4G04670 | Met-10+ like family protein / kelch repeat-containing protein;(source:Araport11) |
| AT2G29330 | tropinone reductase;(source:Araport11) |
| AT2G43510 | Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory. |
| AT1G70560 | TAA1 is involved in the shade-induced production of indole-3-pyruvate (IPA), a precursor to IAA, a biologically active auxin. It is also involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling. This enzyme can catalyze the formation of IPA from L-tryptophan. Though L-Trp is expected to be the preferred substrate in vivo, TAA1 also acts as an aminotransferase using L-Phe, L-Tyr, L-Leu, L-Ala, L-Met, and L-Gln. Lines carrying mutations in this gene are unaffected by auxin transporter inhibitor NPA. Double mutant analysis and exogenous auxin treatment suggest that this gene is required for auxin signaling during lateral root and root meristem development. The activity of TAA1 can be controlled by phosphorylation of residue T101, which, when phosphorylated results in loss of activity. TAA1 is a target of TMK4. |
| AT1G34060 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G38530 | TSBtype2 encodes a type 2 tryptophan synthase beta subunit that catalyzes a condensation reaction between serine and indole to generate tryptophan.It appears to form a homodimer. Its biological role has not yet been determined, but it has a very high affinity for indole which may be involved in allowing TSBtype2 to carefully limit free indole build-up. But, to date no overall change in plant morphology or seedling root growth have been observed in tsbtype2 mutants, indicating that this gene is not essential under optimum conditions. n most organs, TSBtype2 is transcripts are expressed at a lower level than TSB1 but in dry seeds they are expressed at comparable levels. |
| AT2G36960 | Arabidopsis thaliana myb/SANT domain protein |
| AT1G76900 | Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM. |
| AT5G18680 | Member of TLP family of tubby like proteins that also contain an F-Box. Localized to the plasma membrane. |
| AT1G61940 | Member of TLP family |
| AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
| AT4G14960 | Encodes an alpha-tubulin isoform required for right handed helical growth. |
| AT5G62690 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
| AT3G21640 | encodes a 42 kDa FK506-binding protein (AtFKBP42) that possesses similarity to multidomain peptidyl-prolyl cis/trans isomerases (PPIases, EC 5.2.1.8), which are known to be components of mammalian steroid hormone receptor complexes. The protein appears to be localized to the plasma membrane by electron microscopy and binds to HSP90.1 and calmodulin in vitro. It also aggregates citrate synthase in vitro but does NOT show PPIase activity in vivo. Mutants are reduced in size and exhibit disoriented growth in all organs. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT2G29400 | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
| AT5G43380 | encodes a type I serine/threonine protein phosphatase expressed in expressed in roots, rosettes and flowers. |
| AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
| AT2G24850 | Encodes a tyrosine aminotransferase that is responsive to treatment with jasmonic acid. |
| AT3G49810 | Encodes a protein with E3 ubiquitin ligase activity that is involved in negative regulation of salt stress tolerance during germination. |
| AT1G09760 | U2 small nuclear ribonucleoprotein A;(source:Araport11) |
| AT5G09585 | U2;(source:Araport11) |
| AT3G06910 | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. In vitro assays suggest that this enzyme is active against SUMO1 and SUMO2. It has weak activity with SUMO3 and cannot act on SUMO5. The N-terminal regulatory region of this protein is required for full activity. Suppresses growth during salt stress. |
| AT2G35635 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. The mRNA is cell-to-cell mobile. |
| AT3G09790 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. |
| AT5G06460 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. The mRNA is cell-to-cell mobile. |
| AT4G17510 | ubiquitin C-terminal hydrolase 3;(source:Araport11) |
| AT5G66240 | Encodes a WD40-repeat protein that interacts with the E3 Cullin Ring Ligase subunit DDB1a and is involved in secondary wall modification and thickening by regulating the degradation of specific proteins. RNAi-mediated silencing results in anther indehiscence and infertility. |
| AT3G17205 | ubiquitin protein ligase 6;(source:Araport11) |
| AT1G50490 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells. |
| AT2G16920 | ubiquitin-conjugating enzyme 23;(source:Araport11) |
| AT3G15355 | ubiquitin-conjugating enzyme 25;(source:Araport11) |
| AT5G50430 | ubiquitin-conjugating enzyme 33;(source:Araport11) |
| AT3G45180 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
| AT1G32850 | ubiquitin-specific protease 11;(source:Araport11) |
| AT4G17895 | Encodes a ubiquitin-specific protease. |
| AT2G22310 | Encodes a ubiquitin-specific protease. |
| AT3G21280 | Encodes a ubiquitin-specific protease. |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
| AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
| AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
| AT1G14360 | UDP-galactose transporter 3;(source:Araport11) |
| AT4G31600 | Encodes a Golgi-localized UDP?glucose/UDP?galactose transporter that affects lateral root emergence. |
| AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
| AT2G29750 | UDP-glucosyl transferase 71C1;(source:Araport11) |
| AT2G29730 | UDP-glucosyl transferase 71D1;(source:Araport11) |
| AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
| AT3G53150 | UDP-glucosyl transferase 73D1;(source:Araport11) |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
| AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
| AT1G22380 | Encodes a putative UDP-glucosyl transferase. At1g22380 was initially identified as encoding the protein AAF87154, which has been classified as a bHLH protein (AtbHLH152). Subsequently it has been found that the AAF87154 protein appears to be encoded by the AT1G23970 genomic locus. |
| AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT3G55700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G09500 | Glycosyltransferase which negatively regulates hypoxia stress response. |
| AT1G21070 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G42420 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G28760 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT5G41150 | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
| AT5G58970 | UCP2 and its paralog UCP1 is a member of the PUMP2 family of uncoupling proteins. It functions as a mitochondrial transporter of spartate, glutamate and dicarboxylates. |
| AT1G14140 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT2G22500 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
| AT1G33430 | UPEX1 is arabinogalactan b-(1,3)-galactosyltransferase involved in the formation of pollen exine. Belongs to GT31 family. Mutants have reduced levels of AGPs. GALT8 has some but not complete functional overlap with KNS4/UPEX1. |
| AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
| AT4G26330 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G49320 | Encodes USPL1, a BURP domain protein targeted to the protein storage vacuoles. Overexpression of USPL1 affects seed development, protein storage vacuoles and lipid vesicles morphology and function. |
| AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT5G43580 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
| AT2G31670 | Stress responsive alpha-beta barrel domain protein;(source:Araport11) |
| AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression. |
| AT5G01230 | Encodes a tRNA methyltransferase that mediates the 2'-O-ribose methylation of selected tRNA species in the anticodon loop. Mutation of this gene compromises plant immunity against bacteria. |
| AT1G67550 | Encodes a nickel-containing urea hydrolase involved in nitrogen recycling. It requires three urease accessory proteins for its activation. The mRNA is cell-to-cell mobile. |
| AT2G35035 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
| AT1G21840 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
| AT2G34470 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
| AT2G03590 | Encodes a member of a class of allantoin transporters. |
| AT2G03600 | Encodes UPS3 (ureide permease 3), similar to UPS1, an allantoin transporter. |
| AT1G26440 | Encodes a ureide permease, uptake assays in yeast mutants indicated the longer splice variant is a cellular importer for allantoin, uracil and xanthine. Encodes 2 splice variants, UPS5L and UPS5S, which under nonstress conditions may function in allantoin degradation for nutrient recycling, whereas under stress, both genes may be involved in vesicular export allowing allantoin translocation from roots to shoots. |
| AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT2G36310 | Encodes a cytoplasmic nucleoside hydrolase. It has the highest levels of activity with uridine followed by xanthosine. It shows little activity with inosine and none with cytidine. Mutant analyses indicate that it plays a role in purine and pyrimidine catabolism. |
| AT2G37450 | nodulin MtN21-like transporter family protein |
| AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT5G13670 | nodulin MtN21-like transporter family protein |
| AT1G21890 | nodulin MtN21-like transporter family protein |
| AT1G25270 | nodulin MtN21-like transporter family protein |
| AT4G01450 | nodulin MtN21-like transporter family protein |
| AT3G30340 | nodulin MtN21-like transporter family protein |
| AT5G40230 | nodulin MtN21-like transporter family protein |
| AT5G40212 | Pseudogene of AT5G40240; nodulin MtN21 family protein |
| AT5G40240 | nodulin MtN21-like transporter family protein |
| AT3G15620 | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT2G42260 | Encodes a novel plant-specific protein of unknown function. The UVI4 gene is expressed mainly in actively dividing cells. The hypocotyl cells in mutant seedlings undergo one extra round of endoreduplication. The uvi4 mutation also promoted the progression of endo-reduplication during leaf development. |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT4G38510 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. |
| AT1G20260 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
| AT2G14740 | Encodes a vacuolar sorting receptor that participates in vacuolar sorting in vegetative tissues and in seeds. The mRNA is cell-to-cell mobile. |
| AT3G03090 | Encodes a vacuolar membrane-localized glucose transporter that can also transport fructose. Mutations in these gene have effects on seed germination and time to flowering. |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT3G01390 | Subunit G of the vacuolar membrane ATPAse complex |
