| AT1G01030 | AP2/B3-like transcriptional factor family protein. |
| AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G01115 | unknown protein |
| AT1G01140 | Encodes a CBL-interacting protein kinase with similarity to SOS2 |
| AT1G01200 | RAB GTPase homolog A3. |
| AT1G01210 | DNA-directed RNA polymerase, subunit M, archaeal. |
| AT1G01230 | ORM1 is an ER localized orosomucoid-like protein involved in sphingolipid homeostasis. |
| AT1G01240 | transmembrane protein. |
| AT1G01260 | bHLH13 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH14 and bHLH17 to negatively regulate jasmonate responses. |
| AT1G01290 | COFACTOR OF NITRATE REDUCTASE AND XANTHINE DEHYDROGENASE 3. Encodes a protein involved in molybdenum cofactor biosynthesis. |
| AT1G01300 | Eukaryotic aspartyl protease family protein. |
| AT1G01305 | hypothetical protein. |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
| AT1G01430 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers.Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G01440 | hypothetical protein (DUF3133). |
| AT1G01471 | unknown protein |
| AT1G01490 | Heavy metal transport/detoxification superfamily protein. |
| AT1G01540 | Protein kinase superfamily protein. |
| AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. |
| AT1G01570 | transferring glycosyl group transferase (DUF604). |
| AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
| AT1G01630 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4. |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01700 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G01710 | acyl-CoA thioesterase II. |
| AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. |
| AT1G01750 | actin depolymerizing factor 11. |
| AT1G01800 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT1G01840 | AP2-like ethylene-responsive transcription factor SNZ. |
| AT1G01990 | hypothetical protein. |
| AT1G02180 | ferredoxin-like protein. |
| AT1G02190 | Fatty acid hydroxylase superfamily. |
| AT1G02210 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein. |
| AT1G02310 | Glycosyl hydrolase superfamily protein. |
| AT1G02350 | protoporphyrinogen oxidase-like protein. |
| AT1G02360 | Chitinase family protein. |
| AT1G02390 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT1G02391 | unknown protein |
| AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
| AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
| AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein. |
| AT1G02560 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT1G02575 | transmembrane protein. |
| AT1G02630 | Nucleoside transporter family protein. |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. |
| AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT1G02660 | PLIP2 is a glycerolipid A1 lipase with substrate preference for monogalactosyldiacylglycerol. Expression is induced by ABA. |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily. |
| AT1G02813 | pectinesterase (Protein of unknown function, DUF538). |
| AT1G02816 | pectinesterase (Protein of unknown function, DUF538). |
| AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
| AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT1G02890 | AAA-type ATPase family protein. |
| AT1G02900 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. Mediates Ca2+-dependent signaling. Regulates the splicing of flowering genes and exerts an opposite effect on the flowering time compared with FER. |
| AT1G02990 | hypothetical protein. |
| AT1G03000 | Encodes an apparent ATPase similar to yeast and human protein required for peroxisomal biogenesis. May facilitate recycling of PEX5, the peroxisomal matrix protein receptor, and thereby promote peroxisomal matrix protein import. |
| AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
| AT1G03080 | kinase interacting (KIP1-like) family protein. |
| AT1G03090 | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT1G03220 | Eukaryotic aspartyl protease family protein. |
| AT1G03230 | Eukaryotic aspartyl protease family protein. |
| AT1G03457 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT1G03590 | Protein phosphatase 2C family protein. |
| AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
| AT1G03610 | plant/protein (DUF789). |
| AT1G03700 | Uncharacterized protein family (UPF0497). |
| AT1G03710 | Cystatin/monellin superfamily protein. |
| AT1G03730 | pyrroline-5-carboxylate reductase. |
| AT1G03740 | Protein kinase superfamily protein. |
| AT1G03780 | Homolog of vertebrate TPX2. Protein has three domains involved in nuclear targeting, one in nuclear export and two in microtubule binding. Involved in mitotic spindle assembly during late prophase and early prometaphase. |
| AT1G03800 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-10). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT1G03860 | prohibitin 2 |
| AT1G03870 | fasciclin-like arabinogalactan-protein 9 (Fla9). Possibly involved in embryogenesis and seed development. |
| AT1G03920 | Protein kinase family protein. |
| AT1G03930 | Phosphorylates serine, threonine, and tyrosine |
| AT1G03980 | Encodes a protein with phytochelatin synthase activity which binds Cd2+ and Cd-glutathione complexes with high affinity. The protein has been postulated to be involved in Cd2+ tolerance. AtPCS2 expression appears to be less than that of AtPCS1, explaining the inability of endogenous AtPCS2 to substitute for AtPCS1 in the cad1-3 mutant (AtPCS1 null). |
| AT1G03982 | PAK-box/P21-Rho-binding family protein. |
| AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein. |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein. |
| AT1G04180 | YUCCA 9. |
| AT1G04240 | SHY2/IAA3 regulates multiple auxin responses in roots. It is induced rapidly by IAA, and has been shown to be phosphorylated by oat phytochrome A in vitro. |
| AT1G04250 | Transcription regulator acting as repressor of auxin-inducible gene expression. |
| AT1G04260 | Encodes protein that interacts with CaMV movement protein. |
| AT1G04320 | pre-tRNA tRNA-Gly (anticodon: GCC). |
| AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT1G04420 | NAD(P)-linked oxidoreductase superfamily protein. |
| AT1G04425 | other_RNA. |
| AT1G04440 | Member of CKL gene family (CKL-C group). |
| AT1G04445 | C2H2-like zinc finger protein. |
| AT1G04490 | hypothetical protein (DUF3527). |
| AT1G04500 | CCT motif family protein. |
| AT1G04530 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT1G04680 | Pectin lyase-like superfamily protein. |
| AT1G04770 | SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis. |
| AT1G04830 | Ypt/Rab-GAP domain of gyp1p superfamily protein. |
| AT1G04840 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT1G04985 | triacylglycerol lipase-like protein. |
| AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein. |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT1G05170 | Galactosyltransferase family protein. |
| AT1G05200 | Encodes a putative glutamate receptor GLR3 with dual localization in plastid and plasma membrane. |
| AT1G05230 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Mutants have trichomes that appear glass-like under a dissecting microscope as compared to the wild-type trichomes. The mutations do not affect trichome growth or branch number. |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT1G05320 | myosin heavy chain, embryonic smooth protein. |
| AT1G05330 | hypothetical protein. |
| AT1G05340 | cysteine-rich TM module stress tolerance protein. |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT1G05420 | ovate family protein 12. |
| AT1G05460 | Encodes a protein with similarity to RNA helicases. Mutants are defective in post-transcriptional gene silencing. |
| AT1G05575 | transmembrane protein. |
| AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
| AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
| AT1G05630 | Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light?stimulated increase in cytosolic calcium ion. |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein. |
| AT1G05710 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT1G05785 | Got1/Sft2-like vescicle transport protein family. |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT1G05830 | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1. |
| AT1G05835 | PhD finger protein. |
| AT1G05870 | hypothetical protein (DUF1685). |
| AT1G05950 | hypothetical protein. |
| AT1G05960 | ARM repeat superfamily protein. |
| AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
| AT1G06002 | Natural antisense transcript overlaps with AT1G06000. |
| AT1G06010 | basic leucine zipper/W2 domain protein. |
| AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein. |
| AT1G06110 | SKP1/ASK-interacting protein 16. |
| AT1G06120 | Membrane bound acyl-lipid desaturases |
| AT1G06130 | glyoxalase 2-4. |
| AT1G06148 | hypothetical protein. |
| AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT1G06200 | Peptidase S24/S26A/S26B/S26C family protein. |
| AT1G06210 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT1G06350 | Fatty acid desaturase family protein. |
| AT1G06360 | ADS4.2 has strong desaturase activity on acyl-CoA substrates longer than C32 |
| AT1G06400 | small GTP-binding protein (ara-2).RabGTPase functioning in anterograde trafficking from trans-Golgi network/early endosomal compartments to the plasma membrane as well as in responses to salinity stress. |
| AT1G06480 | pre-tRNA tRNA-Ile (anticodon: AAT). |
| AT1G06530 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR2. Involved in mitochondrial morphogenesis. |
| AT1G06590 | anaphase-promoting complex subunit. |
| AT1G06610 | pre-tRNA tRNA-Ala (anticodon: AGC). |
| AT1G06620 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase |
| AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase |
| AT1G06800 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G06810 | endonuclease/glycosyl hydrolase. |
| AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
| AT1G06850 | bZIP protein involved in heat stress response. Under heat stress localization moves exclusively to nucleus. |
| AT1G07080 | Thioredoxin superfamily protein. |
| AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640). |
| AT1G07100 | pre-tRNA tRNA-Ile (anticodon: TAT). |
| AT1G07110 | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. |
| AT1G07135 | glycine-rich protein. |
| AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
| AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
| AT1G07240 | Encodes a UDP-glucosyltransferase that plays a role in abscisic acid (ABA) glucosylation from ABA to ABA-glucose ester and regulates ABA homeostasis, thereby influencing the ABA signal network. |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT1G07410 | RAB GTPase homolog A2B. |
| AT1G07420 | Arabidopsis thaliana sterol 4-alpha-methyl-oxidase mRNA. The sterol 4alpha-methyl oxidase2 family proteins SMO2-1 and SMO2-2 function partially through effects on auxin accumulation, auxin response and PIN1 expression to regulate embryogenesis in Arabidopsis. |
| AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
| AT1G07500 | SMR5 is a member of the SIAMESE-RELATED Cyclin-Dependent Kinase Inhibitor family. It is induced by ROS/oxidative stress. |
| AT1G07510 | encodes an FtsH protease that is localized to the mitochondrion |
| AT1G07520 | GRAS family transcription factor. |
| AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
| AT1G07540 | Arabidopsis thaliana telomere-binding protein, putative (At1g07540) |
| AT1G07550 | Leucine-rich repeat protein kinase family protein. |
| AT1G07560 | Leucine-rich repeat protein kinase family protein. |
| AT1G07570 | Protein kinase capable of phosphorylating tyrosine, serine, and threonine residues |
| AT1G07590 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT1G07600 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT1G07670 | TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT1G07750 | RmlC-like cupins superfamily protein. |
| AT1G07870 | Protein kinase superfamily protein. |
| AT1G07880 | member of MAP Kinase |
| AT1G07885 | hypothetical protein. |
| AT1G07890 | Encodes a cytosolic ascorbate peroxidase APX1. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. |
| AT1G07980 | nuclear factor Y, subunit C10. |
| AT1G07985 | Expressed protein. |
| AT1G08010 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT1G08030 | Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine). |
| AT1G08200 | Encodes a putative UDP-D-apiose/UPD-D-xylose synthetase. |
| AT1G08210 | Eukaryotic aspartyl protease family protein. |
| AT1G08320 | bZIP transcription factor family protein. |
| AT1G08500 | early nodulin-like protein 18. |
| AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
| AT1G08660 | Encodes a sialyltransferase-like protein that is localized to the Golgi apparatus and is involved in pollen tube growth and pollen germination. |
| AT1G08670 | ENTH/VHS family protein. |
| AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT1G08930 | encodes a putative sucrose transporter whose gene expression is induced by dehydration and cold. |
| AT1G08990 | plant glycogenin-like starch initiation protein 5. |
| AT1G09080 | Heat shock protein 70 (Hsp 70) family protein. |
| AT1G09090 | NADPH-oxidase AtrbohB plays a role in seed after-ripening. Major producer of superoxide in germinating seeds. AtrbohB pre-mRNA is alternatively spliced in seeds in a hormonally and developmentally regulated manner. ABA caused accumulation of AtrbohB-? mRNA and prevented prevented AtrbohB-a mRNA expression in fresh seeds. |
| AT1G09150 | pseudouridine synthase and archaeosine transglycosylase (PUA) domain-containing protein. |
| AT1G09155 | phloem protein 2-B15. |
| AT1G09176 | transmembrane protein. |
| AT1G09180 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
| AT1G09230 | Encodes a U12-type spliceosomal protein that is an indispensible component of the minor spliceosome and plays a crucial role in U12 intron splicing and plant development. |
| AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT1G09260 | Chaperone DnaJ-domain superfamily protein. |
| AT1G09470 | NEAP3 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT1G09520 | hypothetical protein. |
| AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
| AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. |
| AT1G09570 | Light-labile cytoplasmic red/far-red light photoreceptor involved in the regulation of photomorphogenesis. It exists in two inter-convertible forms: Pr and Pfr (active) and functions as a dimer.The N terminus carries a single tetrapyrrole chromophore, and the C terminus is involved in dimerization. It is the sole photoreceptor mediating the FR high irradiance response (HIR). Major regulator in red-light induction of phototropic enhancement. Involved in the regulation of de-etiolation. Involved in gravitropism and phototropism. Requires FHY1 for nuclear accumulation. |
| AT1G09580 | emp24/gp25L/p24 family/GOLD family protein. |
| AT1G09780 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT1G09790 | COBRA-like protein 6 precursor. |
| AT1G09850 | Arabidopsis thaliana papain-like cysteine peptidase |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT1G09950 | RESPONSE TO ABA AND SALT 1. |
| AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
| AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. |
| AT1G09980 | Putative serine esterase family protein. |
| AT1G10020 | formin-like protein (DUF1005). |
| AT1G10030 | Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor. |
| AT1G10040 | alpha/beta-Hydrolases superfamily protein. |
| AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4). |
| AT1G10120 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT1G10140 | Uncharacterized conserved protein UCP031279. |
| AT1G10220 | ZCF37. |
| AT1G10360 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT1G10370 | Encodes GSTU17 (Glutathione S-Transferase U17). Functions as a negative component of stress-mediated signal transduction pathways in drought and salt stress responses. |
| AT1G10410 | CW14 protein (DUF1336). |
| AT1G10460 | germin-like protein (GLP7) |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
| AT1G10500 | Involved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues. |
| AT1G10510 | RNI-like superfamily protein. |
| AT1G10530 | PADRE protein |
| AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G10640 | Pectin lyase-like superfamily protein. |
| AT1G10650 | SBP (S-ribonuclease binding protein) family protein. |
| AT1G10660 | transmembrane protein. |
| AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. |
| AT1G10682 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT1G10690 | cyclin-dependent kinase inhibitor. |
| AT1G10700 | Encodes a P-independent phosphoribosyl pyrophosphate (PRPP) synthase. |
| AT1G10740 | alpha/beta-Hydrolases superfamily protein. |
| AT1G10745 | Encodes a Maternally expressed gene (MEG) family protein |
| AT1G10850 | Leucine-rich repeat protein kinase family protein. |
| AT1G10900 | Phosphatidylinositol-4-phosphate 5-kinase family protein. |
| AT1G10940 | Encodes a plant protein kinase similar to the calcium/calmodulin-dependent protein kinase subfamily and the SNF1 kinase subfamily (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Kinase activity of its homolog in tobacco is induced by hyperosmotic condition within 1 minute. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G11000 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO4 belongs to the clade I, with AtMLO11 and AtMLO14. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of root, cotyledons and young leaves, it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G11010 | pre-tRNA tRNA-Met (anticodon: CAT). |
| AT1G11020 | RING/FYVE/PHD zinc finger superfamily protein. |
| AT1G11050 | Protein kinase superfamily protein. |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT1G11180 | Secretory carrier membrane protein (SCAMP) family protein. |
| AT1G11185 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT1G11220 | cotton fiber, putative (DUF761). |
| AT1G11260 | Encodes a H+/hexose cotransporter. |
| AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
| AT1G11320 | GDSL esterase/lipase. |
| AT1G11430 | Encodes a protein involved in RNA editing in chloroplasts. |
| AT1G11440 | hypothetical protein. |
| AT1G11572 | Encodes a Plant thionin family protein |
| AT1G11580 | methylesterase PCR A. |
| AT1G11660 | heat shock protein 70 (Hsp 70) family protein. |
| AT1G11670 | MATE efflux family protein. |
| AT1G11690 | BRANCHLESS TRICHOME-like protein. |
| AT1G11710 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
| AT1G11820 | O-Glycosyl hydrolases family 17 protein. |
| AT1G11840 | Encodes Ni+ dependent glyoxalase I homolog ATGLX1. |
| AT1G12015 | snoRNA. |
| AT1G12100 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT1G12120 | hypothetical protein (DUF863). |
| AT1G12190 | F-box and associated interaction domains-containing protein. |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. |
| AT1G12310 | Calcium-binding EF-hand family protein. |
| AT1G12411 | hypothetical protein. |
| AT1G12420 | ACT domain repeat 8. |
| AT1G12423 | unknown protein |
| AT1G12460 | Leucine-rich repeat protein kinase family protein. |
| AT1G12510 | pre-tRNA tRNA-Val (anticodon: AAC). |
| AT1G12520 | Copper-zinc superoxide dismutase copper chaperone (delivers copper to the Cu-Zn superoxide dismutase). Localized to the chloroplast. Expressed in roots and shoots. Up-regulated in response to copper and senescence. The AtACC activates all three CuZnSOD activities located in three different subcellular compartments. Contains three domains, central, ATX-1 like and C-terminal. ATX-1 like domain essential for the copper chaperone function of AtCCS in planta. |
| AT1G12540 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT1G12550 | Encodes a hydroxypyruvate reductase that reduces HP to glycerate and shows even more activity with glyoxylate, a more upstream intermediate of the photorespiratory cycle. It is likely targeted to the chloroplast where it could provide a compensatory bypass for the reduction of HP and glyoxylate within this compartment. Together with HPPR2 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
| AT1G12560 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Containing a conserved root hair-specific cis-element RHE. Expressed specifically in root hair cell and involved in root hair elongation. |
| AT1G12580 | phosphoenolpyruvate carboxylase-related kinase 1. |
| AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
| AT1G12665 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G12700 | Encodes RNA PROCESSING FACTOR 1 (RPF1), a pentatricopeptide repeat (PPR) protein of the P-class containing canonical PPR-repeats. RPF1 is required for the 5?-end processing of the nad4 mRNA in mitochondria. Ler and other accessions impaired in processing of the nad4 mRNA 5′-end, contain a single nucleotide polymorphism (SNP) 807 nucleotides downstream of the predicted translation start codon (G807A). The resulting premature translation termination codon abolishes the function of the RPF1 gene in Ler. Required for the formation of nad4L-atp4 transcripts with -318 5′ termini. |
| AT1G12710 | This gene is predicted to encode a protein with a PP2 domain. This domain in present in lectins found in squash and cucumber, suggesting that this protein could potentially have carbohydrate binding capabilities. |
| AT1G12740 | encodes a protein with cytochrome P450 domain |
| AT1G12750 | RHOMBOID-like protein 6. |
| AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein. |
| AT1G12805 | nucleotide binding protein. |
| AT1G12810 | proline-rich family protein. |
| AT1G12950 | root hair specific 2. |
| AT1G13080 | cytochrome P450 monooxygenase |
| AT1G13110 | member of CYP71B |
| AT1G13120 | nucleoporin GLE1-like protein. |
| AT1G13180 | Mutant has defect in trichome cell expansion and actin organization resulting in a distorted trichome phenotype. |
| AT1G13190 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT1G13195 | RING/U-box superfamily protein. |
| AT1G13210 | Autoinhibited Ca2+/ATPase II. |
| AT1G13220 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT1G13245 | ROTUNDIFOLIA like 17. |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G13260 | Encodes an AP2/B3 domain transcription factor which is upregulated in response to low temperature. It contains a B3 DNA binding domain. It has circadian regulation and may function as a negative growth regulator. |
| AT1G13270 | Encodes a methionine aminopeptidase formerly called MAP1B, renamed to MAP1C. |
| AT1G13280 | Encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is reduced during senescence, a process that involves jasmonic acid signalling pathway. |
| AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein. |
| AT1G13340 | Regulator of Vps4 activity in the MVB pathway protein. |
| AT1G13360 | hypothetical protein. |
| AT1G13370 | Histone superfamily protein. |
| AT1G13380 | sodium/hydrogen exchanger (DUF1218). |
| AT1G13390 | translocase subunit seca. |
| AT1G13420 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiments show that this enzyme does not act brassinosteroids. ST4B is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
| AT1G13440 | The expression level of GAPC-2 is upregulated in Arabidopsis seedlings exposed to cadmium. |
| AT1G13510 | hypothetical protein (DUF1262). |
| AT1G13520 | hypothetical protein (DUF1262). |
| AT1G13570 | F-box/RNI-like superfamily protein. |
| AT1G13580 | Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
| AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein. |
| AT1G13650 | hypothetical protein. |
| AT1G13940 | T-box transcription factor, putative (DUF863). |
| AT1G13980 | Encodes a GDP/GTP exchange factor for small G-proteins of the ADP ribosylation factor (RAF) class, and as regulator of intracellular trafficking. Homologous to Sec7p and YEC2 from yeast. Involved in the specification of apical-basal pattern formation. Essential for cell division, expansion and adhesion. It appears that heteotypic binding between the DCB and C-terminal domains of two GNOM proteins is required for membrane association, however, GNOM appears to exist predominantly as a heterodimer formed through DCB-DCB interactions. BFA inhibits GNOM trafficking and BFA resistant lines are more resistant to cold stress. |
| AT1G13990 | plant/protein. |
| AT1G14000 | Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. |
| AT1G14010 | emp24/gp25L/p24 family/GOLD family protein. |
| AT1G14080 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT1G14120 | DAO2 is an IAA oxidase expressed in root caps. |
| AT1G14130 | DAO1 is an IAA oxidase expressed in many different plant parts. it is a member of a family of dioxygenase and 2OG Fe(II) oxygenase domain and DAO domain containing proteins. It appears to be the major IAA oxidase in planta and major contributor to IAA degradation. |
| AT1G14140 | Mitochondrial substrate carrier family protein. |
| AT1G14182 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G14185 | Glucose-methanol-choline (GMC) oxidoreductase family protein. |
| AT1G14230 | GDA1/CD39 nucleoside phosphatase family protein. |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT1G14300 | ARM repeat superfamily protein. |
| AT1G14330 | Galactose oxidase/kelch repeat superfamily protein. |
| AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT1G14360 | UDP-galactose transporter 3. |
| AT1G14450 | NADH dehydrogenase (ubiquinone)s. |
| AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084). |
| AT1G14580 | C2H2-like zinc finger protein. |
| AT1G14600 | Homeodomain-like superfamily protein. |
| AT1G14640 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein. |
| AT1G14700 | purple acid phosphatase 3. |
| AT1G14710 | hydroxyproline-rich glycoprotein family protein. |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT1G14860 | nudix hydrolase homolog 18. |
| AT1G14870 | PCR2 encodes a membrane protein involved in zinc transport and detoxification. |
| AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein. |
| AT1G14910 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. Interacts with the SNARE domain of VAMP72 and clathrin at the plasma membrane. Required for recycling of R-SNARE proteins. |
| AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
| AT1G14930 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT1G15010 | mediator of RNA polymerase II transcription subunit. |
| AT1G15030 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT1G15040 | Encodes a nitrogen regulated putative glutamine amidotransferase that represses shoot branching. |
| AT1G15045 | unknown protein |
| AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
| AT1G15110 | PSS1 encodes a base-exchange-type Phosphatidylserine (PS) synthase. Mutant analysis revealed its role in pollen maturation. |
| AT1G15120 | Ubiquinol-cytochrome C reductase hinge protein. |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G15200 | protein-protein interaction regulator family protein. |
| AT1G15210 | pleiotropic drug resistance 7. |
| AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
| AT1G15340 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT1G15350 | DUF4050 family protein. |
| AT1G15360 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. This gene is involved in wax biosynthesis. Over-expression of the gene results in glossy leaf phenotype and increased drought tolerance. Two closely related genes, AT5G25390 and AT5G11190 have similar phenotypes when over-expressed. Strong expression levels in flowers. Binds to the promoter of LACS2. |
| AT1G15370 | TPLATE adaptor complex subunit. |
| AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
| AT1G15500 | TLC ATP/ADP transporter. |
| AT1G15550 | Involved in later steps of the gibberellic acid biosynthetic pathway. Activated by AGAMOUS in a cal-1, ap1-1 background. Deletion of 208 bp from -1016 to -809 (Δ-808) resulted in loss of GA-negative feedback (this sequence, which contains a 43-bp sequence GNFEI, was shown to be sufficient for GA-negative feedback). |
| AT1G15570 | A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues. |
| AT1G15580 | auxin induced protein |
| AT1G15590 | E3 ubiquitin-protein ligase. |
| AT1G15600 | transmembrane protein. |
| AT1G15610 | transmembrane protein. |
| AT1G15640 | transmembrane protein. |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT1G15710 | prephenate dehydrogenase family protein. |
| AT1G15720 | Arabidopsis thaliana myb family transcription factor (At1g15720). MYB/SANT domain containing protein. |
| AT1G15750 | Encodes a protein with several WD40 repeats at the C-terminus and predicted protein-protein interaction domains at the N-terminus. Together with the TOPLESS-RELATED PROTEINS (TPRs), it is thought to be involved in transcriptional repression of root-promoting genes in the top half of the embryo during the transition stage of embryogenesis. It can also interact with IAA12 through the EAR domain of IAA12 and the CTLH domain of TPL. The ability of IAA12 to repress transcription is diminished in a tpl-1 mutant background. |
| AT1G15757 | Encodes a defensin-like (DEFL) family protein. |
| AT1G15800 | hypothetical protein. |
| AT1G15820 | Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II. |
| AT1G15825 | hydroxyproline-rich glycoprotein family protein. |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. |
| AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G16370 | organic cation/carnitine transporter 6. |
| AT1G16500 | filamentous hemagglutinin transporter. |
| AT1G16640 | AP2/B3-like transcriptional factor family protein. |
| AT1G16650 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT1G16660 | transposable_element_gene.;copia-like retrotransposon family |
| AT1G16670 | Encodes a cold-activated plasma membrane protein cold-responsive protein kinase that phosphorylates 14-3-3 proteins. |
| AT1G16850 | transmembrane protein. |
| AT1G16870 | mitochondrial 28S ribosomal protein S29-like protein. |
| AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
| AT1G17060 | Encodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls. |
| AT1G17080 | Ribosomal protein L18ae family. |
| AT1G17090 | transmembrane protein. |
| AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT1G17140 | Encodes a ROP/RAC effector, designated interactor of constitutive active ROPs 1 (ICR1), that interacts with GTP-bound ROPs. ICR1 is a scaffold mediating formation of protein complexes that are required for cell polarity. ICR1 is comprised of coiled-coil domains and forms complexes with itself and the exocyst vesicle-tethering complex subunit SEC3. |
| AT1G17147 | VQ motif-containing protein. |
| AT1G17180 | Encodes glutathione transferase belonging to the tau class of GSTs. Detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plant over-expressing At1g17180 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
| AT1G17190 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT1G17200 | Uncharacterized protein family (UPF0497). |
| AT1G17210 | IAP-like protein 1. |
| AT1G17220 | Encodes a chloroplast localized protein with similarity to translation initiation factor 2. Can complement loss of INFB in E.coli suggesting FUG1 does function as a translation initiation factor in vivo. Identified as a suppressor of the leaf variegation mutant var2-6. Suppression is only seen in hypomorphs as complete loss of function alleles are embryo lethal. |
| AT1G17230 | Leucine-rich receptor-like protein kinase family protein. |
| AT1G17340 | Phosphoinositide phosphatase family protein. |
| AT1G17360 | LOW protein: protein phosphatase 1 regulatory subunit-like protein. |
| AT1G17380 | jasmonate-zim-domain protein 5. |
| AT1G17390 | transposable_element_gene.;similar to RNase H domain-containing protein |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT1G17430 | alpha/beta-Hydrolases superfamily protein. |
| AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
| AT1G17450 | B-block binding subunit of TFIIIC. |
| AT1G17495 | transposable_element_gene.;copia-like retrotransposon family |
| AT1G17500 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein. ALA4 acts redundantly with ALA3, ALA5, ALA9, ALA10 and ALA11 in root and shoot development |
| AT1G17545 | Protein phosphatase 2C family protein. |
| AT1G17550 | Protein Phosphatase 2C |
| AT1G17560 | Encodes HUELLENLOS (HLL), a mitochondrial ribosome protein, similar to L14 ribosomal protein of eubacteria. HLL is essential for normal ovule development. |
| AT1G17570 | pre-tRNA tRNA-Ser (anticodon: AGA). |
| AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
| AT1G17620 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family. |
| AT1G17630 | Encodes a PPR protein involved in mitochondrial functioning. |
| AT1G17730 | Encodes an ESCRT-related protein: CHMP1A/AT1G73030; CHMP1B/AT1G17730. |
| AT1G17744 | hypothetical protein. |
| AT1G17745 | encodes a 3-Phosphoglycerate dehydrogenase |
| AT1G17750 | Encodes PEPR2, a plasma membrane leucine-rich repeat receptor kinase functioning as a receptor for the Pep1 and Pep2 peptides. Pep1 and Pep2 are amino acids that induce the transcription of defense-related genes. |
| AT1G17830 | hypothetical protein (DUF789). |
| AT1G17850 | Rhodanese/Cell cycle control phosphatase superfamily protein. |
| AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein. |
| AT1G18070 | Translation elongation factor EF1A/initiation factor IF2gamma family protein. |
| AT1G18075 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUU. Functions redundantly with MIR159A. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. |
| AT1G18100 | Encodes a member of the FT and TFL1 family of phosphatidylethanolamine-binding proteins. It is expressed in seeds and up-regulated in response to ABA. Loss of function mutants show decreased rate of germination in the presence of ABA. ABA dependent regulation is mediated by both ABI3 and ABI5. ABI5 promotes MFT expression, primarily in the radicle-hypocotyl transition zone and ABI3 suppresses it in the seed. |
| AT1G18140 | putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis). |
| AT1G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT1G18290 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G18300 | nudix hydrolase homolog 4. |
| AT1G18330 | EARLY-PHYTOCHROME-RESPONSIVE1 |
| AT1G18335 | Acyl-CoA N-acyltransferases (NAT) superfamily protein. |
| AT1G18370 | Encodes a kinesin HINKEL. Required for cytokinesis in pollen. Mutant has cytokinesis defects; seedling lethal. |
| AT1G18390 | Serine/Threonine kinase family catalytic domain protein. |
| AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1 |
| AT1G18470 | Putative C3HC4 zinc-finger ubiquitin E3 ligase that is induced by ABA and plays a positive role in ABA signaling. |
| AT1G18490 | 2-aminoethanethiol dioxygenase, putative (DUF1637). |
| AT1G18500 | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). |
| AT1G18580 | Encodes a protein with putative galacturonosyltransferase activity.GAUT11 is required for pectin synthesis in seed coat epidermal cells and normal mucilage release. |
| AT1G18590 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with preference with methionine-derived desulfoglucosinolates. |
| AT1G18690 | Galactosyl transferase GMA12/MNN10 family protein. |
| AT1G18700 | DNAJ heat shock N-terminal domain-containing protein. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT1G18720 | Contains DUF962 domain. Localizes to ER and cam complement yeast Mpo1 dioxygenase function. Interacts with ABI1. May be involved in ER stress response. |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
| AT1G18830 | Together with SEC31B a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT1G18860 | member of WRKY Transcription Factor; Group II-b |
| AT1G18870 | Encodes a protein with isochorismate synthase activity involved in phylloquinone biosynthesis. Mutant studies of this gene's function suggest that its function is redundant with that of ICS1 (AT1G7410). |
| AT1G18990 | myosin-binding protein, putative (Protein of unknown function, DUF593). |
| AT1G19000 | Homeodomain-like superfamily protein. |
| AT1G19010 | hypothetical protein. |
| AT1G19020 | Modulates defense against bacterial pathogens and tolerance to oxidative stress. |
| AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G19190 | Controls leaf stomatal aperture by regulating abscisic acid transport. |
| AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. |
| AT1G19230 | Riboflavin synthase-like superfamily protein. |
| AT1G19250 | FMO1 is required for full expression of TIR-NB-LRR conditioned resistance to avirulent pathogens and for basal resistance to invasive virulent pathogens. Functions in an EDS1-regulated but SA-independent mechanism that promotes resistance and cell death at pathogen infection sites. FMO1 functions as a pipecolate N-hydroxylase and catalyzes the biochemical conversion of pipecolic acid to N-hydroxypipecolic acid (NHP). NHP systemically accumulates in the plant foliage and induces systemic acquired resistance to pathogen infection. |
| AT1G19270 | Encodes a ubiquitin-activated peptidase that is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. Together with CUC2/CUC3-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. |
| AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
| AT1G19310 | RING/U-box superfamily protein. |
| AT1G19340 | Methyltransferase MT-A70 family protein. |
| AT1G19350 | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. |
| AT1G19373 | snoRNA. |
| AT1G19376 | snoRNA. |
| AT1G19380 | sugar, putative (DUF1195). |
| AT1G19460 | Galactose oxidase/kelch repeat superfamily protein. |
| AT1G19570 | Encodes a member of the dehydroascorbate reductase gene family. |
| AT1G19580 | Encodes mitochondrial gamma carbonic anhydrase. Component of the NADH dehydrogenase complex. |
| AT1G19660 | Wound-responsive family protein. |
| AT1G19670 | Chlorophyllase is the first enzyme involved in chlorophyll degradation. |
| AT1G19680 | RING/U-box superfamily protein. |
| AT1G19700 | Encodes a member of the BEL family of homeodomain proteins. |
| AT1G19710 | UDP-Glycosyltransferase superfamily protein. |
| AT1G19800 | Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. |
| AT1G19830 | SAUR-like auxin-responsive protein family. |
| AT1G19835 | TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly. |
| AT1G19840 | SAUR-like auxin-responsive protein family. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT1G19900 | RUBY encodes a secreted galactose oxidase involved in cell wall modification. |
| AT1G19910 | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2) |
| AT1G20010 | beta tubulin |
| AT1G20015 | snoRNA. |
| AT1G20040 | pre-tRNA tRNA-Leu (anticodon: CAA). |
| AT1G20070 | hypothetical protein. |
| AT1G20250 | pre-tRNA tRNA-Lys (anticodon: CTT). |
| AT1G20260 | One of three genes encoding the vacuolar ATP synthase subunit B1. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. |
| AT1G20290 | SWI-SNF-related chromatin binding protein. |
| AT1G20300 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT1G20310 | syringolide-induced protein. |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT1G20340 | recombination and DNA-damage resistance protein (DRT112) One of two Arabidopsis plastocyanin genes. Predominant form, expressed 10x higher than PETE1. PETE2 is thought to be post-transcriptionally regulated via copper accumulation and is involved in copper homeostasis. Mutation of this gene does not have obvious effect on photosynthesis. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT1G20410 | Pseudouridine synthase family protein. |
| AT1G20420 | pre-tRNA tRNA-Pro (anticodon: TGG). |
| AT1G20430 | hypothetical protein. |
| AT1G20450 | Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. |
| AT1G20490 | AMP-dependent synthetase and ligase family protein. |
| AT1G20510 | OPC-8:0 CoA ligase1. |
| AT1G20515 | Natural antisense transcript overlaps with AT1G20520. |
| AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. |
| AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
| AT1G20640 | Plant regulator RWP-RK family protein. |
| AT1G20670 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G20696 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. |
| AT1G20816 | outer envelope pore-like protein. |
| AT1G20967 | unknown protein |
| AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. |
| AT1G20990 | Cysteine/Histidine-rich C1 domain family protein. |
| AT1G21000 | PLATZ transcription factor family protein. |
| AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
| AT1G21020 | transposable_element_gene.;similar to Ulp1 protease family protein |
| AT1G21050 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617). |
| AT1G21060 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547). |
| AT1G21070 | Nucleotide-sugar transporter family protein. |
| AT1G21080 | DNAJ heat shock N-terminal domain-containing protein. |
| AT1G21100 | O-methyltransferase family protein. |
| AT1G21310 | Encodes extensin 3. |
| AT1G21360 | glycolipid transfer protein 2. |
| AT1G21390 | embryo defective 2170. |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein. |
| AT1G21410 | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. |
| AT1G21450 | Encodes a scarecrow-like protein (SCL1). Member of GRAS gene family. |
| AT1G21590 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein. |
| AT1G21600 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. essential subunit of the plastid-encoded RNA polymerase (PEP). Mediates phytochrome signaling. |
| AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT1G21738 | hypothetical protein. |
| AT1G21740 | DUF630 family protein, putative (DUF630 and DUF632). |
| AT1G21830 | hypothetical protein. |
| AT1G21835 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G21910 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G21975 | unknown protein |
| AT1G21980 | Type I phosphatidylinositol-4-phosphate 5-kinase. Preferentially phosphorylates PtdIns4P. Induced by water stress and abscisic acid in Arabidopsis thaliana. Expressed in procambial cells of leaves, flowers and roots. A N-terminal Membrane Occupation and Recognition Nexus (MORN)affects enzyme activity and distribution. |
| AT1G22060 | sporulation-specific protein. |
| AT1G22067 | unknown protein |
| AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT1G22190 | The gene encodes a putative transcription factor belongings to the abiotic stress-associated DREB A-6 clade. |
| AT1G22220 | F-box family protein. |
| AT1G22230 | nucleolar GTP-binding protein. |
| AT1G22275 | One of two nearly identical proteins (ZYP1a) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility. |
| AT1G22280 | Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus. |
| AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT1G22340 | UDP-glucosyl transferase 85A7. |
| AT1G22360 | UDP-glucosyl transferase 85A2. |
| AT1G22370 | UDP-glucosyl transferase 85A5. |
| AT1G22400 | UDP-Glycosyltransferase superfamily protein. |
| AT1G22430 | GroES-like zinc-binding dehydrogenase family protein. |
| AT1G22480 | Cupredoxin superfamily protein. |
| AT1G22500 | Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus. |
| AT1G22540 | Major facilitator superfamily protein. |
| AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G22560 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT1G22570 | Major facilitator superfamily protein. |
| AT1G22580 | transposable_element_gene |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT1G22767 | unknown protein |
| AT1G22810 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity. |
| AT1G22910 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT1G22930 | T-complex protein 11. |
| AT1G22990 | Heavy metal transport/detoxification superfamily protein. |
| AT1G23000 | Heavy metal transport/detoxification superfamily protein. |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein. |
| AT1G23050 | hydroxyproline-rich glycoprotein family protein. |
| AT1G23052 | other_RNA. |
| AT1G23060 | hypothetical protein. |
| AT1G23070 | organic solute transporter ostalpha protein (DUF300). |
| AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G23090 | Encodes AST91 mRNA for sulfate transporter. |
| AT1G23110 | fold protein. |
| AT1G23120 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT1G23330 | alpha/beta-Hydrolases superfamily protein. |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein. |
| AT1G23470 | pseudogene of Pectin lyase-like superfamily protein. |
| AT1G23480 | encodes a gene similar to cellulose synthase |
| AT1G23710 | hypothetical protein (DUF1645). |
| AT1G23730 | beta carbonic anhydrase 3. |
| AT1G23820 | Spermidine synthase. |
| AT1G23850 | transmembrane protein. |
| AT1G23860 | Encodes a 9G8-like serine-arginine rich (SR) protein that interacts in vivo with U1-70K, a U1 small nuclear ribonucleoprotein 70-kDa protein that is involved in nuclear precursor mRNA processing. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT1G23870 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G23880 | NHL domain-containing protein. |
| AT1G23990 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT1G24100 | Encodes a UDP-glucose:thiohydroximate S-glucosyltransferase, involved in glucosinolate biosynthesis |
| AT1G24120 | encodes a DnaJ-like protein similar to ARG1 and ARL2 that are both involved in root and hypocotyl gravitropism response. |
| AT1G24130 | Transducin/WD40 repeat-like superfamily protein. |
| AT1G24145 | transmembrane protein. |
| AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G24180 | Arabidopsis thaliana pyruvate dehydrogenase E1a-like subunit. 81% identical to a previously characterized Arabidopsis mitochondrial PDH E1a-subunit, At1g59900. Serine 296 phosphorylation of IAR4 has critical function in root hair formation and root development. Changing Ser296 in IAR4 to Ala resulted in a phenotype intermediate between mutant and wild-type, while substitution to Asp was either lethal or caused an extreme dwarf phenotype. |
| AT1G24320 | Six-hairpin glycosidases superfamily protein. |
| AT1G24330 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G24430 | HXXXD-type acyl-transferase family protein. |
| AT1G24440 | RING/U-box superfamily protein. |
| AT1G24625 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G25220 | Catalyzes the first step of tryptophan biosynthesis |
| AT1G25230 | Calcineurin-like metallo-phosphoesterase superfamily protein. |
| AT1G25275 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G25280 | Member of TLP family |
| AT1G25390 | Protein kinase superfamily protein. |
| AT1G25400 | transmembrane protein. |
| AT1G25422 | hypothetical protein. |
| AT1G25425 | CLAVATA3/ESR-RELATED 43. |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G25500 | Plasma-membrane choline transporter family protein. |
| AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
| AT1G26150 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G26160 | Metal-dependent phosphohydrolase. |
| AT1G26250 | Proline-rich extensin-like family protein. |
| AT1G26690 | emp24/gp25L/p24 family/GOLD family protein. |
| AT1G26730 | EXS (ERD1/XPR1/SYG1) family protein. |
| AT1G26762 | transmembrane protein. |
| AT1G26916 | unknown protein |
| AT1G26920 | zinc finger CCHC domain protein. |
| AT1G26921 | hypothetical protein. |
| AT1G26930 | Galactose oxidase/kelch repeat superfamily protein. |
| AT1G26945 | Encodes a basic helix-loop-helix (bHLH) protein involved in blue/far-red light signaling. Physically interacts with HFR1 and negatively regulates its activity. |
| AT1G26950 | transposable_element_gene.;similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT5G33360.1);(source:TAIR10) |
| AT1G26960 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Participates in the gene regulatory network controlling root branching by mediating the regulation of LAX3 by ARF7/19. |
| AT1G26970 | Protein kinase superfamily protein. |
| AT1G27030 | hypothetical protein. |
| AT1G27100 | Actin cross-linking protein. |
| AT1G27130 | Encodes glutathione transferase belonging to the tau class of GSTs. GSTU13 acts in the pathogen triggered pathway for indole glucosinolate metabolisms that involves also PENETRATION2 myrosinase. It is likely the enzyme that conjugates GSH with unstable indol-3-ylmethyl-ITCs formed upon PEN2-mediated IG hydrolysis, particularly in the branch of this pathway in which 4-substituted IGs are processed. |
| AT1G27140 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT1G27150 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT1G27200 | glycosyltransferase family protein (DUF23). |
| AT1G27213 | unknown protein |
| AT1G27290 | transmembrane protein. |
| AT1G27300 | transmembrane protein. |
| AT1G27310 | Encodes an ortholog of yeast NTF2, a nuclear envelop transport protein that functions as the nuclear import receptor for RanGDP, an essential player in nucleocytoplasmic transport. |
| AT1G27690 | lipase, putative (DUF620). |
| AT1G27700 | Syntaxin/t-SNARE family protein. |
| AT1G27710 | Glycine-rich protein family. |
| AT1G27730 | Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress. |
| AT1G27740 | Basic helix-loop-helix (bHLH) transcription factor that is sufficient to promote postmitotic cell growth in root-hair cells. RSL4 is a direct transcriptional target of RHD6 |
| AT1G27752 | Ubiquitin system component Cue protein. |
| AT1G27760 | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT1G27950 | Encodes LTPG1, a lipid transfer protein with a predicted GPI (glycosylphosphatidylinositol)-anchor domain. Localized in the plasma membrane. Disruption of the LTPG1 gene causes alterations of cuticular lipid composition, but no significant changes on total wax and cutin monomer loads are seen. |
| AT1G28050 | B-box type zinc finger protein with CCT domain-containing protein. |
| AT1G28100 | hypothetical protein. |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT1G28180 | DEAD-box ATP-dependent RNA helicase-like protein. |
| AT1G28190 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G28200 | VirF-interacting protein FIP1 |
| AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
| AT1G28240 | strawberry notch protein (DUF616). |
| AT1G28270 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF4 and RALF19 act redundantly in the pollen tube to regulate pollen tube growth. |
| AT1G28280 | VQ motif-containing protein. |
| AT1G28281 | unknown protein |
| AT1G28330 | dormancy-associated protein (DRM1) |
| AT1G28350 | Nucleotidylyl transferase superfamily protein. |
| AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
| AT1G28375 | transmembrane protein. |
| AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. |
| AT1G28430 | member of CYP705A |
| AT1G28480 | Encodes GRX480, a member of the glutaredoxin family that regulates protein redox state. GRX480 interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. GRX480 transcription is SA-inducible and requires NPR1. Maybe involved in SA/JA cross-talk. It has also been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT1G28490 | Encodes SYP61, one of 24 Arabidopsis syntaxins. Its mRNA has been shown to be expressed. SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin PIP2;7 to modulate the cell membrane water permeability. |
| AT1G28530 | Encodes a protein that localizes to both chloroplasts and amyloplasts and is required for both chloroplast and mesophyll development. |
| AT1G28540 | Tail-anchored (TA) OEP membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
| AT1G28580 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G28591 | Pseudogene of AT1G28610; GDSL-motif lipase, putative |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G28660 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G28670 | Arabidopsis thaliana lipase |
| AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680. |
| AT1G28960 | Encodes a ppGpp pyrophosphohydrolase. |
| AT1G29020 | Calcium-binding EF-hand family protein. |
| AT1G29025 | Calcium-binding EF-hand family protein. |
| AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G29090 | Cysteine proteinases superfamily protein. |
| AT1G29190 | pseudogene of hypothetical protein (DUF295). |
| AT1G29195 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT1G29270 | transcription factor bHLH35-like protein. |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e |
| AT1G29290 | Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2. |
| AT1G29300 | intracellular protein transporter, putative (DUF641). |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. |
| AT1G29630 | 5-3 exonuclease family protein. |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584). |
| AT1G29650 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G29980 | choice-of-anchor C domain protein, putative (Protein of unknown function, DUF642). |
| AT1G30016 | unknown protein |
| AT1G30020 | SVB family gene. |
| AT1G30030 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT1G30040 | Encodes a gibberellin 2-oxidase that acts on C-19 gibberellins. AtGA2OX2 expression is responsive to cytokinin and KNOX activities. |
| AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
| AT1G30130 | DUF1365 family protein. |
| AT1G30135 | jasmonate-zim-domain protein 8. |
| AT1G30190 | cotton fiber protein. |
| AT1G30200 | F-box family protein. |
| AT1G30220 | Inositol transporter presenting conserved extracellular loop domains homologs of plexins/semaphorin/integrin (PSI) domains from animal type I receptors. |
| AT1G30260 | galactosyltransferase family protein. |
| AT1G30310 | transposable_element_gene.;copia-like retrotransposon family |
| AT1G30320 | Remorin family protein. |
| AT1G30330 | Encodes a member of the auxin response factor family. |
| AT1G30350 | Pectin lyase-like superfamily protein. |
| AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT1G30410 | member of MRP subfamily |
| AT1G30470 | SIT4 phosphatase-associated family protein. |
| AT1G30500 | nuclear factor Y, subunit A7. |
| AT1G30510 | Encodes a root-type ferredoxin:NADP(H) oxidoreductase. |
| AT1G30520 | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT1G30530 | The At1g30530 gene encodes a UDP-rhamnose:flavonol-3-O-rhamnosyltransferase (UGT78D1) attaching a rhamnosyl residue to the 3-O-position of the flavonols kaempferol and quercetin |
| AT1G30650 | member of WRKY Transcription Factor; Group II-e |
| AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT1G30757 | transmembrane protein. |
| AT1G30820 | Cytidine triphosphate synthase. |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT1G31030 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT1G31050 | Together with PFA2 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G31120 | potassium transporter |
| AT1G31130 | polyadenylate-binding protein 1-B-binding protein. |
| AT1G31173 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUGG |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein. |
| AT1G31350 | KAR-UP F-box 1. |
| AT1G31355 | pseudogene of Translation protein SH3-like family protein. |
| AT1G31358 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATTAACGCTGGCGGTTGCGGCAGC |
| AT1G31440 | SH3 domain-containing protein. |
| AT1G31580 | Encodes cell wall protein. ECS1 is not a Xcc750 resistance gene, but the genetic data indicate that ECS1 is linked to a locus influencing resistance to Xcc750. |
| AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G31660 | Encodes a protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and male and female gametophyte development. |
| AT1G31710 | Copper amine oxidase family protein. |
| AT1G31720 | chitin synthase, putative (DUF1218). |
| AT1G31790 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT1G31800 | Encodes a protein with β-ring carotenoid hydroxylase activity. |
| AT1G31812 | Acyl-CoA-binding protein. Bind acyl-CoA esters and protect acyl-CoAs from degradation by microsomal acyl-hydrolases. Plays a role in determining seed oil content. |
| AT1G31814 | family member of FRI-related genes that is required for the winter-annual habit. Genbank accession BK004885 |
| AT1G31830 | Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein. |
| AT1G31880 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. |
| AT1G31930 | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses. |
| AT1G32090 | early-responsive to dehydration stress protein (ERD4). |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein. |
| AT1G32160 | beta-casein (DUF760). |
| AT1G32190 | alpha/beta-Hydrolases superfamily protein. |
| AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
| AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. |
| AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
| AT1G32360 | Zinc finger (CCCH-type) family protein. |
| AT1G32450 | Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to high and low concentrations of nitrate. Not involved in nitrate uptake. Expressed in root pericycle cells under the control of MYB59. Also functions as a proton-coupled H+/K+ antiporter for K+ loading into the xylem. |
| AT1G32460 | hypothetical protein. |
| AT1G32550 | Encodes FdC2, a ferredoxin protein capable of alternative electron partitioning. FdC1 level increases in conditions of acceptor limitation at PSI. |
| AT1G32560 | Encodes LEA4-1, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
| AT1G32640 | Encodes a MYC-related transcriptional activator with a typical DNA binding domain of a basic helix-loop-helix leucine zipper motif. Binds to an extended G-Box promoter motif and interacts with Jasmonate ZIM-domain proteins. MYC2 interacts with EIN3 and EIL1 to repress hook curvature and resistance to Botrytis cinera.Its transcription is induced by dehydration stress, ABA treatment and blue light via CRY1. Negative regulator of blue light-mediated photomorphogenic growth and blue and far-red-light-regulated gene expression. Positive regulator of lateral root formation. Regulates diverse JA-dependent functions. Negatively regulates Trp metabolism and biosynthesis of Trp-derived secondary metabolites. Positively regulates flavonoid biosynthesis, resistance to insects, and response to oxidative stress. Regulates other transcription factors, and negatively regulates its own expression. For example it binds to and regulates the expression of NST1. Its stability is modulated by PUB10 through polyubiquitination. |
| AT1G32650 | hypothetical protein. |
| AT1G32670 | unknown protein |
| AT1G32680 | transposable_element_gene.;similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G35880.1);(source:TAIR10) |
| AT1G32690 | DUF740 family protein. |
| AT1G32700 | PLATZ transcription factor family protein. |
| AT1G32710 | Cytochrome c oxidase, subunit Vib family protein. |
| AT1G32730 | electron carrier/iron ion-binding protein. |
| AT1G32760 | Glutaredoxin family protein. |
| AT1G32920 | hypothetical protein. |
| AT1G32970 | Subtilisin-like serine endopeptidase family protein. |
| AT1G33055 | hypothetical protein. |
| AT1G33060 | NAC 014. |
| AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
| AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604). |
| AT1G33450 | transposable_element_gene.;similar to unknown protein |
| AT1G33590 | Leucine-rich repeat (LRR) family protein. |
| AT1G33610 | Leucine-rich repeat (LRR) family protein. |
| AT1G33700 | Beta-glucosidase, GBA2 type family protein. |
| AT1G33760 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein. |
| AT1G34780 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT1G35160 | GF14 protein phi chain member of 14-3-3 protein family. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1 |
| AT1G35180 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein. |
| AT1G35181 | transmembrane protein. |
| AT1G35250 | Thioesterase superfamily protein. |
| AT1G35255 | transmembrane protein. |
| AT1G35260 | MLP-like protein 165. |
| AT1G35330 | RING/U-box superfamily protein. |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein. |
| AT1G35510 | O-fucosyltransferase family protein. |
| AT1G35560 | Encodes a member of the TCP-P subfamily that is involved in flowering time control and plant development. Mutants present an early flowering phenotype. |
| AT1G35570 | transposable_element_gene.;similar to unknown protein |
| AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
| AT1G35590 | transposable_element_gene.;CACTA-like transposase family (Tnp2/En/Spm) |
| AT1G35600 | transposable_element_gene.;CACTA-like transposase family (Ptta/En/Spm) |
| AT1G35610 | Cysteine/Histidine-rich C1 domain family protein. |
| AT1G35612 | pseudogene of Ulp1 protease family protein |
| AT1G35625 | RING/U-box superfamily protein. |
| AT1G35670 | Encodes a Ca(2+)-dependent, calmodulin-independent protein kinase that is rapidly induced by drought and high-salt stress but not by low-temperature stress or heat stress. |
| AT1G35710 | kinase family with leucine-rich repeat domain-containing protein. |
| AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. |
| AT1G35750 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G35780 | N-lysine methyltransferase. |
| AT1G36060 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2. |
| AT1G36622 | transmembrane protein. |
| AT1G36936 | transposable_element_gene. |
| AT1G37130 | Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940. |
| AT1G37140 | Amember of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. MCT1 expression is increased in the presence of ABA and RNAi suppression showed increased germination rates in the presence of ABA. |
| AT1G38140 | transposable_element_gene.;CACTA-like transposase family (Ptta/En/Spm) |
| AT1G41830 | SKU5-similar 6. |
| AT1G42470 | Patched family protein. |
| AT1G42540 | member of Putative ligand-gated ion channel subunit family |
| AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. |
| AT1G43160 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT1G43640 | Member of TLP family of tubby like proteins that also contain an F-Box. |
| AT1G43650 | nodulin MtN21-like transporter family protein |
| AT1G43710 | Encodes a serine decarboxylase that is involved in ethanolamine metabolism and is crucial for plant growth. |
| AT1G43715 | transposable_element_gene.;copia-like retrotransposon family |
| AT1G44020 | Cysteine/Histidine-rich C1 domain family protein. |
| AT1G44090 | Encodes a gibberellin 20-oxidase. |
| AT1G44100 | amino acid permease 5 |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. |
| AT1G44318 | Aldolase superfamily protein. |
| AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
| AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . |
| AT1G44760 | Adenine nucleotide alpha hydrolases-like superfamily protein. |
| AT1G44790 | ChaC-like family protein. |
| AT1G44800 | Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family. |
| AT1G44820 | Peptidase M20/M25/M40 family protein. |
| AT1G44830 | Encodes a nuclear-localized member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression in cultured cells results in an increase in pectin deposition.ERF014 differentially regulates responses to bacterial and fungal pathogens. |
| AT1G45010 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein. |
| AT1G45015 | MD-2-related lipid recognition domain-containing protein. |
| AT1G45130 | beta-galactosidase 5. |
| AT1G45145 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT1G45160 | Protein kinase superfamily protein. |
| AT1G45163 | transmembrane protein. |
| AT1G45165 | Expressed protein. |
| AT1G45201 | Target of AtGRP7 regulation. |
| AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. |
| AT1G45760 | transposable_element_gene.;hAT-like transposase family (hobo/Ac/Tam3) |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT1G46408 | AGAMOUS-like 97. |
| AT1G46554 | other_RNA. |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT1G47200 | WPP family members contains an NE targeting domain. |
| AT1G47480 | alpha/beta-Hydrolases superfamily protein. |
| AT1G47550 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. It binds phosphoinositide lipids. |
| AT1G47560 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT1G47860 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT1G47970 | nucleolin. |
| AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT1G48330 | SsrA-binding protein. |
| AT1G48430 | Dihydroxyacetone kinase. |
| AT1G48440 | B-cell receptor-associated 31-like protein. |
| AT1G48500 | Jasmonate zim domain transcription factor family protein.Involved in freezing tolerance and JA iduceed leaf senesence. |
| AT1G48510 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis. |
| AT1G48540 | Outer arm dynein light chain 1 protein. |
| AT1G48598 | unknown protein |
| AT1G48600 | Encodes a phosphoethanolamine N-methyltransferase that catalyses the last two methylation steps of the three sequential methylations of phosphoethanolamine (PEA) that are required for the synthesis of phosphocholine (PCho) in plants. |
| AT1G49030 | PLAC8 family protein. |
| AT1G49032 | hypothetical protein. |
| AT1G49040 | Encodes soluble protein containing N-terminal DENN domain and eight C-terminal WD-40 repeats. Involved in cytokinesis of guard mother cells and leaf epidermal cells. The overall growth and development of mutant plants is severely affected, they are smaller than wt, with defects in seedling development, leaf expansion and flower morphology which renders the mutant conditionally sterile. |
| AT1G49160 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its |
| AT1G49200 | RING/U-box superfamily protein. |
| AT1G49210 | RING/U-box superfamily protein. |
| AT1G49230 | RING/U-box superfamily protein. |
| AT1G49330 | hydroxyproline-rich glycoprotein family protein. |
| AT1G49340 | Encodes a phosphatidylinositol 4-kinase that is expressed in inflorescences and shoots. |
| AT1G49350 | PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
| AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein. |
| AT1G49520 | SWIB complex BAF60b domain-containing protein. |
| AT1G49610 | F-box family protein. |
| AT1G49650 | alpha/beta-Hydrolases superfamily protein. |
| AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
| AT1G49710 | Encodes a protein with core α1,3-fucosyltransferase activity. |
| AT1G49780 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
| AT1G49880 | Encodes Erv1, a component of the mitochondrial intermembrane space assembly machinery involved in the import pathway of the small intermembrane space proteins. It contains a Cys-X-Cys shuttle disulfide and oxidizes thioredoxin in vitro. Flavoenzyme-encoding gene. |
| AT1G50020 | tubulin alpha-6 chain. |
| AT1G50030 | Related to TOR proteins from yeast and mammals, regulators of cell growth in response to nutrient availability. TOR proteins belong to the family of phosphatidylinositol 3-kinase and are targets of the antiproliferative drug rapamycin. AtTOR binds the yeast FKBP12 protein in the presence of Rapamycin, is involved in embryogenesis and is expressed in embryos, endosperm and meristems. Participates in negatively modulating ethylene signals and the molecular mechanism is likely involved in the regulation of ethylene biosynthesis by affecting ACSs in transcription and protein levels |
| AT1G50290 | hypothetical protein. |
| AT1G50410 | Encodes a member of the SNF2 family of helicase-like proteins and is involved in RNA-directed DNA methylation. It is functionally redundant with FRG1. |
| AT1G50450 | Saccharopine dehydrogenase. |
| AT1G50560 | member of CYP705A |
| AT1G50590 | RmlC-like cupins superfamily protein. |
| AT1G50600 | Encodes a scarecrow-like protein (SCL5). Member of GRAS gene family. |
| AT1G50603 | unknown protein |
| AT1G50650 | KRS is a member of the STIG1 family of peptides. Its expression in embryos appears to be dependent upon ZOU.Loss of function results in a reduction of α-JIM12 labelled 'sheath' around the developing embryo. |
| AT1G50659 | other_RNA. |
| AT1G50660 | actin cytoskeleton-regulatory complex pan-like protein. |
| AT1G50930 | Serine/Threonine-kinase. |
| AT1G50960 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. DDF1 binds to GA2OX7 and regulates its expression in response to salt stress. |
| AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
| AT1G51160 | TRAPP protein BET5 homolog. |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. |
| AT1G51355 | cyclin-dependent kinase inhibitor SMR3-like protein. |
| AT1G51400 | Photosystem II 5 kD protein. |
| AT1G51402 | hypothetical protein. |
| AT1G51420 | sucrose-phosphatase 1. |
| AT1G51538 | Aminotransferase-like, plant mobile domain family protein. |
| AT1G51760 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and conjugates IAA-Ala in vitro. Gene is expressed most strongly in roots, stems, and flowers. |
| AT1G51940 | Encodes a LysM-containing receptor-like kinase. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. Based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity.It is required for the suppression of defense responses in absence of pathogen infection or upon abscisic acid treatment. Loss-of-function mutants display enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum. Its expression is repressed by pathogen infection and biological elicitors and is induced abscisic acid.Expression is strongly repressed by elicitors and fungal infection, and is induced by the hormone abscisic acid (ABA). Insertional mutants show increased expression of PHYTOALEXIN-DEFICIENT 3 (PAD3), enhanced resistance to Botrytis cinerea and Pectobacterium carotovorum infection and reduced physiological responses to ABA, suggesting that LYK3 is important for the cross-talk between signaling pathways activated by ABA and pathogens (PMID:24639336). |
| AT1G51990 | O-methyltransferase family protein. |
| AT1G52000 | Mannose-binding lectin superfamily protein. |
| AT1G52080 | actin binding protein family. |
| AT1G52085 | pseudogene of Mannose-binding lectin superfamily protein. |
| AT1G52100 | Mannose-binding lectin superfamily protein. |
| AT1G52120 | Mannose-binding lectin superfamily protein. |
| AT1G52155 | transmembrane protein. |
| AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
| AT1G52280 | RAB GTPase homolog G3D. |
| AT1G52290 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G52370 | Ribosomal protein L22p/L17e family protein. |
| AT1G52380 | NUP50 (Nucleoporin 50 kDa) protein. |
| AT1G52410 | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. |
| AT1G52430 | Ubiquitin carboxyl-terminal hydrolase-related protein. |
| AT1G52510 | alpha/beta-Hydrolases superfamily protein. |
| AT1G52520 | FAR1-related sequence 6. |
| AT1G52565 | cytochrome P450 family protein. |
| AT1G52710 | Rubredoxin-like superfamily protein. |
| AT1G52720 | hypothetical protein. |
| AT1G52750 | alpha/beta-Hydrolases superfamily protein. |
| AT1G52760 | Encodes caffeoyl shikimate esterase and is involved in lignin biosynthesis. CSE converts caffeoyl shikimate to caffiate. Loss of function mutations have reduced lignin content and collapsed vessel elements. It is also reported to function as a lysophospholipase 2 (LysoPL2) involved in tolerance to cadmium-induced oxidative stress. Binds Acyl-CoA-binding protein 2 (ACBP2). |
| AT1G52840 | transposable_element_gene.;similar to unknown protein |
| AT1G52855 | hypothetical protein. |
| AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
| AT1G52905 | hypothetical protein. |
| AT1G52990 | thioredoxin family protein. |
| AT1G53000 | Encodes a mitochondrial-localized CMP-KDO (3-deoxy-D-manno-octulosonate) synthetase. |
| AT1G53050 | Protein kinase superfamily protein. |
| AT1G53080 | Legume lectin family protein. |
| AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G53180 | hypothetical protein. |
| AT1G53290 | Galactosyltransferase family protein. |
| AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
| AT1G53340 | Cysteine/Histidine-rich C1 domain family protein. |
| AT1G53370 | F-box and associated interaction domains-containing protein. |
| AT1G53380 | hypothetical protein (DUF641). |
| AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
| AT1G53440 | Leucine-rich repeat transmembrane protein kinase. |
| AT1G53460 | craniofacial development protein. |
| AT1G53470 | mechanosensitive channel of small conductance-like 4. |
| AT1G53500 | encodes a putative NDP-L-rhamnose synthase, an enzyme required for the synthesis of the pectin rhamnogalacturonan I, the major component of Arabidopsis mucilage. Gene is involved in seed coat mucilage cell development. Mutant analyses suggest that MUM4 is required for complete mucilage synthesis, cytoplasmic rearrangement and seed coat development. |
| AT1G53510 | Member of MAP Kinase familly. Target of MPKKK20 phosphorylation. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
| AT1G53520 | Encodes a plastid stroma localized fatty acid binding protein involved in fatty acid metabolism. |
| AT1G53560 | Ribosomal protein L18ae family. |
| AT1G53570 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
| AT1G53620 | transmembrane protein. |
| AT1G53625 | hypothetical protein. |
| AT1G53690 | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G53750 | 26S proteasome AAA-ATPase subunit RPT1a (RPT1a) mRNA, |
| AT1G53760 | K+-H+ exchange-like protein. |
| AT1G53830 | encodes a pectin methylesterase |
| AT1G53840 | encodes a pectin methylesterase |
| AT1G53920 | Contains lipase signature motif and GDSL domain. |
| AT1G53980 | Ubiquitin-like superfamily protein. |
| AT1G53990 | Contains lipase signature motif and GDSL domain. |
| AT1G54000 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G54010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G54020 | GDSL-motif esterase/acyltransferase/lipase. |
| AT1G54030 | Encodes a vacuolar protein. Mutation causes organizational defects in the endoplasmic reticulum and aberrant protein trafficking in the plant secretory pathway. |
| AT1G54040 | Epithiospecifier protein, interacts with WRKY53. Involved in pathogen resistance and leaf senescence. |
| AT1G54095 | DUF1677 family protein, putative (DUF1677). |
| AT1G54100 | Aldehyde dehydrogenase |
| AT1G54110 | Membrane fusion protein Use1. |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT1G54120 | hypothetical protein. |
| AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT1G54140 | putative TATA binding protein associated factor 21kDa |
| AT1G54150 | Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase. |
| AT1G54160 | Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought. |
| AT1G54500 | RBD1 is a thylakoid membrane-bound iron-binding protein that is required for the proper assembly of photosystem II in Arabidopsis. It is found in all oxygenic photoautotrophic organisms (plants, algae and cyanobacteria). |
| AT1G54510 | Encodes AtNEK1, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT1G54720 | early-responsive to dehydration protein-related / ERD protein-like protein. |
| AT1G54820 | Protein kinase superfamily protein. |
| AT1G54830 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC3. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
| AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris |
| AT1G55100 | transposable_element_gene.;pseudogene, putative ATP synthase beta subunit;(source:TAIR10) |
| AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
| AT1G55190 | PRA1 (Prenylated rab acceptor) family protein. |
| AT1G55210 | Disease resistance-responsive (dirigent-like protein) family protein. |
| AT1G55230 | proteinase inhibitor I4, serpin (DUF716). |
| AT1G55240 | proteinase inhibitor I4, serpin (DUF716). |
| AT1G55360 | tRNA-splicing ligase (DUF239). |
| AT1G55530 | RING/U-box superfamily protein. |
| AT1G55535 | transmembrane protein. |
| AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
| AT1G55700 | Cysteine/Histidine-rich C1 domain family protein. |
| AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
| AT1G56030 | RING/U-box protein. |
| AT1G56145 | Leucine-rich repeat transmembrane protein kinase. |
| AT1G56210 | Heavy metal transport/detoxification superfamily protein. |
| AT1G56220 | Dormancy/auxin associated family protein. |
| AT1G56233 | Encodes a defensin-like (DEFL) family protein. |
| AT1G56300 | Chaperone DnaJ-domain superfamily protein. |
| AT1G56330 | Encodes a small GTP-binding protein implicated in ER to cis-Golgi transport of other proteins. A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. The protein is found associated to the ER and free in the cytosol. |
| AT1G56423 | hypothetical protein. |
| AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G56690 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein. |
| AT1G57550 | Low temperature and salt responsive protein family. |
| AT1G57560 | Member of the R2R3 factor gene family. |
| AT1G57600 | MBOAT (membrane bound O-acyl transferase) family protein. |
| AT1G57610 | calcium uniporter (DUF607). |
| AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
| AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT1G58080 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT1G58110 | Basic-leucine zipper (bZIP) transcription factor family protein. |
| AT1G58180 | beta carbonic anhydrase 6. |
| AT1G58200 | A member of MscS-like gene family, structurally very similar to MSL2, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL3-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. MSL3 was capable of increasing the osmotic-shock survival of a mutant bacterial strain lacking MS-ion-channel activity. |
| AT1G58210 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the plasma membrane. |
| AT1G58235 | hypothetical protein. |
| AT1G58270 | ZW9 mRNA, complete cds |
| AT1G58290 | Encodes a protein with glutamyl-tRNA reductase (GluTR) activity, catalyzing the NADPH-dependent reduction of Glu-tRNA(Glu) to glutamate 1-semialdehyde (GSA) with the release of free tRNA(Glu). It is involved in the early steps of chlorophyll biosynthesis. |
| AT1G58350 | Putative serine esterase family protein. |
| AT1G58400 | Disease resistance protein (CC-NBS-LRR class) family. |
| AT1G58410 | Disease resistance protein (CC-NBS-LRR class) family. |
| AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein. |
| AT1G59590 | ZCF37 mRNA, complete cds |
| AT1G59600 | ZCW7. |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. |
| AT1G59730 | Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1. |
| AT1G59740 | Major facilitator superfamily protein. |
| AT1G59820 | Encodes a phospholipid translocase. Involved in secretory vesicle formation from trans-Golgi in peripheral columella cells at the root tip. Mutants have short primary roots and grow slower. |
| AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. |
| AT1G59890 | SIN3-like 5. |
| AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) |
| AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
| AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT1G60050 | nodulin MtN21-like transporter family protein |
| AT1G60140 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G60150 | transposable_element_gene |
| AT1G60190 | Encodes PUB19, a plant U-box armadillo repeat protein. Involved in salt inhibition of germination together with PUB18. |
| AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
| AT1G60260 | beta glucosidase 5. |
| AT1G60270 | beta glucosidase 6. |
| AT1G60470 | Predicted to encode a galactinol synthase. |
| AT1G60550 | enoyl-CoA hydratase/isomerase D. |
| AT1G60560 | SWIM zinc finger family protein. |
| AT1G60815 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT1G60900 | Putative U2A65 splicing factor which functions in abscisic acid mediated flowering via regulating the precursor messenger RNA splicing of ABI5 and FLC in shoot apex. Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65a. |
| AT1G60987 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G60989 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G61065 | 1,3-beta-glucan synthase component (DUF1218). |
| AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT1G61100 | disease resistance protein (TIR class). |
| AT1G61110 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
| AT1G61120 | Encodes a geranyllinalool synthase that produces a precursor to TMTT, a volatile plant defense C16-homoterpene. GES transcript levels rise in response to alamethicin, a fungal peptide mixture that damages membranes. This transcriptional response is blocked in JA biosynthetic and JA signaling mutants, but GES transcript levels still rise in response to alamethicin in mutants with salicylic acid and ethylene biosynthetic and/or signaling defects. GES transcripts also accumulate in response to a larval infestation. This enzyme does not localize to the plastids, and it may be present in the cytosol or endoplasmic reticulum. |
| AT1G61170 | hypothetical protein. |
| AT1G61250 | Encodes a putative secretory carrier membrane protein (SC3). |
| AT1G61255 | hypothetical protein. |
| AT1G61370 | S-locus lectin protein kinase family protein. |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase. |
| AT1G61470 | Deadenylase. |
| AT1G61560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G61667 | serine protease, putative (Protein of unknown function, DUF538). |
| AT1G61670 | Lung seven transmembrane receptor family protein. |
| AT1G61740 | Sulfite exporter TauE/SafE family protein. |
| AT1G61750 | Receptor-like protein kinase-related family protein. |
| AT1G61810 | beta-glucosidase 45. |
| AT1G61820 | beta glucosidase 46. |
| AT1G61890 | MATE efflux family protein. |
| AT1G61900 | hypothetical protein. |
| AT1G62035 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGCCGUGCCAAUAUCACG. Pri-mRNA coordinates for MIR171c (converted to TAIR10 based on PMID19304749): Chr1: 22930427-22929567 (reverse), length: 861 bp; exon coordinates: exon 1: 22930427 to 22930342, exon 2: 22930233 to 22930047, exon 3: 22929839 to 22929567; mature miRNA and miRNA* are located on exon 1. |
| AT1G62200 | Major facilitator superfamily protein. |
| AT1G62301 | unknown protein |
| AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
| AT1G62330 | O-fucosyltransferase family protein. |
| AT1G62370 | RING/U-box superfamily protein. |
| AT1G62380 | Encodes a protein similar to 1-aminocyclopropane-1-carboxylic oxidase (ACC oxidase). Expression of the AtACO2 transcripts is affected by ethylene. |
| AT1G62420 | DUF506 family protein (DUF506). |
| AT1G62422 | hypothetical protein. |
| AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
| AT1G62440 | encodes a paralog of LRX1 (LEUCINE-RICH REPEAT/EXTENSIN 1) which acts synergistically with LRX1 in root hair cell morphogenesis. |
| AT1G62520 | sulfated surface-like glycoprotein. |
| AT1G62540 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G62650 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT1G62660 | Glycosyl hydrolases family 32 protein. |
| AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
| AT1G62720 | Encodes a PPR protein gene that localizes to the mitochondrion and is required for seed germination. |
| AT1G62760 | Pectin methylesterase inhibitor that controls PME activity and pectin methylesterification during Botrytis infection. |
| AT1G62770 | PMEI9 pectin methyleseterase inhibitor. Expressed in many plant tissues. |
| AT1G62780 | dimethylallyl, adenosine tRNA methylthiotransferase. |
| AT1G62800 | Encodes aspartate aminotransferase (Asp4). |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT1G62975 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT1G62981 | transmembrane protein, putative (DUF1191). |
| AT1G62990 | Encodes a homeodomain transcription factor of the Knotted family. May be involved in secondary cell wall biosynthesis. Mutants have moderately irregular xylem development. Expression of this gene is upregulated by SND1 and MYB46. |
| AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase. |
| AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
| AT1G63030 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels. |
| AT1G63090 | phloem protein 2-A11. |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein. |
| AT1G63240 | Methyl-DNA binding protein which interacts with RMB1 and ROS1 acting in the base excision repair pathway through DNA methylation. |
| AT1G63245 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
| AT1G63410 | LURP-one-like protein (DUF567). |
| AT1G63430 | Leucine-rich repeat protein kinase family protein. |
| AT1G63480 | AT hook motif DNA-binding family protein. |
| AT1G63580 | Encodes a plasma membrane-localized protein with two DUF26 domains and a GPI anchor domain. |
| AT1G63640 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein. |
| AT1G63680 | Encodes AtMurE, a homolog of the bacterial MurE that catalyze the ATP-dependent formation of UDP-N-acetylmuramic acid-tripeptide in bacterial peptidoglycan biosynthesis. Localized to plastids. AtMurE is involved in chloroplast biogenesis. |
| AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT1G63720 | hydroxyproline-rich glycoprotein family protein. |
| AT1G63835 | transposable_element_gene.;copia-like retrotransposon family |
| AT1G63840 | RING/U-box superfamily protein. |
| AT1G63850 | BTB/POZ domain-containing protein. |
| AT1G64040 | Encodes the catalytic subunit of a Type 1 phosphoprotein Ser/Thr phosphatase, expressed in roots, shoots and flowers. |
| AT1G64050 | hypothetical protein. |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT1G64140 | WRKY transcription factor. |
| AT1G64142 | unknown protein |
| AT1G64150 | Encodes an integral thylakoid membrane protein that is required for normal operation of oxygen-evolving complex (as evidenced by oxygen evolution rates) and for manganese incorporation. |
| AT1G64200 | vacuolar H+-ATPase subunit E isoform 3. |
| AT1G64340 | Serine/Threonine-kinase. |
| AT1G64350 | seh1-like protein |
| AT1G64370 | filaggrin-like protein. |
| AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. |
| AT1G64385 | transmembrane protein. |
| AT1G64390 | glycosyl hydrolase 9C2. |
| AT1G64405 | hypothetical protein. |
| AT1G64585 | ROTUNDIFOLIA like 22. |
| AT1G64610 | Transducin/WD40 repeat-like superfamily protein. |
| AT1G64618 | other_RNA. |
| AT1G64620 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT1G64628 | unknown protein |
| AT1G64630 | with no lysine (K) kinase 10. |
| AT1G64640 | early nodulin-like protein 8. |
| AT1G64650 | Major facilitator superfamily protein. |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. |
| AT1G64710 | GroES-like zinc-binding alcohol dehydrogenase family protein. |
| AT1G64900 | Encodes cytochrome P450 (CYP89A2). |
| AT1G64950 | member of CYP89A |
| AT1G64980 | Encodes a putative nucleotide-diphospho-sugar transferase required for pollen germination and tube growth. |
| AT1G64990 | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG1 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG1 and may act to down-regulate GTG1 binding to ABA. GTG1 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG1 transcript levels do not appear to change in response to ABA or abiotic stresses. |
| AT1G65040 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT1G65050 | TRAF-like superfamily protein. |
| AT1G65180 | Cysteine/Histidine-rich C1 domain family protein. |
| AT1G65510 | Secreted peptide which functions in plant growth and pathogen defense. |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein. |
| AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT1G65820 | microsomal glutathione s-transferase. |
| AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA). |
| AT1G65840 | encodes a peroxisomal polyamine oxidase, involved in the back-conversion polyamine degradation pathway. Among the five polyamine oxidases in the Arabidopsis genome, PAO4 is the major isoform in root peroxisomes. |
| AT1G65860 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates |
| AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein. |
| AT1G65890 | acyl activating enzyme 12. |
| AT1G65900 | plant/protein. |
| AT1G65930 | Encodes a NADP+-isocitrate dehydrogenase that is believed to function in the cytosol. It appears to contribute to NADPH production under oxidative stress, and thereby to participate in redox signalling linked to defense responses. |
| AT1G65980 | thioredoxin-dependent peroxidase |
| AT1G66100 | Predicted to encode a PR (pathogenesis-related) protein. |
| AT1G66145 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1. |
| AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. |
| AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT1G66230 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT1G66240 | homolog of anti-oxidant 1. |
| AT1G66270 | BGLU21 encodes a beta-glucosidase that has a high level of activity against the naturally occuring secondary metabolite scopolin. Recombinant BGLU21 produced in insect cells shows lower levels of activity using the structurally similar substrates esculin (33%) and 4-MU-glucoside (9%). BGLU21 is glycosylated in planta and has a C-terminal ER retention signal. Transcript analysis as well as protein extraction and western blotting from various plant organs suggest that BGLU21 is only present in roots and seedlings. Transcript levels increase in response to cold, auxin (2,4-D), and methyl jasmonate treatments. |
| AT1G66280 | Glycosyl hydrolase superfamily protein. |
| AT1G66345 | Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I. |
| AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
| AT1G66360 | Calcium-dependent lipid-binding (CaLB domain) family protein. |
| AT1G66370 | Encodes a member of the MYB family of transcription factors. Involved in regulation of anthocyanin biosynthesis. Affects the expression of enzymes involved in later steps of anthocyanin biosynthesis. |
| AT1G66380 | Encodes a member of the MYB family of transcription factors. Involved in regulation of anthocyanin biosynthesis. Affects the expression of enzymes involved in later steps of anthocyanin biosynthesis |
| AT1G66390 | Production of anthocyanin pigment 2 protein (PAP2). |
| AT1G66400 | Encodes a calmodulin-like protein. Regulates nitric oxide levels and transition to flowering. |
| AT1G66470 | ROOT HAIR DEFECTIVE6. |
| AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities |
| AT1G66553 | unknown protein |
| AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
| AT1G66760 | MATE efflux family protein. |
| AT1G66800 | Its expression is enriched in non-root hair cells (compared to root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in non-root hair cells relative to root-hair cells. Protein sequence is similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase. |
| AT1G66880 | Protein kinase superfamily protein. |
| AT1G66890 | 50S ribosomal-like protein. |
| AT1G66920 | Protein kinase superfamily protein. |
| AT1G66940 | kinase-like protein. |
| AT1G67000 | Protein kinase superfamily protein. |
| AT1G67010 | pseudogene of Protein kinase superfamily protein. |
| AT1G67030 | Encodes a novel C2H2 zinc finger protein containing only a single zinc finger which plays a key role in regulating trichome development by integrating GA and cytokinin signaling. |
| AT1G67040 | DnaA initiator-associating protein. |
| AT1G67050 | membrane-associated kinase regulator. |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT1G67080 | Encodes a protein involved in the photoprotection of PSII. An aba4-1 mutant completely lacks neoxanthin,a component of the chromophore of the peripheral antenna system in PSII. ABA4 is required for neoxanthin biosynthesis, an intermediary step in abscisic acid biosynthesis, but no catalytic activity has been detected for the ABA4 protein. |
| AT1G67140 | HEAT repeat-containing protein. |
| AT1G67195 | miRNA (MIR414). Has been identified as a translated small open reading frame by ribosome profiling. |
| AT1G67230 | Encodes a nuclear coiled-coil protein related to the carrot peripheral nuclear protein NMCP1 that is involved in the determination of plant nuclear structure. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT1G67238 | other_RNA. |
| AT1G67240 | transposable_element_gene.;Mutator-like transposase family |
| AT1G67250 | Proteasome maturation factor UMP1. |
| AT1G67265 | ROTUNDIFOLIA like 21. |
| AT1G67300 | Major facilitator superfamily protein. |
| AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain. |
| AT1G67360 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT1G67365 | Natural antisense transcript overlaps with AT1G67370. |
| AT1G67420 | Zn-dependent exopeptidases superfamily protein. |
| AT1G67480 | Galactose oxidase/kelch repeat superfamily protein. |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein. |
| AT1G67590 | Remorin family protein. |
| AT1G67740 | PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts where it is processed into two integral membrane proteins with identical topology (PsbY-1 and PsbY-2). The protein appears to bind manganese. Important for the redox control of cytochrome b559. |
| AT1G67785 | hypothetical protein. |
| AT1G67790 | sieve element occlusion protein. |
| AT1G67792 | Natural antisense transcript overlaps with AT1G67790. |
| AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein. |
| AT1G67900 | Phototropic-responsive NPH3 family protein. |
| AT1G67910 | hypothetical protein. |
| AT1G68020 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain and a trehalose phosphatase (TPP)-like domain. It can complement a yeast mutant lacking both of these activities suggesting that this is a bifunctional enzyme. |
| AT1G68130 | Encodes the longer of two splice variants of a transcription factor involved in regulating starch metabolism in response to cold. |
| AT1G68440 | Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT1G68490 | translocase subunit seca. |
| AT1G68500 | hypothetical protein. |
| AT1G68526 | hypothetical protein. |
| AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G68540 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G68552 | unknown protein |
| AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT1G68580 | Agenet and bromo-adjacent homology (BAH) domain-containing protein. |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein. |
| AT1G68670 | HHO2 is a HRS1 homolog. Nitrate-inducible expression. Also induced in roots by low Pi and is likely involved in maintaining phosphate homeostasis. It is target of PHR1.Both HHO2 and HRS1 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT1G68680 | SH3/FCH domain protein. |
| AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G68765 | Encodes a small protein of 77 amino acids. Loss of function mutations are defective in the process of ethylene independent floral organ abscission. Although the mutants have a normal appearing abscission zone, the floral organs do not abscisce. The peptide appears to be secreted and may function as a ligand. Arabidopsis 35S:IDA lines constitutively overexpressing IDA exhibit earlier abscission of floral organs, showing that the abscission zones are responsive to IDA soon after the opening of the flowers. In addition, ectopic abscission was observed at the bases of the pedicel, branches of the inflorescence, and cauline leaves. The silique valves also dehisced prematurely. |
| AT1G68820 | Putative C3HC4 zinc-finger ubiquitin E3 ligase, negative regulator in ABA and drought stress response. May act as a positive role in regulating the high temperature by mediating the degradation of unknown target proteins. |
| AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
| AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) |
| AT1G68990 | MGP3 (male gametophyte-defective 3) belongs to a small family of nuclear-encoded Phage type RNA polymerases (RPOTs) involved in the transcription of mitochondrial genes in Arabidopsis thaliana. Mutation in MGP 3 significantly retarded pollen tube growth and caused defective embryo development. |
| AT1G69000 | pre-tRNA tRNA-Met. |
| AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT1G69030 | BSD domain-containing protein. |
| AT1G69050 | hypothetical protein. |
| AT1G69150 | Cysteine/Histidine-rich C1 domain family protein. |
| AT1G69250 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein. |
| AT1G69252 | other_RNA. |
| AT1G69260 | ABI five binding protein. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT1G69310 | Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance. |
| AT1G69370 | Encodes chorismate mutase 3 (CM3). |
| AT1G69400 | Transducin/WD40 repeat-like superfamily protein. |
| AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. |
| AT1G69450 | Early-responsive to dehydration stress protein (ERD4). |
| AT1G69485 | Ribosomal L32p protein family. |
| AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G69540 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. |
| AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
| AT1G69580 | Homeodomain-like superfamily protein. |
| AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
| AT1G69610 | zinc finger FYVE domain protein, putative (DUF1666). |
| AT1G69680 | ran guanine nucleotide release factor, putative (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein). |
| AT1G69690 | AtTCP15 is involved in the regulation of endoreduplication. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT1G69760 | suppressor SRP40-like protein. |
| AT1G69780 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein which is expressed during the seed-to-seedling transition, regulates some of the network nodes, and affects late seedling establishment. Knock-out mutants for athb13 showed increased primary root length as compared with wild type (Col-0) seedlings, suggesting that this transcription factor is a negative regulator of early root growth, possibly repressing cell division and/or cell elongation or the length of time cells elongate. |
| AT1G69790 | Protein kinase superfamily protein. |
| AT1G69800 | Cystathionine beta-synthase (CBS) protein. |
| AT1G69818 | Encodes a defensin-like (DEFL) family protein. |
| AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT1G69930 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT1G69935 | Encodes a nuclear localized serine-arginine-aspartate-rich protein that acts as a negative regulator of photomorphogenesis. |
| AT1G70000 | Encodes a MYB-like Domain transcription factor that plays a positive role in anthocyanin accumulation in response to light and cytokinin via repression of MYBL2.MYBD expression increased in response to light or cytokinin, and MYBD enhanced anthocyanin biosynthesis via the repression of MYBL2 encoding for a transcription factor that had a negative effect on this process. In addition, MYBD can bind in vivo to the MYBL2 promoter and a lower level of histone H3K9 acetylation (H3K9ac) at upstream region of MYBL2 in MYBD-OX in comparison to wild-type plants, implies that MYBD represses MYBL2 expression via an epigenetic mechanism. |
| AT1G70160 | zinc finger MYND domain protein. |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT1G70220 | RNA-processing, Lsm domain-containing protein. |
| AT1G70230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G70260 | Encodes an endoplasmic reticulum (ER)-localized nodulin MtN21-like transporter family protein that negatively regulates resistance against biotrophic pathogens but not the necrotrophic pathogen, B. cinerea, possibly by regulating ROS production, cell death and PR1 expression. |
| AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G70300 | potassium transporter |
| AT1G70310 | Spermidine synthase. |
| AT1G70330 | encodes an adenosine transporter that catalyze a proton-dependent adenosine transport. |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT1G70400 | NOSIC domain protein. |
| AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. |
| AT1G70420 | DNA ligase-like protein, putative (DUF1645). |
| AT1G70505 | transmembrane protein. |
| AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein. |
| AT1G70550 | NEP-interacting protein, putative (DUF239). |
| AT1G70570 | anthranilate phosphoribosyltransferase. |
| AT1G70580 | Encodes a protein with glyoxylate aminotransferase activity. |
| AT1G70600 | Ribosomal protein L18e/L15 superfamily protein. |
| AT1G70610 | member of TAP subfamily |
| AT1G70640 | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein. |
| AT1G70645 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UACGCAUUGAGUUUCGUUGCU |
| AT1G70650 | Ran BP2/NZF zinc finger-like superfamily protein. |
| AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT1G70700 | JAZ9 is a protein presumed to be involved in jasmonate signaling. JAZ9 transcript levels rise in response to a jasmonate stimulus. JAZ9 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. The Jas domain appears to be important for JAZ9-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. |
| AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
| AT1G70740 | Protein kinase superfamily protein. |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593). |
| AT1G70760 | a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located on the thylakoid membrane. Mutant has impaired NAD(P)H dehydrogenase activity. |
| AT1G70780 | hypothetical protein. |
| AT1G70782 | unknown protein |
| AT1G70790 | C2-domain ABA-related (CAR) protein, involved in the recruitment of ABA receptors to the plasma membrane to facilitate ABA signaling. |
| AT1G70800 | Encodes a novel NPH3/phototropin binding factor with a calcium binding domain that negatively affects hypocotyl bending under blue light conditions in Arabidopsis thaliana and may regulate phototropism. |
| AT1G70810 | Calcium-dependent lipid-binding (CaLB domain) family protein. |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase. |
| AT1G70860 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT1G70870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT1G70900 | hypothetical protein. |
| AT1G70940 | A regulator of auxin efflux and involved in differential growth. PIN3 is expressed in gravity-sensing tissues, with PIN3 protein accumulating predominantly at the lateral cell surface. PIN3 localizes to the plasma membrane and to vesicles. In roots, PIN3 is expressed without pronounced polarity in tiers two and three of the columella cells, at the basal side of vascular cells, and to the lateral side of pericycle cells of the elongation zone. PIN3 overexpression inhibits root cell growth. Protein phosphorylation plays a role in regulating PIN3 trafficking to the plasma membrane. |
| AT1G70944 | transmembrane protein. |
| AT1G70990 | Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility. |
| AT1G71002 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection. |
| AT1G71010 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the proposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. |
| AT1G71080 | RNA polymerase II transcription elongation factor. |
| AT1G71090 | Auxin efflux carrier family protein. |
| AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
| AT1G71500 | Encodes PSB33, a protein conserved in the plastid lineage. PSB33 is associated with the chloroplast thylakoid membrane and provides stability to Photosystem II. |
| AT1G71520 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. |
| AT1G71692 | Encodes a member of the MADS box family of transcription factors. |
| AT1G71695 | Peroxidase superfamily protein. |
| AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
| AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. |
| AT1G71710 | DNAse I-like superfamily protein. |
| AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. |
| AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
| AT1G71970 | hypothetical protein. |
| AT1G72040 | Encodes a multisubstrate deoxyribonucleoside kinase that salvages DNA precursors. |
| AT1G72050 | Encodes a transcriptional factor TFIIIA required for transcription of 5S rRNA gene. 5S rRNA is the smallest constituent of the ribosome. Work on one of the gene models AT1G72050.2 showed that it encodes a protein with nine Cys(2)-His(2)-type zinc fingers, a characteristic feature of TFIIIA proteins. AT1G72050.2 also contains a 23 amino acid spacer between fingers 1 and 2, a 66 amino acid spacer between fingers 4 and 5, and a 50 amino acid non-finger C-terminal tail. in vitro assay demonstrated that AT1g72050.2 binds to 5S rDNA and efficiently stimulates the transcription of 5S rRNA. AT1g72050.2 also binds to 5S rRNA in vitro. AT1g72050.2 is located at several nuclear foci including the nucleolus and is absent from the cytoplasm. |
| AT1G72110 | O-acyltransferase (WSD1-like) family protein. |
| AT1G72120 | Major facilitator superfamily protein. |
| AT1G72125 | Major facilitator superfamily protein. |
| AT1G72130 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G72140 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes |
| AT1G72160 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232). |
| AT1G72180 | Encodes a leucine-rich repeat receptor kinase that functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT1G72220 | RING/U-box superfamily protein. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
| AT1G72350 | MADS-box transcription factor family protein. |
| AT1G72416 | Chaperone DnaJ-domain superfamily protein. |
| AT1G72440 | Encodes SLOW WALKER2 (SWA2), a NOC1/Mak21 homologue. Essential for coordinated cell cycle progression during female gametophyte development. |
| AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
| AT1G72460 | Leucine-rich repeat protein kinase family protein. |
| AT1G72470 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein. |
| AT1G72510 | DUF1677 family protein (DUF1677). |
| AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein. |
| AT1G72540 | Protein kinase superfamily protein. |
| AT1G72550 | tRNA synthetase beta subunit family protein. |
| AT1G72600 | hydroxyproline-rich glycoprotein family protein. |
| AT1G72620 | alpha/beta-Hydrolases superfamily protein. |
| AT1G72690 | neurofilament heavy protein. |
| AT1G72780 | pre-tRNA tRNA-Ser (anticodon: AGA). |
| AT1G72790 | hydroxyproline-rich glycoprotein family protein. |
| AT1G72830 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT1G72840 | NBS TIR LRR protein. It is induced in response to bacterial pathogens and overexpression results in cell death in leaves. |
| AT1G72890 | NBS TIR protein. |
| AT1G73066 | Leucine-rich repeat family protein. |
| AT1G73080 | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. |
| AT1G73150 | Bromodomain and extra terminal domain family protein. Binds to acetyl-histone H3. Binding is reduced when GTE3 is SUMOylated by SIZ1. |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein. |
| AT1G73165 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
| AT1G73210 | hypothetical protein (DUF789). |
| AT1G73260 | Encodes a trypsin inhibitor involved in modulating programmed cell death in plant-pathogen interactions. |
| AT1G73270 | serine carboxypeptidase-like 6. |
| AT1G73280 | serine carboxypeptidase-like 3. |
| AT1G73300 | serine carboxypeptidase-like 2. |
| AT1G73310 | serine carboxypeptidase-like 4. |
| AT1G73325 | Kunitz family trypsin and protease inhibitor protein. |
| AT1G73330 | encodes a plant-specific protease inhibitor-like protein whose transcript level in root disappears in response to progressive drought stress. The decrease in transcript level is independent from abscisic acid level. |
| AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
| AT1G73470 | hypothetical protein. |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein. |
| AT1G73500 | member of MAP Kinase Kinase family. Autophosphorylates and also phosphorylates MPK3 and MPK6. Independently involved in ethylene and calmalexin biosynthesis. Induces transcription of ACS2, ACS6, ERF1, ERF2, ERF5, ERF6, CYP79B2, CYP79B3, CYP71A13 and PAD3. |
| AT1G73540 | nudix hydrolase homolog 21. |
| AT1G73550 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT1G73600 | Encodes a S-adenosyl-L-methionine-dependent phosphoethanolamine N-methyltransferase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. It catalyzes the three sequential P-base methylation of phosphoethanolamine to phosphocholine. Homologous biochemical function to NMT1 (At3g18000). Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
| AT1G73660 | Encodes a protein with similarity to MAPKKKs. May function as a negative regulator of salt tolerance. |
| AT1G73670 | member of MAP Kinase |
| AT1G73687 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUUGGAUUGAAGGGAGCUCUA. Functions redundantly with MIR159B. Plants that are doubly mutated for MIR159AB have curled leaves and reduced stature. Pri-mRNA coordinates for MIR159a (converted to TAIR10 based on PMID19304749): Chr1: 27713700-27712893 (reverse), length: 808 bp; exon coordinates: exon 1: 27713700 to 27712893, mature miRNA and miRNA* are located on exon 1. |
| AT1G73740 | UDP-Glycosyltransferase superfamily protein. |
| AT1G73750 | alpha/beta hydrolase family protein. |
| AT1G73760 | RING/U-box superfamily protein. |
| AT1G73790 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT1G73830 | Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3) |
| AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
| AT1G74088 | galacturonosyltransferase. |
| AT1G74100 | encodes a desulfoglucosinolate sulfotransferase, involved in the final step of glucosinolate core structure biosynthesis. Has a broad-substrate specificity with different desulfoglucosinolates, the best substrate is indole-3-methyl-dsGS, followed by benzyl-dsGS. Expression was induced by wounding, jasmonate and ethylene stimulates. |
| AT1G74205 | Natural antisense transcript overlaps with AT1G74210. |
| AT1G74210 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT1G74420 | Predicted fucosyltransferase, based on similarity to FUT1, but not functionally redundantwith FUT1. |
| AT1G74430 | Encodes a putative transcription factor (MYB95). |
| AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
| AT1G74448 | unknown protein |
| AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
| AT1G74510 | Galactose oxidase/kelch repeat superfamily protein. |
| AT1G74640 | alpha/beta-Hydrolases superfamily protein. |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
| AT1G74690 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT1G74700 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. |
| AT1G74710 | Encodes a protein with isochorismate synthase activity. Mutants fail to accumulate salicylic acid. Its function may be redundant with that of ICS2 (AT1G18870). |
| AT1G74720 | Encodes a putative transmembrane protein carrying four C(2) domains, suggesting that QKY may function in membrane trafficking in a Ca(2+)-dependent fashion. Mutant analysis shows that this gene is involved in organ development. |
| AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein. |
| AT1G74790 | catalytics. |
| AT1G74830 | myosin-binding protein, putative (Protein of unknown function, DUF593). |
| AT1G74840 | Homeodomain-like superfamily protein. |
| AT1G74929 | hypothetical protein. |
| AT1G74930 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581). |
| AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT1G75060 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G75070 | pre-tRNA tRNA-Asp (anticodon: GTC). |
| AT1G75080 | Encodes a positive regulator of the brassinosteroid (BR) signalling pathway that mediates both downstream BR responses and negative feedback regulation of BR biosynthesis. |
| AT1G75170 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT1G75180 | Erythronate-4-phosphate dehydrogenase family protein. |
| AT1G75190 | hypothetical protein. |
| AT1G75200 | flavodoxin family protein / radical SAM domain-containing protein. |
| AT1G75230 | DNA glycosylase superfamily protein. |
| AT1G75360 | transmembrane protein. |
| AT1G75370 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. |
| AT1G75388 | unknown protein |
| AT1G75390 | basic leucine-zipper 44. |
| AT1G75400 | RING/U-box superfamily protein. |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT1G75440 | ubiquitin-conjugating enzyme 16. |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT1G75460 | ATP-dependent protease La (LON) domain protein. |
| AT1G75480 | pseudogene of gamma-glutamyl hydrolase 1. |
| AT1G75490 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein. |
| AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). |
| AT1G75590 | SAUR-like auxin-responsive protein family. |
| AT1G75710 | C2H2-like zinc finger protein. |
| AT1G75750 | GA-responsive GAST1 protein homolog regulated by BR and GA antagonistically. Possibly involved in cell elongation based on expression data |
| AT1G75790 | SKU5 similar 18. |
| AT1G75800 | Pathogenesis-related thaumatin superfamily protein. |
| AT1G75810 | transmembrane protein. |
| AT1G75950 | SKP1 is core component of the SCF family of E3 ubiquitin ligases and serves to tether the rest of the complex to an F-box protein, which provides specificity in binding to ubiquitin ligase substrate proteins. Predominately expressed from leptotene to pachytene. Negatively regulates recombination. Interacts with P0, a silencing suppressor protein encoded by poleroviruses by means of a conserved minimal F-box motif. |
| AT1G75960 | AMP-dependent synthetase and ligase family protein. |
| AT1G76065 | LYR family of Fe/S cluster biogenesis protein. |
| AT1G76070 | hypothetical protein. |
| AT1G76080 | Encodes a thioredoxin like protein. Localizes to the chloroplast and is redistributed to the chloroplast envelope under heat stress. It is involved in non host resistance and thermotolerance. |
| AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT1G76160 | SKU5 similar 5. |
| AT1G76170 | 2-thiocytidine tRNA biosynthesis protein, TtcA. |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
| AT1G76360 | Protein kinase superfamily protein. |
| AT1G76370 | Protein kinase superfamily protein. |
| AT1G76380 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G76405 | outer envelope pore 21B-like protein. |
| AT1G76410 | RING/U-box superfamily protein. |
| AT1G76480 | caveolin-1 protein. |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine |
| AT1G76500 | Encodes an AT hook domain containing protein. |
| AT1G76520 | Auxin efflux carrier family protein. |
| AT1G76560 | CP12 domain-containing protein 3. |
| AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein. |
| AT1G76590 | PLATZ transcription factor family protein. |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT1G76610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617). |
| AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547). |
| AT1G76640 | Calcium-binding EF-hand family protein. |
| AT1G76728 | transmembrane protein. |
| AT1G76730 | Encodes a paralog of ATP-dependent folate salvage enzyme 5-formyltetrahydrofolate cycloligase (5-FCL) that is targeted to chloroplasts and to be required for embryo viability and lacks 5-FCL activity. |
| AT1G76790 | Encodes a protein with similarity to N-acetylserotonin O-methyltransferase (ASMT) but it does not have ASMT activity in vitro. |
| AT1G76840 | hypothetical protein. |
| AT1G76850 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT1G76870 | transcription factor. |
| AT1G76878 | Natural antisense transcript overlaps with AT1G76880. |
| AT1G76880 | DF1 is a putative transcription factor required for the synthesis of seed mucilage polysaccharides. The df1 seeds produce almost 50% less mucilage than wild-type, but show less severe defects than the myb5 and ttg2 mutants. |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT1G76900 | Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM. |
| AT1G76954 | Encodes a defensin-like (DEFL) family protein. |
| AT1G76980 | patatin-like phospholipase domain protein. |
| AT1G76990 | ACT domain repeat 3. |
| AT1G76994 | hypothetical protein. |
| AT1G77000 | AtSKP2;2 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. AtSKP2b may also be involved in the degradation of KRP1/ICK1, a CDK inhibitor. |
| AT1G77060 | Phosphoenolpyruvate carboxylase family protein. |
| AT1G77131 | Annotated as pseudogene of PGSIP, glycogenin glucosyltransferase. |
| AT1G77138 | other_RNA. |
| AT1G77140 | A peripheral membrane protein that associates with microsomal membranes, likely to function in the transport of proteins to the vacuole. It is a member of Sec1p protein family. It may be involved in the regulation of vesicle fusion reactions through interaction with t-SNAREs at the Golgi trans face. |
| AT1G77260 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT1G77270 | hypothetical protein. |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein. |
| AT1G77320 | Mutant is defective in meiosis and produces abnormal microspores. Encodes a BRCT-domain-containing protein that could be specific to the meiotic cell cycle and that plays a crucial role in some DNA repair events independent of SPO11 DSB recombination repair. |
| AT1G77330 | similar to 1-aminocyclopropane-1-carboxylate oxidase GI:3386565 from (Sorghum bicolor) |
| AT1G77340 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT1G77360 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT1G77370 | Glutaredoxin family protein. |
| AT1G77410 | beta-galactosidase 16. |
| AT1G77420 | alpha/beta-Hydrolases superfamily protein. |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632). |
| AT1G77525 | defensin-like protein. |
| AT1G77640 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. |
| AT1G77650 | F-box associated ubiquitination effector family protein. |
| AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G77670 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein. |
| AT1G77730 | Pleckstrin homology (PH) domain superfamily protein. |
| AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. |
| AT1G77746 | unknown protein |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT1G77765 | transmembrane protein. |
| AT1G77840 | Translation initiation factor IF2/IF5. |
| AT1G77850 | Encodes a transcriptional regulator that directly binds to the promoter of MYB108 and plays a crucial role in anther dehiscence, pollen wall pattern formation, tapetum development, and auxin signal transduction in anthers. |
| AT1G77860 | Mutant has Altered morphology of pollen exine wall; Seven-Path Transmembrane Protein |
| AT1G77870 | membrane-anchored ubiquitin-fold protein 5 precursor. |
| AT1G77880 | Galactose oxidase/kelch repeat superfamily protein. |
| AT1G77990 | Encodes a low-affinity sulfate transporter. |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT1G78030 | hypothetical protein. |
| AT1G78040 | Pollen Ole e 1 allergen and extensin family protein. |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein. |
| AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. |
| AT1G78090 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G78100 | F-box family protein. |
| AT1G78140 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT1G78150 | N-lysine methyltransferase. |
| AT1G78170 | E3 ubiquitin-protein ligase. |
| AT1G78190 | Trm112p-like protein. |
| AT1G78210 | alpha/beta-Hydrolases superfamily protein. |
| AT1G78230 | Outer arm dynein light chain 1 protein. |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT1G78260 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT1G78265 | Natural antisense transcript overlaps with AT1G78270. |
| AT1G78270 | UDP-glucosyl transferase 85A4. |
| AT1G78280 | transferases, transferring glycosyl groups. |
| AT1G78310 | VQ motif-containing protein. |
| AT1G78380 | Encodes a glutathione transferase that is a member of Tau GST gene family. Expression is induced by drought stress, oxidative stress, and high doses of auxin and cytokinin. naming convention according to Wagner et al. (2002) The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G78476 | hypothetical protein. |
| AT1G78480 | Prenyltransferase family protein. |
| AT1G78490 | member of CYP708A family. |
| AT1G78500 | Encodes a protein with pentacyclic triterpene synthase activity. In addition to the compounds lupeol, α-amyrin and bauerenol, this enzyme was also shown to produce two seco-triterpenes: α- and β-seco-amyrin. |
| AT1G78560 | Chloroplast inner membrane, pantothenate transporter. |
| AT1G78590 | Encodes a NADH kinase which can synthesize NADPH from NADH; also utilizes NAD+ as substrate although NADH is the preferred substrate. |
| AT1G78600 | light-regulated zinc finger protein 1. |
| AT1G78610 | mechanosensitive channel of small conductance-like 6. |
| AT1G78620 | integral membrane protein (Protein of unknown function DUF92, transmembrane). |
| AT1G78650 | Similar to DNA polymerase delta (POLD3), which in other organism was shown to be involved in the elongation of DNA replication. |
| AT1G78660 | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78670 | gamma-glutamyl hydrolase 3. |
| AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
| AT1G78690 | Encodes a lysoglycerophospholipid O-acyltransferase that acylates 1-acyl lyso PE and 1-acyl lyso PG but not PE or PG. |
| AT1G78700 | BES1/BZR1 homolog 4. |
| AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein. |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
| AT1G78860 | curculin-like (mannose-binding) lectin family protein |
| AT1G78865 | other_RNA. |
| AT1G78895 | Reticulon family protein. |
| AT1G78900 | Encodes catalytic subunit A of the vacuolar ATP synthase. |
| AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
| AT1G79040 | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ. |
| AT1G79060 | TPRXL. |
| AT1G79070 | SNARE-associated protein-like protein. |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein. |
| AT1G79150 | binding protein. |
| AT1G79160 | filamentous hemagglutinin transporter. |
| AT1G79170 | transmembrane protein. |
| AT1G79180 | Member of the R2R3 factor gene family. |
| AT1G79260 | nitrobindin heme-binding domain protein. |
| AT1G79270 | evolutionarily conserved C-terminal region 8. |
| AT1G79290 | pre-tRNA tRNA-Lys (anticodon: TTT). |
| AT1G79300 | pre-tRNA tRNA-Lys (anticodon: TTT). |
| AT1G79310 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT1G79340 | Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT1G79370 | member of CYP79C |
| AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT1G79410 | organic cation/carnitine transporter5. |
| AT1G79420 | C-type mannose receptor (DUF620). |
| AT1G79500 | Encodes a protein with 3-deoxy-8-phosphooctulonate synthase (KDOP synthase) activity which is involved in the biosynthesis of KDO, a component of cell wall rhamnogalacturonan II. |
| AT1G79510 | hypothetical protein (DUF2358). |
| AT1G79520 | Cation efflux family protein. |
| AT1G79530 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G79570 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein. |
| AT1G79600 | Encodes a chloroplast ABC1-like kinase that regulates vitamin E metabolism. |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT1G79680 | Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP. |
| AT1G79690 | Encodes a dual activity enzyme which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase. |
| AT1G79700 | WRI4 encodes an AP2/ERF-type transcriptional activator that specifically controls cuticular wax biosynthesis in Arabidopsis stems. It also functions to activate transcription of genes involved fatty acid biosynthesis during seed and flower development as well as stem wax biosynthesis. Targets identified by ChIP-seq include: LACS1, KCR1, PAS2, ECR, and WSD1. |
| AT1G79900 | encodes a mitochondrial ornithine transporter that exports ornithine from the mitochondria to the cytosol |
| AT1G79910 | Regulator of Vps4 activity in the MVB pathway protein. |
| AT1G80010 | FAR1-related sequence 8. |
| AT1G80020 | transposable_element_gene.;hAT-like transposase family (hobo/Ac/Tam3) |
| AT1G80100 | AHP6 lacks the conserved histidine residue (Asn83 in AHP6b), which is required for phosphotransfer, present in the other AHPs. AHP6 does not appear to have phosphotransfer activity. Acts as an inhibitor of cytokinin signaling by interacting with the phosphorelay machinery. Expressed in developing protoxylem and associated pericycle cell files. Negative regulator of cytokinin signaling. Expression is down-regulated by cytokinins. There are two alternatively spliced genes for this locus, AHP6a and AHP6b, differing in the length of the first exon. In ahp6-2 seedlings, only the AHP6a transcript is present. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT1G80110 | phloem protein 2-B11. |
| AT1G80120 | LURP-one-like protein (DUF567). |
| AT1G80160 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT1G80170 | Pectin lyase-like superfamily protein. |
| AT1G80180 | Encodes a substrate of the MAPK kinases. Phenotypic analyses of Arabidopsis expressing phosphorylation site mutant forms of At1g80180.1 showed clustered stomata and higher stomatal index in cotyledons expressing the phosphomimetic form of At1g80180.1. Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
| AT1G80245 | Spc97 / Spc98 family of spindle pole body (SBP) component. |
| AT1G80250 | pre-tRNA tRNA-Trp (anticodon: CCA). |
| AT1G80280 | alpha/beta-Hydrolases superfamily protein. |
| AT1G80290 | a member of the Glycosyltransferase Family 64 (according to CAZy Database) |
| AT1G80300 | Encodes an ATP/ADP transporter. |
| AT1G80310 | MOT2 encodes a molybdate transporter which locates to the vacuolar membrane. Loss-of-function (knock out) mutants show elevated molydate levels in rosette leaves and in fully senescent leaves, but decreased MoO4 levels in seeds. Under conditions of molybdate deficiency leaves from mot2::tDNA mutants show strongly reduced nitrate reductase activity. The mot2 gene is slightly expressed in young and mature leaves, but strongly in senescing leaves. This observation points to a function of MOT2 in molybdate transfer from leaves to seeds during plant senescence. |
| AT1G80370 | Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development. |
| AT1G80380 | encodes a glycerate kinase which catalyzes the last step of photorespiration C2 cycle. |
| AT1G80420 | Encodes a component of plant break excision repair and functions at several stages during active DNA demethylation in Arabidopsis. |
| AT1G80440 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB20, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT1G80450 | VQ motif-containing protein. |
| AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
| AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
| AT1G80530 | Major facilitator superfamily protein. |
| AT1G80610 | hypothetical protein. |
| AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
| AT1G80831 | unknown protein |
| AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT1G80870 | Protein kinase superfamily protein. |
| AT1G80900 | Transmembrane magnesium transporter. One of nine family members. |
| AT1G80910 | vacuolar fusion CCZ1-like protein (DUF1712). |
| AT2G01140 | Aldolase superfamily protein. |
| AT2G01150 | Encodes a RING-H2 finger protein that is expressed in vascular tissue, root tips, embryos and pistils. |
| AT2G01300 | mediator of RNA polymerase II transcription subunit. |
| AT2G01310 | hypothetical protein. |
| AT2G01320 | ABC-2 type transporter family protein. |
| AT2G01330 | nucleotide binding protein. |
| AT2G01340 | Encodes a protein whose expression is responsive to nematode infection; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT2G01420 | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). |
| AT2G01422 | other_RNA. |
| AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
| AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
| AT2G01470 | Sec12p-like protein (GTP exchange protein) that functionally complements yeast sec12 null mutant. Protein is localized to the ER. |
| AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
| AT2G01540 | Calcium-dependent lipid-binding (CaLB domain) family protein. |
| AT2G01550 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT2G01560 | Plant protein 1589 of unknown function. |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT2G01667 | hypothetical protein. |
| AT2G01670 | nudix hydrolase homolog 17. |
| AT2G01680 | Ankyrin repeat family protein. |
| AT2G01690 | Homologous to mammalian VAC14s, which is involved in the production of phosphatidylinositol 3,5-bisphosphate. Mutants are male gametophyte lethal. |
| AT2G01700 | transposable_element_gene.;similar to unknown protein |
| AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
| AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
| AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT2G01880 | PEP complex component. |
| AT2G01890 | Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group. |
| AT2G01940 | Encodes a transcription factor that, together with IDD14 and IDD16, regulates auxin biosynthesis and transport and thus aerial organ morphogenesis and gravitropic responses. May be involved in an early event in shoot gravitropism such as gravity perception and/or a signaling process subsequent to amyloplast sedimentation as a putative transcription factor in gravity-perceptive cells. |
| AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. |
| AT2G02060 | Homeodomain-like superfamily protein. |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02180 | Necessary for the efficient multiplication of tobamoviruses. |
| AT2G02220 | Encodes a protein interacting with phytosulfokine, a five amino acid sulfated peptide (YIYTQ). Contains dual guanylate cyclase and kinase catalytic activities that operate in vivo. |
| AT2G02310 | phloem protein 2-B6. |
| AT2G02320 | phloem protein 2-B7. |
| AT2G02360 | Encodes an F-box protein containing a Nictaba-related lectin domain that can act as a carbohydrate-binding protein.Expression is induced by SA and pathogenic bacteria. |
| AT2G02370 | SNARE associated Golgi protein family. |
| AT2G02440 | transmembrane protein. |
| AT2G02450 | NAC domain containing protein 35. |
| AT2G02470 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins that acts as a novel upstream regulator of root hair formation during Pi starvation. |
| AT2G02590 | small multi-drug export protein. |
| AT2G02600 | pre-tRNA tRNA-Ala (anticodon: AGC). |
| AT2G02610 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G02630 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G02680 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G02690 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G02700 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G02780 | Leucine-rich repeat protein kinase family protein. |
| AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
| AT2G02960 | RING/FYVE/PHD zinc finger superfamily protein. |
| AT2G02970 | Encodes a putative apyrase involved in pollen exine pattern formation and anther dehiscence. |
| AT2G03140 | alpha/beta-Hydrolases superfamily protein. |
| AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein. |
| AT2G03300 | TX12 is a Toll/Interleukin-1 receptor domain containing protein. Misexpression results in ectopic activation of defense response genes. |
| AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
| AT2G03380 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT2G03470 | ELM2 domain-containing protein. |
| AT2G03550 | alpha/beta-Hydrolases superfamily protein. |
| AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
| AT2G03750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT2G03980 | GDSL-motif esterase/acyltransferase/lipase. |
| AT2G03990 | transposable_element_gene.;pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G04080 | MATE efflux family protein. |
| AT2G04100 | MATE efflux family protein. |
| AT2G04110 | pseudogene of expressed protein. |
| AT2G04135 | transposable_element_gene.;similar to unknown protein |
| AT2G04160 | encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
| AT2G04250 | pseudogene of ribonuclease H. |
| AT2G04400 | Acts during tryptophan biosynthesis controlled by ERF109. |
| AT2G04500 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G04550 | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1. |
| AT2G04680 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G04690 | Pyridoxamine 5-phosphate oxidase family protein. |
| AT2G04880 | Encodes WRKY1, a member of the WRKY transcription factors in plants involved in disease resistance, abiotic stress, senescence as well as in some developmental processes. WRKY1 is involved in the salicylic acid signaling pathway. The crystal structure of the WRKY1 C-terminal domain revealed a zinc-binding site and identified the DNA-binding residues of WRKY1. |
| AT2G05260 | alpha/beta-Hydrolases superfamily protein. |
| AT2G05290 | transposable_element_gene.;similar to unknown protein |
| AT2G05790 | O-Glycosyl hydrolases family 17 protein. |
| AT2G05830 | Encodes a 5-methylthioribose-1-phosphate isomerase. |
| AT2G05920 | Subtilase family protein. |
| AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
| AT2G06050 | Encodes a 12-oxophytodienoate reductase that is required for jasmonate biosynthesis. Mutants are male sterile and defective in pollen dehiscence. Shows activity towards 2,4,6-trinitrotoluene. CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can restore the fertility of opr3 plants by inducing filament elongation and anther dehiscence. |
| AT2G06255 | DUF1313 domain containing protein. |
| AT2G07042 | other_RNA. |
| AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
| AT2G10606 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUG. miR396 expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
| AT2G11220 | transposable_element_gene.;copia-like retrotransposon family |
| AT2G12400 | plasma membrane fusion protein. |
| AT2G13610 | ABC-2 type transporter family protein. |
| AT2G13650 | Encodes a Golgi-localized GDP-mannose transporter. It can transport ADP-glucose in vitro. |
| AT2G13910 | pseudogene of Cysteine/Histidine-rich C1 domain family protein. |
| AT2G13950 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G13960 | Homeodomain-like superfamily protein. |
| AT2G14100 | a member of the cytochrome P450 family |
| AT2G14247 | Expressed protein. |
| AT2G14290 | LL-diaminopimelate protein (DUF295). |
| AT2G14740 | Encodes a vacuolar sorting receptor that participates in vacuolar sorting in vegetative tissues and in seeds. |
| AT2G14750 | Encodes adenosine-5'-phosphosulfate kinase. Provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. |
| AT2G14878 | other_RNA. |
| AT2G14880 | SWIB/MDM2 domain superfamily protein. |
| AT2G14890 | putative proline-rich protein (At2g14890) mRNA, complete |
| AT2G14900 | Gibberellin-regulated family protein. |
| AT2G14910 | MAR-binding filament-like protein. |
| AT2G14950 | transposable_element_gene.;hAT-like transposase family (hobo/Ac/Tam3) |
| AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
| AT2G15220 | Plant basic secretory protein (BSP) family protein. |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT2G15480 | UDP-glucosyl transferase 73B5. |
| AT2G15490 | UDP-glycosyltransferase 73B4. |
| AT2G15580 | RING/U-box superfamily protein. |
| AT2G15610 | hypothetical protein (DUF1685). |
| AT2G15765 | pseudogene of F-box/RNI-like superfamily protein. |
| AT2G15830 | hypothetical protein. |
| AT2G15950 | pre-tRNA tRNA-Tyr (anticodon: GTA). |
| AT2G15960 | Unknown protein. Expression decreased in response to proline. |
| AT2G15970 | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. |
| AT2G16280 | Encodes KCS9, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT2G16340 | hypothetical protein. |
| AT2G16365 | PCH1 binds and stabilizes the active (Pfr) form of phytochrome B and is involved in the formation of photobodies in the nucleus. PCH1 is expressed in evenings and is associated to the evening complex through binding to phyB, and represses hypocotyl elongation and growth. Using mass spec, the existence of the At2g16365.2 isoform has been verified, however here is no evidence that any of the other three variants are present. Atg2G16365.2 will be assigned PCH1; exon 4 and 5 in the other variants are actually another gene of the F-box/DUF295 family with gene name FDA10. |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT2G16400 | BEL1-like homeodomain 7. |
| AT2G16600 | Encodes cytosolic cyclophilin ROC3. |
| AT2G16640 | multimeric translocon complex in the outer envelope membrane 132. |
| AT2G16650 | Encodes a proteinaceous RNase P that supports RNase P activity in vivo in both organelles and the nucleus. It is also involved in the maturation of small nucleolar RNA (snoRNA) and mRNA. |
| AT2G16668 | unknown protein |
| AT2G16720 | Encodes a member of MYB3R- and R2R3- type MYB- encoding gene family that acts as a repressor of flavonol biosynthesis. AtMYB7 gene expression is induced by salt treatment. |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein. |
| AT2G16790 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT2G16800 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
| AT2G16960 | ARM repeat superfamily protein. |
| AT2G16970 | Major facilitator superfamily protein. |
| AT2G16980 | Major facilitator superfamily protein. |
| AT2G17070 | hypothetical protein (DUF241). |
| AT2G17080 | hypothetical protein (DUF241). |
| AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
| AT2G17290 | Encodes calcium dependent protein kinase 6 (CPK6), a member of the Arabidopsis CDPK gene family. |
| AT2G17295 | snoRNA. |
| AT2G17305 | F-box/LRR protein. |
| AT2G17330 | putative obtusifoliol 14-alpha demethylase. Expressed pseudogene. |
| AT2G17340 | pantothenate kinase. |
| AT2G17360 | Ribosomal protein S4 (RPS4A) family protein. |
| AT2G17370 | Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds. |
| AT2G17430 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. Controls pollen tube reception in synergids. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO7 belongs to the clade III, with AtMLO5, AtMLO8, AtMLO9, and AtMLO10. The gene is expressed in vegetative organs (RT-PCR experiments)and in pollen grains, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G17440 | Encodes PIRL5, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT2G17450 | Encodes a putative RING-H2 finger protein RHA3a. |
| AT2G17490 | transposable_element_gene.;copia-like retrotransposon family |
| AT2G17500 | Auxin efflux carrier family protein. |
| AT2G17550 | RB1-inducible coiled-coil protein. |
| AT2G17556 | unknown protein |
| AT2G17705 | methionine-S-oxide reductase. |
| AT2G17710 | Big1. |
| AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
| AT2G17760 | Eukaryotic aspartyl protease family protein. |
| AT2G17787 | cylicin. |
| AT2G17790 | Encodes a protein with similarity to yeast VPS35 which encodes a component of the retromer involved in retrograde endosomal transport. Mutants partially suppress the loss of VTI11 function in Arabidopsis and restores gravitropism in the double mutant. |
| AT2G17870 | Encodes COLD SHOCK DOMAIN PROTEIN 3 (CSP3), involved in the acquisition of freezing tolerance. |
| AT2G18090 | PHD finger family protein / SWIB complex BAF60b domain-containing protein / GYF domain-containing protein. |
| AT2G18140 | Peroxidase superfamily protein. |
| AT2G18160 | Encodes a b-ZIP transcription factor. |
| AT2G18162 | unknown protein |
| AT2G18170 | MAP kinase 7. |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT2G18200 | transmembrane protein. |
| AT2G18210 | hypothetical protein. |
| AT2G18260 | member of SYP11 Gene Family |
| AT2G18280 | Member of TLP family |
| AT2G18300 | DNA-binding bHLH protein involved in positive regulation of cell elongation and proliferation and, negative control of plant immunity.One component of PRE-IBH1-HBI1 tripartite module. |
| AT2G18350 | homeobox protein 24. |
| AT2G18390 | Encodes a member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Mutant has abnormal mitosis and cell cycle control during seed development. |
| AT2G18440 | Encodes a noncoding RNA, a member of an emerging class of transcripts that lack significant open reading frames and encode RNA as their final product. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
| AT2G18460 | like COV 3. |
| AT2G18600 | Ubiquitin-conjugating enzyme family protein. |
| AT2G18610 | unknown protein |
| AT2G18630 | transmembrane protein, putative (DUF677). |
| AT2G18670 | RING/U-box superfamily protein. |
| AT2G18690 | transmembrane protein. |
| AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT2G18730 | diacylglycerol kinase 3. |
| AT2G18735 | other_RNA. |
| AT2G18740 | Putative temperature-specific splice regulator of development. Only the first splice form (PCP-alpha) has this function as result of C-terminal addition. |
| AT2G18750 | Calmodulin-binding protein. |
| AT2G18780 | F-box and associated interaction domains-containing protein. |
| AT2G18790 | Red/far-red photoreceptor involved in the regulation of de-etiolation. Exists in two inter-convertible forms: Pr and Pfr (active). Involved in the light-promotion of seed germination and in the shade avoidance response. Promotes seedling etiolation in both the presence and absence of phytochrome A. Overexpression results in etiolation under far-red light. Accumulates in the nucleus after exposure to far red light. The phosphorylation state of the Ser-86 residue of the phytochrome B molecule alters dark reversion of the molecule. |
| AT2G18850 | SET domain-containing protein. |
| AT2G18860 | Syntaxin/t-SNARE family protein. |
| AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
| AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. |
| AT2G18969 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT2G19060 | SGNH hydrolase-type esterase superfamily protein. |
| AT2G19090 | DUF630 family protein (DUF630 and DUF632). |
| AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. |
| AT2G19180 | hypothetical protein. |
| AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
| AT2G19460 | DUF3511 domain protein (DUF3511). |
| AT2G19570 | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. |
| AT2G19572 | Potential natural antisense gene, locus overlaps with AT2G19570 |
| AT2G19580 | Member of TETRASPANIN family |
| AT2G19582 | Natural antisense transcript overlaps with AT2G19580. |
| AT2G19650 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G19780 | Leucine-rich repeat (LRR) family protein. |
| AT2G19790 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT2G19806 | transposable_element_gene.;Mariner-like transposase family |
| AT2G19825 | transposable_element_gene.;pseudogene, hypothetical protein |
| AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
| AT2G20010 | Gls protein (DUF810). |
| AT2G20030 | RING/U-box superfamily protein. |
| AT2G20050 | protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein. |
| AT2G20080 | hypothetical protein. |
| AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
| AT2G20120 | Encodes an integral membrane protein of unknown function, highly conserved between plants and bacteria; is likely to be involved in a mechanism that negatively regulates the differentiation of vascular tissue in the stem. Mutants display a dramatic increase in vascular tissue development in the stem in place of the interfascicular region that normally separates the vascular bundles. |
| AT2G20130 | like COV 1. |
| AT2G20140 | Encodes one of the two RPT2 (26S proteasome subunit RPT2) paralogs: RPT2a (At4g29040) and RPT2b (At2g20140). RPT2b can not complement the rpt2a mutant phenotype. rpt2a rpt2b double mutants are embryo lethal. |
| AT2G20142 | Toll-Interleukin-Resistance (TIR) domain family protein. |
| AT2G20180 | Encodes a novel Myc-related bHLH transcription factor that has transcriptional activation activity in the dark. It is a key negative regulator of phytochrome-mediated seed germination and acts by inhibiting chlorophyll biosynthesis, light-mediated suppression of hypocotyl elongation and far-red light-mediated suppression of seed germination, and promoting negative gravitropism in hypocotyls. Light reduces this activity in a phy-dependent manner. The protein preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB), is physically associated with APRR1/TOC1 and is degraded in red (R) and far-red (FR) light through the ubiquitin (ub)-26S proteasome pathway to optimize photomorphogenic development in Arabidopsis. It also negatively regulates GA3 oxidase expression. |
| AT2G20210 | RNI-like superfamily protein. |
| AT2G20230 | Tetraspanin family protein. |
| AT2G20340 | Encodes an aromatic aldehyde synthase (AtAAS), which catalyzes the in vitro conversion of phenylalanine and 3,4-dihydroxy-L-phenylalanine to phenylacetaldehyde and dopaldehyde, respectively. |
| AT2G20480 | hypothetical protein. |
| AT2G20490 | nucleolar RNA-binding Nop10p family protein. |
| AT2G20515 | pollen Ole e I family allergen protein. |
| AT2G20520 | fasciclin-like arabinogalactan-protein 6 (Fla6). Possibly involved in embryogenesis and seed development. |
| AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. Induced in epidermal cells attacked by powdery mildew. The RTY enzyme is expected to function as a dimer (or a higher order multimeric complex), as all RTY-related enzymes with a defined crystal structure are known to form dimers or tetramers. |
| AT2G20630 | PP2C induced by AVRRPM1. |
| AT2G20635 | protein kinase and Mad3-BUB1-I domain-containing protein. |
| AT2G20680 | Encodes a mannanase belonging to clade 1 of the GH5 7 phylogenetic tree that exhibits high substrate affinity and catalytic efficiency on mannan substrates with main chains containing both glucose and mannose units such as konjac glucomannan and spruce galactoglucomannan. It is likely a glycoprotein. |
| AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G20760 | Clathrin light chain protein. |
| AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
| AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. |
| AT2G20930 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT2G20940 | transmembrane protein, putative (DUF1279). |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G21120 | Encodes a putative magnesium transporter that was identified through a forward genetic screen, directly isolating antiviral RNAi-defective (avi) mutant using a Cucumber Mosaic Virus (CMV) mutant. |
| AT2G21130 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein. |
| AT2G21300 | ATP binding microtubule motor family protein. |
| AT2G21370 | Although this gene has a sequence similar to xylulose kinases, several lines of experimental evidence suggest that it does not act on xylulose or deoxy-xylulose. |
| AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT2G21570 | pre-tRNA tRNA-Tyr (anticodon: GTA). |
| AT2G21580 | Ribosomal protein S25 family protein. |
| AT2G21590 | Encodes the large subunit of ADP-glucose pyrophosphorylase |
| AT2G21650 | RSM1 is a member of a small sub-family of single MYB transcription factors. Analysis of overexpressin lines indicate its involvement during early morphogenesis. |
| AT2G21780 | hypothetical protein. |
| AT2G21820 | seed maturation protein. |
| AT2G21830 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G21840 | Cysteine/Histidine-rich C1 domain family protein. |
| AT2G21880 | RAB GTPase homolog 7A. |
| AT2G21905 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
| AT2G22121 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G22125 | Encodes a protein involved in cell elongation in root and anther filaments. |
| AT2G22170 | Lipase/lipooxygenase, PLAT/LH2 family protein. |
| AT2G22200 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. |
| AT2G22201 | unknown protein |
| AT2G22300 | Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
| AT2G22330 | Encodes a cytochrome P450. Involved in tryptophan metabolism. Converts Trp to indole-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. |
| AT2G22340 | transmembrane protein. |
| AT2G22345 | Encodes a defensin-like (DEFL) family protein. |
| AT2G22420 | Encodes a cell wall-localized class III peroxidase that is directly regulated by the MADS-box transcription factor AGL15 and is involved in lignified tissue formation. |
| AT2G22426 | hypothetical protein. |
| AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
| AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
| AT2G22482 | other_RNA. |
| AT2G22496 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUGCUAUGUUGCUGCUCAU |
| AT2G22510 | hydroxyproline-rich glycoprotein family protein. |
| AT2G22560 | Kinase interacting (KIP1-like) family protein. |
| AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
| AT2G22668 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT |
| AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein. |
| AT2G22740 | Encodes a SU(VAR)3-9 homolog, a methyltransferase involved in histone methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs but has a preference for the latter two. This is a member of a subfamily of SET proteins that shares a conserved SRA domain. |
| AT2G22750 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT2G22760 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
| AT2G22790 | hypothetical protein. |
| AT2G22795 | hypothetical protein. |
| AT2G22802 | unknown protein |
| AT2G22850 | basic leucine-zipper 6. |
| AT2G22860 | Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. |
| AT2G22870 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT2G22880 | VQ motif-containing protein. |
| AT2G22900 | Encodes MUCI10, a galactomannan-1,6-galactosyltransferase. MUCI10 likely decorates glucomannan, synthesized by CSLA2, with galactose residues in vivo. The degree of galactosylation is essential for the synthesis of the GGM backbone, the structure of cellulose, mucilage density, as well as the adherence of pectin. |
| AT2G22905 | Expressed protein. |
| AT2G22910 | N-acetyl-l-glutamate synthase 1. |
| AT2G22930 | UDP-Glycosyltransferase superfamily protein. |
| AT2G22970 | serine carboxypeptidase-like 11. |
| AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT2G23010 | serine carboxypeptidase-like 9. |
| AT2G23030 | encodes a member of SNF1-related protein kinases (SnRK2) |
| AT2G23110 | Late embryogenesis abundant protein, group 6. |
| AT2G23120 | Late embryogenesis abundant protein, group 6. |
| AT2G23150 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp4, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. |
| AT2G23180 | member of CYP96A |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT2G23300 | Leucine-rich repeat protein kinase family protein. |
| AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT2G23450 | Protein kinase superfamily protein. |
| AT2G23460 | encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits. |
| AT2G23620 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES1 appears to be involved in MeSA hydrolysis in planta. Expression of MES1 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
| AT2G23710 | transposable_element_gene.;similar to unknown protein |
| AT2G23755 | transmembrane family 220 helix protein. |
| AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT2G23780 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT2G23790 | calcium uniporter (DUF607). |
| AT2G23810 | Member of TETRASPANIN family |
| AT2G23980 | Encodes a cyclic GMP-activated non-selective cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
| AT2G23985 | hypothetical protein. |
| AT2G24100 | ATP-dependent DNA helicase. |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein. |
| AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. |
| AT2G24190 | Encodes an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. In addition, this enzyme can reduce methylglyoxal in vitro. It is believed that this enzyme localizes to the cytosol like the closely related protein encoded by AT3G61220. |
| AT2G24210 | terpene synthase 10. |
| AT2G24220 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G24260 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT2G24540 | Galactose oxidase/kelch repeat superfamily protein. |
| AT2G24545 | Natural antisense transcript overlaps with AT2G24540. |
| AT2G24550 | major centromere autoantigen B-like protein. |
| AT2G24560 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT2G24580 | FAD-dependent oxidoreductase family protein. |
| AT2G24765 | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner |
| AT2G24850 | Encodes a tyrosine aminotransferase that is responsive to treatment with jasmonic acid. |
| AT2G25080 | Encodes glutathione peroxidase. |
| AT2G25130 | ARM repeat superfamily protein. |
| AT2G25150 | HXXXD-type acyl-transferase family protein. |
| AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1. |
| AT2G25169 | transmembrane protein. |
| AT2G25200 | hypothetical protein (DUF868). |
| AT2G25210 | Ribosomal protein L39 family protein. |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT2G25440 | receptor like protein 20. |
| AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein. |
| AT2G25482 | Encodes a ECA1 gametogenesis related family protein |
| AT2G25490 | Encodes an F-box protein involved in the ubiquitin/proteasome-dependent proteolysis of EIN3. |
| AT2G25625 | Histone deacetylase-like protein.. Induced by senescence and abiotic stresses. |
| AT2G25735 | hypothetical protein. |
| AT2G25737 | Sulfite exporter TauE/SafE family protein. |
| AT2G25740 | ATP-dependent protease La (LON) domain protein. |
| AT2G25810 | tonoplast intrinsic protein 4. |
| AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. |
| AT2G25910 | 3-5 exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein. |
| AT2G25950 | PITH domain protein (DUF1000). |
| AT2G25964 | hypothetical protein. |
| AT2G26040 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G26110 | bromodomain protein (DUF761). |
| AT2G26120 | glycine-rich protein. |
| AT2G26130 | Encodes a RING-type zinc finger ubiquitin ligase involved in seed longevity.Gain of function (35S promoter) increases, and loss of function decreases, seed longevity. |
| AT2G26140 | Encodes an FtsH protease that is localized to the mitochondrion. Loss of function results in increased determinacy of the meristem that is exacerbated when plants are grown at higher temperatures. |
| AT2G26150 | member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay. |
| AT2G26200 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT2G26260 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT2G26340 | hypothetical protein. |
| AT2G26360 | Mitochondrial substrate carrier family protein. |
| AT2G26370 | MD-2-related lipid recognition domain-containing protein. |
| AT2G26380 | Leucine-rich repeat (LRR) family protein. |
| AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
| AT2G26430 | Encodes an ania-6a type arginine-rich cyclin which confers tolerance to LiCl and NaCl when expressed in yeast. |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT2G26540 | Encodes a uroporphyrinogen-III synthase involved in tetrapyrrole biosynthesis. The protein localizes to the chloroplast. Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT2G26660 | SPX domain-containing protein 2 (SPX2). |
| AT2G26690 | Major facilitator superfamily protein. |
| AT2G26692 | Natural antisense transcript overlaps with AT2G26690. |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein. |
| AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
| AT2G26730 | Leucine-rich repeat protein kinase family protein. |
| AT2G26800 | Mutant has increased seed ile, leu and val as well as his and arg. |
| AT2G26870 | Non-specific phospholipase C2 involved in gametophyte development. |
| AT2G26880 | AGAMOUS-like 41. |
| AT2G26910 | Encodes a member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters. Required for the formation of a functional cuticle. |
| AT2G27000 | member of CYP705A |
| AT2G27050 | ethylene-insensitive3-like1 (EIL1) |
| AT2G27060 | Leucine-rich repeat protein kinase family protein. |
| AT2G27080 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family. |
| AT2G27300 | NTL8 is a membrane-associated NAC transcription factor that binds both TRY and TCL1. Overexpression results in fewer trichomes. |
| AT2G27310 | F-box family protein. |
| AT2G27360 | GDSL-motif esterase/acyltransferase/lipase. |
| AT2G27500 | Glycosyl hydrolase superfamily protein. |
| AT2G27505 | FBD-like domain family protein. |
| AT2G27550 | encodes a protein similar to TFL1. overexpression leads to similar phenotype as TFL1 overexpression. |
| AT2G27680 | NAD(P)-linked oxidoreductase superfamily protein. |
| AT2G27700 | eukaryotic translation initiation factor 2 family protein / eIF-2 family protein. |
| AT2G27770 | DUF868 family protein (DUF868). |
| AT2G27810 | Encodes a plasma-membrane localized nucleobase transporter capable of transporting adenine, guanine, uracil and hypoxanthine. Likely to be a proton-nucleobase symporter. |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT2G27830 | hypothetical protein. |
| AT2G27840 | Belongs to the plant specific HD2 type proteins; similar to nucleolar Zea mays histone deacetylase; HD2-p39 |
| AT2G27860 | Encodes UDP-d-apiose/UDP-d-xylose synthase that requires NAD+ for enzymatic activity and is strongly inhibited by UDP-d-galacturonate. |
| AT2G27870 | transposable_element_gene.;similar to RNase H domain-containing protein |
| AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
| AT2G28120 | Major facilitator superfamily protein. |
| AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
| AT2G28140 | enabled-like protein (DUF1635). |
| AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
| AT2G28305 | Putative lysine decarboxylase family protein. |
| AT2G28315 | UXT1 is a member of the NST-KT subfamily of nucleotide/sugar transporters. |
| AT2G28350 | Involved in root cap cell differentiation. |
| AT2G28355 | low-molecular-weight cysteine-rich 5. |
| AT2G28400 | senescence regulator (Protein of unknown function, DUF584). |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28510 | DOF transcription factor with a conserved zinc finger (ZF) DNA-binding domain. |
| AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein. |
| AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
| AT2G28560 | Encodes a protein of the RAD51B family involved in double stranded DNA repair. Homozygous mutant plants show increased sensitivity to mitomycin which induces DS breaks. |
| AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
| AT2G28860 | member of CYP710A |
| AT2G28870 | cyclin-dependent kinase inhibitor SMR1-like protein. |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT2G28920 | RING/U-box superfamily protein. |
| AT2G28930 | protein kinase 1B. |
| AT2G28940 | Protein kinase superfamily protein. |
| AT2G28950 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G29050 | RHOMBOID-like 1. |
| AT2G29065 | GRAS family transcription factor. |
| AT2G29120 | member of Putative ligand-gated ion channel subunit family |
| AT2G29125 | ROTUNDIFOLIA like 2. |
| AT2G29130 | Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency. |
| AT2G29390 | Encodes a sterol 4-alpha-methyl-oxidase, specifically a 4-alpha-methyl-delta-7-sterol-4alpha-methyl-oxidase. |
| AT2G29400 | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
| AT2G29440 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT2G29450 | Encodes a member of the TAU glutathione S-transferase gene family. Gene expression is induced by exposure to auxin, pathogen and herbicides. Naming convention according to Wagner et al. (2002) |
| AT2G29452 | hypothetical protein. |
| AT2G29470 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT2G29480 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT2G29500 | HSP20-like chaperones superfamily protein. |
| AT2G29510 | hypothetical protein (DUF3527). |
| AT2G29550 | Encodes a beta-tubulin that is expressed in leaves, roots and flowers. |
| AT2G29560 | Encodes a putative phosphoenolpyruvate enolase that is localized both to the nucleus and the cytoplasm. |
| AT2G29654 | transmembrane protein. |
| AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
| AT2G29995 | PSY3-like protein. |
| AT2G30020 | Encodes AP2C1. Belongs to the clade B of the PP2C-superfamily. Acts as a MAPK phosphatase that negatively regulates MPK4 and MPK6. |
| AT2G30032 | unknown protein |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT2G30060 | Pleckstrin homology (PH) domain superfamily protein. |
| AT2G30100 | pentatricopeptide (PPR) repeat-containing protein. |
| AT2G30105 | LRR/ubiquitin-like domain protein. |
| AT2G30140 | Encodes a putative glycosyltransferase. Regulates flowering time via FLOWERING LOCUS C. |
| AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. |
| AT2G30230 | 6,7-dimethyl-8-ribityllumazine synthase. |
| AT2G30260 | encodes U2B", which is a component of the U2 snRNP complex. Its precise role in pre-mRNA splicing is still unknown. It has been suggested that U2B0 may not be required for the splicing reaction itself but may have a role in U2 snRNP biogenesis. Deletion analysis of the U2B0 gene fusion has identified the N-terminal RNP-80 motif as sufficient for localization to the coiled body and the nucleus. |
| AT2G30270 | LURP-one-like protein (DUF567). |
| AT2G30340 | Lateral Organ Boundaries domain protein. LOB13 promotes lateral root formation. |
| AT2G30360 | Encodes a SOS2-like protein kinase that is a member of the CBL-interacting protein kinase family.Loss of function mutants show a decrease in sensitivity to high pH.Phosphorylates AHA2, a plasma membrane H+ ATPase.This phosphorylation appears to regulate the activity of the proton transporter. |
| AT2G30362 | Natural antisense transcript overlaps with AT2G30360. |
| AT2G30370 | Encodes a small, potentially secreted protein that acts as an inhibitor of stomatal production though likely not through direct interaction with the TMM receptor. It is homologous to known stomatal regulators EPF1 and EPF2. |
| AT2G30460 | UXT2 is a member of the NST-KT subfamily of nucleotide/sugar transporters. |
| AT2G30500 | Kinase interacting (KIP1-like) family protein. |
| AT2G30520 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT2G30530 | zinc finger CCCH domain protein. |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. |
| AT2G30600 | BTB/POZ domain-containing protein. |
| AT2G30720 | Thioesterase/thiol ester dehydrase-isomerase superfamily protein. |
| AT2G30730 | Protein kinase superfamily protein. |
| AT2G30740 | Protein kinase superfamily protein. |
| AT2G30760 | hypothetical protein. |
| AT2G30766 | Functions in iron homeostasis, activates iron deficiency response genes such as bHLH38, bHLH39, IRT1, and FRO2. |
| AT2G30780 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT2G30840 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC). |
| AT2G30860 | Encodes glutathione transferase belonging to the phi class of GSTs. |
| AT2G30870 | early dehydration-induced gene ERD13 homologous to tobacco and maize glutathione S-transferases. Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002) |
| AT2G30925 | transmembrane protein. |
| AT2G30930 | hypothetical protein. |
| AT2G30980 | Encodes a GSK3-like protein kinase. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
| AT2G30984 | Natural antisense transcript overlaps with AT2G30985. |
| AT2G30985 | hypothetical protein. |
| AT2G30990 | arginine N-methyltransferase, putative (DUF688). |
| AT2G31005 | Encodes a Cysteine-rich peptide (CRP) family protein |
| AT2G31010 | Protein kinase superfamily protein. |
| AT2G31083 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT2G31130 | hypothetical protein. |
| AT2G31170 | Encodes the cysteinyl t-RNA synthetase SYCO ARATH (SYCO), which is expressed and required in the central cell but not in the antipodals. SYCO, localized to the mitochondria, is necessary for mitochondrial cristae integrity. Mutation of this gene affects the lifespan of adjacent accessory cells. |
| AT2G31180 | Member of the R2R3 factor gene family. |
| AT2G31240 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT2G31350 | Encodes a mitochondrial glyoxalase 2 that can accommodate a number of different metal centers and with the predominant metal center being Fe(III)Zn(II). |
| AT2G31370 | Basic-leucine zipper (bZIP) transcription factor family protein. |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685). |
| AT2G31570 | glutathione peroxidase GPx |
| AT2G31670 | Stress responsive alpha-beta barrel domain protein. |
| AT2G31680 | RAB GTPase homolog A5D. |
| AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein. |
| AT2G31820 | Ankyrin repeat family protein. |
| AT2G31957 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G31985 | lipoprotein (DUF1264). |
| AT2G31990 | Exostosin family protein. |
| AT2G32030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein. |
| AT2G32150 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein. |
| AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
| AT2G32273 | Encodes a microRNA. Mature sequence:GAAGGTAGTGAATTTGTTCGA. Functions as a negative regulator of seed germination under salt stress conditions. |
| AT2G32370 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development. |
| AT2G32400 | Glr5 |
| AT2G32410 | Involved in chiasma distribution, affects expression of key DNA repair and meiotic genes, signifcant role in DNA repair. |
| AT2G32415 | Polynucleotidyl transferase, ribonuclease H fold protein with HRDC domain-containing protein. |
| AT2G32430 | Galactosyltransferase family protein. |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT2G32520 | alpha/beta-Hydrolases superfamily protein. |
| AT2G32660 | receptor like protein 22. |
| AT2G32930 | Encodes a zinc finger protein. |
| AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
| AT2G32970 | G1/S-specific cyclin-E protein. |
| AT2G32980 | HAUS augmin-like complex subunit. |
| AT2G33040 | gamma subunit of Mt ATP synthase. |
| AT2G33050 | receptor like protein 26. |
| AT2G33051 | Natural antisense transcript overlaps with AT2G33050. |
| AT2G33120 | Encodes a member of Synaptobrevin-like protein family. Also known as VESICLE-ASSOCIATED MEMBRANE PROTEIN 722 (VAMP722). Required for cell plate formation. Post-transcriptionally regulated by CRT1/2 under ER stress. |
| AT2G33175 | transmembrane protein. |
| AT2G33180 | hypothetical protein. |
| AT2G33310 | Auxin induced gene, IAA13 (IAA13). |
| AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein. |
| AT2G33330 | Encodes a plasmodesmal protein that affects the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT2G33340 | Encodes MAC3B, a U-box proteins with homology to the yeast and human E3 ubiquitin ligase Prp19. Associated with the MOS4-Associated Complex (MAC). Involved in plant innate immunity. Regulator of flowering time. |
| AT2G33380 | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxy-octadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. |
| AT2G33690 | Late embryogenesis abundant protein, group 6. |
| AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
| AT2G33710 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. |
| AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
| AT2G34010 | verprolin. |
| AT2G34020 | Calcium-binding EF-hand family protein. |
| AT2G34030 | Calcium-binding EF-hand family protein. |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT2G34100 | nonsense-mediated mRNA decay-like protein. |
| AT2G34110 | hypothetical protein. |
| AT2G34123 | Encodes a defensin-like (DEFL) family protein. |
| AT2G34140 | CDF4 is member of the group II DOF transcription factor family is involved in regulation of differentiation root columella cells. It is a direct target of the transcriptional repressor WOX5. CDF4 itself is a transcriptional repressor that appears to repress root columella stem cell identity. Ectopic expression of CDF leads to premature differentiation of root columella cells. |
| AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex. |
| AT2G34185 | hypothetical protein. |
| AT2G34186 | hypothetical protein. |
| AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein |
| AT2G34250 | SecY protein transport family protein. |
| AT2G34310 | hypothetical protein. |
| AT2G34315 | avirulence induced family protein. |
| AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein. |
| AT2G34490 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze the conversion of both 24-epi-campesterol and β-sitosterol to brassicasterol and stigmasterol, respectively, in the presence of NADPH. |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G34560 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT2G34590 | Transketolase family protein. |
| AT2G34600 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
| AT2G34730 | myosin heavy chain-like protein. |
| AT2G34810 | FAD-binding Berberine family protein. |
| AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT2G34860 | DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development. |
| AT2G34930 | disease resistance family protein / LRR family protein. |
| AT2G34940 | VACUOLAR SORTING RECEPTOR 5. |
| AT2G35010 | Localized in mitochondria; associated with redox-active functions and effects on plant growth in constant light; joint role with Trx h2 in regulating NADPH redox balance and photosynthetic performance in fluctuating light. |
| AT2G35200 | DUF740 family protein. |
| AT2G35208 | unknown protein |
| AT2G35260 | CAAX protease self-immunity protein. |
| AT2G35460 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family. |
| AT2G35470 | ribosome maturation factor. |
| AT2G35480 | envelope glycoprotein. |
| AT2G35630 | Member of the MAP215 family of microtubule-associated proteins required to establish interphase arrays of cortical microtubules.Mutants have defects in cytokinesis during pollen development. Vegetative phenotypes observed in temperature sensitive mutants include left-handed organ twisting, isotropic cell expansion and impairment of root hair polarity. |
| AT2G35635 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. |
| AT2G35637 | Natural antisense transcript overlaps with AT2G35640. |
| AT2G35640 | Homeodomain-like superfamily protein. |
| AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
| AT2G35690 | Encodes an acyl-CoA oxidase. Involved in jasmonate biosynthesis. Expressed uniformly in seedlings and throughout development. |
| AT2G35710 | Nucleotide-diphospho-sugar transferases superfamily protein. |
| AT2G35810 | ureidoglycolate hydrolase. |
| AT2G35820 | ureidoglycolate hydrolase. |
| AT2G35850 | transmembrane protein. |
| AT2G35859 | Natural antisense transcript overlaps with AT2G35860. |
| AT2G35860 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT2G35920 | RNA helicase family protein. |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940. |
| AT2G35950 | embryo sac development arrest 12. |
| AT2G35960 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not altered in response to cucumber mosaic virus or spermine. |
| AT2G35970 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family. |
| AT2G36050 | ovate family protein 15. |
| AT2G36053 | unknown protein |
| AT2G36070 | One of two genes in Arabidopsis that encode a putative subunit of the mitochondrial inner membrane translocase complex. TIM44 subunit is thought to provide the energy for translocation via hydrolysis of ATP. |
| AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
| AT2G36090 | F-box family protein. |
| AT2G36210 | SAUR-like auxin-responsive protein family. |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT2G36320 | A20/AN1-like zinc finger family protein. |
| AT2G36340 | DNA-binding storekeeper protein-related transcriptional regulator. |
| AT2G36350 | Member of AGC VIIIa Kinase gene family. |
| AT2G36370 | ubiquitin-protein ligase. |
| AT2G36380 | pleiotropic drug resistance 6. |
| AT2G36410 | transcriptional activator (DUF662). |
| AT2G36420 | nucleolin-like protein. |
| AT2G36430 | transmembrane protein, putative (DUF247). |
| AT2G36440 | hypothetical protein. |
| AT2G36450 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic overexpression of HRD increases the density of the root network and improves water and salt stress tolerance in Arabidopsis. Overexpression of HRD in rice causes an increase in plant biomass and drought resistance. |
| AT2G36570 | Leucine-rich repeat protein kinase family protein. |
| AT2G36571 | unknown protein |
| AT2G36650 | CHUP1-like protein. |
| AT2G36680 | Modifier of rudimentary (Mod(r)) protein. |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT2G36815 | mid region of cactin. |
| AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. |
| AT2G36890 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB38, regulates axillary meristem formation. |
| AT2G36950 | Heavy metal transport/detoxification superfamily protein. |
| AT2G36960 | Arabidopsis thaliana myb/SANT domain protein |
| AT2G37000 | TCP family transcription factor. |
| AT2G37010 | member of NAP subfamily |
| AT2G37020 | Translin family protein. |
| AT2G37025 | TRF-like 8. |
| AT2G37050 | Leucine-rich repeat protein kinase family protein. |
| AT2G37140 | Terpenoid synthases superfamily protein. |
| AT2G37170 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev |
| AT2G37180 | a member of the plasma membrane intrinsic protein PIP2. functions as aquaporin and is involved in desiccation. |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT2G37390 | Chloroplast-targeted copper chaperone protein. |
| AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. |
| AT2G37435 | Cystatin/monellin superfamily protein. |
| AT2G37520 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein. |
| AT2G37530 | forkhead box protein G1. |
| AT2G37550 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT2G37555 | Natural antisense transcript overlaps with AT2G37550. |
| AT2G37570 | encodes a protein that can complement the salt-sensitive phenotype of a calcineurin (CaN)-deficient yeast mutant. This gene occurs in a single-copy and is 75% identical to tobacco SLT1 gene. |
| AT2G37580 | RING/U-box superfamily protein. |
| AT2G37590 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT2G37610 | hypothetical protein. |
| AT2G37620 | Member of the actin gene family. Expressed in mature pollen. |
| AT2G37630 | Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. |
| AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G37650 | GRAS family transcription factor. |
| AT2G37750 | hypothetical protein. |
| AT2G38000 | chaperone protein dnaJ-like protein. |
| AT2G38040 | encodes the carboxyltransferase alpha subunit of acetyl-CoA carboxylase, involved in de novo fatty acid biosynthesis |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT2G38060 | Encodes an inorganic phosphate transporter (PHT4;2). |
| AT2G38090 | Duplicated homeodomain-like superfamily protein. |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT2G38120 | Encodes an auxin influx transporter. |
| AT2G38130 | Encodes the Arabidopsis homolog of the yeast protein MAK3, a component of the N-terminal acetyltransferase complex C. In mutant plants, synthesis of plastome-encoded photosystem II core proteins D1 and CP47 is affected resulting in fewer thylakoid multiprotein complexes. |
| AT2G38160 | hypothetical protein. |
| AT2G38170 | Encodes a high affinity vacuolar calcium antiporter. |
| AT2G38240 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT2G38250 | Homeodomain-like superfamily protein. |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G38320 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL34 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. This biochemical phenotype can be observed in tbl34 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
| AT2G38360 | prenylated RAB acceptor 1.B4. |
| AT2G38365 | endonuclease/glycosyl hydrolase. |
| AT2G38400 | alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA, |
| AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT2G38420 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT2G38470 | Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT2G38500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
| AT2G38710 | AMMECR1 family. |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT2G38760 | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. |
| AT2G38790 | hypothetical protein. |
| AT2G38800 | Plant calmodulin-binding protein-like protein. |
| AT2G38970 | Zinc finger (C3HC4-type RING finger) family protein. |
| AT2G39000 | Encodes a chloroplast localized n-acetyltransfefase involved in N-terminal protein amino acid acetylation. |
| AT2G39010 | plasma membrane intrinsic protein 2E. |
| AT2G39050 | Encodes a nucleocytoplasmic lectin that is capable of binding carbohydrates. It is involved in ABA mediated stomatal movement and increased expression is correlated with increased resistance to Pseudomonas syringae. |
| AT2G39140 | Suppressor of var2 variegation phenotype. Chloroplast localized. Loss of function mutant has defects in chloroplast protein translation and rRNA processing. Similar in sequence to pseudouridine synthase proteins. |
| AT2G39175 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160a (converted to TAIR10 based on PMID19304749): Chr2: 16339853-16341886 (forward), length: 2034 bp; exon coordinates: exon 1: 16339853 to 16340469, exon 2: 16341621 to 16341886; mature miRNA and miRNA* are located on exon 1. |
| AT2G39180 | CRINKLY4 related 2. |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
| AT2G39250 | Encodes a AP2 domain transcription factor that can repress flowering. SNZ and its paralogous gene, SCHLAFMUTZE (SMZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT2G39260 | Nonsense mediated decay (NMD)factor. |
| AT2G39360 | Protein kinase superfamily protein. |
| AT2G39380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G39390 | Ribosomal L29 family protein. |
| AT2G39400 | alpha/beta-Hydrolases superfamily protein. |
| AT2G39415 | F-box family protein. |
| AT2G39420 | alpha/beta-Hydrolases superfamily protein. |
| AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn2+ and Cu2+ tolerance. |
| AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
| AT2G39510 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT2G39518 | Uncharacterized protein family (UPF0497). |
| AT2G39520 | hypothetical protein. |
| AT2G39530 | Uncharacterized protein family (UPF0497). |
| AT2G39650 | cruciferin (DUF506). |
| AT2G39705 | ROTUNDIFOLIA like 8. |
| AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
| AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
| AT2G39805 | Integral membrane Yip1 family protein. |
| AT2G39810 | A novel protein with a RING finger motif near the amino terminus. Negative regulator of cold responses. Functions as an E3 ligase required for the ubiquitination of ICE1. HOS1 physically interacts with ICE1 and mediates the ubiquitination of ICE1 both in vitro and in vivo. Overexpression represses the expression of CBFs and their downstream genes and confers increased sensitivity to freezing stress. |
| AT2G39865 | transmembrane protein. |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT2G39940 | Encodes a protein containing Leu-rich repeats and a degenerate F-box motif. Associates with AtCUL1, AtRbx1, and the Skp1-like proteins ASK1 and ASK2 to assemble SCF COI1 ubiquitin-ligase complexes in planta. A single amino acid substitution in the F-box motif of COI1 abolishes the formation of the SCF(COI1) complexes and results in loss of the JA response. Required for wound- and jasmonates-induced transcriptional regulation. Amino acid mutations in COI1 distinctively affect jasmonate-regulated male fertility.CFA-Ile, CFA-Leu, CFA-Val, CFA-Met and CFA-Ala could not inhibit the root length and restoration of fertility in coi1-1 mutants. |
| AT2G39950 | flocculation protein. |
| AT2G39980 | HXXXD-type acyl-transferase family protein. |
| AT2G39990 | translation initiation factor eIF2 p47 subunit homolog |
| AT2G40000 | ortholog of sugar beet HS1 PRO-1 2. |
| AT2G40004 | transmembrane protein. |
| AT2G40008 | Natural antisense transcript overlaps with AT2G40010. |
| AT2G40070 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
| AT2G40095 | Alpha/beta hydrolase related protein. |
| AT2G40100 | Lhcb4:3 protein (Lhcb4.3, light harvesting complex of photosystem II |
| AT2G40110 | Yippee family putative zinc-binding protein. |
| AT2G40120 | Protein kinase superfamily protein. |
| AT2G40140 | zinc finger (CCCH-type) family protein. |
| AT2G40200 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT2G40220 | Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings. |
| AT2G40230 | HXXXD-type acyl-transferase family protein. |
| AT2G40260 | Homeodomain-like superfamily protein. |
| AT2G40270 | Protein kinase family protein. |
| AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
| AT2G40475 | hypothetical protein. |
| AT2G40540 | putative potassium transporter AtKT2p (AtKT2) mRNA, |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G40750 | member of WRKY Transcription Factor; Group III. Together with WRKY70 positively regulates SARD1 and CBP60g expression in plant immunity. |
| AT2G40805 | Encodes a microRNA that targets several TCP family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGACUGAAGGGAGCUCCUU |
| AT2G40810 | yeast autophagy-like protein. |
| AT2G40830 | Encodes an E3 ubiquitin ligase for the GA-receptor GID1 that functions as a negative regulator of GA signaling in seedlings and seeds by inducing ubiquitin-dependent proteolysis of GID1s. Tyr321 phosphorylation of GARU by TAGK2 inactivates GARU. |
| AT2G40940 | Ethylene receptor, subfamily 1. Has histidine kinase activity. |
| AT2G40950 | bZIP17 appears to regulate transcription as part of a salt and osmotic stress response. zip17 mutants show enhanced inhibition of primary root elongation in response to NaCl. Several salt-responsive genes, such as ATHB-7 show a reduced transcriptional response to a salt treatment in zip17 mutant seedlings. myc:bZIP17 undergoes proteolytic processing in salt-treated wild type seedlings, but not in s1p-3 (subtilase) mutants and there is also evidence for S1P-mediated cleavage of bZIP17 in vitro. In addition, an mGFP:bZIP17 protein moves from the ER to the nucleus following salt treatment. It is cleaved by S2P to allow translocation to the nucleus. |
| AT2G40970 | Homeodomain-like superfamily protein. |
| AT2G40980 | Protein kinase superfamily protein. |
| AT2G41070 | Transcription factor homologous to ABI5. Regulates AtEm1 expression by binding directly at the AtEm1 promoter. Located in the nucleus and expressed during seed maturation in the cotyledons and later in the whole embryo. |
| AT2G41140 | Encodes CDPK-related kinase 1 (CRK1). |
| AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT2G41300 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G41312 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G41370 | Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. |
| AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT2G41400 | Pollen Ole e 1 allergen and extensin family protein. |
| AT2G41430 | Encodes hydrophilic protein lacking Cys residues that is expressed in response to drought stress, light stress and treatment with plant-growth-promoting rhizobacteria (Paenibacillus polymyxa), possibly revealing a connection between responses to biotic and abiotic stress. Also identified as a CTC Interacting Domain (CID) protein in a yeast two hybrid screen using the PAB2 protein as bait. Contains PAM2 like domain which mediates interaction with PABC domain in PAB2. |
| AT2G41470 | agamous-like MADS-box protein. |
| AT2G41475 | Embryo-specific protein 3, (ATS3). |
| AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT2G41640 | Glycosyltransferase family 61 protein. |
| AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
| AT2G41745 | transposable_element_gene.;pseudogene, similar to putative reverse transcriptase |
| AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
| AT2G41870 | Remorin family protein. |
| AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein. |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
| AT2G41905 | transmembrane protein. |
| AT2G41930 | Protein kinase superfamily protein. |
| AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT2G42030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE1 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
| AT2G42040 | WRC protein. |
| AT2G42110 | hypothetical protein. |
| AT2G42120 | DNA polymerase delta small subunit. |
| AT2G42280 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT2G42350 | RING/U-box superfamily protein. |
| AT2G42360 | RING/U-box superfamily protein. |
| AT2G42425 | other_RNA. |
| AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
| AT2G42440 | Lateral organ boundaries (LOB) domain family protein. |
| AT2G42570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G42610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640). |
| AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. |
| AT2G42660 | Homeodomain-like superfamily protein. |
| AT2G42750 | DNAJ heat shock N-terminal domain-containing protein. |
| AT2G42760 | DUF1685 family protein. |
| AT2G42770 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein. |
| AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT2G42870 | Encodes PHYTOCHROME RAPIDLY REGULATED1 (PAR1), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR2 (At3g58850). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT2G42880 | member of MAP Kinase |
| AT2G42900 | Plant basic secretory protein (BSP) family protein. |
| AT2G42910 | Phosphoribosyltransferase family protein. |
| AT2G42955 | F-box/LRR protein. |
| AT2G42960 | Protein kinase superfamily protein. |
| AT2G42990 | GDSL-motif esterase/acyltransferase/lipase. |
| AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT2G43018 | unknown protein |
| AT2G43020 | Encodes a polyamine oxidase. |
| AT2G43030 | Ribosomal protein L3 family protein. |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily. |
| AT2G43060 | ILI1 binding bHLH 1. |
| AT2G43130 | encodes a protein belonging to the Rab/Ypt family of small GTPases, which are implicated in intracellular vesicular traffic. |
| AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
| AT2G43260 | F-box and associated interaction domains-containing protein. |
| AT2G43261 | transmembrane protein. |
| AT2G43320 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT2G43330 | Encodes a tonoplast-localized myo-inositol exporter, involved in efflux of myo-inositol from the vacuole to the cytosol. The gene is ubiquitously expressed. Reduced root growth in knock-out mutants grown on low inositol agar medium. |
| AT2G43340 | hypothetical protein (DUF1685). |
| AT2G43440 | F-box and associated interaction domains-containing protein. |
| AT2G43500 | Plant regulator RWP-RK family protein. |
| AT2G43530 | Encodes a defensin-like (DEFL) family protein. |
| AT2G43535 | Encodes a defensin-like (DEFL) family protein. |
| AT2G43540 | transmembrane protein. |
| AT2G43550 | Encodes a defensin-like (DEFL) family protein. |
| AT2G43610 | Chitinase family protein. |
| AT2G43710 | Encodes a stearoyl-ACP desaturase, involved in fatty acid desaturation. The ssi2 mutants have increased 18:0 and reduced 18:1 fatty acids. Exogenous application of glycerol to wild type plants mimics the ssi2 mutant phenotype. The altered 18:1 fatty acid content in the ssi2 mutants has an impact on SA- and JA-mediated defense signaling. ssi2 mutants resulted in hyper-resistance to green peach aphid and antibiosis activity in petiole exudates. Redundant Δ9 stearoyl-ACP desaturase gene which together with AAD1 and AAD5 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with AAD1, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
| AT2G43790 | Encodes a MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress.Also involved in ovule development. Homozygous mutants in a MPK3 heterozygous background are female sterile due to defects in integument development.MPK6 appears to be associated with the microsomal compartment and may be involved in mediating secretory processes. |
| AT2G43800 | Localizes to plasmodesmata (PD) through its transmembrane domain and is required for normal intercellular trafficking. Functions in a partially redundant manner with its closest homolog AtFH1. Regulates PD's permeability by anchoring actin filaments to PD. Caps the barbed end of actin filaments and stabilizes them in vitro. |
| AT2G43810 | Small nuclear ribonucleoprotein family protein. |
| AT2G43880 | Pectin lyase-like superfamily protein. |
| AT2G43890 | Pectin lyase-like superfamily protein. |
| AT2G44010 | hypothetical protein. |
| AT2G44070 | NagB/RpiA/CoA transferase-like superfamily protein. |
| AT2G44120 | Ribosomal protein L30/L7 family protein. |
| AT2G44130 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family. Component of SCF ubiquitin protein ligase, interacts with phenylalanine ammonia-lyase. AtKFB39 is a homolog of previously identified AtKFB50 (At3g59940) and specifically interacts with Arabidopsis PAL3 and PAL4 in vitro. In planta, together with AtKFB01, KFB20 and KFB50, it regulates PAL protein stability thus controlling phenylpropanoid biosynthesis . |
| AT2G44195 | pre-mRNA splicing factor domain-containing protein. |
| AT2G44198 | hypothetical protein. |
| AT2G44200 | pre-mRNA splicing factor domain-containing protein. |
| AT2G44210 | carboxyl-terminal peptidase (DUF239). |
| AT2G44280 | Major facilitator superfamily protein. |
| AT2G44430 | DNA-binding bromodomain-containing protein. |
| AT2G44440 | Emsy N Terminus (ENT) domain-containing protein. |
| AT2G44460 | Beta-glucosidase, major myrosinase which initiates sulfur reallocation by hydrolyzing particular GL species, conferring sulfur deficiency tolerance, especially during early development. |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. |
| AT2G44500 | O-fucosyltransferase family protein. |
| AT2G44578 | RING/U-box superfamily protein. |
| AT2G44580 | zinc ion binding protein. |
| AT2G44581 | RING/U-box superfamily protein. |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family. |
| AT2G44670 | senescence-associated family protein (DUF581). |
| AT2G44735 | transmembrane protein. |
| AT2G44740 | cyclin p4. |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
| AT2G44820 | axoneme-associated protein MST101(2) protein. |
| AT2G44840 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
| AT2G44920 | Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. |
| AT2G44930 | transmembrane protein, putative (DUF247). |
| AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT2G44970 | alpha/beta-Hydrolases superfamily protein. |
| AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein. |
| AT2G44990 | More Axillary Branching; carotenoid cleavage dioxygenases. |
| AT2G45050 | Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis. |
| AT2G45126 | unknown protein |
| AT2G45150 | cytidinediphosphate diacylglycerol synthase 4. |
| AT2G45160 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT2G45280 | Encodes a protein similar to RAD51C involved in double stranded break repair via homologous recombination. Sensitive to DSB induced by Mitomycin C and gamma irradiation, interacts with Atxrcc3 in yeast two-hybrid assay. Required for female meiosis but not critical for mitosis under normal conditions. |
| AT2G45290 | Transketolase. |
| AT2G45310 | UDP-D-glucuronate 4-epimerase |
| AT2G45315 | Natural antisense transcript overlaps with AT2G45310. |
| AT2G45330 | RNA 2-phosphotransferase, Tpt1 / KptA family. |
| AT2G45350 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-E subfamily) with 11 pentatricopeptide (PPR) repeats. The protein is involved in RNA editing of the initiation codon of ndhD in the chloroplast. |
| AT2G45360 | ankyrin repeat/KH domain protein (DUF1442). |
| AT2G45380 | myeloid leukemia factor. |
| AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
| AT2G45430 | Encodes a nuclear localized AT hook domain containing protein that can bind AT rich DNA in vitro. |
| AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT2G45460 | SMAD/FHA domain-containing protein. |
| AT2G45470 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT2G45480 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development. |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. |
| AT2G45670 | Encodes an acyl-CoA: lysophosphatidylethanolamine acyltransferase with 20:0-CoA being the best acyl donor. Mutations adversely affect the growth of plants and result in decreased lipid content in roots and seeds. |
| AT2G45680 | TCP family transcription factor. |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680. |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT2G45820 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. |
| AT2G45830 | downstream target of AGL15 2. |
| AT2G45950 | SKP1-like 20. |
| AT2G45960 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. Involved redundantly with PIP1;1/3/4/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT2G46000 | LDL receptor wingless signaling/trafficking chaperone. |
| AT2G46030 | Ubiquitin conjugating enzyme E2 |
| AT2G46040 | Encodes a transcriptional activator that is involved in pollen development. |
| AT2G46080 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
| AT2G46100 | Nuclear transport factor 2 (NTF2) family protein. |
| AT2G46140 | Late embryogenesis abundant protein. |
| AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family. |
| AT2G46160 | RING/U-box superfamily protein. |
| AT2G46170 | Reticulon family protein. |
| AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
| AT2G46230 | PIN domain-like family protein. |
| AT2G46240 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. |
| AT2G46260 | Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. LRBs physically interact with photoexcited and phosphorylated CRY2, at the CCE domain of CRY2, to facilitate polyubiquitination and degradation of CRY2 in response to blue light. |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT2G46308 | transmembrane protein. |
| AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT2G46320 | Mitochondrial substrate carrier family protein. |
| AT2G46330 | Encodes arabinogalactan protein (AGP16). |
| AT2G46340 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA1 is a PHYA signaling intermediate, putative regulator of PHYA signaling pathway. Light responsive repressor of photomorphogenesis. Involved in regulating circadian rhythms and flowering time in plants. Under constant light, the abundance of SPA1 protein exhibited circadian regulation, whereas under constant darkness, SPA1 protein levels remained unchanged. In addition, the spa1-3 mutation slightly shortened circadian period of CCA1, TOC1/PRR1 and SPA1 transcript accumulation under constant light. |
| AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
| AT2G46400 | Encodes a WRKY transcription factor that contributes to the feedforward inhibition of osmotic/salt stress-dependent LR inhibition via regulation of ABA signaling and auxin homeostasis. |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT2G46420 | helicase with zinc finger protein. |
| AT2G46510 | Encodes a nuclear localized BLH domain containing transcriptional activator involved in response to ABA. Overexpression confers enhanced ABA responsiveness while loss of function mutants are ABA sensitive.bHLH17 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH14 to negatively regulate jasmonate responses. |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter. |
| AT2G46530 | auxin response factor 11. |
| AT2G46535 | hypothetical protein. |
| AT2G46580 | Pyridoxamine 5-phosphate oxidase family protein. |
| AT2G46590 | Encodes a protein containing Dof zinc finger motifs that is a positive regulator of light-mediated seed germination. Its expression is limited to vascular system of the mother plant. A recessive mutation is inherited as maternal-effect and expression is not detected in the embryo. Mutants are defective in seed germination and are more dependent on light and cold treatment and less sensitive to gibberellin during seed germination. It plays its main role downstream of PIL5 and DAG1 in the phytochrome B (phyB)-mediated pathway. |
| AT2G46630 | serine/arginine repetitive matrix protein. |
| AT2G46640 | Encodes TAC1 (Tiller Angle Control 1). Influences axillary branch growth angle. Inflorescence stems of TAC1 mutants are vertically oriented and have axillary shoots with narrow branch angles. |
| AT2G46650 | member of Cytochromes b5 |
| AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
| AT2G46690 | Regulates ABA-mediated responses to drought stress. |
| AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
| AT2G46760 | D-arabinono-1,4-lactone oxidase family protein. |
| AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
| AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT2G46800 | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT2G46920 | Pol mutations are recessive, partial suppressors of meristem defects in strong clv1 and clv3 mutants, and nearly complete suppressors of weak clv1 mutants. Single mutants appear normal. Acts downstream of the CLV signaling pathway in meristem development and is required together with PLL1 for stem-cell maintenance through the regulation of WUS. |
| AT2G46930 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
| AT2G46940 | fold protein. |
| AT2G46950 | cytochrome P450, family 709, subfamily B, polypeptide 2. |
| AT2G46970 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
| AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
| AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase. |
| AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
| AT2G47020 | Peptide chain release factor 1. |
| AT2G47060 | Encodes Pto-interacting 1-4 (PTI1-4), a member of the PTI1-like serine/threonine protein kinases that share strong sequence identity to the tomato PTI1 kinase. |
| AT2G47070 | member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA. |
| AT2G47160 | Encodes a key transporter under boron (B) limitation in the soil. Protein accumulates in shoots and roots under conditions of boron deficiency and is degraded within several hours of restoring boron supply. Localized to the plasma membrane under B limitation, and to the cytoplasm after B application before degradation. Protein is transferred via the endosomes to the vacuole for degradation. Localized to the inner plasma membrane domain in the columella, lateral root cap, epidermis, and endodermis in the root tip region, and in the epidermis and endodermis in the elongation zone. Under high-boron is transported to the vacuole for degradation. Thought to be a B transceptor, directly senses the B concentration and promotes its own polyubiquitination and vacuolar sorting for quick and precise maintenance of B homeostasis. |
| AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. |
| AT2G47340 | Plant invertase/pectin methylesterase inhibitor superfamily protein. |
| AT2G47350 | HIT zinc finger and PAPA-1-like domain-containing protein. |
| AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein. |
| AT2G47380 | Cytochrome c oxidase subunit Vc family protein. |
| AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
| AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT2G47460 | MYB12 belongs to subgroup 7 of the R2R3-MYB family. It strongly activates the promoters of chalcone synthase (CHS), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS) and - to a lesser extent - chalcone flavanone isomerase (CHI), but cannot activate the promoters of flavonoid-3'hydroxylase (F3'H) and dihydroflavonol 4-reductase (DF). The activation requires a functional MYB recognition element (MRE). Results from the myb12-1f allele indicate that an activation domain might be present in the C-terminus. Overexpression or knock-out plants do not show any obvious phenotype under greenhouse conditions. Young myb12-ko seedlings contain reduced amounts of flavonoids (quercetin and kaempferol), while seedlings as well as leaves of MYB12-OX plants displayed an increased flavonoid content. They did not show any significant difference in anthocyanin content. Expression of CHS and FLS shows a clear correlation to MYB12 expression levels. CHI and F3H show increased transcript levels in the MYB12-OX lines, but no differences in the knock-out. Even in the absence of functional MYB12, flavonol biosynthesis is not completely absent, suggesting functional redundancy. The redundant factors are MYB11 and MYB111 although MYB12 is primarily required for flavonol biosynthesis in roots. Mutations in MYB12 block both auxin and ethylene stimulation of flavonoid synthesis. |
| AT2G47610 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein. |
| AT2G47660 | unknown protein |
| AT2G47720 | hypothetical protein. |
| AT2G47730 | Encodes glutathione transferase belonging to the phi class of GSTs. |
| AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. |
| AT2G47770 | Encodes a membrane-bound protein designated AtTSPO (Arabidopsis thaliana TSPO-related). AtTSPO is related to the bacterial outer membrane tryptophan-rich sensory protein (TspO) and the mammalian mitochondrial 18 kDa Translocator Protein (18 kDa TSPO), members of the TspO/MBR domain-containing membrane proteins. Mainly detected in dry seeds, but can be induced in vegetative tissues by osmotic or salt stress or abscisic acid treatment. Located in endoplasmic reticulum and the Golgi stacks. It is degraded through the autophagy pathway. |
| AT2G47780 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT2G47790 | Encodes GIGANTUS1 (GTS1), a member of Transducin/WD40 protein superfamily. Controls seed germination, growth and biomass accumulation. |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. |
| AT2G47940 | Encodes DegP2 protease (DEGP2); nuclear gene for chloroplast product. |
| AT2G47950 | myelin transcription factor-like protein. |
| AT2G48000 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT2G48010 | receptor-like serine/threonine kinase (RKF3) |
| AT2G48020 | Encodes a zinc transporter ZIF2. Expression of ZIF2 is regulated by alternative splicing. |
| AT2G48030 | DNAse I-like superfamily protein. |
| AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
| AT2G48080 | oxidoreductase, 2OG-Fe(II) oxygenase family protein. |
| AT3G01070 | early nodulin-like protein 16. |
| AT3G01120 | encodes a cystathionine gamma-synthase, which performs the first committed step in methionine biosynthesis. A conserved motif of 13 amino acids in the first exon is required for posttranscriptional autoregulation. This enzyme shares the same substrate as threonine synthase (TS) and its absence transcriptionally affects 8 genes in the genome. |
| AT3G01220 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Expressed during seed germination in the micropylar endosperm and in the root cap, and increases ABA sensitivity and seed dormancy when mutated. |
| AT3G01270 | Pectate lyase family protein. |
| AT3G01280 | Encodes a voltage-dependent anion channel |
| AT3G01310 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion, producing the InsP8 cofactor of the ASK1-COI1-JAZ-jasmonate co-receptor complex. It is the major isoform in plants, is required for jasmonate-dependent defenses, and plays an important role in plant defenses against necrotrophic fungi and insect herbivores. |
| AT3G01390 | Subunit G of the vacuolar membrane ATPAse complex |
| AT3G01400 | ARM repeat superfamily protein. |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. |
| AT3G01460 | Encodes a protein with a methyl-CpG-binding domain. Has sequence similarity to human MBD proteins. Involved in the modification of the FLC chromatin acetylation state to affect FLC expression. Mutants show an early flowering, and enhanced shoot branching phenotypes. |
| AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
| AT3G01472 | unknown protein |
| AT3G01513 | hypothetical protein. |
| AT3G01516 | transmembrane protein. |
| AT3G01580 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT3G01590 | Galactose mutarotase-like superfamily protein. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. |
| AT3G01690 | alpha/beta-Hydrolases superfamily protein. |
| AT3G01800 | Ribosome recycling factor. |
| AT3G01810 | EEIG1/EHBP1 protein amino-terminal domain protein. |
| AT3G01820 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT3G01830 | Calcium-binding EF-hand family protein. |
| AT3G01900 | member of CYP94B |
| AT3G01910 | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT3G01940 | transmembrane protein, putative (DUF 3339). |
| AT3G01970 | member of WRKY Transcription Factor; Group I |
| AT3G01980 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT3G02040 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. |
| AT3G02050 | potassium transporter KUP3p (KUP3) |
| AT3G02125 | pinin-like protein. |
| AT3G02130 | Encodes a receptor-like kinase RPK2 (also known as TOADSTOOL 2/TOAD2). Functions as a regulator of meristem maintenance. Mutants are insensitive to synthetic CLV3 peptide. Mutations in the RPK2 also result in stem cell expansion and increased number of floral organs, as seen in the other clv mutants. Forms homo-oligomers. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT3G02170 | Encodes LONGIFOLIA2 (LNG2). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG2 homologue LNG1 (At5g15580) has similar function. |
| AT3G02180 | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. |
| AT3G02270 | Trimeric LpxA-like enzyme. |
| AT3G02340 | RING/U-box superfamily protein. |
| AT3G02350 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G02410 | alpha/beta-Hydrolases superfamily protein. |
| AT3G02420 | dihydroflavonol 4-reductase/flavanone protein. |
| AT3G02500 | mental retardation GTPase activating protein. |
| AT3G02510 | Regulator of chromosome condensation (RCC1) family protein. |
| AT3G02515 | Member of Sadhu non-coding retrotransposon family |
| AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT3G02550 | LOB domain-containing protein 41. |
| AT3G02570 | Encodes a protein with phosphomannose isomerase activity. |
| AT3G02580 | Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf phenotype. |
| AT3G02620 | Δ9 Stearoyl-ACP Desaturase |
| AT3G02750 | Protein phosphatase 2C family protein. |
| AT3G02830 | Encodes a zinc finger protein that binds to PORA mRNA in vivo and recruits the Pfr form of phytochrome to the 5′-UTR of PORA mRNA to regulate translation of the mRNA. |
| AT3G02832 | other_RNA. |
| AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
| AT3G02880 | Probable inactive receptor kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins from the three affinity chromatography systems with LPS chemotype Xcc 8530 as ligand. |
| AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
| AT3G02990 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G03040 | F-box/RNI-like superfamily protein. Idenfitied in GWAS as locus involved in response to the defense molecule, allyl glucosinolate. |
| AT3G03050 | encodes a cellulose synthase like protein. |
| AT3G03090 | Encodes a vacuolar membrane-localized glucose transporter that can also transport fructose. Mutations in these gene have effects on seed germination and time to flowering. |
| AT3G03100 | NADH:ubiquinone oxidoreductase, 17.2kDa subunit. |
| AT3G03150 | hypothetical protein. |
| AT3G03160 | B-cell receptor-associated-like protein. |
| AT3G03170 | hypothetical protein. |
| AT3G03180 | Got1/Sft2-like vescicle transport protein family. |
| AT3G03190 | Encodes glutathione transferase belonging to the phi class of GSTs. |
| AT3G03200 | NAC domain containing protein 45. |
| AT3G03210 | Pmr5/Cas1p GDSL/SGNH-like acyl-esterase family protein. |
| AT3G03230 | alpha/beta-Hydrolases superfamily protein. |
| AT3G03240 | alpha/beta-Hydrolases superfamily protein. |
| AT3G03272 | Encodes a ECA1 gametogenesis related family protein |
| AT3G03456 | unknown protein |
| AT3G03460 | One of two paralogous GLTSCR domain containing proteins and a core component of SWI/SNF complexes. |
| AT3G03520 | Lysophosphatidic acid phosphatase highly expressed during phosphate starvation and abiotic stresses. Role in lipid synthesis. |
| AT3G03626 | unknown protein |
| AT3G03630 | Encodes a protein that possesses S-sulfocysteine synthase activity and lacks O-acetylserien(thiol)lyase activity. |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT3G03690 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein. |
| AT3G03770 | Leucine-rich repeat protein kinase family protein. |
| AT3G03847 | SAUR-like auxin-responsive protein family. |
| AT3G03850 | SAUR-like auxin-responsive protein family. |
| AT3G03860 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT3G03950 | Physically interacts with CIPK1. Located in the nucleus. |
| AT3G03980 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT3G03990 | Encodes an alpha/beta hydrolase essential for strigolactone signaling. Degradation of the protein is promoted by strigolactone. |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. |
| AT3G04010 | O-Glycosyl hydrolases family 17 protein. |
| AT3G04050 | Pyruvate kinase family protein. |
| AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
| AT3G04070 | NAC domain containing protein 47. |
| AT3G04090 | Belongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER. |
| AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT3G04120 | encodes cytosolic GADPH (C subunit) involved in the glycolytic pathway but also interacts with H2O2 potentially placing it in a signalling cascade induced by ROS. |
| AT3G04130 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT3G04140 | Ankyrin repeat family protein. |
| AT3G04240 | Has O-linked N-acetyl glucosamine transferase activity. Similar to Arabidopsis SPY gene. |
| AT3G04290 | Li-tolerant lipase 1. |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G04380 | Encodes SUVR4, a nucleolar histone methyltransferase with preference for monomethylated H3K9. One of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. |
| AT3G04420 | NAC domain containing protein 48. |
| AT3G04530 | Encodes a second Arabidopsis phosphoenolpyruvate carboxylase kinase gene product with a different expression pattern from PPCK1. Expression of the gene is upregulated by exposure of the plant to light and is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT3G04570 | AT-hook motif nuclear-localized protein 19. |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G04640 | glycine-rich protein. |
| AT3G04650 | FAD/NAD(P)-binding oxidoreductase family protein. |
| AT3G04670 | member of WRKY Transcription Factor; Group II-d |
| AT3G04680 | Encodes a nuclear protein that functions in mRNA processing. |
| AT3G04720 | Encodes a protein similar to the antifungal chitin-binding protein hevein from rubber tree latex. mRNA levels increase in response to ethylene and turnip crinkle virus infection. |
| AT3G04721 | unknown protein |
| AT3G04730 | early auxin-induced (IAA16) |
| AT3G04732 | unknown protein |
| AT3G04735 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G04810 | Encodes AtNek2, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
| AT3G04860 | hypothetical protein (DUF868). |
| AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
| AT3G04920 | Ribosomal protein S24e family protein. |
| AT3G05000 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT3G05010 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. |
| AT3G05020 | encodes an acyl carrier protein expressed in leaves, roots, and dry seeds. Protein is not regulated by light. |
| AT3G05030 | Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure. |
| AT3G05152 | other_RNA. |
| AT3G05155 | Major facilitator superfamily protein. |
| AT3G05160 | Major facilitator superfamily protein. |
| AT3G05165 | Major facilitator superfamily protein. |
| AT3G05190 | D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein. |
| AT3G05193 | unknown protein |
| AT3G05200 | Encodes a putative RING-H2 zinc finger protein ATL6 (ATL6). |
| AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT3G05220 | Heavy metal transport/detoxification superfamily protein. |
| AT3G05230 | Signal peptidase subunit. |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT3G05420 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
| AT3G05425 | hypothetical protein. |
| AT3G05430 | Tudor/PWWP/MBT superfamily protein. |
| AT3G05480 | Involved in the regulation of DNA damage repair and homologous recombination. |
| AT3G05500 | Encodes a protein that associates with lipid droplet surfaces and shares sequence homology with family of small rubber particle proteins. |
| AT3G05625 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT3G05660 | receptor like protein 33. |
| AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT3G05700 | Encodes a DNA binding protein with transcription activation activity. It is expressed in response to osmotic, drought and ABA stress. |
| AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT3G05770 | hypothetical protein. |
| AT3G05800 | AtBS1(activation-tagged BRI1 suppressor 1)-interacting factor 1. |
| AT3G05820 | Encodes a putative plastid-targeted alkaline/neutral invertase.Expression is induced by salt, osmotic and ABA treatments. Loss of function affects mitochondrial functioning and ROS production. |
| AT3G05830 | Encodes alpha-helical IF (intermediate filament)-like protein.NEAP1 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT). |
| AT3G05890 | Low temperature and salt responsive protein family. |
| AT3G05905 | Natural antisense transcript overlaps with AT3G05900. |
| AT3G05910 | Pectinacetylesterase family protein. |
| AT3G05920 | Heavy metal transport/detoxification superfamily protein. |
| AT3G05930 | germin-like protein (GLP8) |
| AT3G05932 | Potential natural antisense gene, locus overlaps with AT3G05930 |
| AT3G05936 | hypothetical protein. |
| AT3G05937 | hypothetical protein. |
| AT3G05940 | organic solute transporter ostalpha protein (DUF300). |
| AT3G06000 | RNI-like superfamily protein. |
| AT3G06020 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT3G06030 | NPK1-related protein kinase 3 |
| AT3G06035 | Glycoprotein membrane precursor GPI-anchored. |
| AT3G06070 | hypothetical protein. |
| AT3G06090 | homolog of prePIP1 |
| AT3G06120 | Encodes a basic helix-loop-helix (bHLH) protein that controls meristemoid differentiation during stomatal development. In the absence of MUTE, meristemoids abort after excessive asymmetric divisions and fail to differentiate stomata. MUTE expression in the meristemoid is required for SLGCs differentiation as pavement cells. Epidermal cells lose their competence to respond to MUTE overexpression during cotyledon development. |
| AT3G06125 | Unknown gene |
| AT3G06130 | Heavy metal transport/detoxification superfamily protein. |
| AT3G06350 | Encodes a bi-functional dehydroquinate-shikimate dehydrogenase enzyme that catalyzes two steps in the chorismate biosynthesis pathway. |
| AT3G06410 | Zinc finger C-x8-C-x5-C-x3-H type family protein. |
| AT3G06420 | Autophagy protein. |
| AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT3G06620 | PAS domain-containing protein tyrosine kinase family protein. |
| AT3G06650 | One of the two genes encoding subunit B of the trimeric enzyme ATP Citrate lyase |
| AT3G06660 | PAPA-1-like family protein / zinc finger (HIT type) family protein. |
| AT3G06665 | pre-tRNA tRNA-His (anticodon: GTG). |
| AT3G06670 | SMEK1 forms a catalytically active complex with PP4 proteins. The complex has been shown to target and dephosphorylate HYL1 which in turn promotes miRNA biogenesis. Mutants have pleiotrophic phenotypes and decreased production of miRNA. SMEK1 accumulation is responsive to ABA. |
| AT3G06750 | hydroxyproline-rich glycoprotein family protein. |
| AT3G06760 | Drought-responsive family protein. |
| AT3G06770 | Pectin lyase-like superfamily protein. |
| AT3G06780 | glycine-rich protein. |
| AT3G06830 | Plant invertase/pectin methylesterase inhibitor superfamily. |
| AT3G06840 | hypothetical protein. |
| AT3G06995 | Encodes a Defensin-like (DEFL) family protein [pseudogene] |
| AT3G07000 | Cysteine/Histidine-rich C1 domain family protein. |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein. |
| AT3G07280 | None. |
| AT3G07290 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT3G07320 | O-Glycosyl hydrolases family 17 protein. |
| AT3G07330 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT3G07340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506). |
| AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture |
| AT3G07460 | transmembrane protein, putative (Protein of unknown function, DUF538). |
| AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein. |
| AT3G07750 | 3-5-exoribonuclease family protein. |
| AT3G07760 | Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. |
| AT3G07890 | Ypt/Rab-GAP domain of gyp1p superfamily protein. |
| AT3G07960 | Encodes phosphatidylinositol-4-phosphate 5-kinase 6 (PIP5K6). Regulates clathrin-dependent endocytosis in pollen tubes. |
| AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
| AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
| AT3G08630 | alphavirus core family protein (DUF3411). |
| AT3G08636 | hypothetical protein. |
| AT3G08640 | alphavirus core family protein (DUF3411). |
| AT3G08660 | Phototropic-responsive NPH3 family protein. |
| AT3G08670 | serine/arginine repetitive matrix-like protein. |
| AT3G08710 | Associated to plasma membrane. Moves cell to cell, suggesting a role in intercellular communication. The redox reaction between oxidized AtGPX3 and reduced AtTRXh9 is realized through the forming and breaking of disulfide bonds via the active sites of Cys4 and Cys57 in AtTRXh9. |
| AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
| AT3G08730 | Encodes a protein-serine kinase that phosphorylates ribosomal protein in vitro. Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Involved in translational up-regulation of ribosomal proteins. Phosphorylated by PDK1. Interacts with RAPTOR1, which in turn interacts with TOR. SPK6 activity is affected by osmotic stress, and plants overexpressing S6k1 are hypersensitive to osmotic stress. The gene is expressed in all tissues examined, with highest expression level detected in metabolically active tissues. |
| AT3G08762 | unknown protein |
| AT3G08980 | Peptidase S24/S26A/S26B/S26C family protein. |
| AT3G08990 | Yippee family putative zinc-binding protein. |
| AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
| AT3G09100 | mRNA capping enzyme family protein. |
| AT3G09110 | hypothetical protein (DUF674). |
| AT3G09230 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
| AT3G09490 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT3G09500 | Ribosomal L29 family protein. |
| AT3G09570 | Lung seven transmembrane receptor family protein. |
| AT3G09595 | pre-tRNA tRNA-Ser (anticodon: TGA). |
| AT3G09600 | Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response. |
| AT3G09620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT3G09660 | Encodes a minichromosome maintenance protein that is involved with RAD51 in a backup pathway that repairs meiotic double strand breaks without giving meiotic crossovers when the major pathway, which relies on DMC1, fails. |
| AT3G09670 | PWWP domain protein involved in regulation of FLC and flowering time. |
| AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family. |
| AT3G09720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT3G09910 | RAB GTPase homolog C2B. |
| AT3G09915 | pseudogene of Galactose oxidase/kelch repeat superfamily protein. |
| AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT3G09960 | Calcineurin-like metallo-phosphoesterase superfamily protein. |
| AT3G09970 | Encodes a cytosolic tyrosine phosphatase. |
| AT3G09980 | Encodes ACIP1, a microtubules-associated protein required for bacterial immunity. |
| AT3G10000 | Homeodomain-like superfamily protein. |
| AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA). |
| AT3G10210 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein. |
| AT3G10220 | Encodes a tubulin-binding cofactor. Homozygous mutant plants are embryo lethal. Heterozygous mutant plants showed increased ploidy and higher numbers of spindles and phragmoplasts, suggesting a role in cell division. |
| AT3G10260 | Reticulon family protein. |
| AT3G10270 | Protein targeting to mitochondria is influenced by UTR sequences. |
| AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
| AT3G10330 | Cyclin-like family protein. |
| AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
| AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. |
| AT3G10670 | Plastidic SufC-like ATP-binding cassette/ATPase essential for Arabidopsis embryogenesis. Involved in the biogenesis and/or repair of oxidatively damaged Fe?S clusters. Expressed in embryos and meristems. |
| AT3G10680 | SLI1 is a heat shock like protein that is found in sieve elements, sieve plates and spherical bodies peripheral to the mitochondria. Mutants show increased phloem feeding by aphids and decreased heat tolerance. |
| AT3G10760 | Homeodomain-like superfamily protein. |
| AT3G10770 | Single-stranded nucleic acid binding R3H protein. |
| AT3G10815 | RING/U-box superfamily protein. |
| AT3G10820 | Transcription elongation factor (TFIIS) family protein. |
| AT3G10910 | RING/U-box superfamily protein. |
| AT3G10912 | unknown protein |
| AT3G10915 | Reticulon family protein. |
| AT3G10920 | manganese superoxide dismutase (MSD1) |
| AT3G10930 | Encodes a small secreted signaling peptide that processed both N- and C-terminally after translation and is rapidly induced in response to ROS and flg22-induced stress and may act as a negative modulator of stress-induced ROS signalling. |
| AT3G10960 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. |
| AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. |
| AT3G10986 | LURP-one-like protein (DUF567). |
| AT3G11020 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2B). The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A. |
| AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
| AT3G11040 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
| AT3G11110 | RING/U-box superfamily protein. |
| AT3G11120 | Ribosomal protein L41 family. |
| AT3G11165 | hypothetical protein. |
| AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. |
| AT3G11210 | SGNH hydrolase-type esterase superfamily protein. |
| AT3G11220 | A subunit of Elongator, a histone acetyl transferase complex, consisting of six subunits (ELP1?ELP6), that copurifies with the elongating RNAPII in yeast and humans. Three Arabidopsis thaliana genes, encoding homologs of the yeast Elongator subunits ELP1, ELP3 (histone acetyl transferase), and ELP4 are responsible for the narrow leaf phenotype in elongata mutants and for reduced root growth that results from a decreased cell division rate. |
| AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT3G11330 | Encodes PIRL9, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
| AT3G11405 | hypothetical protein. |
| AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
| AT3G11415 | other_RNA. |
| AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604). |
| AT3G11470 | Encodes one of three splice variants. Differs in having CM in positions 88 and 89. The protein is localized to the mitochondria where it phosphopantetheinylates the mature apo mtACP isoforms. It is an essential gene as homozygous mutants cannot be recovered (embryo lethal). |
| AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT3G11590 | golgin family A protein. |
| AT3G11670 | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE). |
| AT3G11690 | hypothetical protein. |
| AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G11710 | lysyl-tRNA synthetase 1. |
| AT3G11760 | structural maintenance of chromosomes flexible hinge domain protein. |
| AT3G11780 | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein. |
| AT3G11800 | Expp1 protein. |
| AT3G11820 | Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment. |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT3G11850 | myosin-binding protein (Protein of unknown function, DUF593). |
| AT3G11880 | transmembrane protein, putative (Protein of unknown function DUF2359, transmembrane). |
| AT3G11890 | Sterile alpha motif (SAM) domain-containing protein. |
| AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
| AT3G11930 | Adenine nucleotide alpha hydrolases-like superfamily protein. |
| AT3G12010 | C18orf8. |
| AT3G12012 | unknown protein |
| AT3G12020 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
| AT3G12150 | alpha/beta hydrolase family protein. |
| AT3G12220 | serine carboxypeptidase-like 16. |
| AT3G12230 | serine carboxypeptidase-like 14. |
| AT3G12240 | serine carboxypeptidase-like 15. |
| AT3G12250 | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
| AT3G12300 | Similar to Bug22p in Paramecium, a conserved centrosomal/ciliary protein. This protein is widespread in eukaryotes harboring centrioles/cilia at some stage of their life cycles. Among eukaryotes devoid of centrioles/cilia, plants possess BUG22 genes whereas some fungi (at least ascomycetes) do not. |
| AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
| AT3G12360 | Encodes a protein with an ankyrin motif and transmembrane domains that is involved in salt tolerance. Expressed throughout the plant and localized to the plasma membrane. Loss of function mutations show an increased tolerance to salt based on assaying seedling growth in the presence of salt. In the mutants, induction of genes required for production of reactive oxygen species is reduced suggesting that itn1 promotes ROS production. It interacts with RCN1 in vivo and may regulate its subcellular localization. |
| AT3G12560 | Encodes a telomeric DNA-binding protein. |
| AT3G12600 | nudix hydrolase homolog 16. |
| AT3G12610 | Plays role in DNA-damage repair/toleration. Partially complements RecA- phenotypes. |
| AT3G12630 | Encodes a protein with E3 ligase activity that acts as a positive regulator of stress responses in Arabidopsis. |
| AT3G12640 | RNA binding (RRM/RBD/RNP motifs) family protein. |
| AT3G12700 | Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression. |
| AT3G12710 | DNA glycosylase superfamily protein. |
| AT3G12835 | hypothetical protein. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G12930 | Encodes a novel conserved chloroplast protein that interacts with components of the PEP complex. Mutants show delayed greening and reduced photosynthetic capcity. |
| AT3G12970 | serine/arginine repetitive matrix-like protein. |
| AT3G13000 | ubiquinone biosynthesis protein (Protein of unknown function, DUF547). |
| AT3G13040 | myb-like HTH transcriptional regulator family protein. |
| AT3G13050 | Encodes a plant nicotinate transporter than can also transport trigonelline (N-methylnicotinate). |
| AT3G13110 | Encodes a mitochondrial serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT3G13120 | Ribosomal protein S10p/S20e family protein. |
| AT3G13170 | Encodes AtSPO11-1, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. AtSPO11-1 accumulates in foci in early G2. At 1 h post-S phase, no foci are observed, but by 3 h a majority (80%) of meiocytes at this time point contain >50 foci. However, by 5 h, AtSPO11-1 foci are no longer detectable. This suggests that the protein undergoes a rapid cycle of accumulation and disappearance in meiocytes over a period of between 1 and 5 h post-S phase. |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein. |
| AT3G13380 | Similar to BRI, brassinosteroid receptor protein. |
| AT3G13405 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CAGCCAAGGAUGACUUGCCGA |
| AT3G13432 | transmembrane protein. |
| AT3G13500 | hypothetical protein. |
| AT3G13510 | carboxyl-terminal peptidase, putative (DUF239). |
| AT3G13520 | Encodes a GPI-anchored arabinogalactan (AG) peptide with a short 'classical' backbone of 10 amino acids, seven of which are conserved among the 4 other Arabidopsis AG peptides. |
| AT3G13600 | calmodulin-binding family protein. |
| AT3G13620 | Encodes POLYAMINE UPTAKE TRANSPORTER 4, an amino acid permease family protein. |
| AT3G13640 | member of RLI subfamily |
| AT3G13650 | Disease resistance-responsive (dirigent-like protein) family protein. |
| AT3G13662 | Disease resistance-responsive (dirigent-like protein) family protein. |
| AT3G13670 | MUT9-like protein kinase. Contributes to phosphorylation of photoexcited CRY2. Interaction with CRY2 occurs via the non catalytic PPKC domain.MLK4 phosphorylates the conserved H2A serine 95 residue. Synthetic mutants that cannot phosphorylate H2AS95 fail to complement the late flowering phenotype suggesting that MLK4 promotes long day flowering via phosphorylation.MLK4 is required for H2A295 phosphorylation of GI. |
| AT3G13686 | unknown protein |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein. |
| AT3G13730 | Encodes a cytochrome P-450 gene that is involved in brassinosteroid biosynthesis, most likely in the conversion step of teasterone (TE) to 3-dehydroteasterone (3DT), and/or 6-deoxoteasterone (6-deoxoTE) to 6-deoxo-3-dehydroteasterone (6-deoxo3DT); or the conversion of cathasterone (CT) to TE, and/or 6-deoxocathasterone (6-deoxoCT) to 6-deoxoTE. Recently, CYP90D1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). Member of the CYP90C CYP450 family. Similar to Cytochrome P450 90C1 (ROT3). |
| AT3G13790 | Encodes a protein with invertase activity. |
| AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein. |
| AT3G13810 | indeterminate(ID)-domain 11. |
| AT3G13820 | F-box and associated interaction domains-containing protein. |
| AT3G13870 | required for regulated cell expansion and normal root hair development. Encodes an evolutionarily conserved protein with putative GTP-binding motifs that is implicated in the control of vesicle trafficking between the endoplasmic reticulum and the Golgi compartments. Degraded by LNP1 and 2 to maintain a tubular ER network. |
| AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
| AT3G13890 | Encodes a putative transcription factor (MYB26). Mutants produces fertile pollen but plants are sterile because anthers do not dehisce. The cellulosic secondary wall thickenings are not formed in the endothecium as they are in non-mutant plants. |
| AT3G13910 | hypothetical protein (DUF3511). |
| AT3G13920 | eukaryotic translation initiation factor 4A-1 |
| AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) |
| AT3G13970 | Autophagy protein. |
| AT3G14050 | Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT3G14060 | hypothetical protein. |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT3G14070 | Involved in cation (K, Na and Mn) homeostasis and transport |
| AT3G14200 | Chaperone DnaJ-domain superfamily protein. |
| AT3G14205 | Phosphoinositide phosphatase family protein. |
| AT3G14220 | GDSL-motif esterase/acyltransferase/lipase |
| AT3G14225 | Contains lipase signature motif and GDSL domain. |
| AT3G14230 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT3G14240 | Subtilase family protein. |
| AT3G14260 | LURP-one-like protein (DUF567). |
| AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
| AT3G14320 | RING-H2 ubiquitin ligase. Mutants are defective in ABA mediated drought response. |
| AT3G14330 | Encodes a pentatricopeptide repeat protein involved in chloroplast mRNA editing. Mutants display defects in C-U editing of psbE. |
| AT3G14340 | hypothetical protein. |
| AT3G14350 | STRUBBELIG-receptor family 7. |
| AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT3G14380 | Uncharacterized protein family (UPF0497). |
| AT3G14431 | unknown protein |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
| AT3G14590 | Ca2+-dependent lipid-binding protein |
| AT3G14640 | putative cytochrome P450 |
| AT3G14650 | putative cytochrome P450 |
| AT3G14680 | putative cytochrome P450 |
| AT3G14720 | member of MAP Kinase |
| AT3G14830 | epstein-barr nuclear antigen. |
| AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. |
| AT3G14870 | hypothetical protein (DUF641). |
| AT3G15080 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein. |
| AT3G15095 | Encodes HCF243 (high chlorophyll fluorescence), a chloroplast-localized protein involved in the D1 protein stability of the photosystem II complex1. |
| AT3G15110 | transmembrane protein. |
| AT3G15115 | serine/arginine repetitive matrix protein. |
| AT3G15120 | Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions. |
| AT3G15200 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. |
| AT3G15350 | G14 enzyme |
| AT3G15356 | Legume lectin family protein. |
| AT3G15359 | hypothetical protein. |
| AT3G15390 | Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing. |
| AT3G15395 | HrpN-interacting protein from malus protein. |
| AT3G15480 | fiber (DUF1218). |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT3G15518 | hypothetical protein. |
| AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT3G15534 | hypothetical protein. |
| AT3G15536 | Unknown gene |
| AT3G15578 | hypothetical protein. |
| AT3G15720 | Pectin lyase-like superfamily protein. |
| AT3G15730 | Encodes phospholipase D alpha 1 (PLD alpha 1). Positive regulator of abscisic acid (ABA) mediated stomatal movements. PLD alpha 1 plays an important role in seed deterioration and aging in Arabidopsis. |
| AT3G15760 | cytochrome P450 family protein. |
| AT3G15780 | transmembrane protein. |
| AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT3G15810 | LURP-one-like protein (DUF567). |
| AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
| AT3G15890 | Protein kinase superfamily protein. |
| AT3G15950 | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
| AT3G15960 | mismatched DNA binding / ATP binding protein. |
| AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
| AT3G16080 | Zinc-binding ribosomal protein family protein. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT3G16210 | F-box family protein. |
| AT3G16240 | Delta tonoplast intrinsic protein, functions as a water channel and ammonium (NH3) transporter. Highly expressed in flower, shoot, and stem. Expression shows diurnal regulation and is induced by ammonium (NH3). Protein localized to vacuolar membrane. |
| AT3G16250 | encodes a novel subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in cyclic electron flow around photosystem I to produce ATP. Contains a 4Fe-4S cluster. |
| AT3G16260 | Encodes a tRNase Z. |
| AT3G16270 | Involved in the plant trans-Golgi network (TGN), where it is part of an adaptor protein (AP) complex to promote vesicle generation with different cargo specificity and destination. Interacts with AP-4, whose function is required for MTV1 recruitment. |
| AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT3G16380 | polyadenylate-binding protein, putative / PABP, putative, similar to polyadenylate-binding protein (poly(A)-binding protein) from {Arabidopsis thaliana} SP:P42731, (Cucumis sativus) GI:7528270, {Homo sapiens} SP:Q13310, {Arabidopsis thaliana} SP:Q05196; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Member of the class III family of PABP proteins. |
| AT3G16400 | Encodes a nitrile-specifier protein NSP1 responsible for constitutive and herbivore-induced simple nitrile formation in rosette leaves. NSP1 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT3G16410 | Encodes a nitrile-specifier protein NSP4. NSP4 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT3G16415 | pseudogene of myrosinase-binding protein 2. |
| AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. |
| AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
| AT3G16432 | hypothetical protein. |
| AT3G16440 | myrosinase-binding protein-like protein (AtMLP-300B) mRNA, |
| AT3G16450 | Mannose-binding lectin superfamily protein. |
| AT3G16460 | Mannose-binding protein |
| AT3G16470 | Encodes a JA-responsive gene that coordinates with GRP7 in shaping plant development through the regulation of RNA processing in Arabidopsis. AtJAC1 interacts with RNA binding protein GRP7 specifically in the cytoplasm to regulate its nucleocytoplasmic distribution. |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT3G16560 | Protein phosphatase 2C family protein. |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT3G16620 | component of TOC complex, plastid protein import machinery. |
| AT3G16630 | Kinesin-13A localized to entire Golgi stacks. Involved in trichome development. |
| AT3G16690 | Nodulin MtN3 family protein. |
| AT3G16700 | Fumarylacetoacetate hydrolase homolog. |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. |
| AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
| AT3G16800 | EGR3 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress, EGR3 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT3G16830 | TOPLESS family member which directly binds the N-terminal domain of SNC1 and interacts with TPR1. |
| AT3G16850 | Pectin lyase-like superfamily protein. |
| AT3G16851 | unknown protein |
| AT3G16857 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT3G16860 | COBRA-like protein 8 precursor. |
| AT3G16870 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT3G16920 | Encodes a chitinase-like protein expressed predominantly in stems. Mutants accumulate ligning in etiolated hypocotyls. |
| AT3G16990 | heme oxygenase-like, multi-helical. |
| AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
| AT3G17020 | Adenine nucleotide alpha hydrolases-like superfamily protein. |
| AT3G17030 | Nucleic acid-binding proteins superfamily. |
| AT3G17070 | Peroxidase family protein. |
| AT3G17100 | sequence-specific DNA binding transcription factor. |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G17120 | transmembrane protein. |
| AT3G17130 | Plant invertase/pectin methylesterase inhibitor superfamily protein. |
| AT3G17185 | Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G17203 | a pseudogene initially named GA2ox5 and thought to be a member of the gibberellin 2-oxidase enzyme family. It was later shown to have a large DNA insert in the putative gene model. |
| AT3G17205 | ubiquitin protein ligase 6. |
| AT3G17250 | Protein phosphatase 2C family protein. |
| AT3G17340 | Ran effector. |
| AT3G17420 | Serine/threonine protein kinase-like protein expressed in etiolated cotyledons and found in glyoxysomes. |
| AT3G17430 | Nucleotide/sugar transporter family protein |
| AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
| AT3G17640 | Leucine-rich repeat (LRR) family protein. |
| AT3G17650 | Arabidopsis thaliana metal-nicotianamine transporter YSL5 |
| AT3G17680 | Kinase interacting (KIP1-like) family protein. |
| AT3G17690 | member of Cyclic nucleotide gated channel family |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium |
| AT3G17830 | Molecular chaperone Hsp40/DnaJ family protein. |
| AT3G17860 | JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. |
| AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
| AT3G18050 | GPI-anchored protein. |
| AT3G18060 | transducin family protein / WD-40 repeat family protein. |
| AT3G18080 | B-S glucosidase 44. |
| AT3G18165 | Encodes MOS4 (Modifier of snc1, 4), a nuclear protein homologous to human Breast Cancer-Amplified Sequence (BCAS2). MOS4 interacts with AtCDC5 and PRL1. All three proteins are essential for plant innate immunity. |
| AT3G18170 | Glycosyltransferase family 61 protein. |
| AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. |
| AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
| AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
| AT3G18560 | hypothetical protein. |
| AT3G18610 | Encodes ATNUC-L2 (NUCLEOLIN LIKE 2). |
| AT3G18620 | DHHC-type zinc finger family protein. |
| AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G18777 | pseudogene of RING/U-box superfamily protein. |
| AT3G18779 | unknown protein |
| AT3G18780 | Encodes an actin that is constitutively expressed in vegetative structures but not pollen. ACT2 is involved in tip growth of root hairs. |
| AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT3G18940 | clast3-like protein. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein. |
| AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT3G19025 | pseudogene of alpha/beta-Hydrolases superfamily protein. |
| AT3G19030 | transcription initiation factor TFIID subunit 1b-like protein. |
| AT3G19035 | transmembrane protein. |
| AT3G19040 | Encodes a protein similar to TATA-binding protein-associated factor TAF1 (a.k.a. TAFII250) with histone acetyltransferase activity. It is required in integrating light signals to regulate gene expression and growth. |
| AT3G19100 | Encodes a protein kinase that positively regulates gibberellic acid (GA) signaling by inactivating the E3 ubiquitin ligase GARU. GARU mediates ubiquitin-dependent degradation of GID1s, which are GA receptors. |
| AT3G19190 | Encodes autophagy-related 2 (ATG2). |
| AT3G19200 | hypothetical protein. |
| AT3G19290 | bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediates ABA-dependent stress responses.ABF4 acts through SnRK2 pathway and binds to ABA response elements of the promoters of NYE1 and regulates their expression to promote chlorophyll degradation. |
| AT3G19390 | Granulin repeat cysteine protease family protein. |
| AT3G19400 | Cysteine proteinases superfamily protein. |
| AT3G19450 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT3G19530 | hypothetical protein. |
| AT3G19553 | Encodes POLYAMINE UPTAKE TRANSPORTER 5, an amino acid permease family protein. |
| AT3G19560 | F-box family protein. |
| AT3G19570 | Encodes SCO3 (snowy cotyledon3), a member of a largely uncharacterized protein family unique to the plant kingdom. The sco3-1 mutation alters chloroplast morphology and development, reduces chlorophyll accumulation, impairs thylakoid formation and photosynthesis in seedlings, and results in photoinhibition under extreme CO(2) concentrations in mature leaves. SCO3 is targeted to the periphery of peroxisomes. Together with QWRF2 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT3G19680 | hypothetical protein (DUF1005). |
| AT3G19690 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein. |
| AT3G19710 | Encodes a methionine-oxo-acid transaminase. Involved in the methionine chain elongation pathway that leads to the ultimate biosynthesis of methionine-derived glucosinolates. |
| AT3G19720 | Encodes a novel chloroplast division protein. Mutants of exhibit defects in chloroplast constriction, have enlarged, dumbbell-shaped chloroplasts. The ARC5 gene product shares similarity with the dynamin family of GTPases, which mediate endocytosis, mitochondrial division, and other organellar fission and fusion events in eukaryotes. Phylogenetic analysis showed that ARC5 is related to a group of dynamin-like proteins unique to plants. A GFP-ARC5 fusion protein localizes to a ring at the chloroplast division site. Chloroplast import and protease protection assays indicate that the ARC5 ring is positioned on the outer surface of the chloroplast. Facilitates separation of the two daughter chloroplasts. |
| AT3G19790 | hypothetical protein. |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
| AT3G19840 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
| AT3G19960 | member of Myosin-like proteins |
| AT3G19970 | alpha/beta-Hydrolases superfamily protein. |
| AT3G20130 | Encodes a member of the CYP705A family of cytochrome P450 enzymes. Mutants show altered gravitropic responses. |
| AT3G20310 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. |
| AT3G20320 | Encodes a permease-like component of an ABC transporter involved in lipid transfer from ER to chloroplast. |
| AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT3G20350 | actin cytoskeleton-regulatory complex pan-like protein. |
| AT3G20370 | TRAF-like family protein. |
| AT3G20390 | Encodes a plastidial RidA (Reactive Intermediate Deaminase A) homolog that hydrolyzes the enamines/imines formed by Thr dehydratase from Ser or Thr. RidA accelerates the deamination of reactive enamine/imine intermediates produced by threonine dehydratase (At3g10050) with threonine or serine as substrates. In the absence of RidA, the serine-derived imine inactivates BCAT3 (At3g49680). RidA thus pre-empts damage to BCAT3 by hydrolyzing the reactive imine before it does damage. |
| AT3G20395 | RING/U-box superfamily protein. |
| AT3G20410 | calmodulin-domain protein kinase CDPK isoform 9 (CPK9) |
| AT3G20500 | purple acid phosphatase 18. |
| AT3G20660 | organic cation/carnitine transporter4. |
| AT3G20770 | Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. EIN3 interacts with MYC2, MYC3 and MYC4 to inhibit jasmonate-induced expression of wound-responsive genes and herbivory-inducible genes, and plant defense against generalist herbivores. |
| AT3G20780 | Encodes putative eukaryotic homolog of archaebacterial topoisomerase VI subunit B, TOP6B. Is essential for endoreduplication and is involved in cell expansion and cell proliferation. The hlq (harlequin) dwarf mutant has fewer root hair and leaf trichome. It has abnormal epidermal cell and accumulates callose. |
| AT3G20820 | Leucine-rich repeat (LRR) family protein. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein. |
| AT3G20930 | Encodes a unique protein that is both a member of the RIP (RNA-editing interacting protein) family and the RNA recognition motif (RRM)-containing family. It controls the editing extent of 62% of the plastid Cs targeted for editing in Arabidopsis. |
| AT3G20935 | cytochrome P450, family 705, subfamily A, polypeptide 28. |
| AT3G20940 | a member of A-type cytochrome P450 |
| AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
| AT3G21100 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT3G21215 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT3G21220 | Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggesting a role for both proteins in mediating floral organ abscission.MKK5 is part of a positive feedback loop that regulates HAE expression in floral receptacles. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
| AT3G21270 | Encodes Dof zinc finger protein adof2. |
| AT3G21320 | EARLY FLOWERING protein. |
| AT3G21330 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT3G21510 | Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT3G21680 | hypothetical protein. |
| AT3G21690 | MATE efflux family protein. |
| AT3G21700 | Monomeric G protein. Expressed in root epidermal cells that are destined to become atrichoblasts. Also expressed during pollen development and in the pollen tube tip. |
| AT3G21720 | Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL) involved in salt tolerance. |
| AT3G21770 | Peroxidase superfamily protein. |
| AT3G21800 | UDP-glucosyl transferase 71B8. |
| AT3G21805 | snoRNA. |
| AT3G22070 | proline-rich family protein. |
| AT3G22072 | Natural antisense transcript overlaps with AT3G22070. |
| AT3G22104 | Phototropic-responsive NPH3 family protein. |
| AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
| AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G22250 | UDP-Glycosyltransferase superfamily protein. |
| AT3G22275 | Encodes a non-TIFY JAsmonate ZIM-domain (JAZ) protein with a Ser-rich C-terminal tail that is a site for phosphorylation that interacts with the bHLH transcription factor MYC2 and the co-repressor TOPLESS and acts as a repressor of JA signaling. JAZ13 is the 13th member of the JAZ family in Arabidopsis, and the only member not classified as a TIFY protein. |
| AT3G22290 | Endoplasmic reticulum vesicle transporter protein. |
| AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT3G22415 | hypothetical protein. |
| AT3G22550 | NAD(P)H-quinone oxidoreductase subunit, putative (DUF581). |
| AT3G22570 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT3G22740 | homocysteine S-methyltransferase (HMT3) |
| AT3G22750 | Protein kinase superfamily protein. |
| AT3G22830 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G22845 | emp24/gp25L/p24 family/GOLD family protein. |
| AT3G22850 | aluminum induced protein with YGL and LRDR motifs. |
| AT3G22890 | encodes ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of Arabidopsis. It may also participate in selenium metabolism. |
| AT3G22961 | Paired amphipathic helix (PAH2) superfamily protein. |
| AT3G22968 | unknown protein |
| AT3G22970 | hypothetical protein (DUF506). |
| AT3G22980 | Ribosomal protein S5/Elongation factor G/III/V family protein. |
| AT3G22990 | Armadillo-repeat containing protein. Involved in leaf and flower development. Located in nucleus. Broadly expressed throughout vegetative and floral tissues. LFR is functionally associated with AS2 to mediate leaf development. |
| AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT3G23040 | unknown protein |
| AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
| AT3G23085 | transposable_element_gene.;hAT-like transposase family (hobo/Ac/Tam3) |
| AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
| AT3G23180 | HR-like lesion-inducing protein-like protein. |
| AT3G23220 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G23240 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3. |
| AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
| AT3G23310 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein. |
| AT3G23320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein. |
| AT3G23330 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT3G23340 | Member of CKL gene family (CKL-C group). |
| AT3G23410 | Encodes a fatty alcohol oxidase. |
| AT3G23440 | embryo sac development arrest 6. |
| AT3G23480 | Cyclopropane-fatty-acyl-phospholipid synthase. |
| AT3G23490 | Encodes a cyanase that catalyzes the bicarbonate-dependent breakdown of cyanate to ammonia and bicarbonate. CYN forms a hexadecamer and is believed to be a cytosolic protein. Long-term exposure to NaCl increases CYN transcript levels. It is also expressed at higher levels in flowers relative to stems, roots, and seedlings. |
| AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase. |
| AT3G23550 | MATE efflux family protein. |
| AT3G23620 | BRIX domain containing protein, similar to RNA biogenesis factors in yeast. |
| AT3G23637 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
| AT3G23670 | Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT3G23727 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT3G23750 | Leucine-rich repeat protein kinase family protein. |
| AT3G23790 | AMP-dependent synthetase and ligase family protein. |
| AT3G23800 | selenium-binding protein 3. |
| AT3G23810 | S-adenosyl-l-homocysteine (SAH) hydrolase 2. |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT3G23880 | F-box and associated interaction domains-containing protein. |
| AT3G23910 | reverse transcriptase-like protein. |
| AT3G23920 | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.Activity of BAM1 increases 4 days after osmotic stress. BAM1 has a higher temperature optimum than BAM3 (PMID:25293962). |
| AT3G23980 | Encodes a protein that interacts with the Polycomb-group (Pc-G) histone methyltransferase CLF (CURLY LEAF). |
| AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G24060 | Plant self-incompatibility protein S1 family. |
| AT3G24090 | Encodes a glutamine-fructose-6-phosphate transaminase that likely plays a role in UDP-N-acetylglucosamine biosynthesis. |
| AT3G24093 | Paired amphipathic helix (PAH2) superfamily protein. |
| AT3G24120 | MYB-CC protein involved in regulation of response to phosphate starvation. |
| AT3G24140 | Encodes a basic helix-loop-helix transcription factor whose activity is required to promote differentiation of stomatal guard cells and to halt proliferative divisions in their immediate precursors. It fulfills its role through recruitment of the Arabidopsis Retinoblastoma homologue, RETINOBLASTOMA-RELATED (RBR). Both transcript and protein are expressed in and are required for halting divisions at the end of the stomatal lineage. It also has a role in the promotion of guard cell fate and in controlling the transition from guard mother cell to guard cell. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT3G24170 | Encodes a cytosolic glutathione reductase. |
| AT3G24180 | Beta-glucosidase, GBA2 type family protein. |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G24300 | Encodes a plasma membrane localized ammonium transporter. |
| AT3G24420 | DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism. |
| AT3G24480 | Leucine-rich repeat (LRR) family protein. |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. |
| AT3G24518 | Natural antisense transcript overlaps with AT3G24520. |
| AT3G24520 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G24542 | Beta-galactosidase related protein. |
| AT3G24550 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT3G24670 | Pectin lyase-like superfamily protein. |
| AT3G24715 | HCR1 belongs to the B4 group of Raf-like MAPKKKs. It corresponds to a root hydraulic pressure QTL between Col-0 and Bur-0 accessions and appears to contribute to variation in root pressure in different haplotypes. It is involved in potassium-dependent response to hypoxia. |
| AT3G24830 | Ribosomal protein L13 family protein. |
| AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT3G24927 | pseudogene of expressed protein. |
| AT3G25110 | Encodes a FatA acyl-ACP thioesterase |
| AT3G25250 | Arabidopsis protein kinase |
| AT3G25400 | dCTP pyrophosphatase-like protein. |
| AT3G25530 | Encodes gamma-hydroxybutyrate dehydrogenase (AtGHBDH). Contains a NADP-binding domain. GHBDH is proposed to function in oxidative stress tolerance. |
| AT3G25540 | Encodes a ceramide synthase that together with LOH3 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
| AT3G25573 | transmembrane protein. |
| AT3G25580 | Thioredoxin superfamily protein. |
| AT3G25585 | aminoalcoholphosphotransferase (AAPT2) |
| AT3G25597 | transmembrane protein. |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
| AT3G25655 | Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission. |
| AT3G25660 | Amidase family protein. |
| AT3G25690 | actin binding protein required for normal chloroplast positioning |
| AT3G25700 | Eukaryotic aspartyl protease family protein. |
| AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein. |
| AT3G25725 | transposable_element_gene.;copia-like retrotransposon family |
| AT3G25730 | ethylene response DNA binding factor 3. |
| AT3G25760 | encodes allene oxide cyclase. One of four genes in Arabidopsis that encode this enzyme, which catalyzes an essential step in jasmonic acid biosynthesis. Gene expression is induced during senescence, a process that involves jasmonic acid signalling pathway. |
| AT3G25770 | Encodes allene oxide cyclase. |
| AT3G25780 | Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis that encode this enzyme. mRNA expression is upregulated in senescing leaves. |
| AT3G25790 | Encodes a nuclear localized member of the GARP family of transcription factors. Along with AtNIGT1/HRS1 it is involved in nitrate and phosphate signaling in the root. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT3G25795 | Encodes a trans-acting siRNA that is phosphate starvation-upregulated and activated by PAP1 (MYB75). Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G25882 | encodes a kinase that physically interacts with NPR1/NIM1 |
| AT3G25900 | Homocysteine S-methyltransferase family protein. |
| AT3G25950 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein. |
| AT3G25960 | Pyruvate kinase family protein. |
| AT3G26000 | RIPF1 is an F-Box E3 ligase that interacts with the ABA receptor RCAR3 and appears to be responsible for facilitating its turnover. |
| AT3G26100 | Regulator of chromosome condensation (RCC1) family protein. |
| AT3G26170 | putative cytochrome P450 |
| AT3G26180 | putative cytochrome P450 |
| AT3G26330 | putative cytochrome P450 |
| AT3G26340 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein. |
| AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B |
| AT3G26420 | Zinc finger-containing glycine-rich RNA-binding protein. Cold-inducible. Contributes to the enhancement of freezing tolerance. Members of this protein family include AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b) and AT5G04280 (AtRZ-1c). |
| AT3G26430 | Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters. |
| AT3G26440 | transmembrane protein, putative (DUF707). |
| AT3G26445 | beta-1,4-N-acetylglucosaminyltransferase family protein. |
| AT3G26450 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT3G26460 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT3G26511 | unknown protein |
| AT3G26520 | gamma tonoplast intrinsic protein 2 (TIP2). expressed throughout the plant and transcript level is increased upon NaCl or ABA treatments. NaCl stress-sensitive yeast mutant strains exhibit more resistance to salt when expressing this protein. |
| AT3G26530 | transposable_element_gene.;similar to Ulp1 protease family protein |
| AT3G26539 | hypothetical protein. |
| AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G26670 | magnesium transporter, putative (DUF803). |
| AT3G26680 | involved in a SNM-dependent recombinational repair process of oxidatively induced DNA damage. |
| AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
| AT3G26810 | Auxin F box protein, the dominant auxin receptor in roots. |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. |
| AT3G27080 | Component of the TOM complex involved in transport of nuclear-encoded mitochondrial proteins |
| AT3G27170 | member of Anion channel protein family |
| AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). |
| AT3G27200 | Cupredoxin superfamily protein. |
| AT3G27210 | hypothetical protein. |
| AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G27260 | Kinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain |
| AT3G27350 | transcriptional regulator ATRX-like protein. |
| AT3G27360 | Histone superfamily protein. |
| AT3G27390 | transmembrane protein. |
| AT3G27415 | hypothetical protein. |
| AT3G27416 | transmembrane protein. |
| AT3G27420 | bromodomain testis-specific protein. |
| AT3G27520 | cryptic loci regulator. |
| AT3G27809 | hypothetical protein. |
| AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
| AT3G27820 | Encodes a peroxisome membrane-bound monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT3G27870 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein. |
| AT3G27880 | hypothetical protein (DUF1645). |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G27965 | transposable_element_gene.;copia-like retrotransposon family |
| AT3G28050 | nodulin MtN21-like transporter family protein |
| AT3G28130 | nodulin MtN21-like transporter family protein |
| AT3G28180 | encodes a gene similar to cellulose synthase |
| AT3G28193 | transmembrane protein. |
| AT3G28210 | Encodes a putative zinc finger protein (PMZ). |
| AT3G28295 | transposable_element_gene.;gypsy-like retrotransposon family |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT3G28920 | homeobox protein 34. |
| AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
| AT3G28940 | AIG2-like (avirulence induced gene) family protein. |
| AT3G29140 | hypothetical protein. |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT3G29252 | pseudogene of short-chain dehydrogenase/reductase (SDR) family |
| AT3G29255 | Putative pentacyclic triterpene synthase 7. |
| AT3G29370 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT3G29575 | ABI five binding protein 3. |
| AT3G29577 | transposable_element_gene.;gypsy-like retrotransposon family |
| AT3G29639 | hypothetical protein. |
| AT3G29647 | transposable_element_gene.;pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT3G30170 | transposable_element_gene.;Mutator-like transposase family |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. |
| AT3G30380 | alpha/beta-Hydrolases superfamily protein. |
| AT3G30730 | hypothetical protein. |
| AT3G30733 | pseudogene of RING/U-box superfamily protein. |
| AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
| AT3G32040 | Chloroplast localized GFDP synthase. |
| AT3G32047 | Cytochrome P450 superfamily protein. |
| AT3G32980 | Peroxidase superfamily protein. |
| AT3G42160 | Pectin lyase-like superfamily protein. |
| AT3G42170 | transposase-like gene with conserved domains from the family of hAT transposases that includes hobo from Drosophila melanogaster, Activator (Ac) from maize, and Tam3 from snapdragon but lacks several amino acids known to be essential for Ac transposition5. The DAYSLEEPER gene lacks 8 bp duplications and TIRs (a common feature of transcriptionally silent hAT transposases), however, DAYSLEEPER expression was detected, and several expressed sequence tags are available. The expression seems to be under the control of factors determining the circadian rhythm. DAYSLEEPER was isolated as a factor binding to a motif (Kubox1) present in the upstream region of the Arabidopsis DNA repair gene Ku70. Mutant plants lacking DAYSLEEPER or strongly overexpressing this gene do not develop in a normal manner. |
| AT3G43110 | transmembrane protein. |
| AT3G43270 | Plant invertase/pectin methylesterase inhibitor superfamily. |
| AT3G43431 | unknown protein |
| AT3G43720 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT3G43800 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT3G43890 | Cysteine/Histidine-rich C1 domain family protein. |
| AT3G43980 | Ribosomal protein S14p/S29e family protein. |
| AT3G43990 | Bromo-adjacent homology (BAH) domain-containing protein. |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein. |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1 |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. |
| AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
| AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
| AT3G44460 | basic leucine zipper transcription factor (BZIP67), identical to basic leucine zipper transcription factor GI:18656053 from (Arabidopsis thaliana); identical to cDNA basic leucine zipper transcription factor (atbzip67 gene) GI:18656052. Located in the nucleus and expressed during seed maturation in the cotyledons. |
| AT3G44560 | fatty acid reductase 8. |
| AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. |
| AT3G44705 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT3G44710 | transmembrane protein, putative (DUF247). |
| AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. |
| AT3G44798 | other_RNA. |
| AT3G44860 | Encodes a farnesoic acid carboxyl-O-methyltransferase. |
| AT3G44870 | Encodes a protein with 93% identity to a farnesoic acid methyl transferase. SABATH family methyltransferase. |
| AT3G44880 | Encodes a pheide a oxygenase (PAO). |
| AT3G45040 | Encodes a putative dolichol kinase that is localized to the endoplasmic reticulum and involved in pollen tube reception in the female gametophyte. |
| AT3G45050 | transmembrane protein. |
| AT3G45080 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. |
| AT3G45210 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584). |
| AT3G45310 | Cysteine proteinases superfamily protein. |
| AT3G45420 | Concanavalin A-like lectin protein kinase family protein. |
| AT3G45430 | Extracellular ATP transmembrane receptor involved in innate immunity. |
| AT3G45530 | Cysteine/Histidine-rich C1 domain family protein. |
| AT3G45600 | Member of TETRASPANIN family |
| AT3G45638 | other_RNA. |
| AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. |
| AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
| AT3G45660 | Encodes a member of the NAXT NPF subfamily. |
| AT3G45690 | Encodes a member of the NAXT NPF subfamily. |
| AT3G45700 | NPF2.4 is a member of the NAXT NPF subfamily. It encodes a plasmamembrane localized chloride transporter that is expressed in the root and is down regulated in response to ABA and salt treatment. NPF2.3 miRNA induced knockdowns have less Cl in the shoots when grown on low NaCl concentrations. |
| AT3G45710 | Encodes a chloride permeable transporter. Modulates chloride efflux from roots. |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT3G46170 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT3G46180 | UDP-galactose transporter 5. |
| AT3G46230 | Member of the class I small heat-shock protein (sHSP) family, which accounts for the majority of sHSPs in maturing seeds.Induced by heat, cold, salt, drought and high-light. |
| AT3G46280 | kinase-like protein. |
| AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT3G46490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT3G46540 | ENTH/VHS family protein. |
| AT3G46550 | Isolated in a screen for salt hypersensitive mutants. Mutants have thinner cell walls, abnormal siliques and root growth is inhibited under salt stress. The gene has similarity to arabinogalactan proteins and domains associated with cell adhesion.SOS5 is required for normal mucilage adherence to seeds. |
| AT3G46560 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM10, AtTIM9 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
| AT3G46610 | Chloroplast-localized PPR protein required for the translation of the psbJ and psbN open reading frames. TPJ(2019) shows that LPE1 is not required for psbA translation, in contrast to previous results (PNAS 2018). |
| AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT3G46630 | DCL protein (DUF3223). |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein. |
| AT3G46920 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein. |
| AT3G46930 | Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses. |
| AT3G47000 | Glycosyl hydrolase family protein. |
| AT3G47010 | Glycosyl hydrolase family protein. |
| AT3G47020 | E3 ubiquitin ligase involved in SGS3 degradation leading to inhibited biosynthesis of tasiRNA. The heat-induced activation of SGIP1 is inherited in the progeny. |
| AT3G47080 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
| AT3G47240 | transposable_element_gene.;similar to unknown protein |
| AT3G47340 | encodes a glutamine-dependent asparagine synthetase, the predicted ASN1 peptide contains a purF-type glutamine-binding domain, and is expressed predominantly in shoot tissues, where light has a negative effect on its mRNA accumulation. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G47341 | transmembrane protein. |
| AT3G47420 | Encodes a Pi starvation-responsive protein AtPS3. A member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT3G47500 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT3G47510 | transmembrane protein. |
| AT3G47560 | alpha/beta-Hydrolases superfamily protein. |
| AT3G47570 | Leucine-rich repeat protein kinase family protein. |
| AT3G47610 | transcription regulator/ zinc ion binding protein. |
| AT3G47620 | Encodes a transcription factor AtTCP14 that regulates seed germination. AtTCP14 shows elevated expression level just prior to germination. AtTCP14 is predominantly expressed in the vascular tissue of the embryo, and affects gene expression in radicles in a non-cell-autonomous manner. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
| AT3G47630 | translocator assembly/maintenance protein. |
| AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
| AT3G47750 | member of ATH subfamily |
| AT3G47800 | Galactose mutarotase-like superfamily protein. |
| AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G47830 | DNA glycosylase superfamily protein. |
| AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT3G47965 | hypothetical protein. |
| AT3G47980 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT3G48050 | Encodes a large protein with N-terminal bromo-adjacent homology (BAH) and transcription elongation factor S-II (TFS2N) domains and two C-terminal GW (glycine and tryptophan) repeats. It is nuclear and colocalizes with the processing-body component DCP1 in the cytoplasm. SOU is a component of the miRNA pathway and is involved in translational repression. |
| AT3G48070 | RING/U-box superfamily protein. |
| AT3G48100 | Encodes a transcription repressor that mediates a negative feedback loop in cytokinin signalling. ARR5 expression is upregulated by Class I KNOX genes. Arr5 protein is stabilized by cytokinin in a two-component phosphorelay. |
| AT3G48275 | pre-tRNA tRNA-Thr (anticodon: TGT). |
| AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
| AT3G48350 | Involved in starvation-related responses that curtail primary root growth under severe nutrient limitation. |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. |
| AT3G48380 | Peptidase C78, ubiquitin fold modifier-specific peptidase 1/ 2. |
| AT3G48390 | MA3 domain-containing protein. |
| AT3G48430 | Relative of Early Flowering 6 (REF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a positive regulator of flowering in an FLC-dependent pathway. REF6 mutants have hyperacetylation of histone H4 at the FLC locus. REF6 interacts with BES1 in a Y2H assay and in vitro. REF6 may play a role in brassinoteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. It is most closely related to the JHDM3 subfamily of JmjN/C proteins. |
| AT3G48440 | Zinc finger C-x8-C-x5-C-x3-H type family protein. |
| AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein. |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1. |
| AT3G48560 | Catalyzes the formation of acetolactate from pyruvate, the first step in valine and isoleucine biosynthesis. Requires FAD, thiamine pyrophosphate and Mg. Inhibited by the sulphonylurea herbicide, chlorsulphuron, and the imidazolinone herbicide, imazapyr. The obtained crystal structure of acetohydroxyacid synthase AHAS, EC 2.2.1.6)in complex with herbicides of the sulphonylurea and imidazolinone family reveals the molecular basis for substrate/inhibitor binding. |
| AT3G48570 | secE/sec61-gamma protein transport protein. |
| AT3G48580 | xyloglucan endotransglucosylase/hydrolase 11. |
| AT3G48600 | SWIB complex BAF60b domain-containing protein. |
| AT3G48610 | Non-specific phospholipase C6 involved in gametophyte development. |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. |
| AT3G48790 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein. |
| AT3G48880 | Encodes an F-box protein, SNIPER4, that regulates the turnover of MUSE13 and MUSE14, redundant TRAF proteins serving as adaptors in the SCFCRP1 complex to facilitate the turnover of nucleotide-binding domain and leucine-rich repeats (NLR) immune receptors. |
| AT3G48890 | putative progesterone-binding protein homolog (Atmp2) mRNA, |
| AT3G48920 | Member of the R2R3 factor gene family. |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821). |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G49210 | WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily. |
| AT3G49230 | transmembrane protein. |
| AT3G49270 | extensin-like protein. |
| AT3G49350 | Ypt/Rab-GAP domain of gyp1p superfamily protein. |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G49550 | hypothetical protein. |
| AT3G49570 | response to low sulfur 3. |
| AT3G49620 | encodes a protein similar to 2-oxoacid-dependent dioxygenase. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT3G49670 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. |
| AT3G49680 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
| AT3G49710 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT3G49760 | basic leucine-zipper 5. |
| AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
| AT3G49790 | Carbohydrate-binding protein. |
| AT3G49810 | Encodes a protein with E3 ubiquitin ligase activity that is involved in negative regulation of salt stress tolerance during germination. |
| AT3G49820 | hypothetical protein. |
| AT3G49840 | Encodes an orthlog of the Xenopus inner nuclear membrane (INM) protein Nemp1/TMEM194A. |
| AT3G49845 | cysteine-rich TM module stress tolerance protein. |
| AT3G49870 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein. |
| AT3G49940 | LOB domain-containing protein 38. |
| AT3G49970 | Phototropic-responsive NPH3 family protein. |
| AT3G49980 | F-box and associated interaction domains-containing protein. |
| AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
| AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
| AT3G50120 | transmembrane protein, putative (DUF247). |
| AT3G50130 | transmembrane protein, putative (DUF247). |
| AT3G50220 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT3G50240 | Encodes a kinesin-related protein. |
| AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT3G50270 | HXXXD-type acyl-transferase family protein. |
| AT3G50280 | HXXXD-type acyl-transferase family protein. |
| AT3G50290 | HXXXD-type acyl-transferase family protein. |
| AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
| AT3G50337 | unknown protein |
| AT3G50340 | hypothetical protein. |
| AT3G50410 | Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an important roles in plant growth and development. |
| AT3G50420 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT3G50430 | golgin. |
| AT3G50450 | Homolog of RPW8 |
| AT3G50630 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Gene was isolated from a yeast two hybrid screen as an interacting protein of CDC2A. Recombinant protein has a strong kinase inhibitor activity in vitro. Transcript is expressed in all tissues examined but is differentially distributed from ICK1. Controls the onset of the endoreduplication cycle through inhibition of CDKA;1. The KRP2 protein abundance is regulated by proteolysis through CDKB1;1 phosphorylation. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC). |
| AT3G50670 | Encodes U1 snRNP 70K |
| AT3G50695 | unknown protein |
| AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. |
| AT3G50750 | BES1/BZR1 homolog 1. |
| AT3G50764 | unknown protein |
| AT3G50780 | BTB/POZ domain protein. |
| AT3G50790 | esterase/lipase/thioesterase family protein. |
| AT3G50800 | PADRE protein. |
| AT3G50810 | Uncharacterized protein family (UPF0497). |
| AT3G50830 | cold acclimation protein WCOR413-like protein beta form. Transcript is not detectable. |
| AT3G50840 | Phototropic-responsive NPH3 family protein. |
| AT3G50850 | Putative methyltransferase family protein. |
| AT3G50890 | homeobox protein 28. |
| AT3G50895 | pre-tRNA tRNA-Asn (anticodon: GTT). |
| AT3G50900 | hypothetical protein. |
| AT3G50910 | netrin receptor DCC. |
| AT3G50925 | Encodes a defensin-like (DEFL) family protein. |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. |
| AT3G50940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT3G51090 | coiled-coil 90B-like protein (DUF1640). |
| AT3G51100 | altered inheritance of mitochondria protein. |
| AT3G51238 | Natural antisense transcript overlaps with AT3G51240. |
| AT3G51240 | Encodes flavanone 3-hydroxylase that is coordinately expressed with chalcone synthase and chalcone isomerases and is involved in flavonoid biosynthesis. Not responsive to auxin or ethylene stimulus (qRT-PCR). |
| AT3G51350 | Eukaryotic aspartyl protease family protein. |
| AT3G51360 | Eukaryotic aspartyl protease family protein. |
| AT3G51370 | Protein phosphatase 2C family protein. |
| AT3G51410 | hypothetical protein (DUF241). |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein. |
| AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein. |
| AT3G51530 | F-box/RNI-like/FBD-like domains-containing protein. |
| AT3G51540 | mucin-5AC-like protein. |
| AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
| AT3G51660 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
| AT3G51770 | Encodes a negative regulator of 1-aminocyclopropane-1-carboxylic acid synthase5(ACS5), which catalyze the rate-limiting step in ethylene biosynthesis. ETO1 directly interacts with ACS5 and inhibits its enzyme activity and targets it for degradation via proteasome-dependent pathway. It also interacts with CUL3 (a component of ubiquitin ligase complexes). eto1 (and eto3) mutations elevate ethylene biosynthesis by affecting the posttranscriptional regulation of ACS |
| AT3G51780 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. |
| AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
| AT3G51840 | Encodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis. |
| AT3G51860 | cation exchanger 3. |
| AT3G51880 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. In interphase cells, HMGB1 is found throughout the nucleus, whereas in mitotic cells it is not chromatin-associated. |
| AT3G51890 | Clathrin light chain protein. |
| AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
| AT3G51940 | oxidoreductase/transition metal ion-binding protein. |
| AT3G51950 | Contains single CCCH domain. |
| AT3G51960 | bZIP transcription factor induced by salt stress and promoted salt tolerance. |
| AT3G51970 | acyl-CoA sterol acyl transferase 1. |
| AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
| AT3G52070 | RNA/RNP complex-1-interacting phosphatase. |
| AT3G52072 | Natural antisense transcript overlaps with AT3G52070. |
| AT3G52100 | RING/FYVE/PHD zinc finger-containing protein. Part of emdomembrane trafficking system. |
| AT3G52105 | DIS3-exonuclease-like protein. |
| AT3G52110 | interferon-activable protein. |
| AT3G52115 | Induced in response to ionizing radiation, shows basal expression in mitotically active cells and high expression in endoreduplicating cells. May be involved in DNA damage-induced growth arrest. Protein sequence contains a PEST destruction box. |
| AT3G52220 | leukocyte immunoglobulin-like receptor family A protein. |
| AT3G52230 | hypothetical protein. |
| AT3G52290 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G52360 | transmembrane protein. |
| AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G52380 | Encodes a chloroplast RNA-binding protein that stabilizes chloroplast RNAs as evidenced by analyses of transcript accumulation in null mutants. Essential for seedling development (albino, strongly retarded growth even on sucrose-containing medium). |
| AT3G52400 | syntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway |
| AT3G52430 | Encodes a lipase-like gene that is important for salicylic acid signaling and function in resistance (R) gene-mediated and basal plant disease resistance. PAD4 can interact directly with EDS1, another disease resistance signaling protein. Expressed at elevated level in response to green peach aphid (GPA) feeding, and modulates the GPA feeding-induced leaf senescence through a mechanism that doesn't require camalexin synthesis and salicylic acid (SA) signaling. Required for the ssi2-dependent heightened resistance to GPA. |
| AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G52460 | hydroxyproline-rich glycoprotein family protein. |
| AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family. |
| AT3G52500 | Eukaryotic aspartyl protease family protein. |
| AT3G52510 | F-box associated ubiquitination effector family protein. |
| AT3G52535 | Natural antisense transcript overlaps with AT3G52540. |
| AT3G52540 | ovate family protein 18. |
| AT3G52660 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT3G52670 | FBD. |
| AT3G52790 | peptidoglycan-binding LysM domain-containing protein. |
| AT3G52800 | A20/AN1-like zinc finger family protein. |
| AT3G52810 | purple acid phosphatase 21. |
| AT3G52830 | ankyrin repeat protein. |
| AT3G52840 | beta-galactosidase 2. |
| AT3G52850 | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). |
| AT3G52870 | IQ calmodulin-binding motif family protein. |
| AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT3G52910 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower. |
| AT3G52960 | Thioredoxin superfamily protein. |
| AT3G52970 | member of CYP76G |
| AT3G53150 | UDP-glucosyl transferase 73D1. |
| AT3G53160 | UGT73C7 is induced by pathogen infection. |
| AT3G53170 | LOW protein: PPR containing protein. |
| AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
| AT3G53190 | Pectin lyase-like superfamily protein. |
| AT3G53200 | Member of the R2R3 factor gene family. |
| AT3G53240 | receptor like protein 45. |
| AT3G53250 | SAUR-like auxin-responsive protein family. |
| AT3G53260 | Encodes phenylalanine lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT3G53350 | Encodes RIP3 (ROP interactive partner 3), a microtubule-binding protein that is anchored to the plasma membrane domains and promotes local microtubule disassembly, forming as specific pattern of secondary walls in xylem vessel cells. Localized at microtubules and interacts with the plant-specific kinesin AtKinesin-13A. |
| AT3G53370 | S1FA-like DNA-binding protein. |
| AT3G53380 | Concanavalin A-like lectin protein kinase family protein. |
| AT3G53420 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev. When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT3G53480 | Negative regulator of auxin polar transport inhibitors. |
| AT3G53520 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. |
| AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
| AT3G53720 | member of Putative Na+/H+ antiporter family. |
| AT3G53790 | Arabidopsis thaliana telomere-binding protein, putative (At3g53790) |
| AT3G53800 | Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). |
| AT3G53810 | Concanavalin A-like lectin protein kinase family protein. |
| AT3G53830 | Regulator of chromosome condensation (RCC1) family protein. |
| AT3G53920 | Encodes a sigma-like transcription factor, Sigma 3 (SIG3 or SIGC). As a subunit of chloroplast RNA polymerase, SIG3 confers the ability to recognize promoter sequences on the core enzyme. SIG3 transcribes specifically the psbN gene in plastids. |
| AT3G53980 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT3G53990 | Encodes universal stress protein (USP). Functions as a molecular chaperone under heat shock and oxidative stress conditions. Chaperone activity and assembly into complexes is redox regulated. |
| AT3G54000 | TIP41-like protein. |
| AT3G54020 | Inositol phosphorylceramide synthase |
| AT3G54030 | kinase with tetratricopeptide repeat domain-containing protein. |
| AT3G54100 | O-fucosyltransferase family protein. |
| AT3G54110 | Member of Uncoupling protein PUMP2 family. Encodes a mitochondrial uncoupling protein AtUCP1 involved in maintain the redox poise of the mitochondrial electron transport chain to facilitate photosynthetic metabolism. Disruption of UCP1 results in a photosynthetic phenotype. Specifically there is a restriction in photorespiration with a decrease in the rate of oxidation of photorespiratory glycine in the mitochondrion. This change leads to an associated reduced photosynthetic carbon assimilation rate. |
| AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family. |
| AT3G54210 | Ribosomal protein L17 family protein. |
| AT3G54400 | Eukaryotic aspartyl protease family protein. |
| AT3G54460 | SNF2 domain-containing protein / helicase domain-containing protein / F-box family protein. |
| AT3G54500 | Member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK2 along with LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex. Functions as a transcriptional coactivator. |
| AT3G54600 | Class I glutamine amidotransferase-like superfamily protein. |
| AT3G54640 | Catalyzes the conversion of indole-3-glycerolphosphate to indole, the penultimate reaction in the biosynthesis of tryptophan. Functions as a heterocomplex with tryptophan synthase beta subunit (TSA2). |
| AT3G54650 | F- box protein involved in regulation of cell cycle genes. |
| AT3G54660 | Encodes glutathione reductase that is most likely localized in the chloroplast. Flavoenzyme-encoding gene. |
| AT3G54680 | proteophosphoglycan-like protein. |
| AT3G54690 | Sugar isomerase (SIS) family protein. |
| AT3G54740 | zein-binding protein (Protein of unknown function, DUF593). |
| AT3G54760 | RRM1 interacts with SUVH9 and FVE and has an auxiliary role in RNA-directed DNA methylation. |
| AT3G54770 | Encodes a putative RNA binding protein that is localized in the nucleus and affects ABA-regulated seed germination of Arabidopsis. |
| AT3G54804 | unknown protein |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. |
| AT3G54823 | transposable_element_gene.;gypsy-like retrotransposon family |
| AT3G54826 | Zim17-type zinc finger protein. |
| AT3G54880 | zinc finger protein. |
| AT3G54920 | Powdery mildew resistant mutant encodes a pectate lyase-like protein |
| AT3G54925 | Plant self-incompatibility protein S1 family. |
| AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
| AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT3G54990 | Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
| AT3G55000 | Encodes a protein of unknown function that is involved in cortical microtubule organization. Mutants exhibit abnormal cell growth and patterns of division. TON1A can functionally complement TON1B and their roles appear to be redundant in plants. Encodes a novel protein that is similar to human FOP and OFD1 centrosomal proteins. Localizes to the preprophase band, cytoplasm and cell cortex where it is probably associated with the cortical cytoskeleton. TON1A associates with plant centrins CEN1 and CEN2. |
| AT3G55050 | Protein phosphatase 2C family protein. |
| AT3G55060 | CAP-gly domain linker. |
| AT3G55120 | Catalyzes the conversion of chalcones into flavanones. Required for the accumulation of purple anthocyanins in leaves and stems. Co-expressed with CHS. |
| AT3G55260 | Encodes a protein withhexosaminidase activity |
| AT3G55270 | Encodes MAP kinase phosphatase 1 (MKP1). Loss of MKP1 results in hypersensitivity to acute UV-B stress, but without impairing UV-B acclimation. |
| AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
| AT3G55290 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT3G55310 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
| AT3G55430 | O-Glycosyl hydrolases family 17 protein. |
| AT3G55440 | Encodes triosephosphate isomerase. |
| AT3G55450 | PBS1-like 1. |
| AT3G55560 | AT-hook protein of GA feedback 2. |
| AT3G55566 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G55573 | unknown protein |
| AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
| AT3G55630 | Encodes one of the three folylpolyglutamate synthetase isoforms (FPGSs): FPGS1 (At5g05980, plastidic), FPGS2 (At3g10160, mitochondrial) and FPGS3 (At3g55630, cytosolic). |
| AT3G55640 | Mitochondrial substrate carrier family protein. |
| AT3G55720 | replication factor C subunit, putative (DUF620). |
| AT3G55734 | Encodes a microRNA that targets several TIR1/AFB family members and one bHLH family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCAAAGGGAUCGCAUUGAUCC. Targets are: F-box proteins and bHLH transcription factor. Specifically cleaves AFB3 transcripts, controlling AFB3 mRNA accumulation in roots in response to nitrate exposure. |
| AT3G55735 | pre-tRNA tRNA-Met. |
| AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots. |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT3G55950 | CRINKLY4 related 3. |
| AT3G55960 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein. |
| AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT3G55980 | salt-inducible zinc finger 1. |
| AT3G56000 | encodes a gene similar to cellulose synthase |
| AT3G56050 | Protein kinase family protein. |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein. |
| AT3G56070 | rotamase cyclophilin 2 (ROC2) exhibiting peptidyl-prolyl cis-trans isomerase activity involved in signal transduction. |
| AT3G56200 | Encodes a putative amino acid transporter. |
| AT3G56240 | CCH protein belongs to a family of eukaryotic proteins that participate in intracellular copper homeostasis by delivering this metal to the secretory pathway; mainly located along the vascular bundles of senescing leaves and petioles as well as in stem sieve elements; hypothesized to have a role in copper mobilization from decaying organs towards reproductive structures, as a result of metalloprotein breakdown. The plant-specific C-terminal domain of the CCH protein forms amyloid-like fibrils in vitro. |
| AT3G56270 | WEB family protein (DUF827). |
| AT3G56275 | pseudogene of expressed protein. |
| AT3G56350 | Iron/manganese superoxide dismutase family protein. |
| AT3G56360 | hypothetical protein. |
| AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
| AT3G56408 | Natural antisense transcript overlaps with AT3G56410. |
| AT3G56410 | hypothetical protein (DUF3133). |
| AT3G56420 | Thioredoxin superfamily protein. |
| AT3G56570 | SET domain-containing protein. |
| AT3G56580 | Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis. |
| AT3G56590 | hydroxyproline-rich glycoprotein family protein. |
| AT3G56620 | nodulin MtN21-like transporter family protein |
| AT3G56720 | pre-mRNA-splicing factor. |
| AT3G56760 | Protein kinase superfamily protein. |
| AT3G56800 | encodes a calmodulin |
| AT3G56810 | hypothetical protein. |
| AT3G56920 | DHHC-type zinc finger family protein. |
| AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
| AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein. |
| AT3G57030 | Calcium-dependent phosphotriesterase superfamily protein. |
| AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
| AT3G57062 | transmembrane protein. |
| AT3G57070 | Glutaredoxin family protein. |
| AT3G57220 | Glycosyl transferase family 4 protein. |
| AT3G57230 | MADS-box transcription factor. |
| AT3G57260 | beta 1,3-glucanase |
| AT3G57320 | threonine-tRNA ligase 2. |
| AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. |
| AT3G57340 | DnaJ heat shock amino-terminal domain protein (DUF1977). |
| AT3G57400 | transmembrane protein. |
| AT3G57410 | Encodes a protein with high homology to animal villin. VLN3 is a Ca2+-regulated villin involved in actin filament bundling. |
| AT3G57420 | Regulates the assembly and trafficking of cellulose synthase complexes. |
| AT3G57450 | hypothetical protein. |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein. |
| AT3G57470 | Insulinase (Peptidase family M16) family protein. |
| AT3G57530 | Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. |
| AT3G57550 | guanylate kinase |
| AT3G57560 | encodes a N-acetylglutamate kinase, involved in arginine biosynthesis |
| AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
| AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT3G57880 | Required for maintenance of inflorescence and shoot SAMs and normal development of the derived vascular cambium, functions in the SAM to promote continuous organogenesis, affects SAM development through STM, where it affects intracellular localization of STM in SAM cells in the peripheral region and prevents STM localization toward the cell wall of SAM cells in the peripheral region. |
| AT3G57990 | Encodes a ?-barrel protein, named OEP40, locates in in the outer envelope of chloroplasts, and functions as a solute channel which is selectively permeable for glucose. |
| AT3G58030 | Encodes a RING domain E3 ligase. Has overlapping function with MUSE2 in the negative regulation of defence responses. SIKIC2 (and possibly SIKIC1 and 3) is ubiquination target. |
| AT3G58035 | pre-tRNA tRNA-Ser (anticodon: GCT). |
| AT3G58060 | TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.) |
| AT3G58120 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT3G58130 | N-acetylglucosaminylphosphatidylinositol de-N-acetylase family protein. |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT3G58640 | Mitogen activated protein kinase kinase kinase-like protein. |
| AT3G58700 | Ribosomal L5P family protein. |
| AT3G58710 | member of WRKY Transcription Factor; Group II-e |
| AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
| AT3G58790 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G58795 | Natural antisense transcript overlaps with AT3G58790. |
| AT3G58840 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR1. Involved in the morphogenesis and proliferation of peroxisomes and mitochondria. |
| AT3G58850 | Encodes PHYTOCHROME RAPIDLY REGULATED2 (PAR2), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR1 (At2g42870). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT3G58990 | Small subunit, which together with IPMI SSU1, IPMISSU2 and IPMI LSU1, is a member of heterodimeric isopropylmalate isomerase (IPMI). Together with IPMI SSU3 participates in the Met chain elongation pathway. |
| AT3G59020 | ARM repeat superfamily protein. |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT3G59052 | unknown protein |
| AT3G59060 | Encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. Involved in shade avoidance. Functions as negative regulator of PhyB. Protein levels are modulated by phytochrome B. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT3G59130 | Cysteine/Histidine-rich C1 domain family protein. |
| AT3G59140 | member of MRP subfamily |
| AT3G59150 | F-box/RNI superfamily protein. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT3G59340 | solute carrier family 35 protein (DUF914). |
| AT3G59360 | UDP-galactose transporter 6. |
| AT3G59440 | Encodes an endomembrane localized member of the CML subfamily VII. Contains a canonical CaM domain and unique N-terminal extension that distinguishes it from other members of the subfamily. |
| AT3G59620 | Mannose-binding lectin superfamily protein. |
| AT3G59650 | mitochondrial ribosomal protein L51/S25/CI-B8 family protein. |
| AT3G59690 | Member of IQ67 (CaM binding) domain containing family. |
| AT3G59710 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT3G59730 | Concanavalin A-like lectin protein kinase family protein. |
| AT3G59760 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization. |
| AT3G59765 | None. |
| AT3G59820 | LETM1-like protein. |
| AT3G59830 | Integrin-linked protein kinase family. |
| AT3G59900 | Encodes ARGOS (Auxin-Regulated Gene Involved in Organ Size). |
| AT3G59920 | RAB GDP DISSOCIATION INHIBITOR 2 |
| AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT3G59960 | histone-lysine N-methyltransferase ASHH4. |
| AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
| AT3G60070 | Major facilitator superfamily protein. |
| AT3G60075 | pre-tRNA tRNA-Ser (anticodon: GCT). |
| AT3G60080 | RING/U-box superfamily protein. |
| AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. |
| AT3G60110 | DNA-binding bromodomain-containing protein. |
| AT3G60120 | beta glucosidase 27. |
| AT3G60130 | beta glucosidase 16. |
| AT3G60170 | transposable_element_gene.;copia-like retrotransposon family |
| AT3G60200 | hypothetical protein. |
| AT3G60220 | Encodes a putative RING-H2 zinc finger protein ATL4 (ATL4). |
| AT3G60260 | ELMO/CED-12 family protein. |
| AT3G60286 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G60290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT3G60390 | Encodes homeobox protein HAT3. |
| AT3G60400 | Mitochondrial transcription termination factor family protein. |
| AT3G60450 | Phosphoglycerate mutase family protein. |
| AT3G60490 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein. |
| AT3G60520 | zinc ion-binding protein. |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G60550 | cyclin p3. |
| AT3G60640 | Autophagy protein. |
| AT3G60647 | unknown protein |
| AT3G60680 | DUF641 family protein (DUF641). |
| AT3G60690 | SAUR-like auxin-responsive protein family. |
| AT3G60720 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G60760 | hypothetical protein. |
| AT3G60957 | pseudogene of GPT |
| AT3G60960 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT3G61185 | Encodes a defensin-like (DEFL) family protein. |
| AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. |
| AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
| AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821). |
| AT3G61280 | O-glucosyltransferase rumi-like protein (DUF821). |
| AT3G61340 | F-box and associated interaction domains-containing protein. |
| AT3G61350 | Encodes an SKP1 interacting partner (SKIP4). |
| AT3G61390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G61400 | 1-aminocyclopropane-1-carboxylate oxidase-like protein |
| AT3G61410 | U-box kinase family protein. |
| AT3G61420 | BSD domain (BTF2-like transcription factors, Synapse-associated proteins and DOS2-like proteins). |
| AT3G61430 | a member of the plasma membrane intrinsic protein subfamily PIP1. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed ubiquitously and protein level decreases slightly during leaf development. |
| AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT3G61470 | Encodes a component of the light harvesting antenna complex of photosystem I. |
| AT3G61580 | Fatty acid/sphingolipid desaturase. |
| AT3G61590 | F-box protein that is involved in some aspect of regulation of gene silencing by miRNA. Loss of function mutations have increased levels of some miRNAs. Its activity depends on the presence of functional F-box. |
| AT3G61600 | POZ/BTB containing-protein AtPOB1. Involvement in protein ubiquitylation is predicted based on physical interaction with CULLIN 3 proteins. |
| AT3G61610 | Galactose mutarotase-like superfamily protein. |
| AT3G61620 | exonuclease RRP41 (RRP41) |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT3G61640 | arabinogalactan protein 20. |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT3G61690 | Putative TNAase |
| AT3G61750 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein. |
| AT3G61790 | SINAT E3 ubiquitin ligase involved in mediation of FREE1 and VPS23A degradation to modulate abscisic acid signaling. |
| AT3G61810 | Glycosyl hydrolase family 17 protein. |
| AT3G61820 | Eukaryotic aspartyl protease family protein. |
| AT3G61825 | pre-tRNA tRNA-Gln (anticodon: CTG). |
| AT3G61850 | Zinc finger transcription factor of the Dof family involved in the control of seed germination. |
| AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
| AT3G61920 | PADRE protein. |
| AT3G61930 | hypothetical protein. |
| AT3G61960 | autophagy gene |
| AT3G61970 | AP2/B3-like transcriptional factor family protein. |
| AT3G62000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT3G62010 | metal ion-binding protein. |
| AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT3G62100 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. |
| AT3G62120 | Encodes a cytosolic prolyl-tRNA synthetase. |
| AT3G62130 | Encodes an enzyme that decomposes L-cysteine into pyruvate, H2S, and NH3. |
| AT3G62160 | HXXXD-type acyl-transferase family protein. |
| AT3G62170 | VANGUARD-like protein. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT3G62270 | BOR2 is involved in efficient borate crosslinking of rhamnogalacturonan II in cell walls under boron limitation. |
| AT3G62390 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G62400 | cytochrome C oxidase subunit. |
| AT3G62420 | Encodes a group-S bZIP transcription factor. |
| AT3G62422 | unknown protein |
| AT3G62490 | transposable_element_gene.;similar to ASY2, DNA binding |
| AT3G62560 | Ras-related small GTP-binding family protein. |
| AT3G62580 | Late embryogenesis abundant protein (LEA) family protein. |
| AT3G62630 | stress response NST1-like protein (DUF1645). |
| AT3G62640 | DUF3511 domain protein (DUF3511). |
| AT3G62650 | hypothetical protein. |
| AT3G62660 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT3G62700 | member of MRP subfamily |
| AT3G62710 | Glycosyl hydrolase family protein. |
| AT3G62720 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. |
| AT3G62725 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT3G62988 | unknown protein |
| AT3G63006 | pre-tRNA tRNA-Ala (anticodon: TGC). |
| AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
| AT3G63020 | hypothetical protein (DUF3049). |
| AT3G63050 | hypothetical protein. |
| AT3G63052 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
| AT3G63070 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT3G63110 | Encodes cytokinin synthase involved in cytokinin biosynthesis. IPT3 subcellular localization is modulated by farnesylation- when farnesylated it is localized to the nucleus, otherwise to the chloroplast. |
| AT3G63180 | TIC-like protein. |
| AT3G63190 | The gene encodes a chloroplast ribosome recycling factor homologue. Analysis of mutants revealed its role in the chloroplast development and eary stages of embryo development. |
| AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
| AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT3G63500 | Encodes a PHD-finger protein that, with TTA2, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT3G63510 | FMN-linked oxidoreductases superfamily protein. |
| AT3G66652 | fip1 motif-containing protein. |
| AT4G00140 | Calcium-binding EF-hand family protein. |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G00305 | RING/U-box superfamily protein. |
| AT4G00310 | Putative membrane lipoprotein. |
| AT4G00335 | RING-H2 finger B1A. |
| AT4G00340 | Encodes a receptor-like protein kinase that is expressed in roots. |
| AT4G00400 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly and is functionally redundant with GPAT4. |
| AT4G00430 | a member of the plasma membrane intrinsic protein subfamily PIP1. involved redundantly with PIP1;1/2/3/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT4G00630 | Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. |
| AT4G00650 | Encodes a major determinant of natural variation in Arabidopsis flowering time. Dominant alleles of FRI confer a vernalization requirement causing plants to overwinter vegetatively. Many early flowering accessions carry loss-of-function fri alleles .Twenty distinct haplotypes that contain non-functional FRI alleles have been identified and the distribution analyzed in over 190 accessions. The common lab strains- Col and Ler each carry loss of function mutations in FRI. |
| AT4G00695 | Spc97/Spc98 family of spindle pole body (SBP) component. |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein. |
| AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). |
| AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
| AT4G00730 | Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of anthocyanin and in root development. Loss of function mutants have increased cell wall polysaccharide content. |
| AT4G00760 | Encodes a response-regulator like protein. |
| AT4G00770 | DUF4378 domain protein. |
| AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT4G00820 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G00830 | Encodes a heterogeneous nuclear ribonucleoprotein (hnRNP-Q) that is involved in the plant innate immune response and may function as a suppressor of cell-autonomous immunity. |
| AT4G00893 | F-box/kelch-repeat protein. |
| AT4G00895 | ATPase, F1 complex, OSCP/delta subunit protein. |
| AT4G00955 | wall-associated receptor kinase-like protein. |
| AT4G01023 | RING/U-box superfamily protein. |
| AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT4G01080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G01090 | Hypothetical protein; participates in wound-induced lateral root development. |
| AT4G01120 | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
| AT4G01130 | GDSL-motif esterase/acyltransferase/lipase. |
| AT4G01210 | glycosyl transferase family 1 protein. |
| AT4G01220 | Encodes MGP4 (MALE GAMETOPHYTE DEFECTIVE 4), a rhamnogalacturonan II xylosyltransferase important for growth of pollen tubes and roots. |
| AT4G01245 | hypothetical protein. |
| AT4G01250 | AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence. |
| AT4G01320 | CAAX protease with broad substrate specificity. Localized exclusively to the endoplasmic reticulum. |
| AT4G01328 | unknown protein |
| AT4G01330 | Protein kinase superfamily protein. |
| AT4G01400 | Pentatricopeptide Repeat Protein involved in splicing of nad4, nad 5, nad 1 and nad2 introns which affects biogenesis of the respiratory complex I. |
| AT4G01410 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family. |
| AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
| AT4G01520 | NAC domain containing protein 67. |
| AT4G01550 | Encodes a plasma-membrane bound NAC transcription factor, whose controlled proteolytic activation allows it to enter the nucleus. |
| AT4G01560 | Ribosomal RNA processing Brix domain protein. |
| AT4G01671 | transmembrane protein. |
| AT4G01680 | Encodes a putative transcription factor (MYB55). |
| AT4G01690 | Encodes protoporphyrinogen oxidase (PPOX). |
| AT4G01710 | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT4G01730 | DHHC-type zinc finger family protein. |
| AT4G01770 | Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT1 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. |
| AT4G01780 | XH/XS domain-containing protein. |
| AT4G01840 | Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
| AT4G01850 | S-adenosylmethionine synthetase 2. |
| AT4G01895 | systemic acquired resistance (SAR) regulator protein NIMIN-1-like protein. |
| AT4G01910 | Cysteine/Histidine-rich C1 domain family protein. |
| AT4G01915 | hypothetical protein. |
| AT4G01920 | Cysteine/Histidine-rich C1 domain family protein. |
| AT4G02090 | PADRE protein. |
| AT4G02100 | Heat shock protein DnaJ with tetratricopeptide repeat-containing protein. |
| AT4G02110 | transcription coactivator. |
| AT4G02120 | Cytidine triphosphate synthase. |
| AT4G02130 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G02180 | DC1 domain-containing protein. |
| AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
| AT4G02290 | glycosyl hydrolase 9B13. |
| AT4G02350 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT4G02360 | transmembrane protein, putative (Protein of unknown function, DUF538). |
| AT4G02380 | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
| AT4G02480 | AAA-type ATPase family protein. |
| AT4G02540 | Cysteine/Histidine-rich C1 domain family protein. |
| AT4G02600 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO1 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and in papillae, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT4G02630 | Protein kinase superfamily protein. |
| AT4G02640 | Encodes a basic leucine zipper (bZIP) transcription factor AtbZIP10. AtbZIP10 shuttles between the nucleus and the cytoplasm. It binds consensus G- and C-box DNA sequences. AtbZIP10 acts antagonistically with LSD1 in both pathogen-induced hypersensitive response and basal defense responses. |
| AT4G02930 | GTP binding Elongation factor Tu family protein. |
| AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
| AT4G03038 | other_RNA. |
| AT4G03039 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGUCCGGUUUUGGAUACGUG |
| AT4G03060 | Encodes a truncated and null function protein, due to a 5-bp deletion in cDNA. |
| AT4G03140 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT4G03280 | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. |
| AT4G03390 | STRUBBELIG-receptor family 3. |
| AT4G03420 | hypothetical protein (DUF789). |
| AT4G03430 | Encodes a nuclear protein similar to the human U5 small ribonucleoprotein-associated 102-kD protein and to the yeast pre-mRNA splicing factors Prp1p and Prp6p. STA1 expression is upregulated by cold stress, and the sta1-1 mutant is defective in the splicing of the cold-induced COR15A gene. Luciferase imaging was used to isolate a recessive mutant, sta1-1, with enhanced stability of the normally unstable luciferase transcript. This mutation also causes the stabilization of some endogenous gene transcripts and has a range of developmental and stress response phenotypes. |
| AT4G03510 | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity. |
| AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. |
| AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
| AT4G03820 | transmembrane protein, putative (DUF3537). |
| AT4G04210 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4) |
| AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
| AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
| AT4G04610 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT4G04690 | F-box and associated interaction domains-containing protein. |
| AT4G04692 | pseudogene of expressed protein. |
| AT4G04745 | hypothetical protein. |
| AT4G04810 | methionine sulfoxide reductase B4. |
| AT4G04820 | transposable_element_gene.;similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G24930.1);(source:TAIR10) |
| AT4G04830 | methionine sulfoxide reductase B5. |
| AT4G04840 | methionine sulfoxide reductase B6. |
| AT4G04850 | Encodes a potassium efflux antiporter; has three splice forms KEA3.1, KEA3.2, and KEA3.3, KEA3.2 is the most abundant splice form in all plant organs (silique, flower, leaf and root). KEA3.1 and KEA3.3 are minor variants that can be found in flowers and in leaves. KEA3 is localized to the thylakoid membrane and enriched in the stromal lamellae. It allows proton efflux from the thylakoid lumen by proton/potassium antiport. |
| AT4G04970 | encodes a gene similar to callose synthase |
| AT4G05010 | F-box family protein. |
| AT4G05018 | transmembrane protein. |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT4G05070 | Member of the wound-induced polypeptide (WIP) family. Positively regulates plant resistance against Pst DC3000 by enhancing PTI responses. |
| AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G05100 | Member of the R2R3 factor gene family. |
| AT4G05150 | Octicosapeptide/Phox/Bem1p family protein. |
| AT4G05180 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. |
| AT4G06534 | transmembrane protein. |
| AT4G06676 | etoposide-induced protein. |
| AT4G06744 | Leucine-rich repeat (LRR) family protein. |
| AT4G08038 | transposable_element_gene. |
| AT4G08170 | Inositol 1,3,4-trisphosphate 5/6-kinase family protein. |
| AT4G08620 | Encodes a high-af?nity sulfate transporter. Contains STAS domain. Expressed in roots and guard cells. Up-regulated by sulfur deficiency. |
| AT4G08850 | MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated. |
| AT4G08860 | transposable_element_gene.;similar to nucleic acid binding / ribonuclease H |
| AT4G08871 | transposable_element_gene.;CACTA-like transposase family (En/Spm) |
| AT4G08949 | unknown protein |
| AT4G09030 | Encodes arabinogalactan protein (AGP10). |
| AT4G09460 | Encodes myb6 DNA-binding protein. |
| AT4G09462 | Carbohydrate-binding X8 domain superfamily protein. |
| AT4G09500 | Glycosyltransferase which negatively regulates hypoxia stress response. |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT4G09560 | Protease-associated (PA) RING/U-box zinc finger family protein. |
| AT4G09890 | mediator of RNA polymerase II transcription subunit, putative (DUF3511). |
| AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
| AT4G10370 | Cysteine/Histidine-rich C1 domain family protein. |
| AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
| AT4G10390 | Protein kinase superfamily protein. |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT4G10610 | RNA-binding protein, putative. Member of a family of proteins having an PABC binding domain (PAM motif). |
| AT4G10613 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein. |
| AT4G10770 | oligopeptide transporter |
| AT4G10940 | unknown protein |
| AT4G10950 | GDSL-type esterase/lipase. Required for pollen development. |
| AT4G11010 | nucleoside diphosphate kinase 3 (ndpk3), located to the inter-membrane space in mitochondria |
| AT4G11020 | hypothetical protein. |
| AT4G11050 | glycosyl hydrolase 9C3. |
| AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G11190 | Disease resistance-responsive (dirigent-like protein) family protein. |
| AT4G11211 | hypothetical protein. |
| AT4G11220 | VIRB2-interacting protein 2. |
| AT4G11300 | ROH1, putative (DUF793). |
| AT4G11310 | cysteine proteinase precursor-like protein |
| AT4G11350 | transferring glycosyl group transferase (DUF604). |
| AT4G11550 | Cysteine/Histidine-rich C1 domain family protein. |
| AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
| AT4G11610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein. |
| AT4G11800 | Calcineurin-like metallo-phosphoesterase superfamily protein. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT4G12000 | SNARE associated Golgi protein family. |
| AT4G12050 | Putative AT-hook DNA-binding family protein. |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC). |
| AT4G12070 | hypothetical protein. |
| AT4G12080 | AT-hook motif nuclear-localized protein 1. |
| AT4G12110 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-2 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
| AT4G12115 | pre-tRNA tRNA-Lys (anticodon: CTT). |
| AT4G12120 | member of KEULE Gene Family |
| AT4G12130 | Encodes a mitochondrial COG0354 protein that requires folate for its function in Fe/S cluster biogenesis. |
| AT4G12250 | UDP-D-glucuronate 4-epimerase |
| AT4G12320 | member of CYP706A |
| AT4G12420 | Encodes a protein of unknown function involved in directed root tip growth. It is a member of 19-member gene family and is distantly related structurally to the multiple-copper oxidases ascorbate oxidase and laccase, though it lacks the copper-binding domains. The protein is glycosylated and GPI-anchored. It is localized to the plasma membrane and the cell wall. The gene is expressed most strongly in expanding tissues. |
| AT4G12423 | transposable_element_gene.;copia-like retrotransposon family |
| AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein. |
| AT4G12432 | unknown protein |
| AT4G12440 | adenine phosphoribosyl transferase 4. |
| AT4G12450 | zinc finger (C2H2 type) family protein. |
| AT4G12520 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT4G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT4G12550 | encodes a protein that is related to a large family of proteins that consist of a proline-rich or glycine-rich N-terminus and a hydrophobic, possibly membrane spanning C-terminus. |
| AT4G12570 | Knock-out mutants showed accelerated senescence of leaves. |
| AT4G12690 | DUF868 family protein (DUF868). |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT4G12735 | Encodes a peroxisomal protein. |
| AT4G12740 | HhH-GPD base excision DNA repair family protein. |
| AT4G12790 | GPN GTPase involved in selective nuclear import of RNA polymerase II. |
| AT4G13040 | Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation. |
| AT4G13050 | Acyl-ACP thioesterase. |
| AT4G13110 | BSD domain-containing protein. |
| AT4G13130 | Cysteine/Histidine-rich C1 domain family protein. |
| AT4G13160 | zein-binding protein (Protein of unknown function, DUF593). |
| AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
| AT4G13300 | Catalyzes the conversion of farnesyl diphosphate to (Z)-gamma-bisabolene and the additional minor products E-nerolidol and alpha-bisabolol. Expressed in cortex and sub-epidermal layers of roots, leaf hydathodes and flower stigmata. Induced by wounding. |
| AT4G13310 | putative cytochrome P450 |
| AT4G13330 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT4G13340 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT4G13360 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein. |
| AT4G13395 | ROTUNDIFOLIA like 12. |
| AT4G13430 | Encodes a methylthioalkylmalate isomerase involved in glucosinolate biosynthesis. |
| AT4G13520 | Encodes a small acid protein (SMAP1) that mediates responses Arabidopsis root to the synthetic auxin 2,4-Dichlorophenoxyacetic acid. |
| AT4G13615 | Uncharacterized protein family SERF. |
| AT4G13660 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows preference for pinoresinol and not lariciresinol. |
| AT4G13850 | Encodes a glycine-rich RNA-binding protein. Gene expression is induced by cold. |
| AT4G13860 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT4G13930 | Encodes a serine hydroxymethyltransferase maximally expressed in root |
| AT4G14030 | selenium-binding protein 1. |
| AT4G14040 | selenium-binding protein 2. |
| AT4G14130 | xyloglucan endotransglycosylase-related protein (XTR7) |
| AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT4G14310 | Transducin/WD40 repeat-like superfamily protein. |
| AT4G14315 | transmembrane protein. |
| AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
| AT4G14490 | SMAD/FHA domain-containing protein. |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT4G14580 | CBL-interacting protein kinase |
| AT4G14620 | hypothetical protein (DUF506). |
| AT4G14622 | unknown protein |
| AT4G14680 | Encodes one of three A. thaliana ATP-sulfurylases. |
| AT4G14723 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G14746 | neurogenic locus notch-like protein. |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G14760 | kinase interacting (KIP1-like) family protein. |
| AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT4G14930 | Survival protein SurE-like phosphatase/nucleotidase. |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT4G14980 | Cysteine/Histidine-rich C1 domain family protein. |
| AT4G14990 | Topoisomerase II-associated protein PAT1. |
| AT4G15000 | Ribosomal L27e protein family. |
| AT4G15075 | FBD-like domain family protein. |
| AT4G15150 | glycine-rich protein. |
| AT4G15210 | cytosolic beta-amylase expressed in rosette leaves and inducible by sugar. RAM1 mutants have reduced beta amylase in leaves and stems. |
| AT4G15215 | pleiotropic drug resistance 13. |
| AT4G15230 | pleiotropic drug resistance 2. |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein. |
| AT4G15236 | ABC-2 and Plant PDR ABC-type transporter family protein. |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein. |
| AT4G15280 | UDP-glucosyl transferase 71B5. |
| AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1. |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT4G15390 | HXXXD-type acyl-transferase family protein. |
| AT4G15393 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT4G15396 | cytochrome P450, family 702, subfamily A, polypeptide 6. |
| AT4G15440 | Encodes a hydroperoxide lyase. Also a member of the CYP74B cytochrome p450 family. In the ecotype Columbia (Col) the gene contains a 10-nucleotide deletion in its first exon that causes it to code for a truncated protein that results in a non-functional hydroperoxide lyase. |
| AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
| AT4G15590 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT4G15765 | FAD/NAD(P)-binding oxidoreductase family protein. |
| AT4G15790 | uveal autoantigen with coiled-coil/ankyrin. |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G15920 | Encodes a vacuolar fructose transporter expressed in parenchyma and xylem that controls leaf fructose content. When its expression is reduced, fructose accumulates in leaves. |
| AT4G16105 | pre-tRNA tRNA-Thr (anticodon: AGT). |
| AT4G16110 | Encodes a pollen-specific transcription factor involved in the expression of nuclear genes for components of mitochondrial complex I in Arabidopsis. Acts in concert with other type-B ARRs in the cytokinin signaling pathway. AHK3 mediates cytokinin-induced phosphorylation of ARR2 on the Asp-80 residue. This phosphorylation plays a positive role of ARR2 in cytokinin-mediated control of leaf longevity. Also involved in cytokinin-dependent inhibition of hypocotyl elongation. |
| AT4G16130 | Arabinokinase. |
| AT4G16140 | proline-rich family protein. |
| AT4G16144 | Encodes AMSH3, a deubiquitinating enzyme that hydrolyzes K48- and K63-linked ubiquitin chains in vitro. Required for intracellular trafficking and vacuole biogenesis. |
| AT4G16146 | cAMP-regulated phosphoprotein 19-related protein. |
| AT4G16162 | Leucine-rich repeat (LRR) family protein. |
| AT4G16210 | enoyl-CoA hydratase/isomerase A. |
| AT4G16215 | hypothetical protein. |
| AT4G16380 | Heavy metal transport/detoxification superfamily protein. |
| AT4G16442 | Uncharacterized protein family (UPF0497). |
| AT4G16444 | GET1 membrane receptor homolog . ER localized protein that Interacts with GET3a and GET2 orthologs. Disruption of both genes results in a decreased membrane localization of the SNARE proteinSYP123 and defects in root hair elongation. |
| AT4G16490 | ARM repeat superfamily protein. |
| AT4G16500 | Cystatin/monellin superfamily protein. |
| AT4G16520 | Autophagy protein. |
| AT4G16650 | O-fucosyltransferase family protein. |
| AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G16680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT4G16745 | Exostosin family protein. |
| AT4G16748 | other_RNA. |
| AT4G16750 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
| AT4G16765 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT4G16770 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. |
| AT4G16830 | Encodes a perinuclear and cytoplasmically localized mRNA binding protein. AtRGGA is likely involved in stress responsivness. It is induced by salt and osmotic stress and loss of function mutations are more sensitive to stress. |
| AT4G17230 | Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family. Regulated by heat shock. |
| AT4G17440 | chromogranin (DUF1639). |
| AT4G17453 | unknown protein |
| AT4G17470 | alpha/beta-Hydrolases superfamily protein. |
| AT4G17480 | alpha/beta-Hydrolases superfamily protein. |
| AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT4G17612 | pre-tRNA tRNA-Trp (anticodon: CCA). |
| AT4G17690 | Peroxidase superfamily protein. |
| AT4G17695 | Homeodomain-like superfamily protein. |
| AT4G17720 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
| AT4G17800 | Putative AT-hook DNA-binding family protein. |
| AT4G17810 | C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4. |
| AT4G17840 | CAAX protease self-immunity protein. |
| AT4G17870 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT4G17895 | Encodes a ubiquitin-specific protease. |
| AT4G17900 | PLATZ transcription factor family protein. |
| AT4G17905 | Putative RING-H2 finger protein ATL4H. |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
| AT4G18030 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT4G18140 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
| AT4G18160 | Encodes AtTPK3 (KCO6), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. |
| AT4G18340 | Glycosyl hydrolase superfamily protein. |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
| AT4G18370 | Encodes DEG5. Forms a hexamer with DEG8 in the thylakoid lumen. Involved in the cleavage of photodamaged D2 protein of photosystem II (PSII). |
| AT4G18375 | RNA-binding KH domain-containing protein. |
| AT4G18380 | F-box family protein. |
| AT4G18390 | TEOSINTE BRANCHED 1, cycloidea and PCF transcription factor 2. |
| AT4G18440 | L-Aspartase-like family protein. |
| AT4G18660 | delay of germination protein. |
| AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT4G18710 | Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. |
| AT4G18750 | Encodes a pentatricopeptide (PPR) protein involved in leaf and root development. dot4 mutants have an aberrant midgap venation pattern in juvenile leaves and cotyledons. |
| AT4G18760 | receptor like protein 51. |
| AT4G18810 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT4G18815 | pre-tRNA tRNA-Gly (anticodon: TCC). |
| AT4G18820 | AAA-type ATPase family protein. |
| AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
| AT4G18890 | BES1/BZR1 homolog 3. |
| AT4G18900 | Transducin/WD40 repeat-like superfamily protein. |
| AT4G18940 | RNA ligase/cyclic nucleotide phosphodiesterase family protein. |
| AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
| AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
| AT4G19010 | Encodes for a 4-coumarate-CoA ligase involved in the biosynthesis of the benzenoid ring of ubiquinone from phenylalanine. |
| AT4G19020 | Encodes a plant DNA methyltransferase that methylates mainly cytosines in CHH (H = any base but G) contexts. It is involved in heat tolerance. |
| AT4G19030 | an aquaporin whose expression level is reduced by ABA, NaCl, dark, and desiccation. is expressed at relatively low levels under normal conditions. Also functions in arsenite transport and tolerance. |
| AT4G19040 | Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. |
| AT4G19045 | Member of a conserved family of proteins. Functions redundantly with MOB1A to regulate cell proliferation and JA metabolism. |
| AT4G19110 | Protein kinase superfamily protein. |
| AT4G19112 | unknown protein |
| AT4G19130 | Replication factor-A protein 1-like protein. |
| AT4G19140 | exopolysaccharide production negative regulator. |
| AT4G19150 | Ankyrin repeat family protein. |
| AT4G19160 | transglutaminase family protein. |
| AT4G19191 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT4G19200 | Glycine and proline rich protein.Mutants have increased size. |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT4G19239 | Pseudogene of AT5G01080; beta-galactosidase |
| AT4G19390 | Uncharacterized protein family (UPF0114). |
| AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
| AT4G19420 | Pectinacetylesterase family protein. |
| AT4G19430 | hypothetical protein. |
| AT4G19440 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT4G19690 | The gene encodes Fe2+ transporter protein. It is a member of the Zrt/Irt-like protein (ZIP) family of transporters. AtIRT1 has broad specificity for divalent heavy metals, mediating the transport of zinc, manganese, cobalt and cadmium under Fe-deficient conditions. IRT1 is monoubiquitinated to promote endocytic trafficking. |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein. |
| AT4G19980 | hypothetical protein. |
| AT4G20000 | VQ motif-containing protein. |
| AT4G20006 | unknown protein |
| AT4G20010 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
| AT4G20040 | Pectin lyase-like superfamily protein. |
| AT4G20050 | Encodes a polygalacturonase that plays a direct role in degrading the pollen mother cell wall during microspore development. |
| AT4G20170 | glycosyltransferase family protein (DUF23). |
| AT4G20180 | transposable_element_gene.;copia-like retrotransposon family |
| AT4G20190 | hypothetical protein. |
| AT4G20230 | terpenoid synthase superfamily protein. |
| AT4G20250 | hypothetical protein. |
| AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. |
| AT4G20270 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. |
| AT4G20290 | transmembrane protein. |
| AT4G20300 | Serine/Threonine-kinase, putative (DUF1639). |
| AT4G20320 | Cytidine triphosphate synthase. |
| AT4G20380 | LSD1 monitors a superoxide-dependent signal and negatively regulates a plant cell death pathway. contains zinc-finger motifs. LSD1 negatively regulates a basal defense pathway that can act upstream or independently of both NIM1/NPR1 function and SA accumulation following avirulent or virulent pathogen challenge |
| AT4G20860 | involved in the generation of H2O2 from reduced compounds |
| AT4G20870 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
| AT4G20890 | tubulin 9 |
| AT4G21080 | Dof-type zinc finger domain-containing protein. |
| AT4G21090 | MITOCHONDRIAL FERREDOXIN 2. |
| AT4G21192 | Cytochrome c oxidase biogenesis protein Cmc1-like protein. |
| AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
| AT4G21280 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT4G21300 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT4G21410 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G21420 | transposable_element_gene.;gypsy-like retrotransposon family |
| AT4G21437 | unknown pseudogene |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT4G21445 | CRR9 gene encodes a novel stromal protein without any known functional domains or motifs. |
| AT4G21450 | PapD-like superfamily protein. |
| AT4G21570 | organic solute transporter ostalpha protein (DUF300). |
| AT4G21600 | Encodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops). |
| AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
| AT4G21790 | encodes a host factor that is required for TMV virus multiplication. |
| AT4G21830 | methionine sulfoxide reductase B7. |
| AT4G21840 | methionine sulfoxide reductase B8. |
| AT4G21850 | methionine sulfoxide reductase B9. |
| AT4G21860 | 2-Cys methionine sulfoxide reductase. |
| AT4G21865 | hypothetical protein. |
| AT4G21900 | Encodes a proteinaceous RNase P that supports RNase P activity in vivo in both organelles and the nucleus. It is also involved in the maturation of small nucleolar RNA (snoRNA) and mRNA. |
| AT4G21902 | hypothetical protein. |
| AT4G21903 | MATE efflux family protein. |
| AT4G21910 | MATE efflux family protein. |
| AT4G21920 | hypothetical protein. |
| AT4G21926 | hypothetical protein. |
| AT4G21930 | senescence regulator (Protein of unknown function, DUF584). |
| AT4G21950 | hypothetical protein. |
| AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). |
| AT4G21990 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. |
| AT4G22000 | tyrosine sulfotransferase-like protein. |
| AT4G22010 | SKU5 similar 4. |
| AT4G22070 | member of WRKY Transcription Factor; Group II-b |
| AT4G22080 | root hair specific 14. |
| AT4G22110 | GroES-like zinc-binding dehydrogenase family protein. |
| AT4G22130 | STRUBBELIG-receptor family 8. |
| AT4G22190 | serine/arginine repetitive matrix-like protein. |
| AT4G22212 | Encodes a defensin-like (DEFL) family protein. |
| AT4G22214 | Encodes a defensin-like (DEFL) family protein. |
| AT4G22230 | Encodes a defensin-like (DEFL) family protein. |
| AT4G22233 | Natural antisense transcript overlaps with AT4G22235. |
| AT4G22235 | Encodes a defensin-like (DEFL) family protein. |
| AT4G22250 | RING/U-box superfamily protein. |
| AT4G22260 | Similar to mitochondrial alternative oxidase. im mutants have a variegated phenotype and fail to differentiate chloroplasts in the majority of their cells under high light intensity continuous illumination. The white tissues of immutans accumulate phytoene, a non-colored C40 carotenoid intermediate. This suggests that immutans controls, either directly or indirectly, the activity of phytoene desaturase (PDS), the enzyme that converts phytoene to zeta-carotene in higher plants. However, im is not the structural gene for PDS. It is located in the lumenar face of the thylakoid membrane. IM is expressed ubiquitously in plant tissues. |
| AT4G22545 | pseudogene of expressed protein. |
| AT4G22560 | sulfated surface-like glycoprotein. |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein. |
| AT4G22592 | unknown protein |
| AT4G22600 | Encodes a protein involved in involved in the formation of the pollen surface apertures. It acts late in aperture formation by excluding specific membrane domains from exine deposition. |
| AT4G22610 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT4G22730 | Leucine-rich repeat protein kinase family protein. |
| AT4G22753 | unknown protein |
| AT4G22756 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-1 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
| AT4G22770 | AT hook motif DNA-binding family protein. |
| AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
| AT4G22800 | unknown protein |
| AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
| AT4G22830 | YCF49-like protein. |
| AT4G22980 | molybdenum cofactor sulfurase-like protein. |
| AT4G23050 | PAS domain-containing protein tyrosine kinase family protein. |
| AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G23100 | Encodes the enzyme glutamate-cysteine ligase catalyzing the first, and rate-limiting, step of glutathione biosynthesis. Required for cell proliferation at the root tip. Involved in susceptibility to the bacterial pathogen Pseudomonas syringae. Mutants are phytoalexin defective. |
| AT4G23103 | unknown protein |
| AT4G23160 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23170 | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. |
| AT4G23270 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23390 | NEP-interacting protein, putative (DUF239). |
| AT4G23400 | Plasma membrane intrinsic protein, involved redundantly with PIP1;1/2/3/4 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT4G23410 | TET5 encodes a member of the TETRASPANIN gene family that is expressed in the embryo and vascular system and is involved in organ growth redundantly with TET6. |
| AT4G23420 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT4G23430 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT4G23432 | unknown protein |
| AT4G23490 | fringe-like protein (DUF604). |
| AT4G23493 | hypothetical protein. |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family. |
| AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein. |
| AT4G23630 | VIRB2-interacting protein 1. |
| AT4G23670 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT4G23720 | transmembrane protein, putative (DUF1191). |
| AT4G23730 | Galactose mutarotase-like superfamily protein. |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT4G23760 | Cox19-like CHCH family protein. |
| AT4G23810 | member of WRKY Transcription Factor; Group III |
| AT4G23840 | Leucine-rich repeat (LRR) family protein. |
| AT4G23850 | AMP-dependent synthetase and ligase family protein. |
| AT4G23870 | hypothetical protein. |
| AT4G23970 | hypothetical protein. |
| AT4G24010 | encodes a protein similar to cellulose synthase |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT4G24100 | Protein kinase superfamily protein |
| AT4G24110 | NADP-specific glutamate dehydrogenase. |
| AT4G24200 | Transcription elongation factor (TFIIS) family protein. |
| AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
| AT4G24280 | Involved in protein import into chloroplasts during early developmental stages. |
| AT4G24290 | MAC/Perforin domain-containing protein. |
| AT4G24310 | transmembrane protein, putative (DUF679). |
| AT4G24340 | Phosphorylase superfamily protein. |
| AT4G24350 | Phosphorylase superfamily protein. |
| AT4G24370 | hypothetical protein. |
| AT4G24380 | dihydrofolate reductase. |
| AT4G24415 | Encodes a microRNA that targets AGL16. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCAUUUGUGAGAAGGGA |
| AT4G24470 | ZIM is a putative transcription factor containing an atypical GATA-type zinc-finger motif. |
| AT4G24480 | Protein kinase superfamily protein. |
| AT4G24652 | Pseudogene of AT4G20330; transcription initiation factor-related |
| AT4G24700 | hypothetical protein. |
| AT4G24710 | Encodes an AAA+ ATPase that mediates meiotic chromosome remodeling and crossover maturation. |
| AT4G24760 | alpha/beta-Hydrolases superfamily protein. |
| AT4G24960 | Homologous to a eukaryote specific ABA- and stress-inducible gene first isolated from barley. Groups in one subfamily with ATHVA22E. Along with other members of the ATHVA22 family, it may be involved in regulation of autophagy during development. |
| AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
| AT4G25020 | D111/G-patch domain-containing protein. |
| AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT4G25225 | transmembrane protein. |
| AT4G25230 | RPM1 interacting protein 2, has a CUE domain which is sufficient for the interaction with RPM1.Positive regulator of RPM1 and PRS2 mediated hypersensitive response.Functions as ubiquitin ligase and binds to RPM1. |
| AT4G25260 | Pectin methylesterase inhibitor. Forms pH dependent complex with PME3. |
| AT4G25270 | Encodes OTP70, a pentatricopeptide repeat protein of the E subgroup involved in splicing of the plastid transcript rpoC1. |
| AT4G25280 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT4G25290 | DNA photolyase. |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT4G25360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G25386 | unknown protein |
| AT4G25390 | Protein kinase superfamily protein. |
| AT4G25400 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT4G25420 | Encodes gibberellin 20-oxidase that is involved in the later steps of the gibberellin biosynthetic pathway. Regulated by a circadian clock. Weak expression response to far red light. |
| AT4G25520 | SEUSS-like 1. |
| AT4G25620 | hydroxyproline-rich glycoprotein family protein. |
| AT4G25630 | encodes a fibrillarin, a key nucleolar protein in eukaryotes which associates with box C/D small nucleolar RNAs (snoRNAs) directing 2'-O-ribose methylation of the rRNA. This gene also encodes a novel box C/D snoRNA, U60.2f in its fifth intron that accumulates in seedlings and that their targeted residue on the 25 S rRNA is methylated. |
| AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
| AT4G25690 | stress response NST1-like protein. |
| AT4G25692 | unknown protein |
| AT4G25770 | alpha/beta-Hydrolases superfamily protein. |
| AT4G25800 | Calmodulin-binding protein. |
| AT4G25810 | xyloglucan endotransglycosylase-related protein (XTR6) |
| AT4G25830 | Uncharacterized protein family (UPF0497). |
| AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT4G26080 | Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure. |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. |
| AT4G26095 | Natural antisense transcript overlaps with AT4G26090. |
| AT4G26255 | other_RNA. |
| AT4G26320 | arabinogalactan protein 13. |
| AT4G26450 | hypothetical protein. |
| AT4G26455 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT4G26480 | RNA-binding KH domain-containing protein. |
| AT4G26483 | nicotianamine synthase. |
| AT4G26500 | Sulfur acceptor that interacts with and activates the cysteine desulfurases, AtSufS in plastids and AtNifS1 in mitochondria, and both activations are vital during embryogenesis. Dual localization in mitochondria and chloroplasts. Involved in Fe-S cluster biogenesis in mitochondria and plastids. Expressed in all major tissues, with higher expression in green parts. Its expression is light-dependent and regulated at the mRNA level. Activates the cysteine desulfurase activity of CpNifS for chloroplastic iron-sulfur cluster biogenesis. |
| AT4G26510 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). |
| AT4G26540 | Leucine-rich repeat receptor-like protein kinase family protein. |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT4G26850 | Encodes a novel protein involved in ascorbate biosynthesis, which was shown to catalyze the transfer of GMP from GDP-galactose to a variety of hexose-1-phosphate acceptors. Recessive mutation has a reduced amount of vitamin C, lower level of non-photochemical quenching, and reduced rate of conversion of violaxanthin to zeaxanthin in high light. |
| AT4G27070 | Tryptophan synthase beta. Expressed at low levels in all tissues. |
| AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). |
| AT4G27270 | Quinone reductase family protein. |
| AT4G27300 | S-locus lectin protein kinase family protein. |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. |
| AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT4G27415 | hypothetical protein. |
| AT4G27450 | aluminum induced protein with YGL and LRDR motifs. |
| AT4G27490 | 3-5-exoribonuclease family protein. |
| AT4G27500 | interacts with H+-ATPase, and regulates its activity |
| AT4G27595 | Encodes a microtubule-associated protein. |
| AT4G27650 | Encodes Arabidopsis homolog of Drosophila pelota protein. Functions in RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. |
| AT4G27652 | hypothetical protein. |
| AT4G27654 | transmembrane protein. |
| AT4G27657 | hypothetical protein. |
| AT4G27660 | hypothetical protein. |
| AT4G27730 | oligopeptide transporter |
| AT4G27850 | Glycine-rich protein family. |
| AT4G27852 | Natural antisense transcript overlaps with AT4G27850 and AT4G27860. |
| AT4G27860 | vacuolar iron transporter (VIT) family protein. |
| AT4G27870 | Vacuolar iron transporter (VIT) family protein. |
| AT4G28085 | transmembrane protein. |
| AT4G28088 | Low temperature and salt responsive protein family. |
| AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase. |
| AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
| AT4G28290 | hypothetical protein. |
| AT4G28300 | Encodes a protein with 13.6% proline amino acids that is predicted to localize to the cell wall. |
| AT4G28540 | Member of CKL gene family (CKL-C group). |
| AT4G28600 | encodes a calmodulin-binding protein that is expressed in pollen, suspension culture cells, flowers, and fruits. |
| AT4G28630 | Half-molecule ABC transporter ATM1. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
| AT4G28660 | Similar to PsbW subunit of photosystem II. |
| AT4G28703 | RmlC-like cupins superfamily protein. |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
| AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT4G28830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT4G28840 | Encodes TCP INTERACTOR-CONTAINING EAR MOTIF PROTEIN 1 (TIE1), an important repressor of CINCINNATA (CIN)-like TEOSINTE BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors, which are key for leaf development. |
| AT4G28850 | xyloglucan endotransglucosylase/hydrolase 26. |
| AT4G28890 | RING/U-box superfamily protein. |
| AT4G28910 | Encodes a transcriptional repressor that functions in the jasmonic acid (JA) signalling pathway, root development, and has a key role in leaf development, likely due to the transcriptional regulation of CYCD3 expression. Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and FRS12 glucosinolate biosynthesis. |
| AT4G28915 | pre-tRNA tRNA-Ser (anticodon: GCT). |
| AT4G28940 | Phosphorylase superfamily protein. |
| AT4G29090 | Ribonuclease H-like superfamily protein. |
| AT4G29100 | Member of basic helix loop helix protein family. Expressed primarily in vascular system. |
| AT4G29103 | transmembrane protein. |
| AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
| AT4G29140 | Encodes Activated Disease Susceptibility 1 (ADS1), a putative MATE (multidrug and toxic compound extrusion) transport protein that negatively regulates plant disease resistance. |
| AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G29190 | Zinc finger C-x8-C-x5-C-x3-H type family protein. |
| AT4G29200 | Over-expressed by salt stress. |
| AT4G29210 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the vacuole and is most active in roots. The encoded enzyme is involved in the initial degradation of glutathione conjugates in this cell compartment. It is also induced by xenobiotics and contributes to xenobiotics metabolism. Note that conflicting nomenclature exists in the literature: At4g29210 is named as GGT3 in Plant J. 2007 Mar 49(5):878-88; At4g29210 is named as GGT4 and At1g69820 as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT4G29230 | NAC domain protein involved in negative regulation of flowering. |
| AT4G29240 | Leucine-rich repeat (LRR) family protein. |
| AT4G29270 | HAD superfamily, subfamily IIIB acid phosphatase. |
| AT4G29273 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G29280 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G29281 | Pseudogene of AT4G29270; acid phosphatase class B family protein |
| AT4G29310 | DUF1005 family protein (DUF1005). |
| AT4G29380 | The gene encodes phosphatidylinositol 3- kinase involved in the development and germination of pollen through the biosynthesis of phosphatidylinositol 3-phosphate (PI3P). |
| AT4G29690 | Alkaline-phosphatase-like family protein. |
| AT4G29700 | Alkaline-phosphatase-like family protein. |
| AT4G29710 | Alkaline-phosphatase-like family protein. |
| AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
| AT4G29810 | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
| AT4G29820 | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit. |
| AT4G29840 | threonine synthase |
| AT4G29850 | transmembrane protein (DUF872). |
| AT4G29860 | Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. |
| AT4G29900 | encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT4G29905 | hypothetical protein. |
| AT4G29930 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT4G29940 | Homeodomain protein (PRHA). Expression of the gene differs in various vegetative and floral plant tissues and is positively influenced by the phytohormone auxin. It is often associated with regions of developing vascular tissue. The prha promoter is highly responsive to the synthetic auxin, naphthalene acetic acid, in transient assays using tobacco protoplasts. The PRHA protein has the capacity to bind to TAATTG core sequence elements but requires additional adjacent bases for high-affinity binding. |
| AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein. |
| AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein. |
| AT4G30064 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30074 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30130 | DUF630 family protein (DUF630 and DUF632). |
| AT4G30160 | Encodes a major actin filament bundling protein that is involved in root hair growth through regulating actin organization in a Ca2+-dependent manner. |
| AT4G30170 | Peroxidase family protein. |
| AT4G30180 | hypothetical protein. |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT4G30210 | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. |
| AT4G30220 | small nuclear ribonucleoprotein F. |
| AT4G30240 | Syntaxin/t-SNARE family protein. |
| AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
| AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30290 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed throughout both the main and the lateral root, with intensive expression at the dividing and elongating regions. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT4G30360 | member of Cyclic nucleotide gated channel family |
| AT4G30370 | RING/U-box superfamily protein. |
| AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). |
| AT4G30390 | UDP-arabinopyranose mutase. |
| AT4G30400 | RING/U-box superfamily protein. |
| AT4G30410 | sequence-specific DNA binding transcription factor. |
| AT4G30420 | nodulin MtN21-like transporter family protein |
| AT4G30430 | Member of TETRASPANIN family |
| AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
| AT4G30450 | glycine-rich protein. |
| AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT4G30490 | AFG1-like ATPase family protein. |
| AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. |
| AT4G30620 | Homolog of STIC2, recent duplication. |
| AT4G30630 | hypothetical protein. |
| AT4G30650 | Low temperature and salt responsive protein family. |
| AT4G30660 | Low temperature and salt responsive protein family. |
| AT4G30670 | Putative membrane lipoprotein. |
| AT4G30680 | Initiation factor eIF-4 gamma, MA3. |
| AT4G30710 | QWRF motif protein (DUF566). |
| AT4G30720 | Encodes a putative oxidoreductase/electron carrier detected in the chloroplast stroma that is essential to ensure a correct electron flow through the photosynthetic chain and, hence, photosynthesis efficiency and normal growth. Mutations in the Col-0 allele result in pale green pigmentation and defective growth. |
| AT4G30780 | ATP-dependent DNA helicase. |
| AT4G30800 | Nucleic acid-binding, OB-fold-like protein. |
| AT4G30810 | serine carboxypeptidase-like 29. |
| AT4G30950 | Chloroplastic enzyme responsible for the synthesis of 16:2 and 18:2 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation resulted in reduced level of unsaturated fatty acids leading to susceptibility to photoinhibition. |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. |
| AT4G30970 | hypothetical protein. |
| AT4G30972 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
| AT4G30975 | None. |
| AT4G30980 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT4G31100 | wall-associated kinase. |
| AT4G31110 | Wall-associated kinase family protein. |
| AT4G31280 | hypothetical protein. |
| AT4G31290 | ChaC-like family protein. |
| AT4G31320 | SAUR-like auxin-responsive protein family. |
| AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599). |
| AT4G31370 | fasciclin-like arabinogalactan-protein, putative (FLA5) |
| AT4G31390 | Protein kinase superfamily protein. |
| AT4G31450 | RING/U-box superfamily protein. |
| AT4G31460 | Ribosomal L28 family. |
| AT4G31490 | Required for plant growth, salt tolerance, and maintenance of the structure of the Golgi apparatus. |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G31560 | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane. |
| AT4G31590 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT4G31600 | Encodes a Golgi-localized UDP?glucose/UDP?galactose transporter that affects lateral root emergence. |
| AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
| AT4G31800 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. |
| AT4G31820 | A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development. |
| AT4G31890 | ARM repeat superfamily protein. |
| AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
| AT4G32020 | serine/arginine repetitive matrix-like protein. |
| AT4G32030 | hypothetical protein. |
| AT4G32070 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT4G32105 | Beta-1,3-N-Acetylglucosaminyltransferase family protein. |
| AT4G32110 | Beta-1,3-N-Acetylglucosaminyltransferase family protein. |
| AT4G32160 | Phox (PX) domain-containing protein. |
| AT4G32272 | Golgi-localized nucleotide sugar (UDP-GlcNAc) transporter that delivers an essential substrate for the maturation of N-glycans and the GIPC class of sphingolipids. |
| AT4G32295 | histone acetyltransferase. |
| AT4G32300 | S-domain-2 5. |
| AT4G32330 | WDL5 is an target of EIN3 that co-localizes with cortical microtubles. It its thought to function to stabilize microtubles during ethylene induced hypocotyl elongation. |
| AT4G32390 | Nucleotide-sugar transporter family protein. |
| AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. |
| AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein. |
| AT4G32480 | sugar phosphate exchanger, putative (DUF506). |
| AT4G32490 | early nodulin-like protein 4. |
| AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
| AT4G32620 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
| AT4G32750 | transmembrane protein. |
| AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G32870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT4G32924 | unknown protein |
| AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
| AT4G33110 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT4G33120 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT4G33240 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT4G33300 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. |
| AT4G33310 | hypothetical protein. |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. |
| AT4G33440 | Pectin lyase-like superfamily protein. |
| AT4G33700 | CBS domain protein (DUF21). |
| AT4G33800 | hypothetical protein. |
| AT4G33810 | Glycosyl hydrolase superfamily protein. |
| AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein. |
| AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT4G33920 | Protein phosphatase 2C family protein. |
| AT4G34000 | Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid. |
| AT4G34040 | RING/U-box superfamily protein. |
| AT4G34131 | UDP-glucosyl transferase 73B3. |
| AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
| AT4G34138 | UDP-glucosyl transferase 73B1. |
| AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
| AT4G34200 | Encodes a 3-phosphoglycerate dehydrogenase that is essential for embryo and pollen development. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G34240 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. |
| AT4G34272 | unknown protein |
| AT4G34280 | Encodes a putative substrate receptor for the cullin4-RING ubiquitin E3 ligase complex that is involved in negative regulation of plant UV-B response. |
| AT4G34310 | alpha/beta-Hydrolases superfamily protein. |
| AT4G34320 | transmembrane protein, putative (DUF677). |
| AT4G34350 | Arabidopsis ISPH is involved in the plastid nonmevalonate pathway of isoprenoid biosynthesis. It was shown to complement the lethal phenotype of E. coli ispH mutant and is therefore most likely encodes a protein with 4-hydroxy-3-methylbut-2-en-1-yl diphosphate reductase activity involved in the last step of mevalonate-independent isopentenyl biosynthesis. Mutant has Albino seedling. |
| AT4G34360 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT4G34400 | B3-type transcription factor, which promotes floral transition and is repressed by FLC/SVP and promoted by SOC1. |
| AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein. |
| AT4G34588 | unknown protein |
| AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
| AT4G34610 | BEL1-like homeodomain 6. |
| AT4G34630 | prostatic spermine-binding-like protein. |
| AT4G34640 | Encodes squalene synthase, which converts two molecules of farnesyl diphosphate (FPP) into squalene via an intermediate: presqualene diphosphate (PSPP). It is generally thought to be one of the key enzymes of sterol biosynthesis, since it catalyzes the first pathway-specific reaction of the sterol branch of the isoprenoid pathway. |
| AT4G34650 | Encodes a protein with similarity to squalene synthase which catalyzes the first committed step in sterol biosynthesis. To date no experimental evidence exists that SQS2 functions as a squalene synthase and some experiments indicate it does not have this function. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. |
| AT4G34720 | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p1) |
| AT4G34760 | SAUR-like auxin-responsive protein family. |
| AT4G34770 | SAUR-like auxin-responsive protein family. |
| AT4G34790 | Putative OXS2-binding DEGs were constitutively activated by OXS2. |
| AT4G34800 | SAUR-like auxin-responsive protein family. |
| AT4G34810 | SAUR-like auxin-responsive protein family. |
| AT4G34910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein. |
| AT4G34990 | Member of the R2R3 factor gene family. |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. |
| AT4G35060 | Heavy metal transport/detoxification superfamily protein. |
| AT4G35070 | SBP (S-ribonuclease binding protein) family protein. |
| AT4G35080 | Encodes a nuclear-encoded chloroplast protein that plays an important role in vegetative growth, female gametogenesis, and embryogenesis likely by mediating chloroplast integrity and development. |
| AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. . |
| AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
| AT4G35200 | hypothetical protein (DUF241). |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632). |
| AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT4G35550 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. |
| AT4G35580 | Encodes a calmodulin-binding NAC protein (CBNAC). Contains calmodulin-binding domain in the C-terminus of the protein. Functions as a calmodulin-regulated transcriptional repressor. |
| AT4G35589 | unknown protein |
| AT4G35590 | RWP-RK domain-containing protein. |
| AT4G35660 | selection/upkeep of intraepithelial T-cells protein, putative (DUF241). |
| AT4G35670 | Pectin lyase-like superfamily protein. |
| AT4G35690 | hypothetical protein (DUF241). |
| AT4G35720 | DUF241 domain protein, putative (DUF241). |
| AT4G35740 | Encodes RECQ3, an ATP-dependent helicase. |
| AT4G35750 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein. |
| AT4G35760 | Encodes a bimodular enzyme comprising an integral domain homologous to the catalytic subunit of mammalian vitamin K epoxide reductase (VKORC1, EC 1.1.4.1) that is fused to a soluble thioredoxin-like moiety. Using yeast microsomes as a recombinant system, it was shown that the VKORC1 domain of At4g35760 functions as a stringent naphthoquinone reductase, and that its reduced Trx-like partner can serve as its electron donor. Located in plastid. Required for the assembly of photosystem II. Can catalyze disulfide bond formation in vitro. |
| AT4G35780 | ACT-like protein tyrosine kinase family protein. |
| AT4G35783 | ROTUNDIFOLIA like 6. |
| AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
| AT4G35800 | Encodes the unique largest subunit of nuclear DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB1 and a homolog of the E. coli RNA polymerase beta prime subunit. |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT4G35890 | Encodes a cytoplasmic LAM domain containing protein that is involved in leaf senescence. |
| AT4G35900 | bZIP protein required for positive regulation of flowering. Mutants are late flowering. FD interacts with FT to promote flowering.Expressed in the shoot apex in floral anlagen, then declines in floral primordia. |
| AT4G36010 | Pathogenesis-related thaumatin superfamily protein. |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT4G36032 | Natural antisense transcript overlaps with AT4G36030. |
| AT4G36040 | Chaperone DnaJ-domain superfamily protein. |
| AT4G36050 | Encodes a base excision repair protein with 3'-phosphatase activity and strong 3'-5' exonuclease activity. |
| AT4G36052 | Natural antisense transcript overlaps with AT4G36050. |
| AT4G36105 | polyamine-modulated factor 1-binding protein. |
| AT4G36110 | SAUR-like auxin-responsive protein family. |
| AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT4G36170 | hypothetical protein. |
| AT4G36180 | LRR-RLK which regulates lateral root development. |
| AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
| AT4G36230 | transmembrane protein. |
| AT4G36360 | putative beta-galactosidase (BGAL3 gene) |
| AT4G36370 | hypothetical protein. |
| AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
| AT4G36500 | hypothetical protein. |
| AT4G36520 | Chaperone DnaJ-domain superfamily protein. |
| AT4G36530 | alpha/beta-Hydrolases superfamily protein. |
| AT4G36630 | Vacuolar sorting protein 39. |
| AT4G36635 | pre-tRNA tRNA-Ile (anticodon: TAT). |
| AT4G36640 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT4G36648 | other_RNA. |
| AT4G36650 | Encodes a protein with similarity to the general transcription factor TFIIB. pBRP binds rDNA sequences in vitro. pBRP has been localized to the outer face of the plastid membrane with GFP fusion however, under conditions of proteosome inhibition it is found in the nucleus. |
| AT4G36670 | Major facilitator superfamily protein. |
| AT4G36710 | GRAS family transcription factor. |
| AT4G36730 | member of a gene family encoding basic leucine zipper proteins (GBFs) which bind the G-box |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein. |
| AT4G36780 | BES1/BZR1 homolog 2. |
| AT4G36790 | Major facilitator superfamily protein. |
| AT4G36820 | Mitochondrial calcium channel. |
| AT4G36830 | ELO family protein. |
| AT4G36850 | PQ-loop repeat family protein / transmembrane family protein. |
| AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
| AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. |
| AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
| AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
| AT4G36920 | Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. |
| AT4G36925 | transmembrane protein. |
| AT4G36945 | PLC-like phosphodiesterases superfamily protein. |
| AT4G36950 | member of MEKK subfamily |
| AT4G36970 | Remorin family protein. |
| AT4G36980 | CLK4-associating serine/arginine-rich protein. |
| AT4G36988 | unknown protein |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. |
| AT4G37060 | Patatin-related phospholipase A. Expressed weakly in roots, cotyledons, and leaves but is transcriptionally induced by auxin. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
| AT4G37070 | Patatin-related phospholipase A. Expressed strongly and exclusively in roots. AtplaIVA-null mutants have reduced lateral root development. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
| AT4G37080 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547). |
| AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. |
| AT4G37190 | plasma membrane, autoregulation-binding site, misato segment II, myosin-like, tubulin/FtsZ protein. |
| AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT4G37250 | Leucine-rich repeat protein kinase family protein. |
| AT4G37260 | Member of the R2R3 factor gene family. |
| AT4G37320 | member of CYP81D |
| AT4G37330 | member of CYP81D |
| AT4G37340 | member of CYP81D |
| AT4G37360 | member of CYP81D |
| AT4G37380 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT4G37400 | member of CYP81F |
| AT4G37410 | member of CYP81F |
| AT4G37432 | Natural antisense transcript overlaps with AT4G37430. |
| AT4G37445 | calcium ion-binding protein. |
| AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. |
| AT4G37460 | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity. |
| AT4G37470 | HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion. |
| AT4G37510 | Ribonuclease III family protein. |
| AT4G37540 | LOB domain-containing protein 39. |
| AT4G37580 | involved in apical hook development. putative N-acetyltransferase |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT4G37608 | hypothetical protein. |
| AT4G37610 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT4G37620 | transposable_element_gene.;similar to RNase H domain-containing protein |
| AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
| AT4G37660 | Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein. |
| AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
| AT4G37700 | hypothetical protein. |
| AT4G37710 | VQ motif-containing protein. |
| AT4G37740 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower |
| AT4G37750 | ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT4G37780 | encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family. |
| AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. |
| AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7. |
| AT4G37810 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT4G37840 | Encodes a putative hexokinase. |
| AT4G37850 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
| AT4G37880 | LisH/CRA/RING-U-box domains-containing protein. |
| AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
| AT4G37980 | NADPH-dependent cinnamaldehyde and hexenal reductase involved in the production of green leaf volitile compounds. |
| AT4G37990 | Encodes an aromatic alcohol:NADP+ oxidoreductase whose mRNA levels are increased in response to treatment with a variety of phytopathogenic bacteria. Though similar to mannitol dehydrogenases, this enzyme does not have mannitol dehydrogenase activity. |
| AT4G38060 | hypothetical protein. |
| AT4G38070 | transcription factor bHLH131-like protein. |
| AT4G38460 | Encodes a type II small subunit of the heteromeric geranyl(geranyl) diphosphate synthase that is localized to the chloroplast, expressed in petals and sepals and is involved in monoterpene biosynthesis. |
| AT4G38470 | Serine/threonine kinase that phosphorylate transit peptides of chloroplast and mitochondria targeted pre-proteins. |
| AT4G38520 | Protein phosphatase 2C family protein. |
| AT4G38530 | Encodes a putative phosphoinositide-specific phospholipase C. There are two genes called ATPLC1, one corresponding to AT4g38530 (this one) and one corresponding to AT5g58670. |
| AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein. |
| AT4G38545 | Natural antisense transcript overlaps with AT4G38530 and AT4G38540. |
| AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. |
| AT4G38670 | Pathogenesis-related thaumatin superfamily protein. |
| AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
| AT4G38690 | PLC-like phosphodiesterases superfamily protein. |
| AT4G38700 | Disease resistance-responsive (dirigent-like protein) family protein. |
| AT4G38710 | glycine-rich protein. |
| AT4G38730 | magnesium transporter, putative (DUF803). |
| AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
| AT4G38760 | nucleoporin (DUF3414). |
| AT4G38770 | Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant. |
| AT4G38810 | Calcium-binding EF-hand family protein. |
| AT4G38850 | mRNA is rapidly induced by auxin and is very short-lived. Has been used as a reporter gene in studying auxin mutants. |
| AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein. |
| AT4G38920 | vacuolar-type H[+]-ATPase C3. |
| AT4G38930 | Ubiquitin fusion degradation UFD1 family protein. |
| AT4G38932 | Natural antisense transcript overlaps with AT4G38930. |
| AT4G38950 | ATP binding microtubule motor family protein. |
| AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
| AT4G39040 | RNA-binding CRS1 / YhbY (CRM) domain protein. |
| AT4G39070 | Encodes BZS1, a brassinosteroids-regulated BZR1 target (BRBT) gene. BZS1 is a putative zinc finger transcription factor. Expression of BZS1 was increased under BR-deficient condition and repressed by BR. Transgenic Arabidopsis plants overexpressing BZS1 showed a hypersensitivity to the BR biosynthetic inhibitor brassinazole (BRZ). In contrast, transgenic plants expressing reduced level of BZS1 had longer hypocotyls than wild type when grown on BRZ. |
| AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
| AT4G39195 | pre-tRNA tRNA-Tyr (anticodon: GTA). |
| AT4G39260 | Encodes a glycine-rich protein with RNA binding domain at the N-terminus. Protein is structurally similar to proteins induced by stress in other plants. Gene expression is induced by cold. Transcript undergoes circadian oscillations that is depressed by overexpression of AtGRP7. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). |
| AT4G39345 | pre-tRNA tRNA-His (anticodon: GTG). |
| AT4G39350 | Encodes a cellulose synthase isomer, related to CESA6. |
| AT4G39360 | hypothetical protein. |
| AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. |
| AT4G39403 | Encodes a 36 amino acid polypeptide that is necessary for correct responses to cytokinins and auxins, correct cell expansion in the root, and for vascular patterning in the leaf. Mutation of PLS results in an enhanced ethylene-response phenotype, defective auxin transport and homeostasis, and altered microtubule sensitivity to inhibitors. |
| AT4G39404 | other_RNA. |
| AT4G39410 | Encodes a member of the Group II-c WRKY Transcription Factor family that is involved in stem development and has been shown to directly bind to the promoter of NST2. WRKY13 binds to the promoter of DCD to upregulate its expression and hydrogen sulfide production to enhance plant cadmium tolerance. Mutants show a weak stem phenotype and show decreased expression of lignin-synthesis-related genes. |
| AT4G39460 | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
| AT4G39470 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT4G39550 | Galactose oxidase/kelch repeat superfamily protein. |
| AT4G39560 | Galactose oxidase/kelch repeat superfamily protein. |
| AT4G39630 | translation initiation factor. |
| AT4G39640 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). |
| AT4G39730 | PLAT1 domain stress protein family member. Involved in mediating response to stresses such as pathogen infection. It is found in endoplasmic reticulum bodies. PLAT1 is induced by pathogenic fungi and induces the production of scopolin. |
| AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. |
| AT4G39790 | bZIP transcription factor, putative (DUF630 and DUF632). |
| AT4G39795 | hypothetical protein (DUF581). |
| AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
| AT4G39840 | cell wall integrity/stress response component-like protein. |
| AT4G39930 | hypothetical protein. |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete |
| AT4G39950 | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. |
| AT4G39952 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT4G39955 | alpha/beta-Hydrolases superfamily protein. |
| AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein. |
| AT4G39980 | Encodes a 2-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase, which catalyzes the first committed step in aromatic amino acid biosynthesis. Gene expression is induced by wounding and pathogenic bacteria Pseudomonas syringae. |
| AT4G39985 | pre-tRNA tRNA-Ile (anticodon: AAT). |
| AT4G39986 | unknown protein |
| AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
| AT4G40011 | hypothetical protein. |
| AT4G40040 | Histone superfamily protein. |
| AT4G40042 | Microsomal signal peptidase 12 kDa subunit (SPC12). |
| AT4G40050 | signal transducer, putative (DUF3550/UPF0682). |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G40065 | other_RNA. |
| AT4G40080 | ENTH/ANTH/VHS superfamily protein. |
| AT4G40085 | Natural antisense transcript overlaps with AT4G40080. |
| AT5G01040 | putative laccase, knockout mutant showed early flowering |
| AT5G01050 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G01070 | RING/FYVE/PHD zinc finger superfamily protein. |
| AT5G01075 | Encodes a small ER-localized protein that is strongly expressed in seeds and regulates both embryo development and accumulation of storage compounds. At the cellular level, TWS1 is responsible for cuticle deposition on epidermal cells and organization of the endomembrane system. |
| AT5G01090 | Concanavalin A-like lectin family protein. |
| AT5G01100 | O-fucosyltransferase family protein. |
| AT5G01200 | Duplicated homeodomain-like superfamily protein. |
| AT5G01260 | Carbohydrate-binding-like fold. |
| AT5G01330 | pyruvate decarboxylase |
| AT5G01335 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT5G01340 | Transports citrate, isocitrate and aconitate, succinate and fumarate. Catalyzes a fast counter-exchange transport as well as a low uniport of substrates, exhibits a higher transport affinity for tricarboxylates than dicarboxylates. Might be involved in storage oil mobilization 78 at early stages of seedling growth and in nitrogen assimilation in root tissue by 79 catalyzing citrate/isocitrate or citrate/succinate exchanges. |
| AT5G01380 | Homeodomain-like superfamily protein. |
| AT5G01500 | encodes an ATP/ADP carrier that is located to the thylakoid membrane involved in providing ATP during thylakoid biogenesis and turnover |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT5G01560 | Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT5G01570 | plectin-like protein. |
| AT5G01595 | Natural antisense transcript overlaps with AT5G01600. |
| AT5G01600 | Encodes a ferretin protein that is targeted to the chloroplast. Member of a Ferritin gene family. Gene expression is induced in response to iron overload and by nitric oxide. Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT5G01710 | methyltransferase. |
| AT5G01712 | unknown protein |
| AT5G01720 | RAE1 is an F-box protein component of a SCF-type E3 ligase complex. It is part of an alumium induced regulatory loop: its activity is induced by STOP1 and it in turn ubiquitinates STOP1 which is then targeted for degradation. |
| AT5G01734 | unknown protein |
| AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
| AT5G01750 | LURP-one-like protein (DUF567). |
| AT5G01760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT5G01790 | hypothetical protein. |
| AT5G01800 | saposin B domain-containing protein. |
| AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
| AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
| AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G01849 | unknown protein |
| AT5G01850 | Protein kinase superfamily protein. |
| AT5G01900 | member of WRKY Transcription Factor; Group III |
| AT5G01910 | myelin transcription factor. |
| AT5G02021 | unknown protein |
| AT5G02080 | phosphopantothenate-cysteine ligase-like protein. |
| AT5G02090 | hypothetical protein. |
| AT5G02160 | Zinc-finger domain containing protein involved in abiotic stress response. Possesses an N-terminal transit peptide followed by a hydrophobic domain and a zinc-finger domain. Despite the presence of a zinc-finger domain (C4-type) with two CXXCXGXG conserved repeats, characteristic of DNAJ protein, the conserved J domain is absent in FIP. Interacts with FtsH5. Gene expression levels are reduced and negatively regulates stress response genes during stress conditions. |
| AT5G02170 | Transmembrane amino acid transporter family protein. |
| AT5G02180 | Transmembrane amino acid transporter family protein. |
| AT5G02190 | encodes an aspartic protease, has an important role in determining cell fate during embryonic development and in reproduction processes. The loss-of-function mutation of PCS1 causes degeneration of both male and female gametophytes and excessive cell death of developing embryos during torpedo stage. |
| AT5G02220 | cyclin-dependent kinase inhibitor. |
| AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein. |
| AT5G02240 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G02270 | member of NAP subfamily |
| AT5G02280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT5G02350 | Cysteine/Histidine-rich C1 domain family protein. |
| AT5G02370 | ATP binding microtubule motor family protein. |
| AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
| AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G02470 | core cell cycle genes |
| AT5G02480 | HSP20-like chaperones superfamily protein. |
| AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
| AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT5G02540 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT5G02550 | hypothetical protein. |
| AT5G02580 | argininosuccinate lyase. |
| AT5G02640 | hypothetical protein. |
| AT5G02770 | Encodes a conserved eukaryotic protein with homology to the human RNA binding protein CIP29 that localizes to the nucleus. Mutants accumulate more poly(A) mRNAs in the nucleus, likely resulting from reduced mRNA export activity. |
| AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012). |
| AT5G03040 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G03110 | protamine P1 family protein. |
| AT5G03120 | transmembrane protein. |
| AT5G03130 | hypothetical protein. |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein. |
| AT5G03150 | JKD is a nuclear-localized putative transcription factor of the BIRDS/IDD C2H2 zinc finger family. JKD and its homologue BIB, restrict SHR movement to a single layer, the endodermis, and delimit tissue boundaries in the root meristem through a process that involves nuclear retention through protein complex formation. JKD mutation leads to periclinal divisions in the cortex, increased cell numbers in the circumference of the cortical and epidermal layers, a disrupted QC marker expression pattern, and disorganized QC and columella cells. This effect is enhanced in jkd bib double mutants where tissue boundaries cannot be maintained due to excessive SHR movement. JKD and BIB restrict CYCIND6 expression to cortex and endodermis stem cells to prevent formative divisions in the ground tissue. JKD physically interacts with cell fate determinants SCR and SHR in a cell type specific manner. Native FRET-FLIM analysis showed higher JKD-SCR complex in the endodermis and predominant JKD-SHR in the QC and cortex/endodermis stem cells. In addition, JKD, SCR and SHR form a ternary complex whose conformation is cell type dependent, conformational changes of this complex differentially regulate SCR and WOX5 expression to specify endodermal cell fate and QC function respectively. Its mRNA is cell-to-cell mobile. |
| AT5G03160 | J domain protein localized in ER lumen. Can partially compensate for the growth defect in jem1 scj1 mutant yeast. |
| AT5G03190 | peptide upstream protein. |
| AT5G03204 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G03210 | Encodes a small polypeptide contributing to resistance to potyvirus. |
| AT5G03220 | Encodes together with its paralog MED7B a subunit of the middle module of the transcriptional co-regulator Mediator complex. Regulates genes required for normal development of etiolated seedlings. |
| AT5G03230 | senescence regulator (Protein of unknown function, DUF584). |
| AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. |
| AT5G03330 | Cysteine proteinases superfamily protein. |
| AT5G03350 | Belongs to the group of early SA-activated genes. Involved in resistance to Pst Avr-Rpm1 as a component of the SA35 mediated defense processes associated to the ETI response. Involved in resistance to P.syringae pv. tomato Avr-Rpm1 in Arabidopsis, as a component of the SA-mediated defense processes associated with the effector-triggered immunity response. |
| AT5G03360 | cysteine/histidine-rich C1 domain protein. |
| AT5G03370 | acylphosphatase family. |
| AT5G03380 | Heavy metal transport/detoxification superfamily protein. |
| AT5G03390 | hypothetical protein (DUF295). |
| AT5G03455 | Encodes a homolog of yeast cell cycle regulator CDC25. It has a sole catalytic domain and devoid of the N-terminal regulatory region found in the human CDC25 and is capable of reducing the mitotic cell length of transformed fission yeast. Non-plant CDC25 proteins have been shown to do this. However, the gene is more or less constant, regardless of whether the tissue examined contained proliferative cells. Also described as having arsenate reductase activity involved in arsenate resistance. |
| AT5G03460 | transmembrane protein. |
| AT5G03470 | Encodes B' regulatory subunit of PP2A (AtB'alpha), putative size of 57 kDa.Functions redundantly with the beta subunit do maintain sister chromatid cohesion during meiosis. |
| AT5G03552 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGCGGGAAGCAUUUGCACAUG |
| AT5G03555 | Encodes PLUTO (plastidic nucleobase transporter), a member of the Nucleobase:Cation-Symporter1 protein family, capable of transporting purine and pyrimidine nucleobases. |
| AT5G03630 | Pyridine nucleotide-disulfide oxidoreductase family protein. |
| AT5G03660 | transcriptional activator (DUF662). |
| AT5G03668 | Natural antisense transcript overlaps with AT5G03670. |
| AT5G03670 | histone-lysine N-methyltransferase SETD1B-like protein. |
| AT5G03690 | Aldolase superfamily protein. |
| AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein. |
| AT5G03730 | Homologous to the RAF family of serine/threonine protein kinases. Negative regulator in the ethylene signal transduction pathway. Interacts with the putative ethylene receptors ETR1 and ERS. Constitutively expressed. |
| AT5G03740 | HD2-type histone deacetylase HDAC. Involved in the ABA and stress responses. Mediates transcriptional repression via histone modification. |
| AT5G03770 | Encodes a putative KDO (3-deoxy-D-manno-octulosonate) transferase |
| AT5G04020 | calmodulin binding protein. |
| AT5G04040 | Encodes a triacylglycerol lipase that is involved in storage lipid breakdown during seed germination. The mutant plant exhibits a much slower rate of postgerminative growth than the wild type. |
| AT5G04120 | Encodes a cofactor-dependent phosphoglycerate mutase (dPGM) - like protein with phosphoserine phosphatase activity that may be responsible for serine anabolism. |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT5G04310 | Pectin lyase-like superfamily protein. |
| AT5G04320 | Encodes a protein that protects meiotic centromere cohesion. |
| AT5G04330 | Cytochrome P450 superfamily protein. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT5G04360 | Encodes an enzyme thought to be involved in the hydrolysis of the α-1,6 linkages during starch degradation in seed endosperm. However, a knockout mutant of Arabidopsis lacking limit dextrinase has normal rates of starch degradation in the leaf at night, indicating that more than one isoamylases might be involved in this process. |
| AT5G04370 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes NAMT1, a methyltransferase that methylates nicotinic acid to yield methyl nicotinate. |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT5G04520 | 3-oxoacyl-acyl-carrier synthase-like protein (Protein of unknown function DUF455). |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G04540 | Myotubularin-like phosphatases II superfamily. |
| AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668). |
| AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
| AT5G04590 | A.thaliana gene encoding sulfite reductase. |
| AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
| AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
| AT5G04830 | Nuclear transport factor 2 (NTF2) family protein. |
| AT5G04860 | splicing factor 3A subunit. |
| AT5G04920 | EAP30/Vps36 family protein. |
| AT5G04930 | Encodes a putative aminophospholipid translocase (p-type ATPase) involved in chilling response. It is targeted to the plasma membrane following association in the endoplasmic reticulum with an ALIS protein beta-subunit. |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein. |
| AT5G05150 | autophagy-related protein 18E. |
| AT5G05250 | hypothetical protein. |
| AT5G05290 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT5G05300 | IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens. |
| AT5G05440 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G05450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT5G05460 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
| AT5G05590 | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in the tryptophan biosynthetic pathway. |
| AT5G05598 | Encodes a Defensin-like (DEFL) family protein |
| AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT5G05610 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. |
| AT5G05690 | Encodes a member of the CP90A family, a cytochrome P450 monooxygenase which converts 6-deoxocathasterone to 6-deoxoteasterone in the late C6 oxidation pathway and cathasterone to teasterone in the early C6 oxidation pathway of brassinolide biosynthesis. |
| AT5G05700 | Encodes an arginyl-tRNA:protein transferase (ATE1), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. |
| AT5G05730 | ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots. |
| AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
| AT5G05870 | UDP-glucosyl transferase 76C1. |
| AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
| AT5G06070 | Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus. |
| AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT5G06240 | embryo defective 2735. |
| AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
| AT5G06278 | pseudogene of abscisic acid-responsive HVA22 family protein |
| AT5G06290 | Encodes a 2-Cys peroxiredoxin (2-Cys PrxB) that contains two catalytic Cys residues. |
| AT5G06300 | Putative lysine decarboxylase family protein. |
| AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
| AT5G06480 | Immunoglobulin E-set superfamily protein. |
| AT5G06490 | RING/U-box superfamily protein. |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT5G06570 | alpha/beta-Hydrolases superfamily protein. |
| AT5G06580 | Encodes a protein with glycolate dehydrogenase activity, which was shown to complement various subunits of the E. coli glycolate oxidase complex. It has not been ruled out that the enzyme might be involved in other catalytic activities in vivo. |
| AT5G06660 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane). |
| AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
| AT5G06750 | Protein phosphatase 2C family protein. |
| AT5G06755 | hypothetical protein. |
| AT5G06790 | cotton fiber protein. |
| AT5G06839 | bZIP transcription factor family protein. |
| AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT5G06865 | Natural antisense transcript overlaps with AT5G06860. |
| AT5G06870 | Encodes a polygalacturonase inhibiting protein involved in plant defense response. PGIPs inhibit the activity of pectin degrading enzymes such as those produced by fungal pathogens. PGIP2 is induced by fungal infection and methyl jasmonate.Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
| AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617). |
| AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
| AT5G07020 | Encodes an integral thylakoid membrane protein that interacts with PSII core complexes and contributes to the maintenance of PSII homeostasis upon exposure to photoinhibitory light conditions by participating in the protection and stabilization of PSII under photoinhibitory stress. |
| AT5G07070 | Encodes CBL-interacting protein kinase 2 (CIPK2). |
| AT5G07080 | Encodes enzymes that can efficiently convert putrescine and caffeoyl-CoA to di-caffeoyl putrescine. |
| AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
| AT5G07110 | Encodes PRA1.B6, an isoform of the PRA1 (Prenylated Rab acceptors) family. PRAs bind to prenylated Rab proteins and possibly aids in targeting Rabs to their respective compartments. PRA1.B6 localizes to the Golgi apparatus and its ER-to-Golgi trafficking and localization to the Golgi apparatus are regulated by multiple sequence motifs in both the C- and N-terminal cytoplasmic domains. |
| AT5G07200 | encodes a gibberellin 20-oxidase. |
| AT5G07215 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT5G07220 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. |
| AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
| AT5G07300 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT5G07310 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting. |
| AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA). |
| AT5G07320 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT5G07350 | RNA binding protein with nuclease activity essential for stress response. Involved in mechanisms acting on mRNAs entering the secretory pathway. Functionally redundant with TSN2. |
| AT5G07360 | Amidase family protein. |
| AT5G07430 | Pectin lyase-like superfamily protein. |
| AT5G07440 | Encodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT5G07460 | ubiquitous enzyme that repairs oxidatively damaged proteins. Methionine sulfoxide reductase activity. Mutant lacking reductase activity showed increased protein oxidation, nitration and glycation of specific amino acid residues during darkness. |
| AT5G07470 | ubiquitous enzyme that repairs oxidatively damaged proteins |
| AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT5G07675 | pre-tRNA tRNA-Ala (anticodon: AGC). |
| AT5G07730 | transmembrane protein. |
| AT5G07740 | actin binding protein. |
| AT5G07860 | HXXXD-type acyl-transferase family protein. |
| AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
| AT5G07980 | dentin sialophosphoprotein-like protein. |
| AT5G08075 | pre-tRNA tRNA-Ala (anticodon: CGC). |
| AT5G08080 | member of SYP13 Gene Family |
| AT5G08110 | Plays a role in the maintenance of genome stability and the repair of aberrant replication intermediates in the root meristem. Is involved with RAD1, FAN1, and RECQ4A in the repair of DNA CLs. |
| AT5G08120 | Microtubule-associated and viral movement protein binding protein. Negatively regulates KN1 association to plasmodesmata and, consequently, cell-to-cell transport. Involved in the alignment of cortical microtubules, the patterning of stomata and in restricting tobamoviral infections. |
| AT5G08130 | Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. |
| AT5G08139 | RING/U-box superfamily protein. |
| AT5G08185 | Encodes a microRNA that targets DCL1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGAUAAACCUCUGCAUCCAG |
| AT5G08190 | nuclear factor Y, subunit B12. |
| AT5G08240 | transmembrane protein. |
| AT5G08250 | Cytochrome P450 superfamily protein. |
| AT5G08320 | E2F-associated phosphoprotein. |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT5G08380 | alpha-galactosidase 1. |
| AT5G08420 | RNA-binding KH domain-containing protein. |
| AT5G08430 | SWIB/MDM2 and Plus-3 and GYF domain-containing protein. |
| AT5G08510 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT5G09350 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta2. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta2 is 83% identical to PI-4kbeta1 encoded by At5g64070. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta1, leads to the formation of abnormal root hairs. |
| AT5G09360 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G09440 | EXORDIUM like 4. |
| AT5G09513 | pseudogene of hAT dimerisation domain-containing protein |
| AT5G09520 | hydroxyproline-rich glycoprotein family protein. |
| AT5G09620 | Octicosapeptide/Phox/Bem1p family protein. |
| AT5G09630 | LisH/CRA/RING-U-box domains-containing protein. |
| AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
| AT5G09655 | pre-tRNA tRNA-Val (anticodon: AAC). |
| AT5G09660 | encodes a microbody NAD-dependent malate dehydrogenase encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G09810 | Member of Actin gene family.Mutants are defective in germination and root growth. |
| AT5G09850 | Transcription elongation factor (TFIIS) family protein. |
| AT5G09860 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. One of the pathways affected by THO1 is the miRNA399-PHO2 pathway that regulates root APase activity. |
| AT5G09870 | Encodes a cellulose synthase CESA5 that produces seed mucilage cellulose. |
| AT5G09876 | hypothetical protein. |
| AT5G09890 | Protein kinase family protein. |
| AT5G09900 | Encodes one of two isoforms for the 26S proteasome regulatory protein (RN) subunit RPN5. For many functions it acts redundantly with the paralogous gene RPN5b but also appears to exert independent effects. |
| AT5G09970 | Member of CYP78A family. Paralog of CYP78A5 and appears to function in a shoot meristem maintainence pathway with LAMP1 that parallels AMP1/CYP87A5. |
| AT5G09975 | pre-tRNA tRNA-Leu (anticodon: AAG). |
| AT5G09976 | hypothetical protein. |
| AT5G09978 | elicitor peptide 7 precursor. |
| AT5G09980 | elicitor peptide 4 precursor. |
| AT5G10020 | Leucine-rich receptor-like protein kinase family protein. |
| AT5G10030 | Encodes a member of basic leucine zipper transcription gene family. Nomenclature according to Xiang, et al. (1997). |
| AT5G10040 | transmembrane protein. |
| AT5G10110 | DNA-directed RNA polymerase subunit beta. |
| AT5G10150 | SOK2 is a DUF966 domain containing protein of unknown function. Expressed in discrete domains of the PM. In root endodermis and embryo, expression is in inner basal edges and in basal |
| AT5G10170 | myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G10200 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein. |
| AT5G10210 | nitric oxide synthase-interacting protein. |
| AT5G10290 | leucine-rich repeat transmembrane protein kinase family protein. |
| AT5G10300 | Encodes a protein with R-selective hydroxynitrile lyase activity. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. |
| AT5G10504 | unknown protein |
| AT5G10540 | Zincin-like metalloproteases family protein. |
| AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
| AT5G10570 | Encodes a myo-inositol hexakisphosphate kinase. |
| AT5G10572 | Encodes a H/ACA-box snoRNA (snoR77). Gb: AL353995 |
| AT5G10720 | member of Histidine Kinase |
| AT5G10750 | enhanced disease resistance-like protein (DUF1336). |
| AT5G10820 | Major facilitator superfamily protein. |
| AT5G10830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT5G10946 | hypothetical protein. |
| AT5G10990 | SAUR-like auxin-responsive protein family. |
| AT5G11000 | hypothetical protein (DUF868). |
| AT5G11090 | serine-rich protein-like protein. |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein. |
| AT5G11230 | Nucleotide-sugar transporter family protein. |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT5G11270 | Encodes a homeodomain transcription factor involved in mediating resistance to infection by necrotrophic pathogens dependent on perception of jasmonic acid through COI1. Expressed in the nucleus. Downregulated upon fungal infection. Also involved in drought tolerance. |
| AT5G11460 | FCS like zinc finger 10 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT5G11500 | coiled-coil protein. |
| AT5G11510 | Arabidopsis thaliana putative c-myb-like transcription factor MYB3R-4. Functions in powdery mildew induced host endoreduplication at the site of infection. Activates mitotic gene expression, cytokinin response. |
| AT5G11530 | Involved in regulating reproductive development |
| AT5G11550 | ARM repeat superfamily protein. |
| AT5G11560 | catalytics. |
| AT5G11590 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT5G11670 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis. |
| AT5G11700 | ephrin type-B receptor. |
| AT5G11740 | Encodes arabinogalactan protein (AGP15). |
| AT5G11800 | member of Putative potassium proton antiporter family |
| AT5G11810 | rhomboid family protein. |
| AT5G11890 | harpin-induced protein. |
| AT5G11930 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT5G11940 | Subtilase family protein. |
| AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
| AT5G11960 | magnesium transporter, putative (DUF803). |
| AT5G11970 | ABC family ABC transporter, putative (DUF3511). |
| AT5G12060 | Plant self-incompatibility protein S1 family. |
| AT5G12170 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
| AT5G12330 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation. |
| AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT5G12480 | calmodulin-domain protein kinase CDPK isoform 7 (CPK7) |
| AT5G12840 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT5G12890 | UDP-Glycosyltransferase superfamily protein. |
| AT5G12900 | DNA double-strand break repair RAD50 ATPase. |
| AT5G12930 | inactive rhomboid protein. |
| AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
| AT5G13100 | Gap junction beta-4 protein. |
| AT5G13110 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is most highly expressed in root. |
| AT5G13120 | Encodes a lumenal cyclophilin with peptidyl-prolyl isomerase activity that is associated with the NAD(P)H dehydrogenase complex in stromal regions of the thylakoid membrane. It is likely to be important for the accumulation of the hydrophobic domain of the NAD(P)H dehydrogenase complex. This complex is associated with PSI and is responsible for the reduction of plastoquinone. |
| AT5G13170 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
| AT5G13200 | Encodes a protein with unknown function that is involved in hormone mediated regulation of seed germination/dormancy. |
| AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
| AT5G13225 | snoRNA. |
| AT5G13240 | Global repressor of RNA polymerase III (Pol III). Maf1 repressor activity is critical for plant survival during environmental stresses, and is regulated by its phosphorylation/dephosphorylation through the activity of TOR and PP4/PP2A phosphatases. |
| AT5G13250 | RING finger protein. |
| AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
| AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G13460 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G13490 | Encodes mitochondrial ADP/ATP carrier |
| AT5G13500 | Hyp O-arabinosyltransferase-like protein. |
| AT5G13530 | Encodes KEEP ON GOING (KEG), a RING E3 ligase involved in abscisic acid signaling. KEG is essential for Arabidopsis growth and development. ABA promotes KEG degradation via the ubiquitin dependent 26S proteasome pathway. Associates with and ubiquitinates MKK4 and MKK5 to regulate plant immunity. |
| AT5G13550 | Encodes a sulfate transporter. |
| AT5G13690 | Encodes an enzyme that is predicted to act as an alpha-N-acetylglucosaminidase (NAGLU). An naglu mutant arrests early in seed development but does not appear to have male or female gametophytic defects. Transcript levels for this gene are increased during reproductive development. |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT5G13710 | SMT1 controls the level of cholesterol in plants |
| AT5G13730 | Encodes sigma 4 factor, involved in regulating the activity of the plastid-encoded RNA polymerase PEP. Regulates the overall quantity of NDH complexes and thus influences NDH activity. |
| AT5G13740 | Encodes ZIF1 (ZINC-INDUCED FACILITATOR1), a member of the Major Facilitator Superfamily (MFS) of membrane proteins which are found in all organisms and transport a wide range of small, organic molecules. Involved in a mechanism of Zn sequestration, possibly by transport of a Zn ligand or Zn-ligand complex into vacuoles. |
| AT5G13750 | zinc induced facilitator-like 1. |
| AT5G13760 | Plasma-membrane choline transporter family protein. |
| AT5G13800 | Encodes a pheophytinase that is involved in chlorophyll breakdown. Its transcript levels increase during senescence and pph-1 mutants have a stay-green phenotype. |
| AT5G13810 | Glutaredoxin family protein. |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G13920 | GRF zinc finger / Zinc knuckle protein. |
| AT5G13960 | Encodes a histone 3 lysine 9 specific methyltransferase involved in the maintenance of DNA methylation. SUVH4/KYP is a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. In kyp mutants, there is a loss of CpNpG methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs via its SRA domain but has a preference for the latter two. There is also evidence that KYP/SUVH4 might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT5G13990 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane and is not found to colocalize with or interact with core exocyst subunits. |
| AT5G14000 | NAC domain containing protein 84. |
| AT5G14105 | hypothetical protein. |
| AT5G14110 | peroxidase (DUF 3339). |
| AT5G14120 | Major facilitator superfamily protein. |
| AT5G14200 | The AtIMD1 is one out of 3 genes encoding the enzyme 3-isopropylmalate dehydrogenase involved in leucine biosynthesis in Arabidopsis. Its subcellular location has been targeted to plastids. Encodes methylthioalkylmalate dehydrogenase. Involved in glucosinolate biosynthesis, in methionine chain elongation. |
| AT5G14210 | Leucine-rich repeat protein kinase family protein. |
| AT5G14340 | Member of the R2R3 factor gene family. |
| AT5G14345 | Encodes a Uclacyanin/Basic blue family protein |
| AT5G14350 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT5G14360 | Ubiquitin-like superfamily protein. |
| AT5G14390 | alpha/beta-Hydrolases superfamily protein. |
| AT5G14420 | Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. |
| AT5G14430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT5G14510 | Armadillo (ARM) repeat containing protein involved in vascular development. |
| AT5G14620 | A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues. |
| AT5G14640 | shaggy-like kinase 13. |
| AT5G14690 | transmembrane protein. |
| AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT5G14710 | proteasome assembly chaperone-like protein. |
| AT5G14730 | Unknown protein, expression induced by IDL7 and stress. |
| AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
| AT5G14950 | Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans. |
| AT5G15040 | Paired amphipathic helix (PAH2) superfamily protein. |
| AT5G15050 | Encodes GlcAT14B. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
| AT5G15070 | Encodes a functional VIP1/PPIP5K-type ATP-grasp kinase that is involved in both InsP6 to InsP7 conversion and InsP7 to InsP8 conversion. It is the minor isoform in plants and is expressed in pollen. |
| AT5G15080 | Protein kinase superfamily protein. |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637). |
| AT5G15140 | Galactose mutarotase-like superfamily protein. |
| AT5G15150 | homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem. |
| AT5G15190 | hypothetical protein. |
| AT5G15200 | Ribosomal protein S4. |
| AT5G15220 | Ribosomal protein L27 family protein. |
| AT5G15230 | Encodes gibberellin-regulated protein GASA4. Promotes GA responses and exhibits redox activity. |
| AT5G15240 | Transmembrane amino acid transporter family protein. |
| AT5G15320 | ATP synthase E chain. |
| AT5G15350 | early nodulin-like protein 17. |
| AT5G15420 | hypothetical protein. |
| AT5G15430 | Plant calmodulin-binding protein-like protein. |
| AT5G15580 | Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function. |
| AT5G15581 | transmembrane protein. |
| AT5G15600 | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
| AT5G15650 | RGP2 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1(at3g02230)/rgp2 double mutants have a male gametophyte lethal phenotype. RGP2 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. RGP2 was originally identified as Reversibly Glycosylated Polypeptide-2. Constitutive expression in tobacco impairs plant development and virus spread. |
| AT5G15700 | Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast. |
| AT5G15740 | RRT1 is a member of a novel glycosyltransferase famly in plants. It functions as a rhamnosyltransferase, elongating the RG-1 backbone. It functions during seed coat mucilage development. |
| AT5G15860 | Encodes a protein with prenylcysteine methylesterase activity. |
| AT5G15870 | glycosyl hydrolase family 81 protein. |
| AT5G15940 | NAD(P)-binding Rossmann-fold superfamily protein. |
| AT5G15948 | unknown protein |
| AT5G15950 | Adenosylmethionine decarboxylase family protein. |
| AT5G15970 | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance. |
| AT5G15995 | transposable_element_gene.;Mutator-like transposase family |
| AT5G16000 | NSP-interacting kinase (NIK1), receptor-like kinase, involved in defense response against geminivirus It acts as a virulence target of the begomovirus nuclear shuttle protein (NSP). |
| AT5G16010 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein. |
| AT5G16020 | Encodes GEX3, a plasma membrane localized protein expressed in the male gametophyte. Required for micropylar pollen tube guidance. Also plays a role during early embryogenesis. |
| AT5G16120 | alpha/beta-Hydrolases superfamily protein. |
| AT5G16140 | Peptidyl-tRNA hydrolase family protein. |
| AT5G16150 | Encodes a putative plastidic glucose transporter. |
| AT5G16190 | encodes a gene similar to cellulose synthase |
| AT5G16200 | 50S ribosomal protein-like protein. |
| AT5G16210 | HEAT repeat-containing protein. |
| AT5G16220 | Octicosapeptide/Phox/Bem1p family protein. |
| AT5G16286 | unknown protein |
| AT5G16290 | Encodes a regulatory subunit of acetohydroxy acid synthase (AHAS), the first committed enzyme in the branched chain amino acid biosynthesis pathway. |
| AT5G16340 | AMP-dependent synthetase and ligase family protein. |
| AT5G16350 | O-acyltransferase (WSD1-like) family protein. |
| AT5G16360 | NC domain-containing protein-like protein. |
| AT5G16370 | acyl activating enzyme 5. |
| AT5G16375 | pre-tRNA tRNA-Ser (anticodon: AGA). |
| AT5G16380 | autophagy-like protein, putative (Protein of unknown function, DUF538). |
| AT5G16410 | HXXXD-type acyl-transferase family protein. |
| AT5G16420 | Pentatricopeptide repeat (PPR-like) superfamily protein. |
| AT5G16560 | Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis. |
| AT5G16567 | unknown protein |
| AT5G16600 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT5G16630 | DNA repair protein Rad4 family. |
| AT5G16640 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT5G16730 | Encodes a microtubule-associated protein. |
| AT5G16750 | Encodes a nucleolar localized WD-40 repeat protein that is preferentially expressed in dividing cells and is required for regulated division planes and embryo development. |
| AT5G16760 | Encodes a inositol 1,3,4-trisphosphate 5/6-kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
| AT5G16770 | Member of the R2R3 factor gene family. |
| AT5G16810 | Protein kinase superfamily protein. |
| AT5G16820 | Encodes a putative transcription factor whose expression is not induced by heat but whose stable overexpression leads to expression of HSP. Required early in the stress response for transient expression of heat shock genes. |
| AT5G16830 | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
| AT5G16840 | Binds to ACD11 and fungal elicitor RxLR207. Regulates ROS mediated defense response. |
| AT5G16900 | Leucine-rich repeat protein kinase family protein. |
| AT5G16910 | encodes a gene similar to cellulose synthase. |
| AT5G17070 | Encodes a PP4R2 domain protein that likely functions as a regulatory subunit of PP4, a highly conserved ser/thr protein phosphatase. |
| AT5G17240 | SET domain group 40. |
| AT5G17270 | Protein prenylyltransferase superfamily protein. |
| AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
| AT5G17330 | Encodes one of two isoforms of glutamate decarboxylase. |
| AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C. |
| AT5G17480 | pollen calcium-binding protein 1. |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT5G17500 | Glycosyl hydrolase superfamily protein. |
| AT5G17560 | BolA-like family protein. |
| AT5G17640 | Expression of this gene is induced by abscisic acid and salt stress. |
| AT5G17650 | glycine/proline-rich protein. |
| AT5G17660 | tRNA (guanine-N-7) methyltransferase. |
| AT5G17710 | Chloroplast GrpE protein involved in chloroplastic response to heat stress and the correct oligomerization of the photosynthesis-related LHCII complex. |
| AT5G17760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT5G17795 | unknown protein |
| AT5G17820 | Peroxidase superfamily protein, overexpression increases ROS. |
| AT5G17850 | CCX2 is a putative cation/Ca2+ exchange protein. |
| AT5G17870 | plastid-specific ribosomal protein 6 precursor (Psrp-6) - like |
| AT5G17910 | cardiomyopathy-associated protein. |
| AT5G17920 | Encodes a cytosolic cobalamin-independent methionine synthase, involved in methionine regeneration via the activated methyl cycle (SAM cycle). The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. |
| AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein. |
| AT5G17990 | Encodes the tryptophan biosynthetic enzyme phosphoribosylanthranilate transferase (PAT1, called trpD in bacteria). Converts anthranilate and phosphoribosylpyrophosphate into phosphoribosylanthranilate and inorganic pyrophosphate. |
| AT5G18130 | transmembrane protein. |
| AT5G18140 | Chaperone DnaJ-domain superfamily protein. |
| AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
| AT5G18190 | Casein kinase involved in phosphorylation and ubiquination of RYR/PYLs, resulting in negative regulation of ABA response.Also annotated as MUT9-LIKE kinase that functions as H3-T3 specific histone kinase. |
| AT5G18200 | encodes an adenylyltransferase |
| AT5G18270 | NAC domain containing protein 87. |
| AT5G18280 | Encodes an enzyme with ATPase and ADPase activity (an apyrase) that when mutated in combination with ATAPY1 causes a complete inhibition of pollen germination. |
| AT5G18310 | ubiquitin hydrolase. |
| AT5G18460 | carboxyl-terminal peptidase (DUF239). |
| AT5G18470 | Curculin-like (mannose-binding) lectin family protein. |
| AT5G18480 | Encodes an IPC (inositol phosphorylceramide) glucuronosyltransferase. Defects in transmission via the pollen are evident but the defect in transmission through the male gametophyte is not due to improper pollen development or inability of pollen tubes to germinate and grow. Using a pollen specific complementation strategy to obtain homozygotes, loss of function results in constitutive hypersensitive response and severe growth defects. |
| AT5G18490 | vacuolar sorting-associated protein (DUF946). |
| AT5G18600 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
| AT5G18620 | Encodes a member of the A. thaliana imitation switch (AtISWI) subfamily of chromatin remodeling factors. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density. |
| AT5G18630 | alpha/beta-Hydrolases superfamily protein. |
| AT5G18640 | alpha/beta-Hydrolases superfamily protein. |
| AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. |
| AT5G18670 | putative beta-amylase BMY3 (BMY3) |
| AT5G18680 | Member of TLP family of tubby like proteins that also contain an F-Box. Localized to the plasma membrane. |
| AT5G18850 | Low-density receptor-like protein. |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT5G18940 | Mo25 family protein. |
| AT5G18950 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT5G18960 | Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and NINJA glucosinolate biosynthesis. |
| AT5G19015 | transposable_element_gene.;CACTA-like transposase family (Tnp2/En/Spm) |
| AT5G19020 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
| AT5G19040 | Encodes cytokinin synthase. |
| AT5G19060 | cytochrome P450 family protein. |
| AT5G19070 | SNARE associated Golgi protein family. |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein. |
| AT5G19095 | pre-tRNA tRNA-Gly (anticodon: GCC). |
| AT5G19100 | Eukaryotic aspartyl protease family protein. |
| AT5G19110 | Eukaryotic aspartyl protease family protein. |
| AT5G19120 | Eukaryotic aspartyl protease family protein. |
| AT5G19190 | hypothetical protein. |
| AT5G19200 | Encodes one of the Arabidopsis proteins (At3g06060/TSC10A and At5g19200/TSC10B) with significant similarity to the yeast 3-ketodihydrosphinganine (3-KDS) reductase, Tsc10p. Both TSC10A and TSC10B are bona fide 3-KDS reductase as shown by complementation experiment in yeast. |
| AT5G19230 | Glycoprotein membrane precursor GPI-anchored. |
| AT5G19257 | unknown protein |
| AT5G19380 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
| AT5G19450 | calcium-dependent protein kinase (CDPK19) mRNA, complete |
| AT5G19460 | nudix hydrolase homolog 20. |
| AT5G19520 | mechanosensitive channel of small conductance-like 9. |
| AT5G19810 | Proline-rich extensin-like family protein. |
| AT5G19820 | Encodes an importin that transports HYL1, a component of the microprocessor, from the cytoplasm to the nucleus to constitute functional microprocessor, thereby affecting miRNA processing. Knockdown amiR mutants significantly reduced nuclear portion of HYL1 protein and correspondingly compromised the pri-miRNA processing in the nucleus.KETCH1 may protect RPs from the 26S proteasome-mediated degradation. |
| AT5G19875 | transmembrane protein. |
| AT5G19970 | GRAS family transcription factor family protein. |
| AT5G19990 | 26S proteasome AAA-ATPase subunit |
| AT5G20110 | Dynein light chain type 1 family protein. |
| AT5G20150 | Expression is upregulated in the shoot of cax1/cax3 mutant. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
| AT5G20190 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT5G20500 | Glutaredoxin family protein. |
| AT5G20550 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT5G20700 | senescence-associated family protein, putative (DUF581). |
| AT5G20890 | TCP-1/cpn60 chaperonin family protein. |
| AT5G20900 | jasmonate-zim-domain protein 12. |
| AT5G21090 | Leucine-rich repeat (LRR) family protein. |
| AT5G21100 | Plant L-ascorbate oxidase. |
| AT5G21105 | Plant L-ascorbate oxidase. |
| AT5G21110 | unknown protein |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein. |
| AT5G21960 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G21970 | Ubiquitin carboxyl-terminal hydrolase family protein. |
| AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. |
| AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
| AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
| AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1 |
| AT5G22270 | hypothetical protein. |
| AT5G22315 | pre-tRNA tRNA-Gln (anticodon: CTG). |
| AT5G22355 | Cysteine/Histidine-rich C1 domain family protein. |
| AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein. |
| AT5G22410 | root hair specific 18. |
| AT5G22490 | O-acyltransferase (WSD1-like) family protein. |
| AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
| AT5G22540 | Associated with a QTL for quantitative disease resistance. |
| AT5G22545 | hypothetical protein. |
| AT5G22570 | member of WRKY Transcription Factor; Group III |
| AT5G22580 | Stress responsive A/B Barrel Domain-containing protein. |
| AT5G22620 | encodes a putative 2-carboxy-D-arabinitol 1-phosphate phosphatase |
| AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. |
| AT5G22780 | Adaptor protein complex AP-2, alpha subunit. |
| AT5G22850 | Eukaryotic aspartyl protease family protein. |
| AT5G22900 | member of Putative Na+/H+ antiporter family |
| AT5G22910 | member of Putative Na+/H+ antiporter family |
| AT5G23010 | Encodes a methylthioalkylmalate synthase, catalyzes the condensation reactions of the first two rounds of methionine chain elongation in the biosynthesis of methionine-derived glucosinolates. |
| AT5G23027 | unknown protein |
| AT5G23100 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617). |
| AT5G23140 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). This mitochondrial CLPP2 assists coordination and homeostasis of respiratory complexes. |
| AT5G23150 | Putative transcription factor. Member of the floral homeotic AGAMOUS pathway.Mutations in HUA enhance the phenotype of mild ag-4 allele. Single hua mutants are early flowering and have reduced levels of FLC mRNA. Other MADS box flowering time genes such as FLM and MAF2 also appear to be regulated by HUA2. HUA2 normally activates FLC expression and enhances AG function. HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT5G23220 | nicotinamidase 3. |
| AT5G23235 | pseudogene of DNAJ heat shock N-terminal domain-containing protein. |
| AT5G23280 | Transcription factor which plays an important role during leaf and hypocotyl development, redundantly, with at least six class I TCPs, and regulates the expression of CYCD1;1 to affect endoreplication. |
| AT5G23370 | GRAM domain-containing protein / ABA-responsive protein-like protein. |
| AT5G23440 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 1. |
| AT5G23450 | Encodes a sphingosine kinase that specifically phosphorylates D-erythro-dihydrosphingosine (DHS), but not N-acetyl-DHS or D-threo-DHS. It also also phosphorylates D-erythro-sphingosine, trans-4, trans-8-sphingadienine and phytosphingosine. |
| AT5G23460 | hypothetical protein. |
| AT5G23520 | smr (Small MutS Related) domain-containing protein. |
| AT5G23530 | carboxyesterase 18. |
| AT5G23580 | Member of a unique family of enzymes containing a single polypeptide chain with a kinase domain at the amino terminus and a putative calcium-binding EF hands structure at the carboxyl terminus; recombinant protein is fully active and induced by Ca2+ |
| AT5G23590 | DNAJ heat shock N-terminal domain-containing protein. |
| AT5G23680 | Sterile alpha motif (SAM) domain-containing protein. |
| AT5G23690 | Polynucleotide adenylyltransferase family protein. |
| AT5G23810 | Encodes nonfunctional amino acid transporter. AAP7 is the most distantly related member of the AAP family, a group of well characterized amino acid transporters within the ATF1 superfamily. Expression of this gene has not been detected with RNA gel blots or promoter GUS studies. |
| AT5G23820 | ML3 can be modified by NEDD8 and ubiquitin. ML3 expression is regulated by NAI1. ML3 expression is regulated by MeJA, ethylene and wounding. ml3-3 is more susceptible against infections with Alternaria brassicicola and more resistant against infections with Pseudomonas syringae DC3000. |
| AT5G23830 | MD-2-related lipid recognition domain-containing protein. |
| AT5G23840 | MD-2-related lipid recognition domain-containing protein. |
| AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. |
| AT5G23870 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
| AT5G23930 | Mitochondrial transcription termination factor family protein. |
| AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
| AT5G24030 | Encodes a protein with ten predicted transmembrane helices. The SLAH3 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement an slac1-2 mutant suggesting that it performs a similar function. SLAH3:GFP localizes to the plasma membrane. |
| AT5G24080 | Protein kinase superfamily protein. |
| AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
| AT5G24140 | Encodes a protein with similarity to squalene monoxygenases. |
| AT5G24290 | Vacuolar iron transporter (VIT) family protein. |
| AT5G24300 | SSI is a plastidial enzyme and crucial for the synthesis of normal amylopectin in the leaves of Arabidopsis. The absence of SSI results in a deficiency in the number of shorter glucans which in turn affect the formation and connection of the amylopectin clusters in starch. |
| AT5G24310 | One of four ABI-like proteins. |
| AT5G24320 | Transducin/WD40 repeat-like superfamily protein. |
| AT5G24420 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. |
| AT5G24540 | beta glucosidase 31. |
| AT5G24550 | beta glucosidase 32. |
| AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599). |
| AT5G24610 | cyclic AMP-responsive element-binding protein. |
| AT5G24660 | response to low sulfur 2. |
| AT5G24760 | GroES-like zinc-binding dehydrogenase family protein. |
| AT5G24770 | Has acid phosphatase activity dependent on the presence of divalent cations (Mg2+, Co2+, Zn2+, Mn2+) and anti-insect activity. |
| AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
| AT5G24810 | ABC1 family protein. |
| AT5G24820 | Eukaryotic aspartyl protease family protein. |
| AT5G24870 | Ubiquitin E3 ligase, works with WDL7 in module which regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
| AT5G24890 | stress response NST1-like protein. |
| AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT5G25120 | putative cytochrome P450 |
| AT5G25190 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G25220 | A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia |
| AT5G25270 | Ubiquitin-like superfamily protein. |
| AT5G25290 | F-box protein (DUF295). |
| AT5G25350 | Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA. Part of the SCF complex, it is located in the nucleus and is involved in the ethylene-response pathway. |
| AT5G25360 | hypothetical protein. |
| AT5G25451 | Pseudogene of AT5G25440; protein kinase family protein |
| AT5G25460 | Encodes a DUF642 cell wall protein. |
| AT5G25790 | Tesmin/TSO1-like CXC domain-containing protein. |
| AT5G25800 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein. |
| AT5G25810 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. |
| AT5G25830 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G25840 | DUF1677 family protein (DUF1677). |
| AT5G25920 | hypothetical protein. |
| AT5G25930 | kinase family with leucine-rich repeat domain-containing protein. |
| AT5G26140 | Putative lysine decarboxylase family protein. |
| AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G26260 | TRAF-like family protein. |
| AT5G26270 | transmembrane protein. |
| AT5G26280 | TRAF-like family protein. |
| AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
| AT5G26345 | transposable_element_gene.;Mutator-like transposase family |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein. |
| AT5G26610 | D111/G-patch domain-containing protein. |
| AT5G26660 | myb domain protein 86. |
| AT5G26751 | Encodes a SHAGGY-related kinase involved in meristem organization. It regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase 6.Functions as a positive regulator of salt stress tolerance. Phosphorylates and enhances G6PD6 (At5g40760) activity |
| AT5G26760 | Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation. |
| AT5G26950 | AGAMOUS-like 93. |
| AT5G26960 | Galactose oxidase/kelch repeat superfamily protein. |
| AT5G27030 | TOPLESS family member involved in the negative regulation of SNC1-dependent phenotypes. |
| AT5G27043 | pseudogene of cell division cycle 20.2. |
| AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. |
| AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. |
| AT5G27360 | Encodes a sugar-porter family protein that unlike the closely related gene, SFP1, is not induced during leaf senescence. |
| AT5G27380 | Encodes a protein with similarity to glutathione synthetases, which catalyzes one of the early steps in glutathione biosynthesis. Two transcripts have been detected; the longer transcript is less abundant and the protein is localized to the chloroplast. The smaller transcript, in which the transit peptide is truncated, is localized to the cytosol. Increased glutathione accumulation in response to cesium stress. |
| AT5G27395 | Mitochondrial inner membrane translocase complex, subunit Tim44-related protein. |
| AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. |
| AT5G27430 | Signal peptidase subunit. |
| AT5G27520 | encodes a peroxisomal adenine nucleotide transporter, involved in fatty acid beta-oxidation during early stage of postgerminative growth. |
| AT5G27660 | Encodes a protein with similarity to human PARK13, a mitochondrial protease implicated in Parkinson disease. DEG14 is induced by heat stress and involved in degradation of misfolded proteins. |
| AT5G27670 | Encodes HTA7, a histone H2A protein. |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT5G27925 | transposable_element_gene.;copia-like retrotransposon family |
| AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT5G28050 | Cytidine/deoxycytidylate deaminase family protein. |
| AT5G28145 | transposable_element_gene.;copia-like retrotransposon family |
| AT5G28237 | Pyridoxal-5-phosphate-dependent enzyme family protein. |
| AT5G28262 | other_RNA. |
| AT5G28263 | transposable_element_gene.;Mutator-like transposase family |
| AT5G28287 | pseudogene of methylesterase PCR A. |
| AT5G28410 | hypothetical protein. |
| AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
| AT5G28672 | transposable_element_gene. |
| AT5G28913 | Member of Sadhu non-coding retrotransposon family |
| AT5G29015 | transposable_element_gene.;CACTA-like transposase family (En/Spm) |
| AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
| AT5G34930 | arogenate dehydrogenase. |
| AT5G35170 | adenylate kinase family protein. |
| AT5G35180 | ENHANCED DISEASE RESISTANCE protein (DUF1336). |
| AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
| AT5G35750 | Encodes histidine kinase AHK2. |
| AT5G35935 | transposable_element_gene.;copia-like retrotransposon family |
| AT5G35940 | Mannose-binding lectin superfamily protein. |
| AT5G36220 | member of CYP81D family of cytochrome p450s. This gene was originally called CYP91A1, but was later renamed to CYP81D1. |
| AT5G36223 | transposable_element_gene.;pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
| AT5G36900 | hypothetical protein. |
| AT5G36903 | pseudogene of protein related to self-incompatibility |
| AT5G36925 | hypothetical protein. |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT5G37070 | hypothetical protein (Protein of unknown function, DUF538). |
| AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
| AT5G37500 | Encodes a guard cell outward potassium channel. Belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutants have increased water consumption and limited stomatal closure in response to abscisic and jasmonic acids. It forms a heteromeric K(out) channels with SKOR. The gene is expressed ubiquitously in root and the vasculature and guard cells of leaves. Expression is suppressed during agrobacterium-induced tumor formation and increased in response to water deprivation and cold. |
| AT5G37540 | Eukaryotic aspartyl protease family protein. |
| AT5G37610 | Eukaryotic porin family protein. |
| AT5G37740 | Calcium-dependent lipid-binding (CaLB domain) family protein. |
| AT5G37790 | Protein kinase superfamily protein. |
| AT5G37850 | Encodes a pyridoxal kinase required for root hair development. Mutants are hypersensitive to Na+, K+ and Li+. |
| AT5G37950 | UDP-Glycosyltransferase superfamily protein. |
| AT5G37960 | GroES-like family protein. |
| AT5G37990 | SABATH family methyltransferase. |
| AT5G38000 | Zinc-binding dehydrogenase family protein. |
| AT5G38010 | UDP-Glycosyltransferase superfamily protein. |
| AT5G38020 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT). |
| AT5G38096 | Pseudogene of AT5G38100; methyltransferase-related protein |
| AT5G38100 | SABATH family methyltransferase. |
| AT5G38130 | HXXXD-type acyl-transferase family protein. |
| AT5G38140 | nuclear factor Y, subunit C12. |
| AT5G38200 | Class I glutamine amidotransferase-like superfamily protein. |
| AT5G38280 | putative receptor serine/threonine kinase PR5K (PR5K) mRNA, PR5-like receptor kinase |
| AT5G38285 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT5G38560 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT5G38590 | F-box/RNI-like/FBD-like domains-containing protein. |
| AT5G38595 | transposable_element_gene.;similar to zinc ion binding |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein. |
| AT5G38780 | SABATH methyltransferase. |
| AT5G38800 | basic leucine-zipper 43. |
| AT5G38810 | F-box and associated interaction domains-containing protein. |
| AT5G38975 | transposable_element_gene.;copia-like retrotransposon family |
| AT5G39020 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39024 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT5G39070 | transposable_element_gene.;hAT-like transposase family (hobo/Ac/Tam3) |
| AT5G39080 | HXXXD-type acyl-transferase family protein. |
| AT5G39210 | Encodes a protein of the chloroplastic NAD(P)H dehydrogenase complex (NDH Complex) involved in respiration, photosystem I (PSI) cyclic electron transport and CO2 uptake. The product of this gene appears to be essential for the stable formation of the NDH Complex. |
| AT5G39240 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT5G39320 | UDP-glucose 6-dehydrogenase family protein. |
| AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
| AT5G39620 | RAB GTPase homolog G1. |
| AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
| AT5G39790 | Encodes a chloroplast localized protein that is involved in protein translocation and starch metabolism. PTST helps localize GBSS to the starch granules where GBSS functions in amylose biosynthesis. |
| AT5G39800 | Mitochondrial ribosomal protein L27. |
| AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT5G39970 | catalytics. |
| AT5G40210 | nodulin MtN21-like transporter family protein |
| AT5G40212 | Pseudogene of AT5G40240; nodulin MtN21 family protein |
| AT5G40250 | RING/U-box superfamily protein. |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT5G40340 | PWWP domain protein involved in regulation of FLC and flowering time. |
| AT5G40348 | Natural antisense transcript overlaps with AT5G40350. |
| AT5G40384 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACAAAAUCCGUCUUUGAAGA |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT5G40450 | Encodes a member of a plant gene family, APK_ORTHOMCL5144,of unknown function. RBB1 is localized to the cytosol and involved in vacuolar biogenesis and organization. RBB1 mutants have increased number of vacuolar bulbs and fewer trans-vacuolar strands. |
| AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein. |
| AT5G40470 | RNI-like superfamily protein. |
| AT5G40630 | Ubiquitin-like superfamily protein. |
| AT5G40640 | transmembrane protein. |
| AT5G40680 | Galactose oxidase/kelch repeat superfamily protein. |
| AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein. |
| AT5G40700 | transcriptional regulator ATRX-like protein. |
| AT5G40720 | C3H4 type zinc finger protein (DUF23). |
| AT5G40780 | Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. |
| AT5G40790 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40850 | Encodes a urophorphyrin III methylase that catalyzes S-adenosyl-L-methionine-dependent transmethylation in a multistep process involving the formation of a covalently linked complex with S-adenosyl-L-methionine. |
| AT5G40860 | transmembrane protein. |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT5G40900 | Nucleotide-diphospho-sugar transferase family protein. |
| AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT5G41120 | Esterase/lipase/thioesterase family protein. |
| AT5G41130 | Esterase/lipase/thioesterase family protein. |
| AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein. |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT5G41390 | PLAC8 family protein. |
| AT5G41400 | RING/U-box superfamily protein. |
| AT5G41401 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G41410 | Homeodomain protein required for ovule identity. |
| AT5G41600 | VIRB2-interacting protein 3. |
| AT5G41620 | intracellular protein transporter USO1-like protein. |
| AT5G41774 | unknown protein |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. |
| AT5G41810 | Avr9/Cf-9 rapidly elicited protein. |
| AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2. |
| AT5G42000 | Interacts with serine palmitoyltransferase (SPT) to negatively regulate sphingolipid biosynthesis. |
| AT5G42010 | Transducin/WD40 repeat-like superfamily protein. |
| AT5G42030 | ABL interactor-like protein 4. |
| AT5G42040 | regulatory particle non-ATPase 12B. |
| AT5G42100 | encodes a plasmodesmal (Pd)-associated membrane protein involved in plasmodesmal callose degradation, i.e. beta-1,3-glucanase (EC 3.2.1.39), and functions in the gating of Pd |
| AT5G42220 | Ubiquitin-like superfamily protein. |
| AT5G42250 | Zinc-binding alcohol dehydrogenase family protein. |
| AT5G42290 | transcription activator-like protein. |
| AT5G42380 | calmodulin like 37. |
| AT5G42440 | Protein kinase superfamily protein. |
| AT5G42445 | pseudogene of R-protein L3 B. |
| AT5G42500 | Disease resistance-responsive (dirigent-like protein) family protein. |
| AT5G42580 | a member of the cytochrome P450 family |
| AT5G42590 | putative cytochrome P450 |
| AT5G42591 | unknown protein |
| AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
| AT5G42635 | glycine-rich protein. |
| AT5G42645 | transposable_element_gene.;copia-like retrotransposon family |
| AT5G42650 | Encodes a member of the cytochrome p450 CYP74 gene family that functions as an allene oxide synthase. This enzyme catalyzes dehydration of the hydroperoxide to an unstable allene oxide in the JA biosynthetic pathway. It shows a dual catalytic activity, the major one being a 13-AOS but also expressing a 9-AOS activity. CFA-Leu, CFA-Val, CFA-Met and CFA-Ala can induce the expression of AOS. |
| AT5G42677 | Pseudogene of AT5G19630 |
| AT5G42700 | AP2/B3-like transcriptional factor family protein. |
| AT5G42785 | transmembrane protein. |
| AT5G42810 | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level. |
| AT5G42840 | Cysteine/Histidine-rich C1 domain family protein. |
| AT5G42860 | CC2 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. |
| AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT5G42930 | alpha/beta-Hydrolases superfamily protein. |
| AT5G42980 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
| AT5G42990 | ubiquitin-conjugating enzyme 18. |
| AT5G43000 | hypothetical protein. |
| AT5G43030 | Cysteine/Histidine-rich C1 domain family protein. |
| AT5G43035 | transposable_element_gene.;copia-like retrotransposon family |
| AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
| AT5G43140 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein. |
| AT5G43150 | elongation factor. |
| AT5G43160 | QWRF motif protein (DUF566). |
| AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G43190 | Galactose oxidase/kelch repeat superfamily protein. |
| AT5G43260 | chaperone protein dnaJ-like protein. |
| AT5G43270 | Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
| AT5G43350 | Encodes an inorganic phosphate transporter Pht1;1. Mutants display enhanced arsenic accumulation. Under high arsenate concentrations, PHT1;1 levels are reduced and it is delocalized from the plasma membrane. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).PHT1;1 expression is transcriptionally regulated by WRKY6 and by PHR1. |
| AT5G43410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Expression of ERF96 is induced by pathogens, JA and ethylene and over expression leads to increased resistance to resistance to necrotrophic pathogens. It is a nuclear localized, transcriptional activator that binds to GCC elements that is involved in positive regulation of ABA responses. |
| AT5G43560 | Encodes MUSE14, a TRAF domain protein. Regulates the turnover of nucleotide-binding domain and leucine-rich repeat-containing (NLR) immune receptors SNC1 and RPS2. Loss of both MUSE13 and MUSE14 leads to enhanced pathogen resistance, NLR accumulation, and autoimmunity. In addition, MUSE13/14 physically interact with ATG6 and appear to regulate ATG6 ubiquitination and thus formation of autophagosomes. |
| AT5G43570 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. |
| AT5G43580 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein. |
| AT5G43600 | Encodes a protein with ureidoglycolate amidohydrolase activity in vitro. |
| AT5G43650 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT5G43680 | Encodes a TatB--like component of the mitochondrial Twin arginine translocation (Tat) pathway. The protein is localized to the inner mitochondrial membrane that is nuclear-encoded and is essential for plant growth and development. Mutants are embryo lethal. |
| AT5G43690 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT5G43745 | ion channel POLLUX-like protein, putative (DUF1012). |
| AT5G43750 | NAD(P)H dehydrogenase 18. |
| AT5G43760 | Encodes KCS20, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
| AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT5G43830 | aluminum induced protein with YGL and LRDR motifs. |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G43900 | Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner. |
| AT5G43910 | pfkB-like carbohydrate kinase family protein. |
| AT5G43935 | flavonol synthase 6. |
| AT5G43940 | Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility. |
| AT5G44010 | fanconi anemia group F protein (FANCF). |
| AT5G44020 | HAD superfamily, subfamily IIIB acid phosphatase. |
| AT5G44050 | MATE efflux family protein. |
| AT5G44060 | embryo sac development arrest protein. |
| AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
| AT5G44255 | transposable_element_gene.;gypsy-like retrotransposon family |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT5G44290 | Protein kinase superfamily protein. |
| AT5G44350 | ethylene-responsive nuclear protein-like protein. |
| AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC). |
| AT5G44380 | FAD-binding Berberine family protein. |
| AT5G44390 | FAD-binding Berberine family protein. |
| AT5G44460 | Calcium sensor. |
| AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT5G44670 | glycosyltransferase family protein (DUF23). |
| AT5G44680 | DNA glycosylase superfamily protein. |
| AT5G44710 | 37S ribosomal protein S27. |
| AT5G44720 | Molybdenum cofactor sulfurase family protein. |
| AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
| AT5G44820 | Nucleotide-diphospho-sugar transferase family protein. |
| AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT5G45350 | proline-rich family protein. |
| AT5G45360 | Encodes a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT5G45370 | nodulin MtN21-like transporter family protein |
| AT5G45410 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
| AT5G45420 | The gene encodes a MYB transcription factor belons to R2R3-MYB family of transcription factors. Knock-down mutant analysis indicates its role in root hair elongation. |
| AT5G45428 | unknown protein |
| AT5G45430 | Protein kinase superfamily protein. |
| AT5G45480 | transmembrane protein, putative (DUF594). |
| AT5G45490 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT5G45500 | RNI-like superfamily protein. |
| AT5G45510 | Leucine-rich repeat (LRR) family protein. |
| AT5G45530 | transmembrane protein, putative (DUF594). |
| AT5G45580 | GARP-G2-like transcription factor involved in low temperature regulation of flavonoid biosynthesis. |
| AT5G45590 | Ribosomal protein L35. |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT5G45860 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. |
| AT5G46040 | Major facilitator superfamily protein. |
| AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
| AT5G46090 | transmembrane protein, putative (DUF679). |
| AT5G46170 | F-box family protein. |
| AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
| AT5G46220 | Encodes a protein with alkaline ceramidase activity that is involved in regulation of turgor during pollen tube growth and silique stomatal movement. Tod1 is expressed specifically in pollen and silique guard cells. Loss of function mutations have reduced fertility due to defects in pollen transmission. |
| AT5G46230 | ABA responsive SVB family gene. |
| AT5G46240 | Encodes a potassium channel protein (KAT1). ABA triggers KAT1 endocytosis both in epidermal cells as well as guard cells. Upon removal of ABA, KAT1 is recycled back to the plasma membrane. KAT1 is localized within 0.5?0.6 μm diameter microdomains at the plasma membrane surface. KAT1 belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. |
| AT5G46400 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
| AT5G46750 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT5G46760 | MYC3 is a JAZ-interacting transcription factor that act together with MYC2 and MYC4 to activate JA-responses. |
| AT5G46770 | hypothetical protein. |
| AT5G46820 | carboxyl-terminal proteinase-like protein, putative (DUF239). |
| AT5G46880 | homeobox-7. |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein. |
| AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
| AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein. |
| AT5G47110 | Encodes a light-harvesting-like protein that is involved in chlorophyll and tocopherol biosynthesis anchoring geranylgeranyl reductase in the thylakoid membrane. |
| AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. |
| AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein. |
| AT5G47190 | Ribosomal protein L19 family protein. |
| AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
| AT5G47230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G47240 | nudix hydrolase homolog 8. |
| AT5G47250 | LRR and NB-ARC domains-containing disease resistance protein. |
| AT5G47260 | putative disease resistance protein. |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547). |
| AT5G47480 | RGPR-related protein; SEC16A homolog. Part of endomembrane trafficking system. |
| AT5G47490 | RGPR-like protein. |
| AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
| AT5G47620 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT5G47630 | Encodes a member of the mitochondrial acyl carrier protein (ACP) family. Its role is currently obscure as it is weakly expressed and has not yet been identified by mitochondrial proteome analysis. |
| AT5G47635 | Pollen Ole e 1 allergen and extensin family protein. |
| AT5G47640 | Involved in the regulation of response to nutrient levels. |
| AT5G47700 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT5G47710 | Calcium-dependent lipid-binding (CaLB domain) family protein. |
| AT5G47730 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT5G47740 | Adenine nucleotide alpha hydrolases-like superfamily protein. |
| AT5G47760 | serine/threonine protein kinase |
| AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
| AT5G47900 | heparan-alpha-glucosaminide N-acetyltransferase-like protein (DUF1624). |
| AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT5G47950 | BIA2 is a putative HXXXD-type BAHD acyltransferase |
| AT5G47980 | HXXXD-type acyl-transferase family protein. |
| AT5G47990 | Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses. |
| AT5G48000 | Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation. |
| AT5G48010 | Encodes an oxidosqualene cyclase involved in the biosynthesis of thalianol, a tricyclic triterpenoid of unknown function. Overexpression of THAS leads to dwarfing in the aerial tissues of Arabidopsis plants, but increases their root length. THAS is part of a small operon-like cluster of genes (with At5g48000 (THAH) and At5g47990 (THAD)) involved in thalianol metabolism. |
| AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
| AT5G48150 | Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. |
| AT5G48170 | encodes an F-box protein whose protein sequence is similar to SLY1, which belongs to SCF-SLY1 E3 ligase complex. SCF-SLY1 E3 ligase degrades DELLA proteins that are involved in promoting growth. Overexpression of SLY2 can partially compensate sly1-10 mutant phenotype of dwarfism. |
| AT5G48200 | hypothetical protein. |
| AT5G48230 | Encodes an acetoacetyl-CoA thiolase that generates the bulk of the acetoacetyl-CoA precursor needed for the cytosolic localized, mevalonate-derived isoprenoids biosynthetic pathway. Loss-of-function mutants are embryo lethal. |
| AT5G48250 | B-box type zinc finger protein with CCT domain-containing protein. |
| AT5G48270 | DUF868 family protein (DUF868). |
| AT5G48410 | member of Putative ligand-gated ion channel subunit family |
| AT5G48540 | receptor-like protein kinase-related family protein. |
| AT5G48545 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT5G48650 | Negative regulator of defense response to Pseudomonas syringae pv. tomato through altered stomatal and apoplastic immunity. |
| AT5G48800 | Phototropic-responsive NPH3 family protein. |
| AT5G48850 | Homologous to the wheat sulphate deficiency-induced gene sdi1. Expression in root and leaf is induced by sulfur starvation. Knockout mutants retained higher root and leaf sulfate concentrations, indicating a role in regulation of stored sulfate pools. |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT5G48900 | Pectin lyase-like superfamily protein. |
| AT5G48960 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase. |
| AT5G49060 | DnaJ heat shock amino-terminal domain protein (DUF1977). |
| AT5G49100 | vitellogenin-like protein. |
| AT5G49160 | Encodes a cytosine methyltransferase MET1. Required for silencing of FWA paternal allele in endosperm. Two lines with RNAi constructs directed against DMT1 have reduced agrobacterium-mediated tumor formation. |
| AT5G49170 | hypothetical protein. |
| AT5G49215 | Pectin lyase-like superfamily protein. |
| AT5G49220 | hypothetical protein (DUF789). |
| AT5G49280 | hydroxyproline-rich glycoprotein family protein. |
| AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. |
| AT5G49440 | hypothetical protein. |
| AT5G49448 | unknown protein |
| AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
| AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. |
| AT5G49615 | trans-acting siRNA (tasi-RNA) |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein. |
| AT5G49700 | Putative AT-hook DNA-binding family protein. |
| AT5G49720 | Encodes a membrane-bound endo-1,4-beta-D-glucanase, involved in cellulose biosynthesis. Loss-of-function mutants have severe cellulose-deficient phenotypes. During cell elongation, KOR1 is associated with Golgi apparatus and early endosome. Inhibition of cellulose biosynthesis promoted a redistribution of KOR1 in subcellular locations. These observations suggest that deposition of cellulose involves the intracellular cycling of KOR1. |
| AT5G49730 | Encodes a plasma membrane-located ferric chelate reductase. Its mRNA is expressed in green aerial tissues (shoot, flower and cotyledon) in a light- and cell differentiation-specific manner. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT5G49800 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT5G49890 | member of Anion channel protein family |
| AT5G49900 | Beta-glucosidase, GBA2 type family protein. |
| AT5G50150 | LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1. |
| AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. |
| AT5G50335 | hypothetical protein. |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G50361 | hypothetical protein. |
| AT5G50370 | Adenylate kinase family protein. |
| AT5G50450 | HCP-like superfamily protein with MYND-type zinc finger. |
| AT5G50460 | secE/sec61-gamma protein transport protein. |
| AT5G50760 | SAUR-like auxin-responsive protein family. |
| AT5G50840 | alpha-taxilin-like protein. |
| AT5G50900 | ARM repeat superfamily protein. |
| AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. |
| AT5G50950 | Encodes a fumarase enzyme initially shown to be in the mitochondria through proteomic studies but later shown to be present in the cytosol using an RFP fluorescent protein tag. It appears to be important for the accumulation of fumarate from malate in leaves in the light, and helps to promote nitrogen assimilation under high nitrogen conditions. It does not appear to be necessary for lipid metabolism and seedling growth. Inhibition of fumarate accumulation results in an overall shift in the cold response of leaves, with a complete inhibition of cold acclimation of photosynthesis. |
| AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT5G50970 | transducin family protein / WD-40 repeat family protein. |
| AT5G51050 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT5G51055 | pre-tRNA tRNA-Ser (anticodon: AGA). |
| AT5G51060 | RHD2 (along with RHD3 and RHD4) is required for normal root hair elongation. Has NADPH oxidase activity. Gene is expressed in the elongation and differention zone in trichoblasts and elongating root hairs. RDH2 is localized to the growing tips of root hair cells. It is required for the production of reactive oxygen species in response to extracellular ATP stimulus. The increase in ROS production stimulates Ca2+ influx. |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase. |
| AT5G51270 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G51290 | Encodes a ceramide kinase that plays a role in modulating cell death. |
| AT5G51300 | Encodes a nuclear localized splicing factor homolog that is involved in alternative splicing of some mRNAs. |
| AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
| AT5G51380 | RNI-like superfamily protein. |
| AT5G51390 | hypothetical protein. |
| AT5G51400 | PLAC8 family protein. |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT5G51550 | EXORDIUM like 3. |
| AT5G51580 | hypothetical protein. |
| AT5G51740 | Mitochondrial ATP-independent protease .Important for maintenance of proper function of the oxphos system. |
| AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT5G51820 | Encodes a plastid isoform of the enzyme phosphoglucomutase involved in controlling photosynthetic carbon flow. Effective petiole movement against the direction of the gravity requires functional PGM activity that is required for full development of amyloplasts. |
| AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
| AT5G51940 | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At2g04630. |
| AT5G52065 | transposable_element_gene.;similar to unknown protein |
| AT5G52120 | phloem protein 2-A14. |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G52280 | Myosin heavy chain-related protein. |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4. |
| AT5G52330 | TRAF-like superfamily protein. |
| AT5G52400 | member of CYP715A |
| AT5G52410 | oxidoreductase/transition metal ion-binding protein. |
| AT5G52430 | hydroxyproline-rich glycoprotein family protein. |
| AT5G52510 | SCARECROW-like 8. |
| AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
| AT5G52550 | stress response NST1-like protein. |
| AT5G52552 | unknown protein |
| AT5G52560 | Encodes a protein with UTP:sugar 1-phosphate uridylyltransferase activity |
| AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
| AT5G52797 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAAUUUGGUGUUUCUUCGAUC |
| AT5G52800 | primase/polymerase protein |
| AT5G52840 | NADH-ubiquinone oxidoreductase-like protein. |
| AT5G52870 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52880 | F-box family protein. |
| AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52901 | unknown protein |
| AT5G52980 | ER-based factor for assembly of V-ATPase. |
| AT5G52990 | SNARE-like superfamily protein. |
| AT5G53050 | alpha/beta-Hydrolases superfamily protein. |
| AT5G53160 | Encodes RCAR3, a regulatory component of ABA receptor. Interacts with protein phosphatase 2Cs ABI1 and ABI2. Stimulates ABA signaling. |
| AT5G53170 | encodes an FtsH protease that is localized to the chloroplast and the mitochondrion |
| AT5G53200 | Encodes a R3MYB transcription inhibitor that regulates trichome patterning. Mutants produce trichome clusters whereas other transcriptional inhibitors involved in this patterning are involved in trichome density regulation. Natural hypofunctional alleles producing trichome development in fruits have been found. |
| AT5G53205 | unknown protein |
| AT5G53210 | Encodes a basic helix-loop-helix (bHLH) transcription factor that is necessary and sufficient for the asymmetric divisions that establish the stomatal lineage in Arabidopsis thaliana. Expression of SPCH in young epidermal cells allows these cells to make asymmetric divisions. SPCH is a substrate of a kinase MPK3 and MPK6. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT5G53220 | hypothetical protein. |
| AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT5G53340 | Encodes a hydroxyproline O-galactosyltransferase. |
| AT5G53350 | CLP protease regulatory subunit CLPX mRNA, nuclear gene |
| AT5G53420 | Member of ASML2 family of CCT domain proteins.There is a preferential accumulation of RNA isoforms CCT101.1 and CCT101.2 in response to N-treatment, each isoform has different targets. |
| AT5G53450 | OBP3-responsive protein 1. |
| AT5G53451 | unknown protein |
| AT5G53500 | Transducin/WD40 repeat-like superfamily protein. |
| AT5G53540 | Encodes a P-loop NTPase APP1. |
| AT5G53550 | YELLOW STRIPE like 3. |
| AT5G53588 | unknown protein |
| AT5G53590 | SAUR-like auxin-responsive protein family. |
| AT5G53660 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT5G53750 | CBS domain-containing protein. |
| AT5G53780 | F-box protein, putative (DUF295). |
| AT5G53930 | transcriptional regulator ATRX-like protein. |
| AT5G53940 | Yippee family putative zinc-binding protein. |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. |
| AT5G53980 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT5G53990 | UDP-Glycosyltransferase superfamily protein. |
| AT5G54000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT5G54020 | Cysteine/Histidine-rich C1 domain family protein. |
| AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. |
| AT5G54170 | Polyketide cyclase/dehydrase and lipid transport superfamily protein. |
| AT5G54260 | DNA repair and meiotic recombination protein, component of MRE11 complex with RAD50 and NBS1 |
| AT5G54290 | Encodes CcdA, a thylakoid membrane protein required for the transfer of reducing equivalents from stroma to thylakoid lumen. |
| AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT5G54390 | Encodes a 3'-phosphoadenosine-5'-phosphate (PAP) phosphatase that is sensitive to physiological concentrations of Na+. It does not also act as inositol polyphosphate 1-phosphatases, which other members of the HAL2-like family do. It is proposed that AHL acts in concert with sulphotransferases to prevent both the toxicity of PAP on RNA processing enzymes as well as the product inhibition of PAP on sulphate conjugation. |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT5G54450 | hypothetical protein (DUF295). |
| AT5G54470 | B-box type zinc finger family protein. |
| AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
| AT5G54530 | serine protease, putative (Protein of unknown function, DUF538). |
| AT5G54585 | hypothetical protein. |
| AT5G54590 | Splice variant At5g54590.2 encodes CRLK1 (440-amino acid in length) calcium/calmodulin-regulated receptor-like kinase crucial for cold tolerance. |
| AT5G54670 | Encodes a truncated KatC polypeptide (KatC(207-754)), which includes the carboxyl-terminal region of KatC. This was expressed in Escherichia coli and was shown to possess microtubule-stimulated ATPase activity. |
| AT5G54810 | A.thaliana tryptophan synthase beta subunit (trpB) |
| AT5G54840 | Monomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes. |
| AT5G54940 | Translation initiation factor SUI1 family protein. |
| AT5G54950 | Aconitase family protein. |
| AT5G54960 | pyruvate decarboxylase-2 |
| AT5G54970 | hypothetical protein. |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G55070 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
| AT5G55090 | member of MEKK subfamily |
| AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
| AT5G55170 | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein. |
| AT5G55350 | MBOAT (membrane bound O-acyl transferase) family protein. |
| AT5G55360 | MBOAT (membrane bound O-acyl transferase) family protein. |
| AT5G55390 | Encodes EDM2 (enhanced downy mildew 2). The predicted protein bears typical features of transcriptional regulators. EDM2 contains two putative bipartite nuclear localization signals (NLS) two zinc-finger-like motifs, a Proline-rich region and a large aspartic acid-rich region. Both zinc-finger-like stretches resemble the PHD (plant homeodomain) finger motif. Mutations in EDM2 comprise RPP7 mediated resistance against Hyaloperonospora parasitica isolate Hiks1 (HpHiks1). EDM2 may function as a direct or indirect regulator of RPP7 expression. |
| AT5G55480 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT5G55520 | kinesin-like protein. |
| AT5G55530 | Calcium-dependent lipid-binding (CaLB domain) family protein. |
| AT5G55550 | RNA-binding (RRM/RBD/RNP motifs) family protein. |
| AT5G55700 | In vitro assay indicates no beta-amylase activity of BAM4. However mutation in BAM4 impairs starch breakdown. BAM4 may play a regulatory role. |
| AT5G55720 | Pectin lyase-like superfamily protein. |
| AT5G55730 | Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development. |
| AT5G55790 | hypothetical protein. |
| AT5G55840 | PPR superfamily protein. |
| AT5G55850 | NOI protein |
| AT5G55856 | Ubiquitin-like superfamily protein. |
| AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
| AT5G55896 | transposable_element_gene.;non-LTR retrotransposon family (LINE) |
| AT5G55910 | Member of AGC VIIIa Kinase family. D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. D6PK is associated with sterol enriched membrane rafts and may be involved in regulation of the switch from basal to planar polarity during root hair initiation. Involved in pulse-induced phototropism but also for time-dependent second positive phototropism. Works with PIN3 in the same genetic pathway of hypocotyl phototropism under all light conditions. Involved in the generation of auxin asymmetrical distribution induced by phototropic stimulation. |
| AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
| AT5G55960 | transmembrane protein C9orf5 protein. |
| AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
| AT5G56040 | Leucine-rich receptor-like protein kinase family protein. |
| AT5G56050 | late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein. |
| AT5G56160 | Sec14p-like phosphatidylinositol transfer family protein. |
| AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
| AT5G56240 | hapless protein. |
| AT5G56260 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase. |
| AT5G56350 | Pyruvate kinase family protein. |
| AT5G56360 | Encodes PSL4, beta-subunit of endoplasmic reticulum-resident glucosidase II, which is essential for stable accumulation and quality control of the elf18 receptor EFR but not the flg22 receptor FLS2. |
| AT5G56510 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G56520 | hypothetical protein. |
| AT5G56550 | Encodes OXIDATIVE STRESS 3 (OXS3), involved in tolerance to heavy metals and oxidative stress. |
| AT5G56600 | Encodes profilin3, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Originally known as profilin5, and later named profilin3. Expressed in vegetative organs. Mutants have slightly elongated petioles. |
| AT5G56630 | phosphofructokinase 7. |
| AT5G56747 | transposable_element_gene.;copia-like retrotransposon family |
| AT5G56750 | AGB1/AGG dimmer interacting protein, response to water deficit. |
| AT5G56760 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT5G56770 | transcription repressor-like protein. |
| AT5G56865 | unknown protein |
| AT5G56870 | beta-galactosidase 4. |
| AT5G56880 | hypothetical protein. |
| AT5G56940 | Ribosomal protein S16 family protein. |
| AT5G56950 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC). |
| AT5G56980 | Pathogen-associated molecular pattern-induced gene.Responsive to jasmonic acid and wounding. |
| AT5G57010 | calmodulin-binding family protein. |
| AT5G57015 | Member of CKL gene family (member of CKL-B group). |
| AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
| AT5G57060 | 60S ribosomal L18a-like protein. |
| AT5G57070 | hydroxyproline-rich glycoprotein family protein. |
| AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
| AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT5G57180 | Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. |
| AT5G57330 | Galactose mutarotase-like superfamily protein. |
| AT5G57340 | ras guanine nucleotide exchange factor Q-like protein. |
| AT5G57380 | Encodes a plant homeodomain protein VERNALIZATION INSENSITIVE 3 (VIN3). |
| AT5G57391 | unknown protein |
| AT5G57400 | transmembrane protein. |
| AT5G57480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT5G57500 | Galactosyltransferase family protein. |
| AT5G57510 | cotton fiber protein. |
| AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein. |
| AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
| AT5G57660 | CONSTANS-like 5. |
| AT5G57670 | Protein kinase superfamily protein. |
| AT5G57700 | BNR/Asp-box repeat family protein. |
| AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. |
| AT5G57720 | AP2/B3-like transcriptional factor family protein. |
| AT5G57790 | Encodes a nuclear localized protein of unknown function that is involved in pollen and embryo sac development. |
| AT5G57815 | Cytochrome c oxidase, subunit Vib family protein. |
| AT5G57830 | zein-binding protein (Protein of unknown function, DUF593). |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT5G57910 | ribosomal RNA small subunit methyltransferase G. |
| AT5G57990 | Encodes a ubiquitin-specific protease. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT5G58080 | member of Response Regulator: B- Type |
| AT5G58320 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the tonoplast membrane. It is expressed in the epidermis of the root meristem and the early expansion zone. |
| AT5G58340 | myb-like HTH transcriptional regulator family protein. |
| AT5G58350 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT5G58370 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT5G58375 | Methyltransferase-related protein. |
| AT5G58440 | sorting nexin 2A. |
| AT5G58450 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT5G58510 | Rab3 GTPase-activating protein catalytic protein. |
| AT5G58520 | Protein kinase superfamily protein. |
| AT5G58530 | Glutaredoxin family protein. |
| AT5G58560 | FOLK is a farnesol kinase that can phosphorylate farnesol using an NTP donor. It can also phosphorylate geraniol, or geranylgeraniol, but it prefers farnesol in experiments performed using yeast membranes. folk loss-of-function mutants show ABA hypersensitivity in a seed germination assay and the mutants also exhibit abnormal flower development, including extra carpel formation, when subjected to water stress. |
| AT5G58570 | transmembrane protein. |
| AT5G58575 | Component of the deubiquitination module of the SAGA complex. |
| AT5G58595 | snoRNA. |
| AT5G58620 | Involved in control of defence gene expression post-transcriptionally through release from translation arrest within TZF9-PAB2-containing RNA granules. TZF9 shows phospho-mobility shift after flg22 treatment, inferred to be caused by phosphorylation through MPK3 and/or MPK6. The major MPK3/6-targeted phospho-sites are S181, S323, S343, S352, S356, S362 and S377. |
| AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
| AT5G58680 | ARM repeat superfamily protein. |
| AT5G58690 | phosphatidylinositol-speciwc phospholipase C5. |
| AT5G58710 | Encodes cyclophilin ROC7. |
| AT5G58720 | smr (Small MutS Related) domain-containing protein. |
| AT5G58730 | pfkB-like carbohydrate kinase family protein. |
| AT5G58900 | R-R-type MYB protein |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G58930 | hypothetical protein (DUF740). |
| AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
| AT5G59010 | kinase with tetratricopeptide repeat domain-containing protein. |
| AT5G59020 | hepatocyte growth factor activator, putative (DUF3527). |
| AT5G59030 | encodes a putative copper transport protein that contains copper-binding motif and functionally complements in copper-transport defective yeast strains |
| AT5G59040 | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast |
| AT5G59050 | G patch domain protein. |
| AT5G59090 | subtilase 4.12. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT5G59230 | transcription factor-like protein. |
| AT5G59350 | transmembrane protein. |
| AT5G59430 | Encodes a telomeric repeat binding protein with a DNA binding domain at its C terminus. The DNA binding domain has a preference for GGTTTAG sequences and at least five of these repeats are required for recognition by a nearly full-length TRP1 protein. |
| AT5G59440 | Encodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. |
| AT5G59450 | GRAS family transcription factor. |
| AT5G59480 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein. |
| AT5G59490 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein. |
| AT5G59505 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: GAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172e (converted to TAIR10 based on PMID19304749): Chr5: 23988070-23988886 (forward), length: 817 bp; exon coordinates: exon 1: 23988070 to 23988886; mature miRNA and miRNA* are located on exon 1. |
| AT5G59520 | encodes a metal ion transporter whose expression is regulated by copper. |
| AT5G59530 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein. |
| AT5G59550 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT5G59580 | UDP-glucosyl transferase 76E1. |
| AT5G59590 | UDP-glucosyl transferase 76E2. |
| AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT5G59700 | Protein kinase superfamily protein. |
| AT5G59730 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G59732 | Natural antisense transcript overlaps with AT5G59730. The RNA is cell-to-cell mobile. |
| AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. |
| AT5G59900 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT5G59910 | Histone superfamily protein. |
| AT5G59920 | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
| AT5G59930 | Cysteine/Histidine-rich C1 domain family protein. |
| AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein. |
| AT5G59970 | Histone superfamily protein. |
| AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
| AT5G60060 | F-box SKIP23-like protein (DUF295). |
| AT5G60070 | ankyrin repeat family protein. |
| AT5G60160 | Vacuolar aspartyl aminopeptidase which also functions as a molecular chaperone. |
| AT5G60170 | E3 ligase involved in regulation of chloroplast protein synthesis through activity of PGR3. |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G60210 | Encodes RIP5 (ROP interactive partner 5), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT5G60220 | Member of TETRASPANIN family |
| AT5G60270 | Concanavalin A-like lectin protein kinase family protein. |
| AT5G60290 | hypothetical protein. |
| AT5G60300 | Encodes a legume-type lectin receptor kinase that is structurally distinct from the mammalian extracellular ATP receptors and acts as an extracellular ATP receptor in Arabidopsis. Extracellular ATP acts as a damage-associated molecular pattern in plants, and its signaling through P2K1 is important for mounting an effective defense response against various pathogenic microorganisms. It also plays a role in cell wall-plasma membrane adhesion. |
| AT5G60310 | Concanavalin A-like lectin protein kinase family protein. |
| AT5G60320 | Concanavalin A-like lectin protein kinase family protein. |
| AT5G60410 | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. Regulates leaf cell division and expansion through salicylic acid accumulation. signaling |
| AT5G60660 | A member of the plasma membrane intrinsic protein subfamily PIP2.When expressed in yeast cells can conduct hydrogen peroxide into those cells. Mutants exhibit longer root hairs. |
| AT5G60670 | Ribosomal protein L11 family protein. |
| AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584). |
| AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein. |
| AT5G60750 | Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities. |
| AT5G60760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein. |
| AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
| AT5G60800 | Heavy metal transport/detoxification superfamily protein. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT5G60880 | Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. |
| AT5G60890 | Myb-like transcription factor that modulates expression of ASA1, a key point of control in the tryptophan pathway; mutant has deregulated expression of ASA1 in dominant allele. Loss of function allele suggests ATR1 also functions at a control point for regulating indole glucosinolate homeostasis. |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT5G61210 | membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation |
| AT5G61290 | Flavin-binding monooxygenase family protein. |
| AT5G61340 | transmembrane protein. |
| AT5G61412 | hypothetical protein. |
| AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
| AT5G61440 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
| AT5G61590 | Encodes an AP2/ERF-type transcription factor that is preferentially expressed in the epidermis and induced by darkness and negatively regulates cuticular wax biosynthesis. |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G61640 | ubiquitous enzyme that repairs oxidatively damaged proteins |
| AT5G61650 | The P-type cyclins (CYCPs) share a conserved central region of 100 amino acids ('cyclin box') displaying homology to the corresponding region of the PHO80 cyclin from Saccharomyces cerevisiae and the related G1 cyclins from Trypanosoma cruzi and T. brucei. |
| AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. |
| AT5G61780 | Involved in the regulation of AtGA20ox3 expression, as well as seed germination. |
| AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT5G61820 | stress up-regulated Nod 19 protein. |
| AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G61900 | Encodes a plasma-membrane localized, copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. |
| AT5G61910 | DCD (Development and Cell Death) domain protein. |
| AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
| AT5G61970 | signal recognition particle-related / SRP-like protein. |
| AT5G61990 | Pentatricopeptide repeat (PPR) superfamily protein. |
| AT5G61997 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G62030 | diphthamide synthesis DPH2 family protein. |
| AT5G62090 | Encodes a protein that functions with LUH to promote Al binding to the root cell wall. |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. |
| AT5G62130 | Per1-like family protein. |
| AT5G62150 | peptidoglycan-binding LysM domain-containing protein. |
| AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein. |
| AT5G62180 | Carboxyesterase that binds stringolactones. |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT5G62270 | Ribosomal protein L20.. Required for proper mitochondrial cristae formation. Expressed throughout plant. Mutants are defective in late stages of megagametogenesis. Pollen tube defective. Gametophytic lethality is probably due to mitochondrial disfunction. |
| AT5G62280 | DUF1442 family protein (DUF1442). |
| AT5G62290 | nucleotide-sensitive chloride conductance regulator (ICln) family protein. |
| AT5G62300 | Ribosomal protein S10p/S20e family protein. |
| AT5G62350 | Plant invertase/pectin methylesterase inhibitor superfamily protein. |
| AT5G62370 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT5G62430 | Dof-type zinc finger domain-containing protein, similar to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Represses expression of Constans (CO), a circadian regulator of flowering time. Interacts with LKP2 and FKF1. Expression oscillates under constant light conditions. Mainly expressed in the vasculature of cotyledons, leaves and hypocotyls, but also in stomata. Localized to the nucleus and acts as a repressor of CONSTANS through binding to the Dof binding sites in the CO promoter. Protein gets degraded by FKF1 in the afternoon. CDF1 binds to the TOPLESS co-repressor protein through an N-terminal motif which is conserved across CDF-like proteins throughout land-plants. This interaction is important for the repression of CO and FT genes during the morning. Loss of CDF1 dependent repression through omission of TPL coordinating residues or through the loss of TPL function in phloem companion cells results in early flowering due to an up regulation of FT. |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. |
| AT5G62500 | Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT5G62530 | Encodes mitochondrial Delta-pyrroline-5- carboxylate dehydrogenase. Involved in the catabolism of proline to glutamate. |
| AT5G62540 | Encodes a protein predicted to be an E2 ubiquitin conjugating enzyme. It appears homologous to the RAD6 protein in yeast implicated in histone ubiquitination, but, UBC3 has not been experimentally associated with this process. |
| AT5G62570 | Calmodulin binding protein-like protein. |
| AT5G62610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein. |
| AT5G62630 | hipl2 protein precursor. |
| AT5G62670 | H[+]-ATPase 11. |
| AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT5G62690 | encodes tubulin beta-2/beta-3 chain |
| AT5G62700 | encodes tubulin beta-2/beta-3 chain |
| AT5G62865 | hypothetical protein. |
| AT5G62890 | Xanthine/uracil permease family protein. |
| AT5G62900 | PADRE protein down-regulated after infection by S. sclerotiorum. |
| AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein. |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. |
| AT5G63270 | RPM1-interacting protein 4 (RIN4) family protein. |
| AT5G63410 | Leucine-rich repeat protein kinase family protein. |
| AT5G63420 | Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA. |
| AT5G63440 | Encodes a single copy protein in Arabidopsis containing a DUF167 domain that is conserved in eukaryotes. Genetically CSU suppresses mutations in COP1. In vitro, it interacts with CACTIN and in vivo with CCA1. CSU4 promotes photomorphogenesis via negative regulation of CCA1 and PIF4 expression. |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT5G63460 | Enhances ABA response and plant drought tolerance by modulating the stability and localization of c2-domain ABA-related proteins.LOT1 regulates plant tolerance to drought stress by affecting ABA signaling through regulating the stability and dynamic localization of CAR9 (PMID:31102784). |
| AT5G63470 | Encodes a member of class of transcription regulators that his highly conserved across many plant species.In Arabidopsis and rice, NF-YC4 interacts with other members of this class and CO to regulate flowering. In Arabidopsis, it interacts with QQS to regulate C/N partitioning. |
| AT5G63490 | CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein. |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT5G63590 | flavonol synthase 3. |
| AT5G63595 | flavonol synthase 4. |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT5G63610 | significant sequence similarity to plant and animal cyclin-dependent protein kinases, and was classified as an E-type CDK with a SPTAIRE cyclin binding motif in the kinase domain. |
| AT5G63620 | Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria. |
| AT5G63650 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT5G63810 | member of Glycoside Hydrolase Family 35 |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. |
| AT5G63890 | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
| AT5G63900 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein. |
| AT5G63930 | Leucine-rich repeat protein kinase family protein. |
| AT5G63940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein. |
| AT5G63970 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
| AT5G63980 | Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration and increased levels of 3'-phosphoadenosine 5'-phosphate (PAP). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity. Its activity is sensitive to the redox state of its environment, decreasing under oxidative conditions and is regulated by dimerization and intra and inter-molecular disulfide bond formation. |
| AT5G64070 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta1. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta1 is 83% identical to PI-4kbeta2 encoded by At5g09350. Interacts with the RabA4b GTPase. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta2, leads to the formation of abnormal root hairs. |
| AT5G64130 | cAMP-regulated phosphoprotein 19-related protein. |
| AT5G64210 | encodes an isoform of alternative oxidase, which is expressed in rosettes, stems, and roots. Transcript accumulates in dry seeds and decreased upon germination and is not affected by actinomycin A. Protein is localized to mitochondria. |
| AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. |
| AT5G64250 | Aldolase-type TIM barrel family protein. |
| AT5G64260 | EXORDIUM like 2. |
| AT5G64395 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G64400 | CHCH domain protein. involved in mechanotransduction. Loss of both At12cys-1 and At12cys-2 lead to enhanced tolerance to drought and light stress and increased anti-oxidant capacity. |
| AT5G64410 | oligopeptide transporter |
| AT5G64430 | Octicosapeptide/Phox/Bem1p family protein. |
| AT5G64530 | xylem NAC domain 1. |
| AT5G64550 | loricrin-like protein. |
| AT5G64560 | Transmembrane magnesium transporter that is located in plasma membrane of microspores to take up Mg from the locule. One of 9 family members. |
| AT5G64570 | Encodes a beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT5G64572 | Natural antisense transcript overlaps with AT5G64570. |
| AT5G64580 | Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
| AT5G64610 | Encodes an enzyme with histone acetyltransferase activity. HAM1 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM1. HAM1 acetylates histone H4 lysine 5. |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2. |
| AT5G64667 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G64730 | Transducin/WD40 repeat-like superfamily protein. |
| AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG). |
| AT5G64740 | Encodes a cellulose synthase isomer. CESA6 mutants have cellulose defect in the primary cell wall. |
| AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. |
| AT5G64770 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
| AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
| AT5G64880 | transmembrane protein. |
| AT5G64890 | elicitor peptide 2 precursor. |
| AT5G64900 | Encodes a putative 92-aa protein that is the precursor of AtPep1, a 23-aa peptide which activates transcription of the defensive gene defensin (PDF1.2) and activates the synthesis of H2O2, both being components of the innate immune response. |
| AT5G64905 | elicitor peptide 3 precursor. |
| AT5G65010 | Encodes asparagine synthetase (ASN2). |
| AT5G65015 | pre-tRNA tRNA-Arg (anticodon: ACG). |
| AT5G65020 | Annexins are calcium binding proteins that are localized in the cytoplasm. When cytosolic Ca2+ increases, they relocate to the plasma membrane. They may be involved in the Golgi-mediated secretion of polysaccharides. |
| AT5G65207 | hypothetical protein. |
| AT5G65210 | Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated. |
| AT5G65280 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor. Loss of function mutations in GCL1 show no ABA response defects based on assays of seed germination and seedling development.GCL1 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT5G65290 | LMBR1-like membrane protein. |
| AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
| AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT). |
| AT5G65310 | Encodes a class I HDZip (homeodomain-leucine zipper) protein that is a positive regulator of ABA-responsiveness, mediating the inhibitory effect of ABA on growth during seedling establishment. |
| AT5G65380 | MATE efflux family protein. |
| AT5G65390 | arabinogalactan protein 7. |
| AT5G65400 | alpha/beta-Hydrolases superfamily protein. |
| AT5G65470 | O-fucosyltransferase family protein. |
| AT5G65480 | CCL1 is induced by WUS and binds to the kinase domains of BAM1 and CLV1. Localizes to lipid rich plasma membrane rafts. Likely to be involved in WUS/CLV signaling pathway. |
| AT5G65510 | Encodes one of three PLETHORA transcription factors required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. |
| AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein. |
| AT5G65530 | Encodes a protein kinase involved in mediating resistance to fungi and also trichome branch number. |
| AT5G65600 | L-type lectin receptor kinase which modulates metabolites and abiotic stress responses. Phosphorylates AvrPtoB which in turn reduces its virulence. |
| AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
| AT5G65640 | bHLH093/NFL encodes a bHLH transcription factor involved in GA mediated control of flowering time. |
| AT5G65650 | sugar transporter, putative (DUF1195). |
| AT5G65660 | hydroxyproline-rich glycoprotein family protein. |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene |
| AT5G65676 | transposable_element_gene.;copia-like retrotransposon family |
| AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein. |
| AT5G65690 | Encodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent). |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT5G65830 | receptor like protein 57. |
| AT5G65840 | Thioredoxin superfamily protein. |
| AT5G65850 | F-box and associated interaction domains-containing protein. |
| AT5G65860 | ankyrin repeat family protein. |
| AT5G65870 | Probable phytosulfokines 5 precursor, coding for a unique plant peptide growth factor. |
| AT5G65880 | transmembrane protein. |
| AT5G65890 | Member of ACT domain containing protein family. ACT domains are amino acid binding domains. Shows strongest expression in flowers and siliques. |
| AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65925 | hypothetical protein. |
| AT5G65940 | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT5G65980 | Auxin efflux carrier family protein. |
| AT5G65990 | Transmembrane amino acid transporter family protein. |
| AT5G66050 | Wound-responsive family protein. |
| AT5G66080 | Type 2C protein phosphatase located in the plasma membrane. Functions in heat shock response memory mantainance. |
| AT5G66090 | cell wall integrity/stress response component. |
| AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
| AT5G66170 | Encodes a thiosulfate sulfurtransferase/rhodanese. |
| AT5G66180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein. |
| AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT5G66210 | Calcium Dependent Protein Kinase. Functions in the BIK1 innate immune response pathway. |
| AT5G66230 | Chalcone-flavanone isomerase family protein. |
| AT5G66310 | ATP binding microtubule motor family protein. |
| AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT5G66330 | Leucine-rich repeat (LRR) family protein. |
| AT5G66340 | hypothetical protein. |
| AT5G66580 | PADRE protein. |
| AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein. |
| AT5G66607 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G66610 | DA1-related protein 7. |
| AT5G66620 | DA1-related protein 6. |
| AT5G66640 | DA1-related protein 3. |
| AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
| AT5G66675 | transmembrane protein, putative (DUF677). |
| AT5G66680 | Encodes a protein ortholog of human SOT48 or yeast WBP1, an essential protein subunit of the oligosaccharyltransferase (OST) complex, which is responsible for the transfer in the ER of the N-linked glycan precursor onto Asn residues of candidate proteins. |
| AT5G66690 | UGT72E2 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl aldehydes as well as sinapyl- and coniferyl alcohol. The enzyme is thought to be involved in lignin metabolism. A knockdown mutant line (72E2KD) was obtained using RNAi silencing. A twofold reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype. In comparison, both knockout and knockdown lines of UGT72E1 and UGT72E3, respectively, failed to display the same reduction in phenylpropanoid 4-O-glucosides. |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT5G66730 | C2H2-like zinc finger protein. |
| AT5G66770 | GRAS family transcription factor. |
| AT5G66800 | membrane-associated kinase regulator-like protein. |
| AT5G66860 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein. |
| AT5G66870 | Encodes LOB domain protein whose overexpression results in KNOX gene repression. |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. |
| AT5G66910 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.1. |
| AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein. |
| AT5G67020 | hypothetical protein. |
| AT5G67050 | alpha/beta-Hydrolases superfamily protein. |
| AT5G67070 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT5G67080 | member of MEKK subfamily |
| AT5G67150 | HXXXD-type acyl-transferase family protein. |
| AT5G67160 | Encodes a member of the BAHD acyltransferase superfamily. Mutants have enhanced susceptibility to virulent and avirulent pathogens and are defective in pathogen induced SA biosynthesis. EPS1 may act upstream of SA biosynthesis as application of SA can rescue the mutant phenotype. |
| AT5G67170 | SEC-C motif-containing protein / OTU-like cysteine protease family protein. |
| AT5G67180 | target of early activation tagged (EAT) 3. |
| AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT5G67210 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
| AT5G67220 | FMN-linked oxidoreductases superfamily protein. |
| AT5G67230 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT5G67250 | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT5G67280 | receptor-like kinase. |
| AT5G67290 | FAD-dependent oxidoreductase family protein. |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. |
| AT5G67320 | Encodes a WD-40 protein involved in histone deacetylation in response to abiotic stress.Identified in a screen for mutations with altered expression of stress induced genes. Functions as a repressor of cold tolerance induced genes. Loss of function mutants are hypersensitive to freezing.Part of a PWR-HOS15-HD2C complex to regulate expression of COR genes involved in cold tolerance via histone modification. |
| AT5G67330 | Encodes a member of the Nramp2 metal transporter family; like its homolog Atnramp3, localized in vacuolar membrane. Seedlings of double mutant, atnramp3-1 atnramp4-1, were arrested at early germination. |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G67350 | hypothetical protein. |
| AT5G67360 | Encodes a subtilisin-like serine protease essential for mucilage release from seed coats. |
| AT5G67390 | glycosyltransferase-like protein. |
| AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit. |
| AT5G67411 | GRAS family transcription factor. |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein. |
| AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT5G67470 | formin homolog 6. |
| AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G67488 | Natural antisense transcript overlaps with AT5G67490. |
| AT5G67490 | SDHAF4 acts on FAD-SDH1 and promotes its assembly with SDH2, thereby stabilizing SDH2 and enabling its full assembly with SDH3/SDH4 to form the SDH complex. |
| AT5G67500 | Encodes a voltage-dependent anion channel |
| AT5G67520 | Provides activated sulfate for the sulfation of secondary metabolites, including the glucosinolates. Redundant with APK3. |