| AT5G53530 | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
| AT3G61770 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT2G14720 | encodes a vacuolar sorting receptor |
| AT2G34940 | VACUOLAR SORTING RECEPTOR 5;(source:Araport11) |
| AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
| AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
| AT2G38020 | necessary for proper vacuole formation and morphogenesis in Arabidopsis |
| AT2G17740 | VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development. |
| AT3G60600 | Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2. |
| AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G42270 | VAR1 contains a conserved motif for ATPase and a metalloprotease characteristic to FtsH proteins, and is targeted into chloroplasts. A VAR1-fusion protein synthesized in vitro exhibited ATPase activity and partial metalloprotease activity. This protein is located to the thylakoid membrane and forms a complex with VAR2. FtsH1 (VAR1) and FtsH5 are interchangeable in thylakoid membranes. Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
| AT1G02120 | Encodes VAD1 (Vascular Associated Death1), a regulator of cell death and defense responses in vascular tissues. VAD1 is a putative membrane associated protein and contains a GRAM domain. vad1 is a lesion mimic mutant that exhibits light conditional appearance of propagative HR (hypersensitive response)-like lesions along the vascular system. The mRNA is cell-to-cell mobile. |
| AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
| AT5G54790 | CTD small phosphatase-like protein;(source:Araport11) |
| AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
| AT4G29260 | VSP3 is a secreted acid phosphatase. |
| AT5G40270 | VEN4 is homologous to human SAMHD1 and functions in chloroplast biogenesis. |
| AT5G61150 | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. Member of PAF-C complex. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT3G54300 | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
| AT1G14000 | Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. The mRNA is cell-to-cell mobile. |
| AT2G29890 | Encodes a ubiquitously expressed villin-like protein, whose mRNA may be alternatively processed. Villin belongs to a superfamily of actin binding proteins called the villin/gelsolin family. Animal villins are involved in actin binding. VLN1 protein co-localizes with actin filaments in several assays. VLN1 binds and bundles F-actin in a calcium-independent manner. It does not nucleate, cap or sever actin filaments and it stabilizes actin filaments, protecting them from ADF-mediated depolymerization. |
| AT4G30160 | Encodes a major actin filament bundling protein that is involved in root hair growth through regulating actin organization in a Ca2+-dependent manner. |
| AT3G49480 | F-Box Gene regulated by Agrobacterium virulence protein VirD5 and essential for Agrobacterium-mediated plant transformation. |
| AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT4G32770 | Tocopherol cyclase involved in tocopherol (vitamin E)synthesis. VTE1 over-expressing plants have increased tocopherol indicating VTE1 is a major limiting factor in tocopherol synthesis. Mutants defective in this gene accumulate high amounts of zeaxanthin in conditions of high light or low temperature. Plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT5G15090 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. Purified VDAC3 is shown to have voltage-dependent anion channel activity. |
| AT3G18360 | Member of VQ gene family. VQ proteins are named for the VQ motif (FxxxVQxxTG), a conserved amino acid region. Interacts with members of WRKY gene family, involved in pollen development. |
| AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development. |
| AT1G79680 | Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP. |
| AT1G16260 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16140 | Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
| AT1G16160 | WAK-like kinase The mRNA is cell-to-cell mobile. |
| AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
| AT1G21270 | cytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase. |
| AT1G58070 | WALLIN is an actin binding protein involved in ROP11 mediated xylem pit patterning. |
| AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G71260 | Encodes WHY2, a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to mitochondria and not the nucleus. WHY2 is a member of the Whirly family proteins present mainly in the plant kingdom performing various activities related to DNA metabolism. Crystal structure of Solanum tuberosum WHY2, a close homolog of Arabidopsis WHY2, reveal that Whirly proteins bind to single strand DNA to promote accurate repair of DNA double-strand breaks over an error-prone repair pathway. |
| AT2G41420 | proline-rich family protein;(source:Araport11) |
| AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT1G11060 | Encodes one of two redundant proteins (the other is WAPL2) that are involved in prophase removal of cohesion during meiosis. Double mutants with wapl2 exhibit reduced fertility due to defects in meiosis and also some abnormal embryo development in rare cases where embryos are formed. |
| AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
| AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
| AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT1G30650 | member of WRKY Transcription Factor; Group II-e |
| AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G31800 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Constitutive expression of WRKY18 enhanced resistance to P. syringae, but its coexpression with WRKY40 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
| AT4G18170 | Member of WRKY Transcription Factor; Group II-c. Involved in the activation of salicylic acid biosynthesis genes ICS1 and PBS3. In the ovule, it is expressed in hypodermal somatic cells and appears to play a role in supression of megasporocyte cell fate. In the leaf if is upstream of FHY3 and regulates light-mediated leaf senescence. |
| AT5G24110 | member of WRKY Transcription Factor; Group III |
| AT4G22070 | member of WRKY Transcription Factor; Group II-b |
| AT4G30935 | member of WRKY Transcription Factor; Group I |
| AT2G38470 | Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT4G26440 | member of WRKY Transcription Factor; Group I |
| AT2G34830 | member of WRKY Transcription Factor; Group II-e |
| AT5G22570 | member of WRKY Transcription Factor; Group III |
| AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G43290 | member of WRKY Transcription Factor; Group II-c |
| AT5G26170 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT2G40740 | member of WRKY Transcription Factor; Group III |
| AT3G01080 | member of WRKY Transcription Factor; Group I |
| AT2G25000 | Pathogen-induced transcription factor. Forms protein complexes with itself and with WRKY40. Coexpression with WRKY18 or WRKY40 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT5G01900 | member of WRKY Transcription Factor; Group III |
| AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
| AT1G29860 | member of WRKY Transcription Factor; Group II-c |
| AT5G15130 | member of WRKY Transcription Factor; Group II-b; contribute to basal immunity. The mRNA is cell-to-cell mobile. |
| AT5G46350 | member of WRKY Transcription Factor; Group II-c |
| AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT4G35550 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT1G46480 | Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
| AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
| AT4G14365 | hypothetical protein;(source:Araport11) |
| AT5G64530 | xylem NAC domain 1;(source:Araport11) |
| AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
| AT4G14130 | xyloglucan endotransglycosylase-related protein (XTR7) |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G13090 | xyloglucan endotransglucosylase/hydrolase 2;(source:Araport11) |
| AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
| AT4G18990 | xyloglucan endotransglucosylase/hydrolase 29;(source:Araport11) |
| AT1G32170 | xyloglucan endotransglycosylase-related protein (XTR4) The mRNA is cell-to-cell mobile. |
| AT2G36870 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1). By sequence similarity to XTH31 (At3g44990) and in vivo analysis, likely to exhibit predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
| AT2G35610 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT5G17630 | Phosphate translocator family member which resides in the plastid inner envelope membrane. Retrieves excessive pentose phosphates from the extra-plastidial space and makes them available to the plastids. |
| AT4G05410 | Encodes a nucleolar protein with seven WD40-repeats that plays a role in embryo sac development and is critical for the correct positioning of the division plane of zygote and the apical cell lineage in Arabidopsis. YAO may act by modulating nucleolar function, such as rRNA biogenesis, during early embryogenesis and gametogenesis. |
| AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
| AT5G41000 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT1G48370 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT3G51430 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT5G51640 | Encodes leaf-senescence-related protein. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G63700 | Member of MEKK subfamily, a component of the stomatal development regulatory pathway. Mutations in this locus result in embryo lethality. |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
| AT5G57360 | Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1. |
| AT1G56590 | Involved in vesicle trafficking between the trans -Golgi network and vacuoles. |
| AT2G32930 | Encodes a zinc finger protein. |
| AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G31260 | member of Fe(II) transporter isolog family |
| AT3G20870 | ZIP metal ion transporter family;(source:Araport11) |
| AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT1G80730 | Encodes a zinc finger protein and is expressed at high levels in the shoot apex, including the apical meristem, developing leaves and the developing vascular system. expression induced three days post germination. T-DNA insertion mutant has a dominant phenotype in leaf initiation. |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G59520 | encodes a metal ion transporter whose expression is regulated by copper. |
| AT5G65930 | encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches. |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |