AT1G44760 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT2G10931 | hypothetical protein;(source:Araport11) |
AT3G55840 | Hs1pro-1 protein;(source:Araport11) |
AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
AT3G28600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
AT4G06556 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.3e-152 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
AT1G74820 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G04490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G03370 | C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11) |
AT1G67060 | peptidase M50B-like protein;(source:Araport11) |
AT3G32917 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.0e-114 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT1G51270 | vesicle-associated protein 1-4;(source:Araport11) |
AT1G48230 | Nucleotide/sugar transporter family protein |
AT3G60940 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT3G47800 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT3G11395 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT1G04390 | BTB/POZ domain-containing protein;(source:Araport11) |
AT3G42220 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.9e-166 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT4G21820 | binding / calmodulin binding protein;(source:Araport11) |
AT3G23320 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT4G03460 | Ankyrin repeat family protein;(source:Araport11) |
AT3G13500 | hypothetical protein;(source:Araport11) |
AT1G30550 | S-adenosyl-L-methionine-dependent methyltransferase superfamily protein;(source:Araport11) |
AT1G17300 | hypothetical protein;(source:Araport11) |
AT3G27845 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G41790 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 0.00017 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT1G36745 | hypothetical protein;(source:Araport11) |
AT3G14470 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT1G47480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G59880 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G02440 | transmembrane protein;(source:Araport11) |
AT3G63240 | DNAse I-like superfamily protein;(source:Araport11) |
AT2G42020 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G55350 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
AT5G44090 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G10730 | Protein kinase superfamily protein |
AT1G04645 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G40020 | Myosin heavy chain-related protein;(source:Araport11) |
AT2G39860 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT3G43303 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G42785 | transmembrane protein;(source:Araport11) |
AT5G13250 | RING finger protein;(source:Araport11) |
AT5G53380 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT4G06688 | myosin heavy chain-like protein;(source:Araport11) |
AT3G44810 | F-box family protein;(source:Araport11) |
AT5G11070 | hypothetical protein;(source:Araport11) |
AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G15700 | Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast. |
AT2G07210 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.8e-27 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT3G55672 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G34044 | pseudogene of 50S ribosomal protein L34;(source:Araport11) |
AT5G54460 | wound-responsive protein-like protein;(source:Araport11) |
AT5G08010 | hypothetical protein;(source:Araport11) |
AT2G06715 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G01860 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT2G12500 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 6.8e-208 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G35860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10) |
AT5G50140 | Ankyrin repeat family protein;(source:Araport11) |
AT1G67720 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G44805 | TRAF-like superfamily protein;(source:Araport11) |
AT1G11730 | Galactosyltransferase family protein;(source:Araport11) |
AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT3G30390 | Encodes a putative amino acid transporter. |
AT3G54520 | hypothetical protein;(source:Araport11) |
AT4G29870 | Oligosaccharyltransferase complex/magnesium transporter family protein;(source:Araport11) |
AT5G28672 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
AT3G15600 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G07770.1);(source:TAIR10) |
AT5G31999 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.3e-44 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G37037 | transposable_element_gene;(source:Araport11) |
AT5G29060 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
AT2G40745 | hypothetical protein;(source:Araport11) |
AT5G35460 | membrane protein;(source:Araport11) |
AT2G11851 | hypothetical protein;(source:Araport11) |
AT5G27925 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.0e-249 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G07260 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT4G23970 | hypothetical protein;(source:Araport11) |
AT3G58630 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT5G58150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G12920 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.2e-128 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G37352 | Pseudogene of AT2G25010 |
AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G32435 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase GI:4335720 from (Arabidopsis thaliana);(source:TAIR10) |
AT4G01210 | glycosyl transferase family 1 protein;(source:Araport11) |
AT3G57120 | Protein kinase superfamily protein;(source:Araport11) |
AT2G10975 | hypothetical protein;(source:Araport11) |
AT5G08680 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
AT4G15030 | folate-sensitive fragile site protein;(source:Araport11) |
AT4G03920 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-40 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G04972 | hypothetical protein;(source:Araport11) |
AT3G30620 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila);(source:TAIR10) |
AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT2G42110 | hypothetical protein;(source:Araport11) |
AT1G60630 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G55100 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
AT4G13615 | Uncharacterized protein family SERF;(source:Araport11) |
AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT3G33131 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32610.1);(source:TAIR10) |
AT5G35045 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-66 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G24600 | Ankyrin repeat family protein;(source:Araport11) |
AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
AT1G22060 | sporulation-specific protein;(source:Araport11) |
AT1G23830 | transmembrane protein;(source:Araport11) |
AT4G39060 | LOW protein: coatomer subunit alpha-1-like protein;(source:Araport11) |
AT3G31367 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-71 P-value blast match to GB:226407 retrotransposon del1-46 (Gypsy_Ty3-element) (Lilium henryi);(source:TAIR10) |
AT4G09360 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
AT5G41020 | myb family transcription factor;(source:Araport11) |
AT4G23470 | PLAC8 family protein;(source:Araport11) |
AT3G33154 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.5e-36 P-value blast match to GB:CAB39733 rotease, reverse transcriptase, ribonuclease H, integrase (Gypsy_Ty3-element) (Drosophila buzzatii);(source:TAIR10) |
AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
AT3G47670 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G78530 | Protein kinase superfamily protein;(source:Araport11) |
AT4G07806 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-124 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G13860 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.4e-275 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT2G10970 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G16586 | transmembrane protein;(source:Araport11) |
AT4G31460 | Ribosomal L28 family;(source:Araport11) |
AT4G01460 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G19190 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT5G36930 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G62350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G26660 | kinesin-like protein;(source:Araport11) |
AT1G20750 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
AT3G58975 | pseudogene of F-box family protein |
AT1G16170 | ephrin-A3 protein;(source:Araport11) |
AT3G18450 | PLAC8 family protein;(source:Araport11) |
AT5G58720 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
AT4G03376 | Pseudogene of AT1G56420 |
AT4G16195 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G46550 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT4G13820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G74610 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
AT4G34170 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G38212 | Natural antisense transcript overlaps with AT5G38210;(source:Araport11) |
AT5G17730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G16162 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G06642 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
AT3G28350 | Pseudogene of AT3G28350; unknown protein |
AT1G56020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT4G30910 | Cytosol aminopeptidase family protein;(source:Araport11) |
AT5G67140 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G60560 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G56880 | VQ motif-containing protein;(source:Araport11) |
AT3G01513 | hypothetical protein;(source:Araport11) |
AT1G57650 | ATP binding protein;(source:Araport11) |
AT3G55690 | hypothetical protein;(source:Araport11) |
AT2G27315 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
AT2G40420 | Encodes a putative amino acid transporter. |
AT5G29613 | hypothetical protein;(source:Araport11) |
AT5G54720 | Ankyrin repeat family protein;(source:Araport11) |
AT3G14740 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G51645 | Natural antisense transcript overlaps with AT1G51640;(source:Araport11) |
AT5G60615 | Encodes a defensin-like (DEFL) family protein. |
AT1G09360 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
AT2G39490 | F-box family protein;(source:Araport11) |
AT4G20000 | VQ motif-containing protein;(source:Araport11) |
AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT5G37610 | Eukaryotic porin family protein;(source:Araport11) |
AT3G47590 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT5G25754 | RNA polymerase I-associated factor PAF67;(source:Araport11) |
AT1G05085 | hypothetical protein;(source:Araport11) |
AT5G38340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G33555 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to hypothetical protein GB:AAD26889 (Arabidopsis thaliana);(source:TAIR10) |
AT4G06632 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.9e-05 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G25720 | hypothetical protein;(source:Araport11) |
AT1G69030 | BSD domain-containing protein;(source:Araport11) |
AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G44180 | syntaxin-related family protein;(source:Araport11) |
AT2G41830 | Uncharacterized protein;(source:Araport11) |
AT3G11310 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT3G12910 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT3G58200 | TRAF-like family protein;(source:Araport11) |
AT4G36150 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT1G52200 | PLAC8 family protein;(source:Araport11) |
AT2G13500 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT1G31983 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT3G57100 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT2G28980 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-43 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G13500 | transmembrane protein;(source:Araport11) |
AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G29805 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G33100 | protein phosphatase;(source:Araport11) |
AT4G06474 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein;(source:TAIR10) |
AT3G14830 | epstein-barr nuclear antigen;(source:Araport11) |
AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
AT5G33432 | similar to En/Spm-like transposon |
AT4G28915 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT3G46850 | Subtilase family protein;(source:Araport11) |
AT3G15518 | hypothetical protein;(source:Araport11) |
AT5G28495 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.8e-77 P-value blast match to gb|AAL06416.1|AF378057_1 reverse transcriptase (Sorghum bicolor) (Gypsy_Ty3-family);(source:TAIR10) |
AT1G12440 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT3G15800 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
AT5G13890 | plant viral-response family protein (DUF716);(source:Araport11) |
AT2G14635 | ARABIDILLO protein;(source:Araport11) |
AT1G66780 | MATE efflux family protein;(source:Araport11) |
AT4G08360 | KOW domain-containing protein;(source:Araport11) |
AT2G07400 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-53 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT4G20770 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G76610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT1G49032 | hypothetical protein;(source:Araport11) |
AT3G61870 | plant/protein;(source:Araport11) |
AT5G29635 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 7.7e-111 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G43715 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-130 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G42792 | transposable_element_gene;(source:Araport11);Mutator-related transposase, temporary automated functional assignment;(source:TAIR10) |
AT4G24265 | homeobox protein;(source:Araport11) |
AT5G30942 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.3e-162 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G52170 | DNA binding protein;(source:Araport11) |
AT1G63740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G11590 | golgin family A protein;(source:Araport11) |
AT4G08092 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 2.3e-143 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT5G32654 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.8e-78 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11) |
AT3G22180 | DHHC-type zinc finger family protein;(source:Araport11) |
AT1G53380 | hypothetical protein (DUF641);(source:Araport11) |
AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G10220 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
AT1G64385 | transmembrane protein;(source:Araport11) |
AT4G21630 | Subtilase family protein;(source:Araport11) |
AT2G21460 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-303 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
AT2G20835 | hypothetical protein;(source:Araport11) |
AT3G48080 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G56070 | hypothetical protein;(source:Araport11) |
AT1G19025 | DNA repair metallo-beta-lactamase family protein;(source:Araport11) |
AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
AT5G29054 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G15555 | other_RNA;(source:Araport11) |
AT1G35143 | transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G52950.1);(source:TAIR10) |
AT2G31730 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G36040 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30610.1);(source:TAIR10) |
AT1G35300 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.1e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G47250 | RNA helicase family protein;(source:Araport11) |
AT3G42830 | RING/U-box superfamily protein;(source:Araport11) |
AT1G52900 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT3G44093 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-162 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
AT4G18340 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G42320 | Zn-dependent exopeptidases superfamily protein;(source:Araport11) |
AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT1G44125 | Natural antisense transcript overlaps with AT1G44120;(source:Araport11) |
AT4G07744 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.1e-79 P-value blast match to aT6L9 reverse transcriptase (from Dan Voytas http://www.public.iastate.edu/~voytas) (Gypsy_Ty3-family);(source:TAIR10) |
AT1G45229 | transmembrane protein;(source:Araport11) |
AT3G43410 | F-box/LRR protein;(source:Araport11) |
AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G11900 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G54148 | sarcosine dehydrogenase-2C protein;(source:Araport11) |
AT2G18115 | pseudogene of glycine-rich protein;(source:Araport11) |
AT5G53486 | transmembrane protein;(source:Araport11) |
AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G22440 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT1G61390 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G71691 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G06630 | protein kinase family protein;(source:Araport11) |
AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT4G06608 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
AT4G26480 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT1G24068 | other_RNA;(source:Araport11) |
AT1G64130 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G22530 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT4G08097 | hypothetical protein;(source:Araport11) |
AT2G17140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G37240 | hypothetical protein;(source:Araport11) |
AT5G54040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G39860 | hematological/neurological-like protein;(source:Araport11) |
AT1G11370 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
AT1G66245 | hypothetical protein;(source:Araport11) |
AT3G47110 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
AT1G55240 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
AT5G35950 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT3G30838 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-163 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT1G34510 | Peroxidase superfamily protein;(source:Araport11) |
AT5G67390 | glycosyltransferase-like protein;(source:Araport11) |
AT3G29830 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G11810 | transmembrane protein;(source:Araport11) |
AT1G52060 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT4G11190 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT2G03510 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT1G22980 | Grap2/cyclin-D-interacting protein;(source:Araport11) |
AT1G71530 | Protein kinase superfamily protein;(source:Araport11) |
AT3G45200 | hypothetical protein;(source:Araport11) |
AT3G42550 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT4G12545 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G28545 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-08 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G50620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G80610 | hypothetical protein;(source:Araport11) |
AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT4G08874 | transmembrane protein;(source:Araport11) |
AT1G48090 | calcium-dependent lipid-binding family protein;(source:Araport11) |
AT2G12290 | hypothetical protein;(source:Araport11) |
AT1G29980 | choice-of-anchor C domain protein, putative (Protein of unknown function, DUF642);(source:Araport11) |
AT3G03930 | kinase-like protein;(source:Araport11) |
AT2G27590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G04550 | type-1 restriction enzyme mjaxp r protein (DUF668);(source:Araport11) |
AT4G02250 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G04130 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G42690.1);(source:TAIR10) |
AT3G21960 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT5G32825 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-296 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT2G41640 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT3G07550 | RNI-like superfamily protein;(source:Araport11) |
AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT1G73440 | calmodulin-like protein;(source:Araport11) |
AT3G59590 | jacalin lectin family protein;(source:Araport11) |
AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT2G10610 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-162 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT5G18210 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G22530 | Unknown protein, knockout shows increased sensitivity to Al stress. |
AT3G26747 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT4G00160 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
AT1G52950 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G59260 | pirin;(source:Araport11) |
AT4G08000 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.0e-136 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT5G40960 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G36440 | hypothetical protein;(source:Araport11) |
AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT2G47120 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G19420 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT2G15100 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.0e-216 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G42280 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G04990 | intracellular protein transporter;(source:Araport11) |
AT1G65483 | hypothetical protein;(source:Araport11) |
AT5G32925 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-105 P-value blast match to GB:AAA66266 unknown protein ORF1 transposable element En-1 (CACTA-element) (Zea mays);(source:TAIR10) |
AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
AT1G75970 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT1G35570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
AT2G25169 | transmembrane protein;(source:Araport11) |
AT3G42520 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G44875.1);(source:TAIR10) |
AT2G33847 | hypothetical protein;(source:Araport11) |
AT5G43240 | hypothetical protein (DUF674);(source:Araport11) |
AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G36210 | transmembrane/coiled-coil protein (DUF726);(source:Araport11) |
AT5G64572 | Natural antisense transcript overlaps with AT5G64570;(source:Araport11) |
AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT4G32360 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
AT3G12040 | Encodes a 3-methyladenine-DNA glycosylase. Arabdiopsis cDNA complements the methyl methanesulfonate-sensitive phenotype of an Escherichia coli double mutant deficient in 3-methyladenine glycosylases (DNA-3-methyladenine glycosidases I and II, EC 3.2.2.20 and 3.2.2.21, respectively, encoded by tag and alkA). |
AT4G14145 | cytochrome C oxidase assembly protein;(source:Araport11) |
AT3G52520 | hypothetical protein;(source:Araport11) |
AT4G20920 | double-stranded RNA-binding domain (DsRBD)-containing protein;(source:Araport11) |
AT3G48710 | DEK domain-containing chromatin associated protein;(source:Araport11) |
AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
AT1G47950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-238 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT4G06618 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 42%25 identity and 1.2e-18 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT5G43040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT1G46192 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G23205 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G55610 | isopentenyl-diphosphate delta-isomerase;(source:Araport11) |
AT5G38250 | Protein kinase family protein;(source:Araport11) |
AT5G65170 | VQ motif-containing protein;(source:Araport11) |
AT3G13403 | Encodes a defensin-like (DEFL) family protein. |
AT5G65380 | MATE efflux family protein;(source:Araport11) |
AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G10190 | Major facilitator superfamily protein;(source:Araport11) |
AT3G13030 | hAT transposon superfamily protein;(source:Araport11) |
AT4G10507 | other_RNA;(source:Araport11) |
AT5G67020 | hypothetical protein;(source:Araport11) |
AT5G53135 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-199 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G30757 | transmembrane protein;(source:Araport11) |
AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT2G01560 | Plant protein 1589 of unknown function;(source:Araport11) |
AT5G01200 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT4G37620 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10) |
AT5G19350 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
AT1G40083 | hypothetical protein;(source:Araport11) |
AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G47020 | MraZ;(source:Araport11) |
AT2G36970 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G68875 | hypothetical protein;(source:Araport11) |
AT1G47470 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
AT5G39120 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G28491 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G76780 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G06095 | transmembrane protein;(source:Araport11) |
AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
AT3G29000 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT1G42525 | cysteine proteinase superfamily protein;(source:Araport11) |
AT1G61090 | hypothetical protein;(source:Araport11) |
AT5G54370 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
AT3G53100 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G38220 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G77655 | hypothetical protein;(source:Araport11) |
AT2G11240 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-38 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G31240 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G33700 | CBS domain protein (DUF21);(source:Araport11) |
AT3G11640 | transmembrane protein;(source:Araport11) |
AT4G22640 | LTPG protein |
AT5G11325 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
AT2G03100 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-225 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G17490 | epidermal patterning factor-like protein;(source:Araport11) |
AT2G36860 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G50740 | Transmembrane proteins 14C;(source:Araport11) |
AT1G43502 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-158 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT1G30600 | Subtilase family protein;(source:Araport11) |
AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G66910 | Protein kinase superfamily protein;(source:Araport11) |
AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT5G12060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G46195 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.8e-38 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G65710 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT5G57230 | Thioredoxin superfamily protein;(source:Araport11) |
AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G21930 | transmembrane protein;(source:Araport11) |
AT5G34867 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.7e-279 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT2G36255 | Encodes a defensin-like (DEFL) family protein. |
AT1G31220 | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide |
AT5G23610 | DYAD protein;(source:Araport11) |
AT5G28720 | hypothetical protein;(source:Araport11) |
AT1G51310 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase;(source:Araport11) |
AT1G72060 | serine-type endopeptidase inhibitor;(source:Araport11) |
AT5G10920 | L-Aspartase-like family protein;(source:Araport11) |
AT3G44798 | other_RNA;(source:Araport11) |
AT1G52825 | sporulation-specific protein;(source:Araport11) |
AT2G46360 | hypothetical protein;(source:Araport11) |
AT3G60200 | hypothetical protein;(source:Araport11) |
AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
AT1G51040 | Protein kinase superfamily protein;(source:Araport11) |
AT1G76070 | hypothetical protein;(source:Araport11) |
AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G42220 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
AT3G63320 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G49500 | Signal recognition particle, SRP54 subunit protein;(source:Araport11) |
AT5G64880 | transmembrane protein;(source:Araport11) |
AT4G04296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-13 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G43610 | Chitinase family protein;(source:Araport11) |
AT5G35735 | Auxin-responsive family protein;(source:Araport11) |
AT4G20730 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
AT4G20250 | hypothetical protein;(source:Araport11) |
AT3G43540 | initiation factor 4F subunit (DUF1350);(source:Araport11) |
AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
AT5G56570 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
AT5G32516 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G07100 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-42 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G62370 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
AT4G39580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G43175 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G48953 | hypothetical protein;(source:Araport11) |
AT2G05640 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, low similarity to SP|Q9UUA2 DNA repair and recombination protein pif1, mitochondrial precursor {Schizosaccharomyces pombe};(source:TAIR10) |
AT2G37700 | Fatty acid hydroxylase superfamily;(source:Araport11) |
AT2G23321 | hypothetical protein;(source:Araport11) |
AT3G07450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G42740 | Sugar isomerase (SIS) family protein;(source:Araport11) |
AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT4G06702 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G78170 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
AT2G19825 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G51035 | hypothetical protein;(source:Araport11) |
AT3G43715 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT3G44230 | transmembrane protein;(source:Araport11) |
AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G08555 | hypothetical protein;(source:Araport11) |
AT2G30780 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G07280 | hypothetical protein;(source:Araport11) |
AT1G43140 | Cullin family protein;(source:Araport11) |
AT2G25409 | hypothetical protein;(source:Araport11) |
AT3G21481 | Pseudogene of AT4G34870; ROC5 (ROTAMASE CYP 5); peptidyl-prolyl cis-trans isomerase |
AT1G75163 | snoRNA;(source:Araport11) |
AT3G60440 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT1G43775 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
AT5G18661 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G39090 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G13210 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
AT5G59670 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G46190 | TRAF-like family protein;(source:Araport11) |
AT3G52500 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G27330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G60022 | Natural antisense transcript overlaps with AT5G60020;(source:Araport11) |
AT1G28327 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
AT2G26270 | BRCT domain DNA repair protein;(source:Araport11) |
AT5G64190 | neuronal PAS domain protein;(source:Araport11) |
AT1G79570 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT1G13820 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G29755 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.5e-180 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT1G02260 | Divalent ion symporter;(source:Araport11) |
AT3G46360 | transmembrane protein;(source:Araport11) |
AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT3G04300 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G05410 | MATH domain/coiled-coil protein;(source:Araport11) |
AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G03880 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G34849 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.5e-166 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT1G33785 | pseudogene of photosynthetic electron transfer B;(source:Araport11) |
AT1G66530 | Arginyl-tRNA synthetase, class Ic;(source:Araport11) |
AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
AT1G45015 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
AT5G19120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G15405 | other_RNA;(source:Araport11) |
AT4G36230 | transmembrane protein;(source:Araport11) |
AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT2G04740 | ankyrin repeat family protein;(source:Araport11) |
AT1G20030 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT2G15870 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G67411 | GRAS family transcription factor;(source:Araport11) |
AT3G29680 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G01516 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G18050 | GPI-anchored protein;(source:Araport11) |
AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G48220 | Protein kinase superfamily protein;(source:Araport11) |
AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G10185 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
AT3G51350 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G05360 | Zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT3G42796 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-31 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G14688 | E3 ubiquitin ligase;(source:Araport11) |
AT4G11580 | RNI-like superfamily protein;(source:Araport11) |
AT3G49200 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G44740 | hypothetical protein;(source:Araport11) |
AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G01710 | methyltransferase;(source:Araport11) |
AT1G30320 | Remorin family protein;(source:Araport11) |
AT4G06534 | transmembrane protein;(source:Araport11) |
AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
AT1G69550 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT5G28641 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-21 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G26380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G40435 | transcription factor SCREAM-like protein;(source:Araport11) |
AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G24090 | homer protein;(source:Araport11) |
AT5G33070 | Encodes a defensin-like (DEFL) family protein. |
AT4G17440 | chromogranin (DUF1639);(source:Araport11) |
AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
AT1G06700 | Protein kinase superfamily protein;(source:Araport11) |
AT5G26300 | TRAF-like family protein;(source:Araport11) |
AT2G32179 | Natural antisense transcript overlaps with AT2G32180;(source:Araport11) |
AT1G17495 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-213 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G35980 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT2G02103 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT1G05450 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT4G15070 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G24920 | secE/sec61-gamma protein transport protein;(source:Araport11) |
AT2G13895 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G16895 | pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G28515 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G32037 | transposable_element_gene;(source:Araport11);pseudogene, helicase -related, similar to putative helicase;(source:TAIR10) |
AT3G48960 | Ribosomal protein L13e family protein;(source:Araport11) |
AT1G69430 | Son of sevenless protein;(source:Araport11) |
AT5G58610 | PHD finger transcription factor;(source:Araport11) |
AT1G29360 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-24 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G63820 | CCT motif family protein;(source:Araport11) |
AT5G56880 | hypothetical protein;(source:Araport11) |
AT1G32585 | VQ motif-containing protein-like protein;(source:Araport11) |
AT4G03800 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.5e-125 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT4G21950 | hypothetical protein;(source:Araport11) |
AT5G09290 | Inositol monophosphatase family protein;(source:Araport11) |
AT5G15260 | ribosomal protein L34e superfamily protein;(source:Araport11) |
AT1G10455 | B3 DNA-binding domain protein;(source:Araport11) |
AT4G07820 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT1G10720 | BSD domain-containing protein;(source:Araport11) |
AT2G02795 | transmembrane protein;(source:Araport11) |
AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT5G23650 | Homeodomain-like transcriptional regulator;(source:Araport11) |
AT3G62510 | disulfide isomerase-like protein;(source:Araport11) |
AT2G39160 | hypothetical protein;(source:Araport11) |
AT1G09645 | transmembrane protein;(source:Araport11) |
AT1G55830 | coiled-coil protein;(source:Araport11) |
AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT5G03495 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G10520 | Subtilase family protein;(source:Araport11) |
AT1G21286 | Pseudogene of AT1G21245; wall-associated kinase-related protein |
AT5G36010 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G52410.1);(source:TAIR10) |
AT1G76185 | NADH-ubiquinone oxidoreductase chain;(source:Araport11) |
AT1G33475 | SNARE-like superfamily protein;(source:Araport11) |
AT5G09876 | hypothetical protein;(source:Araport11) |
AT5G25170 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT2G33140 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT4G32000 | Protein kinase superfamily protein;(source:Araport11) |
AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
AT1G09620 | ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
AT3G18790 | pre-mRNA-splicing factor ISY1-like protein;(source:Araport11) |
AT4G13330 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G53110 | proton pump-interactor;(source:Araport11) |
AT3G23160 | plant/protein (DUF668);(source:Araport11) |
AT3G27325 | hydrolases, acting on ester bond;(source:Araport11) |
AT5G28935 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-48 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G42922 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to Mutator-like transposase;(source:TAIR10) |
AT5G13260 | myosin;(source:Araport11) |
AT4G08375 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.4e-244 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT1G50660 | actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11) |
AT1G74750 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G58600 | Adaptin ear-binding coat-associated protein 1 NECAP-1;(source:Araport11) |
AT5G61180 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G61540 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT3G45935 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT1G68845 | hypothetical protein;(source:Araport11) |
AT3G33136 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.5e-192 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G50210 | pseudogene of NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT1G79720 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G22720 | Actin-like ATPase superfamily protein;(source:Araport11) |
AT2G35250 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT2G13190 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-06 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT4G27620 | intracellular protein transporter;(source:Araport11) |
AT1G48840 | Plant protein of unknown function (DUF639);(source:TAIR10) |
AT5G25020 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT2G37290 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G11670 | MATE efflux family protein;(source:Araport11) |
AT4G36000 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT2G23710 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
AT5G03370 | acylphosphatase family;(source:Araport11) |
AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G06922 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-20 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT4G08750 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G08760.1);(source:TAIR10) |
AT5G49170 | hypothetical protein;(source:Araport11) |
AT1G44050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G17760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G62280 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G38870 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
AT5G57970 | DNA glycosylase superfamily protein;(source:Araport11) |
AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G11925 | Encodes a Stigma-specific Stig1 family protein |
AT4G27400 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G52110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G03210 | Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11) |
AT2G43620 | Chitinase family protein;(source:Araport11) |
AT5G51220 | ubiquinol-cytochrome C chaperone family protein;(source:Araport11) |
AT3G48205 | Encodes a Plant thionin family protein |
AT1G58010 | pseudogene of R-protein L3 B;(source:Araport11) |
AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
AT1G36140 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G38975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-15 P-value blast match to GB:CAA30503 pol polypeptide (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
AT1G61400 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT5G05430 | RNA-binding protein;(source:Araport11) |
AT5G13980 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT1G18485 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G02870 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G36903 | pseudogene of protein related to self-incompatibility |
AT4G15563 | F-box-like protein;(source:Araport11) |
AT4G21192 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
AT2G13975 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
AT2G14980 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-247 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT2G13665 | Natural antisense transcript overlaps with AT2G13660;(source:Araport11) |
AT1G65070 | DNA mismatch repair protein MutS, type 2;(source:Araport11) |
AT4G27220 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT5G23700 | coiled-coil protein;(source:Araport11) |
AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
AT4G04410 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-176 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G47230 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10) |
AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT2G32295 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT1G42745 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G41761 | other_RNA;(source:Araport11) |
AT2G30820 | aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit;(source:Araport11) |
AT1G74640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G52610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.0e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
AT3G28950 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT4G22020 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT3G26720 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT5G67220 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT4G08131 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.3e-05 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G03852 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT4G04790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. |
AT1G42380 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.0e-31 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G58770 | hypothetical protein;(source:Araport11) |
AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G10890 | myosin heavy chain-like protein;(source:Araport11) |
AT1G11440 | hypothetical protein;(source:Araport11) |
AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT4G07720 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
AT5G22315 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT5G17110 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G72141 | transmembrane protein;(source:Araport11) |
AT5G57000 | DEAD-box ATP-dependent RNA helicase;(source:Araport11) |
AT2G15780 | Cupredoxin superfamily protein;(source:Araport11) |
AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT4G11450 | bromo-adjacent domain protein, putative (DUF3527);(source:Araport11) |
AT3G27997 | pseudogene of expressed protein;(source:Araport11) |
AT4G08953 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-22 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G37570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G52410.1);(source:TAIR10) |
AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT4G04653 | Pseudogene of AT1G35516 |
AT2G29160 | pseudogene of senescence-associated gene 13;(source:Araport11) |
AT5G27495 | Encodes a defensin-like (DEFL) family protein. |
AT1G27921 | Natural antisense transcript overlaps with AT1G27920;(source:Araport11) |
AT3G21130 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G52480 | transmembrane protein;(source:Araport11) |
AT5G47250 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT2G45040 | Matrixin family protein;(source:Araport11) |
AT1G26620 | T-box transcription factor, putative (DUF863);(source:Araport11) |
AT3G13820 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G11300 | hypothetical protein;(source:Araport11) |
AT1G19810 | pseudogene of cell division cycle 48C;(source:Araport11) |
AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT3G26483 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-252 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G42690 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT4G04130.1);(source:TAIR10) |
AT1G04425 | other_RNA;(source:Araport11) |
AT2G24750 | pseudogene of glutamate receptor 2.2;(source:Araport11) |
AT1G54500 | RBD1 is a thylakoid membrane-bound iron-binding protein that is required for the proper assembly of photosystem II in Arabidopsis. It is found in all oxygenic photoautotrophic organisms (plants, algae and cyanobacteria). |
AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
AT2G46735 | death domain associated protein;(source:Araport11) |
AT3G09385 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G06708 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-289 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G67480 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G05894 | hypothetical protein;(source:Araport11) |
AT3G42100 | transposable_element_gene;(source:Araport11);similar to AT hook motif-containing protein-related [Arabidopsis thaliana] (TAIR:AT1G35940.1);(source:TAIR10) |
AT5G27095 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT2G39040 | Peroxidase superfamily protein;(source:Araport11) |
AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
AT5G26330 | Cupredoxin superfamily protein;(source:Araport11) |
AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G63540 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G24485 | ER protein carbohydrate-binding protein;(source:Araport11) |
AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G47400 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G36090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G28010.1);(source:TAIR10) |
AT1G26610 | C2H2-like zinc finger protein;(source:Araport11) |
AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G44065 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G29024 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 7.1e-05 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G33530 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT5G28190 | transmembrane protein;(source:Araport11) |
AT1G22200 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT3G04270 | two-component response regulator ARR22-like protein;(source:Araport11) |
AT1G25400 | transmembrane protein;(source:Araport11) |
AT2G15610 | hypothetical protein (DUF1685);(source:Araport11) |
AT3G15940 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G07190 | Lon protease;(source:Araport11) |
AT1G80450 | VQ motif-containing protein;(source:Araport11) |
AT5G28937 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT1G17830 | hypothetical protein (DUF789);(source:Araport11) |
AT1G21520 | hypothetical protein;(source:Araport11) |
AT4G26940 | Galactosyltransferase family protein;(source:Araport11) |
AT5G08690 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
AT3G44700 | transmembrane protein;(source:Araport11) |
AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G19110 | Protein kinase superfamily protein;(source:Araport11) |
AT1G41810 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G34590.1);(source:TAIR10) |
AT3G16060 | ATP binding microtubule motor family protein;(source:Araport11) |
AT5G28600 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
AT1G62050 | Ankyrin repeat family protein;(source:Araport11) |
AT1G53120 | RNA-binding S4 domain-containing protein;(source:Araport11) |
AT5G20310 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT2G36650 | CHUP1-like protein;(source:Araport11) |
AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
AT3G44425 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-41 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT5G10695 | methionyl-tRNA synthetase;(source:Araport11) |
AT5G27705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-58 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT4G06542 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G51172 | hypothetical protein;(source:Araport11) |
AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
AT1G54700 | hypothetical protein;(source:Araport11) |
AT5G60290 | hypothetical protein;(source:Araport11) |
AT2G36885 | translation initiation factor;(source:Araport11) |
AT1G05220 | Transmembrane protein 97, Putative;(source:Araport11) |
AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G14860 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G20970 | calponin-like domain protein;(source:Araport11) |
AT3G58890 | RNI-like superfamily protein;(source:Araport11) |
AT3G07510 | maternal effect embryo arrest protein;(source:Araport11) |
AT2G07170 | ARM repeat superfamily protein;(source:Araport11) |
AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G36350 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT5G45460 | transmembrane protein;(source:Araport11) |
AT1G06730 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
AT5G35145 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, PF03078: ATHILA ORF-1 family;(source:TAIR10) |
AT1G63580 | Encodes a plasma membrane-localized protein with two DUF26 domains and a GPI anchor domain. |
AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
AT1G33130 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.3e-125 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G50840 | alpha-taxilin-like protein;(source:Araport11) |
AT5G66558 | Natural antisense transcript overlaps with AT5G66560;(source:Araport11) |
AT5G35570 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G36750 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.5e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G27150 | Target gene of MIR2111-5p. |
AT5G10820 | Major facilitator superfamily protein;(source:Araport11) |
AT3G29033 | glycine-rich protein;(source:Araport11) |
AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT2G24340 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G35555 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-177 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
AT1G67620 | Lojap-related protein;(source:Araport11) |
AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT2G15410 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.1e-217 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G51795 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
AT1G07700 | Thioredoxin superfamily protein;(source:Araport11) |
AT3G28570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G15090 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT5G02550 | hypothetical protein;(source:Araport11) |
AT2G23210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G56423 | hypothetical protein;(source:Araport11) |
AT3G56300 | Cysteinyl-tRNA synthetase, class Ia family protein;(source:Araport11) |
AT1G75550 | glycine-rich protein;(source:Araport11) |
AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
AT4G07521 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / zinc ion binding [Arabidopsis thaliana] (TAIR:AT2G01050.1);(source:TAIR10) |
AT1G35146 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-33 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G52050 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G16225 | Target SNARE coiled-coil domain protein;(source:Araport11) |
AT1G11540 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT2G06760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.4e-38 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT4G23215 | pseudogene of cysteine-rich receptor-like protein kinase family protein |
AT3G43522 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative Ta11-like non-LTR retroelement protein;(source:TAIR10) |
AT3G58530 | RNI-like superfamily protein;(source:Araport11) |
AT2G39580 | zinc finger C3H1 domain protein;(source:Araport11) |
AT1G02360 | Chitinase family protein;(source:Araport11) |
AT3G43360 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.1e-82 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G19210 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G28918 | hypothetical protein;(source:Araport11) |
AT1G58130 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G36850 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.2e-90 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
AT5G60190 | Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins. |
AT4G11200 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30370.1);(source:TAIR10) |
AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G40920 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G61360 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G35660 | erythroid differentiation factor-like protein;(source:Araport11) |
AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT2G12640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.7e-25 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G28580 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.3e-33 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT2G37975 | Yos1-like protein;(source:Araport11) |
AT2G35120 | Single hybrid motif superfamily protein;(source:Araport11) |
AT2G16420 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-39 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G01440 | hypothetical protein (DUF3133);(source:Araport11) |
AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G19055 | hypothetical protein;(source:Araport11) |
AT3G49270 | extensin-like protein;(source:Araport11) |
AT5G37750 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G49640 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT3G27390 | transmembrane protein;(source:Araport11) |
AT5G07910 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT2G17525 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G43850 | hypothetical protein;(source:Araport11) |
AT3G01960 | hypothetical protein;(source:Araport11) |
AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G38440 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G11220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-16 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT4G33820 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT2G01020 | 5.8SrRNA |
AT3G48410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G14090 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G33930 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT2G39920 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT5G47790 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT5G67000 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT1G12890 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT3G20350 | actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11) |
AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
AT4G06530 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G08310 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
AT4G07470 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30600.1);(source:TAIR10) |
AT5G46295 | transmembrane protein;(source:Araport11) |
AT5G53030 | hypothetical protein;(source:Araport11) |
AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT5G41380 | CCT motif family protein;(source:Araport11) |
AT1G53350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT4G39380 | TSL-kinase interacting-like protein;(source:Araport11) |
AT5G46871 | Encodes a defensin-like (DEFL) family protein. |
AT5G48770 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G44325 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.4e-28 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G75717 | hypothetical protein;(source:Araport11) |
AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G13770 | nuclease;(source:Araport11) |
AT2G10250 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-157 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G71730 | hypothetical protein;(source:Araport11) |
AT1G10330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G11320 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 1.7e-199 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT1G62550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10) |
AT3G50850 | Putative methyltransferase family protein;(source:Araport11) |
AT1G34660 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.1e-114 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
AT3G30830 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.8e-26 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G03820 | E6-like protein;(source:Araport11) |
AT1G20060 | ATP binding microtubule motor family protein;(source:Araport11) |
AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
AT4G05018 | transmembrane protein;(source:Araport11) |
AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
AT1G36110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G17560 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G08490 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.7e-81 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G28927 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT2G32450 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
AT3G15310 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32621.1);(source:TAIR10) |
AT1G12100 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G43030 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G24610 | cyclic AMP-responsive element-binding protein;(source:Araport11) |
AT5G02370 | ATP binding microtubule motor family protein;(source:Araport11) |
AT3G58720 | RING/U-box superfamily protein;(source:Araport11) |
AT1G45832 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.3e-80 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G08110 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.2e-66 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
AT1G74680 | Exostosin family protein;(source:Araport11) |
AT3G10195 | Encodes a defensin-like (DEFL) family protein. |
AT3G46280 | kinase-like protein;(source:Araport11) |
AT2G14455 | transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G35930.1);(source:TAIR10) |
AT5G61940 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G07473 | hypothetical protein;(source:Araport11) |
AT3G54980 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G43570 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G42645 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-127 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G42760 | DUF1685 family protein;(source:Araport11) |
AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT2G06810 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative non-LTR retroelement reverse transcriptase, blastp match of 33%25 identity and 3.5e-10 P-value to GP|10140689|gb|AAG13524.1|AC068924_29|AC068924 putative non-LTR retroelement reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G36180 | EF hand calcium-binding protein family;(source:Araport11) |
AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G09994 | pseudogene of U-box domain-containing protein / armadillo/beta-catenin repeat family protein |
AT5G48900 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G04230 | rRNA-processing EFG1-like protein (DUF2361);(source:Araport11) |
AT1G42350 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-102 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G63200 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
AT5G08430 | SWIB/MDM2 and Plus-3 and GYF domain-containing protein;(source:Araport11) |
AT5G23760 | Copper transport protein family;(source:Araport11) |
AT5G22520 | hypothetical protein;(source:Araport11) |
AT3G42791 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-56 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
AT1G31310 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G78922 | transmembrane protein;(source:Araport11) |
AT1G11112 | hypothetical protein;(source:Araport11) |
AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
AT2G13125 | hypothetical protein;(source:Araport11) |
AT3G47560 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G17270 | O-fucosyltransferase family protein;(source:Araport11) |
AT2G34670 | benzoyl-CoA reductase subunit C, putative (DUF630 and DUF632);(source:Araport11) |
AT3G63052 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
AT4G06750 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.0e-60 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT3G52030 | F-box family protein with WD40/YVTN repeat doamin;(source:Araport11) |
AT1G75490 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT2G05540 | Glycine-rich protein family;(source:Araport11) |
AT1G44150 | pseudogene of non-LTR retrolelement reverse transcriptase;(source:Araport11) |
AT3G09080 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G19400 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G51210 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
AT4G02220 | zinc finger (MYND type) family protein / programmed cell death 2 C-terminal domain-containing protein;(source:Araport11) |
AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
AT5G62610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G32628 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to mutator-like transposase, putative;(source:TAIR10) |
AT1G75810 | transmembrane protein;(source:Araport11) |
AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
AT2G13146 | Pseudogene of AT2G12905 |
AT5G64590 | NYN domain protein;(source:Araport11) |
AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
AT5G04730 | Ankyrin-repeat containing protein;(source:Araport11) |
AT3G09440 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT2G29995 | PSY3-like protein;(source:Araport11) |
AT2G11950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-158 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
AT3G26770 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G28440 | proline-rich family protein;(source:Araport11) |
AT2G32520 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G60380 | transmembrane protein, putative (DUF239);(source:Araport11) |
AT2G33010 | Ubiquitin-associated (UBA) protein;(source:Araport11) |
AT5G08240 | transmembrane protein;(source:Araport11) |
AT4G25330 | SAWADEE protein;(source:Araport11) |
AT5G48605 | Encodes a defensin-like (DEFL) family protein. |
AT1G11320 | GDSL esterase/lipase;(source:Araport11) |
AT4G16235 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
AT3G55780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT3G17120 | transmembrane protein;(source:Araport11) |
AT3G18620 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G59500 | protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase;(source:Araport11) |
AT2G13274 | Pseudogene of AT2G13150; transcription factor |
AT1G75670 | DNA-directed RNA polymerase;(source:Araport11) |
AT3G57350 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
AT4G11900 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT2G31018 | hypothetical protein;(source:Araport11) |
AT2G03900 | pseudogene of zinc transporter 7 precursor;(source:Araport11) |
AT5G58280 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT2G39170 | MEF2BNB-like protein;(source:Araport11) |
AT4G34420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G59725 | DNAJ heat shock family protein;(source:Araport11) |
AT4G16650 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G23610 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G06180 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
AT4G28706 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
AT2G09860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.1e-47 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G43291 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G43826 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G06658 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-182 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT4G10980 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-44 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G08540 | ribosomal RNA small subunit methyltransferase J;(source:Araport11) |
AT4G21865 | hypothetical protein;(source:Araport11) |
AT2G13940 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.4e-197 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT4G33985 | membrane insertase, putative (DUF1685);(source:Araport11) |
AT3G29110 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
AT3G03845 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT3G09050 | 8-amino-7-oxononanoate synthase;(source:Araport11) |
AT2G42640 | Mitogen activated protein kinase kinase kinase-like protein;(source:Araport11) |
AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
AT1G50770 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
AT2G14790 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.9e-82 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G15960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G74300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G43755 | non-LTR retrolelement reverse transcriptase-like protein;(source:Araport11) |
AT1G55430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G50210 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G52272 | pseudogene of ACYB-2/ACYB-1 (cytochrome b reductase) |
AT2G06820 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09700.1);(source:TAIR10) |
AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
AT4G11521 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT1G30350 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G44220 | F-box family protein;(source:Araport11) |
AT3G49950 | GRAS family transcription factor;(source:Araport11) |
AT2G14590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27606.1);(source:TAIR10) |
AT5G37480 | maltase-glucoamylase, intestinal protein;(source:Araport11) |
AT2G40955 | hypothetical protein;(source:Araport11) |
AT4G09060 | hypothetical protein;(source:Araport11) |
AT1G35115 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-168 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G31850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G23510 | hypothetical protein;(source:Araport11) |
AT3G21650 | Encodes protein phosphatase 2A (PP2A) B'zeta subunit. Targeted to mitochondria. |
AT3G47000 | Glycosyl hydrolase family protein;(source:Araport11) |
AT1G61480 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G50200 | hypothetical protein (DUF247);(source:Araport11) |
AT5G51180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G07944 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G32394.1);(source:TAIR10) |
AT3G10015 | pre-tRNA tRNA-Leu (anticodon: TAA);(source:Araport11, TAIR10) |
AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G23520 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT4G11945 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to transposases;(source:TAIR10) |
AT3G33035 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.1e-204 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G16040 | transmembrane protein;(source:Araport11) |
AT5G54050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
AT2G46915 | DUF3754 family protein, putative (DUF3754);(source:Araport11) |
AT2G03821 | hypothetical protein;(source:Araport11) |
AT1G06137 | transmembrane protein;(source:Araport11) |
AT5G62140 | ATP-dependent Clp protease ATP-binding subunit;(source:Araport11) |
AT4G36945 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT1G42602 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G56120 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G34880 | Amidase family protein;(source:Araport11) |
AT2G06340 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G37442 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.7e-44 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G28170 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35110.1);(source:TAIR10) |
AT3G42083 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), contains Pfam profile PF03078: ATHILA ORF-1 family;(source:TAIR10) |
AT1G73740 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G41740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G27771 | pseudogene of (SAUR) auxin-responsive family protein |
AT4G27657 | hypothetical protein;(source:Araport11) |
AT5G36297 | pseudogene of aspartyl protease family protein |
AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
AT3G17150 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G12000 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G14870 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G28110 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27590.1);(source:TAIR10) |
AT2G10220 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.3e-151 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G47680 | zinc finger (CCCH type) helicase family protein;(source:Araport11) |
AT2G28810 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT4G11216 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT3G49370 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT5G33252 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.1e-311 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT3G32043 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G20298 | pseudogene of exonuclease family protein |
AT1G19968 | other_RNA;(source:Araport11) |
AT2G35360 | ubiquitin family protein;(source:Araport11) |
AT1G27900 | RNA helicase family protein;(source:Araport11) |
AT5G14330 | transmembrane protein;(source:Araport11) |
AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G34140 | D111/G-patch domain-containing protein;(source:Araport11) |
AT1G17230 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT3G43302 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.7e-143 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G03920 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
AT1G56540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G29750 | CRS1 / YhbY (CRM) domain-containing protein;(source:Araport11) |
AT1G78350 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 9.0e-42 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT2G42320 | nucleolar protein gar2-like protein;(source:Araport11) |
AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
AT5G51730 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G38396 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G04090 | MATE efflux family protein;(source:Araport11) |
AT3G17740 | hypothetical protein;(source:Araport11) |
AT1G66100 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT2G23148 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G02205 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G28630 | glycine-rich protein;(source:Araport11) |
AT2G26380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G64090 | hyccin;(source:Araport11) |
AT4G07630 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03078: ATHILA ORF-1 family;(source:TAIR10) |
AT3G30590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G24910.1);(source:TAIR10) |
AT3G04750 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G48960 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
AT2G34950 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
AT3G25130 | acidic leucine-rich nuclear phosphoprotein 32 family B protein;(source:Araport11) |
AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
AT5G49430 | WD40/YVTN repeat and Bromo-WDR9-I-like domain-containing protein;(source:Araport11) |
AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
AT1G26940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT3G22250 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G22430 | RNA recognition motif XS domain protein;(source:Araport11) |
AT5G23490 | hypothetical protein;(source:Araport11) |
AT4G03770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.8e-206 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
AT4G08020 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.5e-93 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT5G31821 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G61660 | hypothetical protein;(source:Araport11) |
AT3G62580 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT3G33130 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-256 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G56920 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G19680 | RING/U-box superfamily protein;(source:Araport11) |
AT1G67920 | hypothetical protein;(source:Araport11) |
AT5G65490 | suppressor-like protein;(source:Araport11) |
AT5G16870 | Peptidyl-tRNA hydrolase II (PTH2) family protein;(source:Araport11) |
AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
AT1G72131 | pseudogene of proton-dependent oligopeptide transporter |
AT1G77820 | transposable_element_gene;(source:Araport11);pseudogene, endonuclease/exonuclease/phosphatase family protein, contains similarity to reverse transcriptase GI:976278 from (Arabidopsis thaliana);(source:TAIR10) |
AT3G24360 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G03405 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G56260 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
AT1G01990 | hypothetical protein;(source:Araport11) |
AT5G35732 | hypothetical protein;(source:Araport11) |
AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
AT2G05570 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.8e-75 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
AT4G28340 | pyrroline-5-carboxylate reductase;(source:Araport11) |
AT3G50050 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G01010 | rRNA;(source:Araport11) |
AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
AT2G05280 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-30 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G06481 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam domain PF03078: ATHILA ORF-1 family;(source:TAIR10) |
AT1G24145 | transmembrane protein;(source:Araport11) |
AT2G18110 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
AT1G36406 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.1e-26 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G63340 | hypothetical protein;(source:Araport11) |
AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT5G22490 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT4G36960 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G04480 | F-box protein with a domain protein;(source:Araport11) |
AT1G43680 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
AT3G29037 | Pseudogene of AT5G35760; beta-galactosidase |
AT3G30650 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G10175.1);(source:TAIR10) |
AT1G13240 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT2G25355 | PNAS-3-like protein;(source:Araport11) |
AT2G41342 | hypothetical protein;(source:Araport11) |
AT1G12190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G29771 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G63230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G25290 | DNA photolyase;(source:Araport11) |
AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT1G70010 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-289 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G26115 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT1G64583 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G13000 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT4G13110 | BSD domain-containing protein;(source:Araport11) |
AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G60480 | StAR lipid transfer-like protein;(source:Araport11) |
AT3G52870 | IQ calmodulin-binding motif family protein;(source:Araport11) |
AT5G35069 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G28830 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G29034 | transmembrane protein;(source:Araport11) |
AT5G34868 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.1e-131 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G24175 | kinesin-like protein;(source:Araport11) |
AT5G12085 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.0e-197 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G44770 | transmembrane protein, putative (DUF626);(source:Araport11) |
AT2G14878 | other_RNA;(source:Araport11) |
AT1G51405 | myosin-like protein;(source:Araport11) |
AT2G46550 | transmembrane protein;(source:Araport11) |
AT5G59450 | GRAS family transcription factor;(source:Araport11) |
AT2G24510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G29690 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G26740 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT2G40765 | transmembrane protein;(source:Araport11) |
AT5G06660 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
AT5G28660 | NHL domain-containing protein;(source:Araport11) |
AT3G10250 | histidine-tRNA ligase;(source:Araport11) |
AT2G44780 | Encodes a Uclacyanin/Basic blue family protein [pseudogene] |
AT2G06912 | pseudogene of nucleic acid binding / zinc ion binding protein;(source:Araport11) |
AT4G15590 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-50 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G35750 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
AT1G03400 | A single copy gene that encodes a protein with sequence similarity to tomato E8 (ACC oxidase, the last step in ethylene biosynthesis) involved in ethylene synthesis and fruit ripening in tomato. This gene is not induced by ethylene in siliques. The transcript is found in siliques, etiolated seedlings, leaves, stems and flowers. |
AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
AT1G52000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G36970 | transmembrane protein, putative (DUF1985);(source:Araport11) |
AT1G74088 | galacturonosyltransferase;(source:Araport11) |
AT3G11120 | Ribosomal protein L41 family;(source:Araport11) |
AT4G27660 | hypothetical protein;(source:Araport11) |
AT3G33030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-50 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G23330 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT2G39910 | ARM repeat superfamily protein;(source:Araport11) |
AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G59680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G37670 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G01570 | plectin-like protein;(source:Araport11) |
AT1G27100 | Actin cross-linking protein;(source:Araport11) |
AT1G09195 | Ppx-GppA phosphatase;(source:Araport11) |
AT2G10620 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 5.5e-59 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G20724 | Annotated as pseudogene of unknown protein.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
AT3G50130 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT5G27220 | Frigida-like protein;(source:Araport11) |
AT5G47740 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G60970 | SNARE-like superfamily protein;(source:Araport11) |
AT5G28253 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-60 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
AT4G08230 | glycine-rich protein;(source:Araport11) |
AT5G02670 | hypothetical protein;(source:Araport11) |
AT1G28400 | GATA zinc finger protein;(source:Araport11) |
AT5G49560 | Putative methyltransferase family protein;(source:Araport11) |
AT5G04070 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G05610 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, putative retrotransposon-like orf - Arabidopsis thaliana,PID:g4309868;(source:TAIR10) |
AT2G40113 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT4G21902 | hypothetical protein;(source:Araport11) |
AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT5G20852 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
AT3G16565 | threonyl and alanyl tRNA synthetase second additional domain-containing protein;(source:Araport11) |
AT3G31310 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G60930.1);(source:TAIR10) |
AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
AT1G13630 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G25530 | DNAJ heat shock family protein;(source:Araport11) |
AT2G04690 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
AT2G41810 | imidazolonepropionase (Protein of unknown function, DUF642);(source:Araport11) |
AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
AT1G61500 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G05400 | hypothetical protein;(source:Araport11) |
AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT2G31800 | Integrin-linked protein kinase family;(source:Araport11) |
AT3G25080 | hypothetical protein;(source:Araport11) |
AT5G28230 | pseudogene of glucose-6-phosphate/phosphate translocator 2;(source:Araport11) |
AT1G04555 | transmembrane protein;(source:Araport11) |
AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT5G27247 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G48620 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT2G05752 | hypothetical protein;(source:Araport11) |
AT5G65340 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT5G32702 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-150 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G37880 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT2G17043 | hypothetical protein;(source:Araport11) |
AT2G22080 | transmembrane protein;(source:Araport11) |
AT5G14230 | ankyrin;(source:Araport11) |
AT4G29270 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT2G07480 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.4e-101 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
AT5G25070 | neurofilament light protein;(source:Araport11) |
AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
AT4G19160 | transglutaminase family protein;(source:Araport11) |
AT3G22920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G23510 | OBP32pep protein;(source:Araport11) |
AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
AT3G13070 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
AT4G39170 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G53635 | hypothetical protein;(source:Araport11) |
AT2G05910 | LURP-one-like protein (DUF567);(source:Araport11) |
AT1G59770 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.2e-49 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G08076 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-64 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G51160 | Ankyrin repeat family protein;(source:Araport11) |
AT1G33590 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G01740 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G42432 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.4e-45 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G10050 | transposable_element_gene;(source:Araport11);similar to pol polyprotein-like [Solanum tuberosum] (GB:AAU89775.1);(source:TAIR10) |
AT5G37250 | RING/U-box superfamily protein;(source:Araport11) |
AT5G59945 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT5G28696 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.2e-184 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G46940 | fold protein;(source:Araport11) |
AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G32780 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
AT1G63205 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT5G37017 | Pseudogene of AT5G16486 |
AT1G67130 | F-box family protein;(source:Araport11) |
AT5G52145 | Encodes a defensin-like (DEFL) family protein. |
AT2G44200 | pre-mRNA splicing factor domain-containing protein;(source:Araport11) |
AT5G62930 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT3G62650 | hypothetical protein;(source:Araport11) |
AT5G49680 | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
AT2G07460 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT2G31820 | Ankyrin repeat family protein;(source:Araport11) |
AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT3G03670 | Peroxidase superfamily protein;(source:Araport11) |
AT4G28900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT4G32970 | BRISC/BRCA1-A complex protein;(source:Araport11) |
AT3G44150 | Expp1 protein;(source:Araport11) |
AT4G08830 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.0e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G13220 | transmembrane protein;(source:Araport11) |
AT5G41810 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT2G24620 | S-locus glycoprotein family protein;(source:Araport11) |
AT5G28288 | Encodes a defensin-like (DEFL) family protein. |
AT3G62000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT2G11820 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.3e-40 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G24332 | Natural antisense transcript overlaps with AT3G24330;(source:Araport11) |
AT5G13560 | structural maintenance of chromosomes protein;(source:Araport11) |
AT3G55735 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
AT4G40011 | hypothetical protein;(source:Araport11) |
AT2G31990 | Exostosin family protein;(source:Araport11) |
AT1G37080 | transposable_element_gene;(source:Araport11);similar to DNA binding [Arabidopsis thaliana] (TAIR:AT4G01980.1);(source:TAIR10) |
AT3G19300 | Protein kinase superfamily protein;(source:Araport11) |
AT1G54445 | Encodes a defensin-like (DEFL) family protein. |
AT4G18660 | delay of germination protein;(source:Araport11) |
AT4G07760 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 5.4e-220 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT3G52535 | Natural antisense transcript overlaps with AT3G52540;(source:Araport11) |
AT3G62990 | myelin transcription factor-like protein;(source:Araport11) |
AT3G42535 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.7e-10 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G53710 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT1G30390 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-17 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT4G25870 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G03020 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
AT4G08336 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42810.1);(source:TAIR10) |
AT5G44910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT3G12390 | Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11) |
AT5G53990 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G35340 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
AT1G74790 | catalytics;(source:Araport11) |
AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
AT5G52410 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
AT5G60150 | hypothetical protein;(source:Araport11) |
AT5G28570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G12725.1);(source:TAIR10) |
AT5G02480 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT3G14030 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G58590 | other_RNA;(source:Araport11) |
AT3G22060 | contains Pfam profile: PF01657 Domain of unknown function that is usually associated with protein kinase domain Pfam:PF00069, however this protein does not have the protein kinase domain |
AT4G03380 | hypothetical protein;(source:Araport11) |
AT5G34864 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.3e-143 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT1G59710 | actin cross-linking protein (DUF569);(source:Araport11) |
AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT5G48657 | defense protein-like protein;(source:Araport11) |
AT5G38010 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G21080 | ABC transporter-like protein;(source:Araport11) |
AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G73655 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT3G04854 | hypothetical protein;(source:Araport11) |
AT1G61475 | ATP binding / protein kinase;(source:Araport11) |
AT5G35331 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.8e-44 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G33610 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G43980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G08596 | transposable_element_gene;(source:Araport11);pseudogene, FAR1 -related protein, temporary automated functional assignment;(source:TAIR10) |
AT4G28703 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G20490 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT5G28894 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G33855 | transmembrane protein;(source:Araport11) |
AT5G28295 | hypothetical protein;(source:Araport11) |
AT2G40995 | Encodes a defensin-like (DEFL) family protein. |
AT5G39473 | pseudogene of DC1 (domain-containing protein) |
AT5G10605 | methyltransferase;(source:Araport11) |
AT3G45095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-140 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT5G39450 | F-box family protein;(source:Araport11) |
AT3G29760 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G22390 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G30380 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT5G40510 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
AT4G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G12855 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.4e-13 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G17270 | F-box/associated interaction domain protein;(source:Araport11) |
AT4G00005 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT3G25990 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G52030 | TraB family protein;(source:Araport11) |
AT4G32630 | ArfGap/RecO-like zinc finger domain-containing protein;(source:Araport11) |
AT1G12380 | hypothetical protein;(source:Araport11) |
AT1G41840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-23 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G04360 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G24690 | plant/protein, putative (DUF3411);(source:Araport11) |
AT3G51330 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G46552 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-184 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G31310 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT5G17960 | Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments. |
AT3G22030 | Receptor protein kinase-like protein;(source:Araport11) |
AT4G10170 | SNARE-like superfamily protein;(source:Araport11) |
AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT4G08780 | Peroxidase superfamily protein;(source:Araport11) |
AT3G22070 | proline-rich family protein;(source:Araport11) |
AT5G51490 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G00580 | COP1-interacting protein-like protein;(source:Araport11) |
AT2G41550 | Rho termination factor;(source:Araport11) |
AT3G51340 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G37036 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 6.6e-26 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT5G42330 | hypothetical protein;(source:Araport11) |
AT4G11930 | hypothetical protein;(source:Araport11) |
AT3G55590 | Glucose-1-phosphate adenylyltransferase family protein;(source:Araport11) |
AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G16930 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G58412 | Encodes a Plant thionin family protein |
AT3G15330 | pseudogene of the NLI interacting factor (NIF) protein family |
AT2G10990 | pseudogene of reverse transcriptase-like protein;(source:Araport11) |
AT3G21351 | transmembrane protein;(source:Araport11) |
AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
AT2G05786 | hypothetical protein;(source:Araport11) |
AT2G31345 | transmembrane protein;(source:Araport11) |
AT1G28640 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G59990 | CCT motif family protein;(source:Araport11) |
AT2G05133 | Pseudogene of AT2G37680 |
AT2G38970 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT1G42515 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G45570.1);(source:TAIR10) |
AT2G32470 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G39430 | DUF1336 family protein, putative (DUF1336);(source:Araport11) |
AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G37483 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G44045 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-19 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT5G19670 | Exostosin family protein;(source:Araport11) |
AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT4G37022 | hypothetical protein;(source:Araport11) |
AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT2G40600 | appr-1-p processing enzyme family protein;(source:Araport11) |
AT3G28005 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G11640 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10) |
AT3G48660 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
AT4G36660 | polyol transporter, putative (DUF1195);(source:Araport11) |
AT4G06710 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G27852 | Natural antisense transcript overlaps with AT4G27850 and AT4G27860;(source:Araport11) |
AT1G68680 | SH3/FCH domain protein;(source:Araport11) |
AT5G46260 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G59020 | ARM repeat superfamily protein;(source:Araport11) |
AT5G33442 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
AT2G23200 | Protein kinase superfamily protein;(source:Araport11) |
AT4G04440 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-215 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G79740 | hAT transposon superfamily;(source:Araport11) |
AT3G45525 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
AT1G51720 | Amino acid dehydrogenase family protein;(source:Araport11) |
AT5G28655 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G34550 | F-box protein;(source:Araport11) |
AT4G18940 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
AT5G28830 | calcium-binding EF hand family protein;(source:Araport11) |
AT5G45690 | histone acetyltransferase (DUF1264);(source:Araport11) |
AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G66340 | hypothetical protein;(source:Araport11) |
AT5G18500 | Protein kinase superfamily protein;(source:Araport11) |
AT1G63830 | PLAC8 family protein;(source:Araport11) |
AT5G25451 | Pseudogene of AT5G25440; protein kinase family protein |
AT5G27980 | Seed maturation protein;(source:Araport11) |
AT2G05715 | pseudogene of GLU-ADT subunit B;(source:Araport11) |
AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
AT1G48210 | Protein kinase superfamily protein;(source:Araport11) |
AT1G52810 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G34690 | pseudogene of maturase K;(source:Araport11) |
AT3G07273 | hypothetical protein;(source:Araport11) |
AT5G45240 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT5G64830 | programmed cell death 2 C-terminal domain-containing protein;(source:Araport11) |
AT3G62220 | Protein kinase superfamily protein;(source:Araport11) |
AT3G07200 | RING/U-box superfamily protein;(source:Araport11) |
AT4G15053 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
AT1G70430 | Protein kinase superfamily protein;(source:Araport11) |
AT2G04500 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G08485 | Encodes a defensin-like (DEFL) family protein. |
AT1G15540 | 2-oxoglutarate-dependent dioxygenase-like protein;(source:Araport11) |
AT3G30335 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.2e-129 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT2G13170 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-88 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT1G19380 | sugar, putative (DUF1195);(source:Araport11) |
AT3G32904 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT5G21050 | hyccin;(source:Araport11) |
AT1G34440 | transmembrane protein;(source:Araport11) |
AT4G40050 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
AT4G34150 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G26100 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT5G24080 | Protein kinase superfamily protein;(source:Araport11) |
AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G01170 | hypothetical protein;(source:Araport11) |
AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G39540 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G57790 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G29562 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.8e-228 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G29773 | pseudogene of nuclease;(source:Araport11) |
AT2G10330 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.7e-176 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G15170 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
AT5G53050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G48640 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G41612 | Natural antisense transcript overlaps with AT5G41610;(source:Araport11) |
AT4G03913 | pseudogene of Ulp1 protease family protein;(source:Araport11) |
AT5G56452 | FBD-like domain family protein;(source:Araport11) |
AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
AT4G16840 | transmembrane protein;(source:Araport11) |
AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
AT1G69980 | structural polyprotein;(source:Araport11) |
AT3G30685 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase GB:AAD25149 from (Arabidopsis thaliana);(source:TAIR10) |
AT5G01350 | UvrABC system C protein;(source:Araport11) |
AT5G07322 | other_RNA;(source:Araport11) |
AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G32220 | Ribosomal L27e protein family;(source:Araport11) |
AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
AT1G05136 | hypothetical protein;(source:Araport11) |
AT1G59865 | transmembrane protein;(source:Araport11) |
AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT4G04745 | hypothetical protein;(source:Araport11) |
AT3G15650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G58225 | hypothetical protein;(source:Araport11) |
AT2G11050 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.7e-211 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G31985 | Ribosomal protein L39 family protein;(source:Araport11) |
AT5G52680 | Copper transport protein family;(source:Araport11) |
AT3G45670 | Protein kinase superfamily protein;(source:Araport11) |
AT1G36600 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.9e-21 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G51920 | transmembrane protein;(source:Araport11) |
AT1G05291 | GPI inositol-deacylase C, putative (DUF1218);(source:Araport11) |
AT1G23350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G47965 | hypothetical protein;(source:Araport11) |
AT5G02860 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
AT1G45207 | Remorin family protein;(source:Araport11) |
AT1G62250 | orotidine 5-phosphate decarboxylase;(source:Araport11) |
AT1G48010 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G32047 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT5G38310 | hypothetical protein;(source:Araport11) |
AT4G26483 | nicotianamine synthase;(source:Araport11) |
AT5G01130 | hypothetical protein (DUF674);(source:Araport11) |
AT3G61117 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G15250 | TPRXL;(source:Araport11) |
AT3G41979 | 5.8SrRNA |
AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
AT3G24929 | hypothetical protein;(source:Araport11) |
AT3G62200 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT1G29465 | transmembrane protein;(source:Araport11) |
AT4G02340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G44757 | pseudogene of transmembrane protein;(source:Araport11) |
AT3G01175 | transmembrane protein;(source:Araport11) |
AT1G23840 | transmembrane protein;(source:Araport11) |
AT5G67510 | Translation protein SH3-like family protein;(source:Araport11) |
AT1G07160 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G24065 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G01510 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G48440 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT5G25200 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT1G55980 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT3G43575 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-44 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT4G06585 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.8e-06 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G36895 | D-tagatose-1,6-bisphosphate aldolase subunit;(source:Araport11) |
AT4G14290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G18815 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
AT3G01930 | Major facilitator superfamily protein;(source:Araport11) |
AT1G65850 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G08670 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
AT3G50370 | hypothetical protein;(source:Araport11) |
AT5G49040 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT2G13469 | pseudogene of putative nucleic-acid protein;(source:Araport11) |
AT4G19930 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G17580 | Bax inhibitor-1 family protein;(source:Araport11) |
AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
AT3G27600 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
AT2G37220 | Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT3G54270 | sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
AT5G47170 | hypothetical protein;(source:Araport11) |
AT1G45238 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT2G15160 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.8e-86 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G77550 | tubulin-tyrosine ligase;(source:Araport11) |
AT4G05060 | PapD-like superfamily protein;(source:Araport11) |
AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G08270 | vacuolar protein sorting-associated protein;(source:Araport11) |
AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
AT1G36620 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-54 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G13662 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
AT3G46140 | Protein kinase superfamily protein;(source:Araport11) |
AT3G58920 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G40981 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G04500 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G46915 | transcriptional factor B3 family protein;(source:Araport11) |
AT3G18560 | hypothetical protein;(source:Araport11) |
AT3G28850 | Glutaredoxin family protein;(source:Araport11) |
AT5G33260 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
AT1G43763 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-96 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
AT2G35387 | snoRNA;(source:Araport11) |
AT2G06822 | Pseudogene of AT2G06822 |
AT5G35753 | DnaJ heat shock amino-terminal domain protein (DUF3444);(source:Araport11) |
AT2G11135 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04273.1);(source:TAIR10) |
AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT2G01008 | maternal effect embryo arrest protein;(source:Araport11) |
AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
AT2G21020 | pseudogene of NOD26-like intrinsic protein 3;(source:Araport11) |
AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G46350 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT3G30220 | hypothetical protein;(source:Araport11) |
AT3G61010 | Ferritin/ribonucleotide reductase-like family protein;(source:Araport11) |
AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT5G48140 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G48730 | hypothetical protein;(source:Araport11) |
AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G33163 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G55928 | nuclear speckle splicing regulatory-like protein (DUF2040);(source:Araport11) |
AT4G12870 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
AT5G06480 | Immunoglobulin E-set superfamily protein;(source:Araport11) |
AT2G10210 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.0e-209 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G47600 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G19090 | DUF630 family protein (DUF630 and DUF632);(source:Araport11) |
AT5G60250 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G57120 | nucleolar/coiled-body phosphoprotein;(source:Araport11) |
AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G06490 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.5e-83 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G23150 | hypothetical protein;(source:Araport11) |
AT2G21905 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT3G49400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G01670 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT5G34832 | pseudogene of hypothetical protein;(source:Araport11) |
AT2G07300 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G35090.1);(source:TAIR10) |
AT1G54820 | Protein kinase superfamily protein;(source:Araport11) |
AT5G49770 | Leucine rich receptor kinase. |
AT5G57535 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT2G16905 | pseudogene of MATE efflux family protein;(source:Araport11) |
AT2G41178 | Natural antisense transcript overlaps with AT2G41180;(source:Araport11) |
AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT4G16870 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G65365 | pseudogene of WALL ASSOCIATED KINASE (WAK)-LIKE 10;(source:Araport11) |
AT1G12030 | phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11) |
AT1G10705 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
AT4G24644 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G27270 | Quinone reductase family protein;(source:Araport11) |
AT3G58035 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT1G38710 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.8e-117 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT1G52180 | Aquaporin-like superfamily protein;(source:Araport11) |
AT3G33187 | Encodes a defensin-like (DEFL) family protein. |
AT4G30640 | RNI-like superfamily protein;(source:Araport11) |
AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT3G55870 | ADC synthase superfamily protein;(source:Araport11) |
AT4G03965 | RING/U-box superfamily protein;(source:Araport11) |
AT2G29065 | GRAS family transcription factor;(source:Araport11) |
AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT4G01960 | transmembrane protein;(source:Araport11) |
AT5G24620 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT5G35810 | Ankyrin repeat family protein;(source:Araport11) |
AT4G32870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
AT3G31955 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G04210.1);(source:TAIR10) |
AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G68907 | Encodes a defensin-like (DEFL) family protein. |
AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
AT5G54710 | Ankyrin repeat family protein;(source:Araport11) |
AT3G58520 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G30490 | craniofacial development-like protein;(source:Araport11) |
AT5G16170 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G49000 | transmembrane protein;(source:Araport11) |
AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
AT2G04860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G03955 | Encodes a defensin-like (DEFL) family protein. |
AT5G54480 | hypothetical protein (DUF630 and DUF632);(source:Araport11) |
AT1G49475 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
AT5G32520 | transposable_element_gene;(source:Araport11);pseudogene, expressed protein, predicted proteins, Arabidopsis thaliana and others;(source:TAIR10) |
AT2G26970 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G58037 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G08345 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT1G64618 | other_RNA;(source:Araport11) |
AT5G13940 | aminopeptidase;(source:Araport11) |
AT1G69660 | TRAF-like family protein;(source:Araport11) |
AT1G56480 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G37000 | glycosyltransferase family exostosin protein;(source:Araport11) |
AT3G44205 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.5e-40 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT3G62840 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT1G69150 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G32397 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.1e-81 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G24650 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
AT3G45730 | hypothetical protein;(source:Araport11) |
AT3G61545 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
AT3G26670 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT3G04970 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G42910 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G28250.1);(source:TAIR10) |
AT3G13950 | ankyrin;(source:Araport11) |
AT4G14370 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G60830 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G35945 | F-box/LRR protein;(source:Araport11) |
AT3G30410 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.4e-26 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT3G50170 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G11220 | cotton fiber, putative (DUF761);(source:Araport11) |
AT3G26950 | transmembrane protein;(source:Araport11) |
AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
AT2G04300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G65010 | Encodes a microtubule-associated protein. Putative role in flower development. Comparison of SALK_061426C to Columbia wild type in normal lighting and under low light of 33 micromoles per meter-squared per second resulted in a trend toward earlier bolting in the mutant under low light (P=0.055) (Ann Stapleton and Patrick Pridgen, 2009, personal communication). |
AT4G06477 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.1e-112 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G06620 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
AT4G06682 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-196 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G33607 | Encodes a defensin-like (DEFL) family protein. |
AT3G04220 | Target of miR825/825. Mutants have decreased resistance to fungal pathogens. |
AT4G32640 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT3G43352 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-09 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
AT2G33760 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G75210 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
AT5G46645 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 0.00040 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G47980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G64910 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G07475 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to En/Spm-like transposon protein;(source:TAIR10) |
AT3G57400 | transmembrane protein;(source:Araport11) |
AT5G57340 | ras guanine nucleotide exchange factor Q-like protein;(source:Araport11) |
AT3G09960 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT3G32023 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.7e-54 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G39950 | flocculation protein;(source:Araport11) |
AT3G27999 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G00780 | TRAF-like family protein;(source:Araport11) |
AT1G48625 | pseudogene of F-box family protein |
AT5G11242 | pseudogene of ribosomal protein |
AT5G25050 | Major facilitator superfamily protein;(source:Araport11) |
AT5G39370 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
AT3G43990 | Bromo-adjacent homology (BAH) domain-containing protein;(source:Araport11) |
AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
AT3G15760 | cytochrome P450 family protein;(source:Araport11) |
AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT4G16610 | C2H2-like zinc finger protein;(source:Araport11) |
AT1G78780 | pathogenesis-related family protein;(source:Araport11) |
AT3G29240 | PPR containing protein (DUF179);(source:Araport11) |
AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
AT3G21770 | Peroxidase superfamily protein;(source:Araport11) |
AT1G47940 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G07934 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-44 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G55070 | LisH/CRA/RING-U-box domains-containing protein;(source:Araport11) |
AT5G46325 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT3G06520 | agenet domain-containing protein;(source:Araport11) |
AT4G08691 | hypothetical protein;(source:Araport11) |
AT3G42916 | transposable_element_gene;(source:Araport11);transposon protein -related, temporary automated functional assignment;(source:TAIR10) |
AT4G24530 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G15800 | hypothetical protein;(source:Araport11) |
AT2G37370 | centrosomal protein of 135 kDa-like protein;(source:Araport11) |
AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
AT3G58300 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT5G43800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G61670 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT3G21620 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
AT1G70600 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
AT1G27020 | plant/protein;(source:Araport11) |
AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G56720 | pre-mRNA-splicing factor;(source:Araport11) |
AT3G49610 | B3 domain protein (DUF313);(source:Araport11) |
AT1G55535 | transmembrane protein;(source:Araport11) |
AT5G52370 | 28S ribosomal S34 protein;(source:Araport11) |
AT3G45770 | Polyketide synthase, enoylreductase family protein;(source:Araport11) |
AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
AT2G10960 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT4G31230 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT3G18840 | LOW protein: PPR containing-like protein;(source:Araport11) |
AT5G62770 | membrane-associated kinase regulator, putative (DUF1645);(source:Araport11) |
AT4G36370 | hypothetical protein;(source:Araport11) |
AT1G62045 | ankyrin repeat protein;(source:Araport11) |
AT4G32140 | EamA-like transporter family;(source:Araport11) |
AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G21960 | RING/U-box superfamily protein;(source:Araport11) |
AT2G01023 | hypothetical protein;(source:Araport11) |
AT5G21080 | Uncharacterized protein;(source:Araport11) |
AT1G68340 | hypothetical protein (DUF1639);(source:Araport11) |
AT5G14460 | Pseudouridine synthase family protein;(source:Araport11) |
AT5G03795 | Exostosin family protein;(source:Araport11) |
AT5G06125 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT5G39770 | Represents a non-function pseudogene homologous to AtMSU81 (At4g30870). |
AT1G08165 | hypothetical protein;(source:Araport11) |
AT5G03377 | pseudogene of acylphosphatase family protein |
AT1G43835 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT3G61160 | Protein kinase superfamily protein;(source:Araport11) |
AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT2G12490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G56550 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G39640 | glycosyl hydrolase family 17 protein;(source:Araport11) |
AT4G04320 | malonyl-CoA decarboxylase family protein;(source:Araport11) |
AT4G38650 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT1G63660 | GMP synthase (glutamine-hydrolyzing), putative / glutamine amidotransferase;(source:Araport11) |
AT5G38910 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G20880 | ethylene-responsive nuclear protein / ethylene-regulated nuclear protein (ERT2);(source:Araport11) |
AT1G56610 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT5G59410 | Rab5-interacting family protein;(source:Araport11) |
AT5G29550 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.4e-126 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G44800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G29210 | hypothetical protein;(source:Araport11) |
AT2G05190 | pseudogene of cytochrome P450;(source:Araport11) |
AT5G31770 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.7e-53 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G45990 | Cofilin/tropomyosin-type actin-binding protein family;(source:Araport11) |
AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
AT5G32630 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, various predicted helicase proteins, Arabidopsis thaliana and others;(source:TAIR10) |
AT3G54740 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT1G20120 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G03565 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G70030 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT3G32050 | hypothetical protein;(source:Araport11) |
AT1G62870 | hypothetical protein;(source:Araport11) |
AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT2G06090 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
AT1G55280 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
AT1G51300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G44350 | ethylene-responsive nuclear protein-like protein;(source:Araport11) |
AT5G41760 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT4G17700 | hypothetical protein;(source:Araport11) |
AT2G27320 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT4G36500 | hypothetical protein;(source:Araport11) |
AT3G50040 | hypothetical protein;(source:Araport11) |
AT4G14980 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G34800 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
AT3G59765 | None;(source:Araport11) |
AT1G70050 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT1G06550 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT1G11200 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT1G14170 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT5G67350 | hypothetical protein;(source:Araport11) |
AT5G33075 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.5e-216 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT2G28990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G52905 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT2G41620 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
AT1G19240 | transmembrane protein;(source:Araport11) |
AT3G07580 | hypothetical protein;(source:Araport11) |
AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G42950 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G60410 | hypothetical protein (DUF1639);(source:Araport11) |
AT1G77270 | hypothetical protein;(source:Araport11) |
AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT2G40260 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G33380 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.1e-10 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G28840 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G64405 | hypothetical protein;(source:Araport11) |
AT5G27970 | ARM repeat superfamily protein;(source:Araport11) |
AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G15340 | glycine-rich protein;(source:Araport11) |
AT4G06541 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G10720 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT3G22415 | hypothetical protein;(source:Araport11) |
AT2G05000 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G47320.1);(source:TAIR10) |
AT5G35604 | myosin heavy chain-like protein;(source:Araport11) |
AT3G47490 | HNH endonuclease;(source:Araport11) |
AT5G37474 | Encodes a defensin-like (DEFL) family protein. |
AT3G48420 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT4G16490 | ARM repeat superfamily protein;(source:Araport11) |
AT1G62270 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G13128 | pseudogene of F-box family protein |
AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G28250 | transmembrane protein;(source:Araport11) |
AT3G29785 | Pol-like polyprotein/retrotransposon;(source:Araport11) |
AT1G24440 | RING/U-box superfamily protein;(source:Araport11) |
AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
AT2G29340 | NAD-dependent epimerase/dehydratase family protein;(source:Araport11) |
AT5G22690 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
AT2G08986 | hypothetical protein;(source:Araport11) |
AT4G04985 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G30000 | PHF5-like protein;(source:Araport11) |
AT4G02405 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G47830 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G78060 | Glycosyl hydrolase family protein;(source:Araport11) |
AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G48420 | hypothetical protein;(source:Araport11) |
AT1G77650 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G59170 | Proline-rich extensin-like family protein;(source:Araport11) |
AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G10290 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT1G33790 | jacalin lectin family protein;(source:Araport11) |
AT2G13080 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
AT5G34854 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT4G04730 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT2G47720 | hypothetical protein;(source:Araport11) |
AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G09110 | hypothetical protein (DUF674);(source:Araport11) |
AT3G33118 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G22580 | Exostosin family protein;(source:Araport11) |
AT5G49525 | transmembrane protein;(source:Araport11) |
AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
AT1G32460 | hypothetical protein;(source:Araport11) |
AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G13910 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G14230 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
AT3G22530 | heat shock protein;(source:Araport11) |
AT5G42620 | metalloendopeptidase / zinc ion binding protein;(source:Araport11) |
AT2G22220 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
AT3G42180 | Exostosin family protein;(source:Araport11) |
AT4G06648 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-181 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G27900 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-26 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT1G13550 | hypothetical protein (DUF1262);(source:Araport11) |
AT3G20360 | TRAF-like family protein;(source:Araport11) |
AT5G66490 | hypothetical protein;(source:Araport11) |
AT5G43415 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.5e-36 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G28480 | Oxoglutarate/iron-dependent oxygenase;(source:Araport11) |
AT5G22700 | LOW protein: F-box/FBD/LRR-like protein;(source:Araport11) |
AT1G13485 | hypothetical protein;(source:Araport11) |
AT2G06080 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 38%25 identity and 7.7e-40 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT1G02610 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G17450 | B-block binding subunit of TFIIIC;(source:Araport11) |
AT4G06490 | hypothetical protein (DUF3287);(source:Araport11) |
AT5G10800 | RNA recognition motif (RRM)-containing protein;(source:Araport11) |
AT1G43280 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.6e-47 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT5G53592 | FBD-like domain family protein;(source:Araport11) |
AT3G61715 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT4G14470 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-25 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G61810 | Glycosyl hydrolase family 17 protein;(source:Araport11) |
AT3G48490 | hypothetical protein;(source:Araport11) |
AT5G32591 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, PF03078: ATHILA ORF-1 family;(source:TAIR10) |
AT5G03905 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G07920 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G29170 | transmembrane protein (DUF872);(source:Araport11) |
AT2G05550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.6e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G05440 | C2 domain-containing protein;(source:Araport11) |
AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
AT3G17140 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G76440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT3G48020 | hypothetical protein;(source:Araport11) |
AT3G30733 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT1G33360 | Encodes ClpX3, a subunit of the Clp protease complex. |
AT5G23170 | Protein kinase superfamily protein;(source:Araport11) |
AT5G44705 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
AT3G29260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G32560 | paramyosin-like protein;(source:Araport11) |
AT2G37730 | glycosyltransferase (DUF604);(source:Araport11) |
AT5G32900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.6e-05 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G02520 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G02490 | hypothetical protein;(source:Araport11) |
AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
AT3G25680 | SLH domain protein;(source:Araport11) |
AT5G35777 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-67 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
AT2G42060 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G30859 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.6e-42 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G43895 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT1G72855 | Natural antisense transcript overlaps with AT1G72860;(source:Araport11) |
AT4G31760 | peroxidase superfamily protein;(source:Araport11) |
AT1G69050 | hypothetical protein;(source:Araport11) |
AT4G38030 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT3G17780 | B-cell receptor-associated-like protein;(source:Araport11) |
AT3G11960 | Cleavage and polyadenylation specificity factor (CPSF) A subunit protein;(source:Araport11) |
AT5G23520 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
AT2G33350 | CCT motif family protein;(source:Araport11) |
AT2G13335 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 9.7e-06 P-value blast match to GB:BAA84457 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902444|dbj|BAA84457.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT4G33550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G12880 | proline-rich family protein;(source:Araport11) |
AT1G76120 | Pseudouridine synthase family protein;(source:Araport11) |
AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G37800 | cysteine/histidine-rich C1 domain protein;(source:Araport11) |
AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G47640 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT3G55790 | transmembrane protein;(source:Araport11) |
AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
AT2G14255 | Ankyrin repeat family protein with DHHC zinc finger domain-containing protein;(source:Araport11) |
AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G23760 | Cox19-like CHCH family protein;(source:Araport11) |
AT2G03580 | F-box family protein-like protein;(source:Araport11) |
AT5G35070 | pseudogene of hypothetical protein;(source:Araport11) |
AT5G27905 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-35 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G15710 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT4G08091 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 4.4e-31 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G11000 | Ankyrin repeat family protein;(source:Araport11) |
AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
AT1G57690 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G02620 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G13590 | hypothetical protein;(source:Araport11) |
AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G27416 | transmembrane protein;(source:Araport11) |
AT3G04960 | trichohyalin, putative (DUF3444);(source:Araport11) |
AT2G40020 | Nucleolar histone methyltransferase-related protein;(source:Araport11) |
AT3G43955 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G20155 | hypothetical protein;(source:Araport11) |
AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G37120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G18420.1);(source:TAIR10) |
AT5G41960 | zinc finger matrin-type protein;(source:Araport11) |
AT3G50340 | hypothetical protein;(source:Araport11) |
AT3G49050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
AT3G32964 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.7e-181 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT2G04100 | MATE efflux family protein;(source:Araport11) |
AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT3G02010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G30405 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.1e-154 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT4G11630 | Ribosomal protein L19 family protein;(source:Araport11) |
AT5G25920 | hypothetical protein;(source:Araport11) |
AT2G15420 | myosin heavy chain-like protein;(source:Araport11) |
AT3G48650 | pseudogene of pectinesterase;(source:Araport11) |
AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
AT4G11790 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT1G45760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-37 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G24260 | prolyl oligopeptidase family protein;(source:Araport11) |
AT5G40070 | MADS-box family protein;(source:Araport11) |
AT4G17590 | NOL1/NOP2/sun family protein;(source:Araport11) |
AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
AT5G26345 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-43 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G24010 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT1G62421 | hypothetical protein;(source:Araport11) |
AT5G60570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G01327 | Encodes a ECA1 gametogenesis related family protein |
AT3G24530 | AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11) |
AT4G14780 | Protein kinase superfamily protein;(source:Araport11) |
AT1G74870 | RING/U-box superfamily protein;(source:Araport11) |
AT1G35610 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
AT1G45242 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G35870 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.4e-152 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT2G31290 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT3G21965 | pseudogene of Receptor-like protein kinase-related family protein;(source:Araport11) |
AT5G14680 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT1G02990 | hypothetical protein;(source:Araport11) |
AT3G12950 | Trypsin family protein;(source:Araport11) |
AT1G22560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.4e-20 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G07010 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G74330 | Protein kinase superfamily protein;(source:Araport11) |
AT3G60370 | Encodes an immunophilin, FKBP20-2, that belongs to the FK-506 binding protein (FKBP) subfamily functioning as peptidyl-prolyl isomerases (PPIases) in protein folding. FKBP20-2 has a unique pair of cysteines at the C terminus and was found to be reduced by thioredoxin (Trx) (itself reduced by NADPH by means of NADP-Trx reductase). The FKBP20-2 protein, which contains only two of the five amino acids required for catalysis, showed a low level of PPIase activity that was unaffected on reduction by Trx. Genetic disruption of the FKBP20-2 gene provide evidence that FKBP20-2 participates specifically in the accumulation of the PSII supercomplex in the chloroplast thylakoid lumen by means of a mechanism that has yet to be determined. |
AT3G01880 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT4G06654 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.2e-88 P-value blast match to GB:BAA84458 GAG-POL precursor (gypsy_Ty3-element) (Oryza sativa)gi|5902445|dbj|BAA84458.1| GAG-POL precursor (Oryza sativa (japonica cultivar-group)) (RIRE2) (Gypsy_Ty3-family);(source:TAIR10) |
AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G13495 | other_RNA;(source:Araport11) |
AT5G10340 | F-box family protein;(source:Araport11) |
AT2G35410 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G21850 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G62760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G33817 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-100 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT4G15150 | glycine-rich protein;(source:Araport11) |
AT2G19160 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G63840 | RING/U-box superfamily protein;(source:Araport11) |
AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
AT1G50380 | Prolyl oligopeptidase family protein;(source:Araport11) |
AT4G05510 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.0e-144 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
AT5G55132 | Encodes a defensin-like (DEFL) family protein. |
AT2G22460 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT4G28170 | transmembrane protein;(source:Araport11) |
AT2G41050 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
AT3G33166 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.2e-29 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G31023 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-152 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G06135 | transmembrane protein;(source:Araport11) |
AT1G06720 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G13525 | snoRNA;(source:Araport11) |
AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT1G35516 | myb-like transcription factor family protein;(source:Araport11) |
AT2G32030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G15890 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G20480 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT4G14819 | hypothetical protein (DUF1677);(source:Araport11) |
AT5G41420 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G05500 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
AT1G55207 | hypothetical protein;(source:Araport11) |
AT5G45510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G28360 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
AT5G53010 | calcium-transporting ATPase;(source:Araport11) |
AT1G36445 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBa0026J14.30, blastp match of 62%25 identity and 5.5e-108 P-value to GP|20146463|dbj|BAB89243.1||AP004231 OSJNBa0026J14.30 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT4G25570 | Encodes cytochrome b561. |
AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
AT3G07030 | Alba DNA/RNA-binding protein;(source:Araport11) |
AT4G03070 | Encodes a possible 2-oxoglutarate-dependent dioxygenase that is involved in glucosinolate biosynthesis. The gene is expressed in all ecotypes examined but the enzymatic activity has not been determined experimentally. In Col, there is one copy of this gene (aka AOP1.1) but Ler contains two copies, AOP1.1 and a tightly linked AOP1.2. |
AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
AT2G43130 | encodes a protein belonging to the Rab/Ypt family of small GTPases, which are implicated in intracellular vesicular traffic. |
AT1G24140 | Expression induced by fungal and bacterial pathogens. |
AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
AT4G15415 | B' regulatory subunit of PP2A (AtB'gamma) |
AT1G01980 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30730 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT5G26130 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT5G44050 | MATE efflux family protein;(source:Araport11) |
AT1G22810 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity. |
AT3G11730 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
AT4G24990 | geranylgeranylated protein ATGP4 |
AT1G48605 | Encodes a protein similar to yeast HAL3, which regulates the cell cycle and tolerance to salt stress through inhibition of the PPZ1 type-1 protein phosphatase. AtHAL3b mRNA levels are induced by salt stress. HAL3B presumably encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis as indicated by functional complementation of a double mutant hal3 aaBb. |
AT2G34510 | Protein of unknown function, DUF642. Found in cellulose enriched cell wall fractions. |
AT4G03520 | Encodes a redox activated co-chaperone, chloroplast localized thioredoxin, similar to prokaryotic types. |
AT1G34360 | translation initiation factor 3 (IF-3) family protein;(source:Araport11) |
AT1G72310 | Encodes a putative RING-H2 zinc finger protein ATL3 (ATL3). |
AT5G55460 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
AT4G29170 | A homolog of yeast, mouse and human mnd1delta protein. Null mutants exhibit normal vegetative and flower development; however, during prophase I, chromosomes become fragmented resulting in random distribution of the fragments between polyads. Both male and female meiosis are defective and strong accumulation of AtRAD51 was observed in the inflorescence nuclei of mutant plants. Similarly to its yeast and animal homologues, AtMnd1 might play a role in DSB repair during meiosis. |
AT3G27560 | encodes a protein with kinase domains, including catalytic domains for serine/threonine as well as tyrosine kinases. a member of multi-gene family and is expressed in all tissues examined. |
AT2G31450 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G35537 | Encodes a defensin-like peptide with antifungal activity. |
AT3G47380 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. |
AT3G14300 | pectinesterase family protein;(source:Araport11) |
AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT2G23310 | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. |
AT1G08600 | The Arabidopsis ATRX harbours a N-terminal ADD domain and a C-terminal helicase domain and is devoid of the large central region involved in DAXX interaction in mammals. Arabidopsis ATRX mutant alleles are viable, but with reduced fertility. Their combination with mutants for the H3.3 chaperone HIRA impairs plant survival. ATRX loss affects cellular histone H3.3 pools and modulates the H3.1/H3.3 balance. Notably, at a genome-wide scale, loss of ATRX leads to a reduced H3.3 level at genes characterized by elevated H3.3 occupancy and high expression, including the 45S ribosomal DNA (45S rDNA) loci. Indeed, expression of specific 45S rDNA sequence variants is altered by ATRX loss (DOI:10.1105/tpc.16.00877) |
AT3G18370 | C2 domain-containing protein;(source:Araport11) |
AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT4G12490 | Encodes a member of the AZI family of lipid transfer proteins. Contains a PRR domain that appears to be required for localization to the chloroplast. |
AT2G01340 | Encodes a protein whose expression is responsive to nematode infection; PADRE protein up-regulated after infection by S. sclerotiorun. |
AT5G24240 | Encodes PI4Kc3, localizes to the nucleus and has autophosphorylation activity, but no lipid kinase activity. Overexpression mutants display late-flowering phenotype. |
AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT5G20990 | Involved in molybdenum cofactor (Moco) biosynthesis, inserting Mo into Molybdopterin. sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
AT3G11480 | The gene encodes a SABATH methyltransferase that methylates both salicylic acid and benzoic acid. It is highly expressed in flowers, induced by biotic and abiotic stress and thought to be involved in direct defense mechanism. |
AT1G15280 | CASC3/Barentsz eIF4AIII binding protein;(source:Araport11) |
AT3G10800 | Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment. It is cleaved by S2P to allow translocation to the nucleus. The mRNA is cell-to-cell mobile. |
AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
AT2G45770 | chloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids. |
AT1G56190 | One of a pair of plastid localized phosphoglycerate kinases involved in galactolipid biosynthesis. Functions redundantly with AT3g12780 (PGK1) in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal. |
AT5G08650 | Critical for chloroplast protein synthesis under suboptimal conditions. Essential translation factor that promotes the efficiency of chloroplast protein synthesis. |
AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
AT1G17760 | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex. |
AT2G35660 | Encodes a member of a novel gene family with homology to known proteins involved in hydroxylation and oxidation of an aromatic ring. |
AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
AT1G59620 | Encodes CW9. |
AT4G27120 | ER-resident adaptor protein. Part of complex with C53 and UFL1, the E3 ligase that mediates ufmylation. Involved in the pathway that links ribosome-associated quality control with selective autophagy at the ER. |
AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT2G40340 | Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
AT4G26910 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
AT1G30580 | GTP binding protein;(source:Araport11) |
AT1G56050 | GTP-binding protein-like protein;(source:Araport11) |
AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT1G30960 | Ortholog of ERA (E. coli RAS-like protein)-related GTPase (ERG). Mitochondrial protein that associates with 18sRNA. Heterozygous mutants segregate for embryo lethality inherited as a sporphytic maternal effect. Increased ROS in the mutant ovule suggests a heritable mitochondrial defect results in lethality. |
AT5G07580 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT2G32170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
AT3G52750 | Nuclear gene that encodes a plastidial division protein (FtsZ2-2). FtsZ2-2 is involved in chloroplast morphology and internal organisation in addition to participating in chloroplast partition |
AT5G13480 | Encodes a protein with similarity to yeast Pfs2p, an mRNA processing factor. Involved in regulation of flowering time; affects FCA mRNA processing. Homozygous mutants are late flowering, null alleles are embryo lethal. |
AT1G27120 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. |
AT1G29670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
AT1G17890 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
AT1G08750 | GPI8/PIG-K homolog involved in stomata development. Loss of function alleles do not transmit through the pollen. |
AT5G11010 | Nuclear-localizing protein. |
AT4G15660 | Encodes a member of the CC-type glutaredoxin (ROXY) family. Represses transcriptional and developmental responses to nitrate. Operates downstream of cytokinins in a signal transduction pathway that negatively regulates plant primary root growth in response to nitrate.Interacts with the TGA1 and TGA4 transcription factors, which are central regulators of early transcriptional responses to nitrate in root. |
AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
AT4G10670 | Homologous to yeast SPT16, a general chromatin factor required for transcription |
AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile. |
AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
AT3G55350 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
AT4G10465 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G36830 | ELO family protein. |
AT1G75600 | Histone superfamily protein;(source:Araport11) |
AT1G56460 | HIT zinc finger and PAPA-1-like domain-containing protein;(source:Araport11) |
AT1G32130 | The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. |
AT3G44110 | homologous to the co-chaperon DNAJ protein from E coli |
AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
AT4G15093 | catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11) |
AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
AT3G62810 | complex 1 family protein / LVR family protein;(source:Araport11) |
AT5G01970 | unknown protein;(source:TAIR10) |
AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G39410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G39420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G03630 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
AT3G21350 | RNA polymerase transcriptional regulation mediator-like protein;(source:Araport11) |
AT1G23360 | Encodes a 2-phytyl-1,4-naphthoquinone methyltransferase that catalyzes the final step in phylloquinone (vitamin K1) biosynthesis. |
AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
AT3G18870 | Mitochondrial transcription termination factor family member. |
AT1G62110 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62120 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT3G24570 | contributes to osmotic stress tolerance |
AT5G02290 | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl. |
AT4G09320 | nucleoside diphosphate kinase type 1 (NDPK1) gene, complete The mRNA is cell-to-cell mobile. |
AT5G13950 | nuclear factor kappa-B-binding protein;(source:Araport11) |
AT3G44220 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G24600 | late embryogenesis abundant protein, group 2;(source:Araport11) |
AT5G41835 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-43 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
AT1G11475 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10. |
AT5G41010 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
AT4G21710 | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
AT2G15430 | Non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, encoded by At2g15400, can substitute for At2g15430 in the context of Pol V. |
AT2G15400 | Non-catalytic subunit of Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, At2g15430 can substitute for At2g15400 in the context of Pol V and encodes the equivalent subunit of Pol II and Pol IV. |
AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
AT3G20760 | Nse4, component of Smc5/6 DNA repair complex;(source:Araport11) |
AT5G60980 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT3G61050 | Encodes a novel transcriptional regulator, a calcium-dependent lipid-binding protein containing a C2 domain, that binds specifically to the promoter of THAS1 (thalianol synthase 1). It can bind ceramide and is involved in drought and salt tolerance. |
AT3G51620 | PAP/OAS1 substrate-binding domain superfamily;(source:Araport11) |
AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT1G65080 | Structurally distinct member of Oxa1 superfamily , has tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2b.Involved in maturation of mitochondrial cytochrome c. |
AT4G02450 | Encodes one of two isoforms of a co-chaperone of HSP90 that is required for root growth, in particular in the maintenance of the root meristem. |
AT3G03773 | Encodes one of two isoforms of a co-chaperone of HSP90 that is required for root growth, in particular in the maintenance of the root meristem. It can be phosphorylated in vitro by human and maize CK2. |
AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
AT2G02120 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. Mediates ammonium metabolism by regulatingglutamine synthetase activity. |
AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
AT1G49290 | Paternally expressed gene that is localized around the sperm nuclei of pollen. PEG2 acts as a sponge for siRNA854 during endosperm development, this action is necessary to induce triploid seed abortion. |
AT3G27110 | PGM48 is a member of a plant specific clade of metallo-endopeptidase proteins. It is found in plastoglobules. Analysis of over-expression and loss of function phenotypes suggests PGM48 may have a role in positively regulating senescence. |
AT4G22990 | Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
AT5G10410 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT5G65370 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
AT1G33340 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT1G10900 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
AT1G60890 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
AT3G27400 | Encodes a pectate lyase involved in response to nematodes. |
AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
AT4G37070 | Patatin-related phospholipase A. Expressed strongly and exclusively in roots. AtplaIVA-null mutants have reduced lateral root development. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
AT5G11560 | catalytics;(source:Araport11) |
AT1G76140 | Putative prolyl oligopeptidase. |
AT1G76950 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT5G52800 | primase/polymerase protein |
AT5G44582 | hypothetical protein;(source:Araport11) |
AT5G44575 | hypothetical protein;(source:Araport11) |
AT1G04080 | Encodes a U1 small nuclear ribonucleoprotein (snRNP) factor involved in alternative splicing. |
AT5G64100 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G25160 | Encodes a U-box domain-containing E3 ubiquitin ligase with central Ser/Thr protein kinase domain whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT1G68940 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G51270 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G18560 | Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression. |
AT3G46060 | small GTP-binding protein (ara-3) The mRNA is cell-to-cell mobile. |
AT5G22750 | DNA repair gene. gamma-radiation hypersensitive (RAD5) involved in stable transformation and T-DNA transfer |
AT5G49470 | Encodes a protein with similarity to RAF MAP Kinase that is expressed in most plant tissues. Based on loss of function and gain of function phenotypes, RAF10 appears to be involved in ABA response. |
AT4G11230 | NADPH-oxidase RbohI is expressed highly in seeds and roots. Mutants have inreased sensitivity to osmotic stress suggesting a role in mediating cellular response to stress in roots. |
AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT1G67800 | Copine (Calcium-dependent phospholipid-binding protein) family;(source:Araport11) |
AT1G74450 | Plants overexpressing At1g74450 are stunted in height and have reduced male fertility. |
AT5G14070 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. ROXY2, together with ROXY1 (AT3G02000), controls anther development. roxy1 roxy2 double mutants are sterile and do not produce pollen. |
AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
AT3G02250 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
AT2G25420 | WD40 domain protein which interacts with ROS1 in the base excision repair pathway through DNA methylation. |
AT1G58370 | Encodes a protein with xylanase activity. |
AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
AT2G47820 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
AT5G51340 | SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage. |
AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
AT1G21170 | Exocyst complex component SEC5;(source:Araport11) |
AT1G66740 | Located on the SSL2 region of Arabidopsis thaliana, which is homeologous to the Brassica S locus for self incompatibility. Expressed in both vegetative and reproductive organs suggesting AtSP7 might not be involved in self incompatibility. Its expression is regulated during cell cycle progression through E2F transcription factors. The protein interacts with acetylated histones H3 and H4 and HAM acetyltransferases, proteins known to be involved in cell cycle control and DNA repair. Functions redundantly with AT5G38110 during gametogenesis. |
AT4G23570 | Closely related to SGT1B, may function in SCF(TIR1) mediated protein degradation. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. AtSGT1a is induced upon pathogen infection and can function in R gene-mediated resistance. |
AT4G11260 | Functions in plant disease resistance signaling, SCF(TIR1) mediated degradation of Aux/IAA proteins and HSP90 mediated degradation of R resistance proteins. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. |
AT5G53360 | RING‐finger E3 ubiquitin ligase (SINATT) member that lacks ubiquitin ligase activity due to the absence of the RING domain, functions as a protector protein which stabilizes FREE1. Involved in response to iron deficiency stress. |
AT1G17600 | SOC3 is a TIR-NB-leucine-rich repeat (TNL) protein.Mutants suppress loss of chs2 phenotype of auto-activation of immunity. When the TIR domain of SOC3 interacts with CHS2 the binding results in temperature activation of cell death, the suppressors inhibit this interaction. |
AT1G22890 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65486 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65490 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65500 | Secreted peptide which functions in plant growth and pathogen defense. |
AT4G08810 | Calcium binding protein involved in cryptochrome and phytochrome coaction |
AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G43990 | Encodes SUVR2, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
AT1G30020 | SVB family gene. |
AT4G24130 | ABA responsive SVB family gene. |
AT3G48740 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT5G53190 | Nodulin MtN3 family protein;(source:Araport11) |
AT4G10850 | Nodulin MtN3 family protein;(source:Araport11) |
AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
AT3G48600 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
AT2G14880 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT3G03590 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
AT3G02950 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
AT5G55220 | Contains with HP22 a protein that is related to the bacterial trigger factor chaperone. Plants depleted of either HP22 or HP65b or even both were increasingly delayed in leaf senescence and retained much longer stromal chloroplast constituents than wild-type plants. |
AT4G12650 | Endomembrane protein 70 protein family;(source:Araport11) |
AT5G25100 | Endomembrane protein 70 protein family;(source:Araport11) |
AT1G02510 | Encodes AtTPK4, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK4 is targeted to the plasma membrane. In contrast other members of the AtTPK proteins are located in tonoplast. AtTPK4 forms a voltage-independent K+ channel that is blocked by extracellular calcium ions. May form homomeric ion channels in vivo. |
AT4G40000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G08115 | U1A small nuclear RNA |
AT1G60900 | Putative U2A65 splicing factor which functions in abscisic acid mediated flowering via regulating the precursor messenger RNA splicing of ABI5 and FLC in shoot apex. Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65a. |
AT4G27560 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
AT4G15480 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
AT3G53120 | Modifier of rudimentary (Mod(r)) protein;(source:Araport11) |
AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT4G01250 | AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence. |
AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
AT4G01720 | member of WRKY Transcription Factor; Group II-b |
AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
AT4G21160 | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
AT4G33020 | member of Fe(II) transporter isolog family |
AT3G57700 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57640 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57730 | Protein kinase superfamily protein;(source:Araport11) |
AT1G58350 | Putative serine esterase family protein;(source:Araport11) |
AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT1G44318 | Aldolase superfamily protein;(source:Araport11) |
AT5G14220 | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. |
AT2G20960 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT4G31430 | Encodes a plant-specific protein that physically interacts with CRWN1 and its homolog CRWN4 and localizes at the inner nuclear membrane. KAKU4 deforms the nuclear envelope in a dose-dependent manner, in association with nuclear membrane invagination and stack formation. |
AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
AT4G37770 | Encodes an auxin inducible ACC synthase. |
AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
AT4G11280 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile. |
AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G14290 | Encodes 20S proteasome subunit PAE2 (PAE2) that has RNase activity. |
AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
AT4G03415 | Encodes a myristoylated 2C-type protein phosphatase that interacts with AGB1 and is localized to the plasma membrane. |
AT4G14440 | encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G07720 | Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT2G15090 | Encodes KCS8, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). The mRNA is cell-to-cell mobile. |
AT1G17745 | encodes a 3-Phosphoglycerate dehydrogenase The mRNA is cell-to-cell mobile. |
AT4G24770 | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Required for editing and stability of specific chloroplast mRNAs. |
AT2G26260 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
AT3G04770 | 40s ribosomal protein SA B;(source:Araport11) |
AT3G02360 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT5G41670 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT1G01100 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT5G47700 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT5G46800 | Seedling lethal mutation; Mitochondrial Carnitine Acyl Carrier-Like Protein |
AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
AT4G26080 | Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure. |
AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
AT2G40090 | member of ATH subfamily |
AT1G60600 | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
AT3G23560 | Member of the multidrug and toxic compound extrusion (MATE) family, protects roots from inhibitory compounds. |
AT3G29575 | ABI five binding protein 3;(source:Araport11) |
AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
AT2G45190 | Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS). |
AT1G67080 | Encodes a protein involved in the photoprotection of PSII. An aba4-1 mutant completely lacks neoxanthin,a component of the chromophore of the peripheral antenna system in PSII. ABA4 is required for neoxanthin biosynthesis, an intermediary step in abscisic acid biosynthesis, but no catalytic activity has been detected for the ABA4 protein. |
AT1G45249 | Leucine zipper transcription factor that binds to the abscisic acid (ABA)?responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment. |
AT2G27150 | Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis. |
AT5G19530 | Encodes a spermine synthase. Required for internode elongation and vascular development, specifically in the mechanism that defines the boundaries between veins and nonvein regions. This mechanism may be mediated by polar auxin transport. Though ACL5 has been shown to function as a spermine synthase in E. coli, an ACL5 knockout has no effect on the endogenous levels of free and conjugated polyamines in Arabidopsis, suggesting that ACL5 may have a very specific or altogether different in vivo function. |
AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
AT5G51290 | Encodes a ceramide kinase that plays a role in modulating cell death. |
AT4G14400 | encodes a novel protein with putative ankyrin and transmembrane regions. It is a member of one of the largest uncharacterized gene families in higher plants. The gene is involved in resistance to Pseudomonas syringae. |
AT5G46110 | Encodes a chloroplast triose phosphate / 3-phosphoglycerate translocator that transports triose phosphates derived from the Calvin cycle in the stroma to the cytosol for use in sucrose synthesis and other biosynthetic processes. A tpt mutant has altered acclimation responses. The mRNA is cell-to-cell mobile. |
AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
AT1G36160 | Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile. |
AT1G36180 | acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile. |
AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
AT1G76990 | ACT domain repeat 3;(source:Araport11) |
AT2G36840 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile. |
AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
AT3G27000 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. its transcript level is down regulated by light and is expressed in very low levels in all organs examined. |
AT3G12110 | Encodes an actin that is expressed predominantly during reproductive development. |
AT2G30910 | actin-related protein C1A;(source:Araport11) |
AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
AT1G55320 | Encodes a protein with similarity to acyl activating enzymes. AAE18 is localized to the peroxisome where it may be involved in metabolism of auxin precursors to active auxins. |
AT3G02610 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
AT5G53470 | Encodes an acyl-CoA binding protein that is localized to vesicles,and plasma membrane especially in epidermal cells of heart, torpedo and cotyledon stage embryos, cell wall of the seed coat. Northern blot analysis showed that the 1.4 kb ACBP1 mRNA was expressed in silique, root, stem, leaf and flower. |
AT3G05420 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
AT3G02630 | One of seven acyl acyl carrier proteins. Expressed primarily in developing seeds.Involved in fatty acid metabolism. Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD1 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
AT3G50860 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
AT4G01100 | Adenine nucleotide transporter. Located in mitochondrion. Expressed in a broad range of tissues, but predominantly in root tips. Loss of function mutants exhibit reduced root growth and respiration. |
AT2G47420 | Encodes a putative rRNA dimethyltransferase. |
AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
AT2G24765 | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner |
AT3G03120 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. |
AT5G65050 | Originally published as Agamous like MADS-box protein AGL31. One of a group of MADS box genes involved in control of flowering time. Four variant sequences have been identified for this locus but have not been characterized for differences in expression pattern and/or function. |
AT1G77980 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. |
AT3G30260 | Agamous-like transcription factor. A target of SPL10, AGL79 knockdowns show defects in leaf shape, shoot branching, and flowering time. |
AT5G39750 | AGAMOUS-like 81;(source:Araport11) |
AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
AT1G22590 | AGAMOUS-like 87;(source:Araport11) |
AT3G66656 | AGAMOUS-like 91;(source:Araport11) |
AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
AT1G74800 | Encodes a Golgi-localized hydroxyproline galactosyltransferase GALT5. Functions together with GALT2 as redundant GALTs that control AGP (arabinogalactan-proteins) O-glycosylation, which is essential for normal growth and development. Mutants display multiple phenotypes including reduced root hair growth. |
AT4G37750 | ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis. |
AT5G10510 | Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation. |
AT1G72330 | Encodes for alanine aminotransferase ALAAT2. |
AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
AT2G14170 | Arabidopsis thaliana methylmalonate-semialdehyde dehydrogenase |
AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
AT3G43600 | Encodes an aldehyde oxidase. AAO2 does not appear to act on abscisic aldehyde in vitro but it is possible that it may function in abscisic acid biosynthesis when the activity of At2g27150 (AAO3), the primary abscisic aldehyde oxidase, is lost. |
AT3G53880 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
AT5G26210 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
AT3G25780 | Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis that encode this enzyme. mRNA expression is upregulated in senescing leaves. Note: Nomenclature for Arabidopsis allene oxide cyclase 3 (AOC3, AT3G25780) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC3 (AT3G25780) is also referred to as AOC2 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile. |
AT3G52720 | Encodes an alpha carbonic anhydrase (CAH1) located in the chloroplast stroma. Most chloroplast proteins are encoded by the nuclear genome and imported with the help of sorting signals that are intrinsic parts of the polypeptides. CAH1 takes an alternative route through the secretory pathway, and becomes N-glycosylated before entering the chloroplast. Glycosylation and intra-molecular disulfide bridge fromation are necessary for the correct folding, ER export, trafficking and activity of the protein. |
AT2G28210 | alpha carbonic anhydrase 2;(source:Araport11) |
AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
AT3G10740 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 51 of glycoside hydrolases. It may be involved in cell wall modification. |
AT2G25940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. |
AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
AT3G54720 | Encodes glutamate carboxypeptidase. Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1. |
AT5G47580 | transmembrane protein;(source:Araport11) |
AT4G17970 | Anion transporter involved in stomatal closure. Gene has 3 splicing variants. |
AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
AT1G44100 | amino acid permease 5 |
AT5G49630 | Is a high affinity amino acid transporter capable of transporting aspartate and tryptophan. May be involved in the amino acid uptake from xylem. |
AT1G10010 | Encodes a high affinity amino acid transporter that is probably responsible for import of organic nitrogen into developing seeds. One of eight gene family members that encode amino acid permeases. Most closely related to AAP1 (75%) identity. |
AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
AT4G33090 | encodes an aminopeptidase, a ortholog of mouse microsomal AP (EC 3.4.11.2). |
AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
AT2G39090 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT5G14530 | Encodes a low molecular weight nuclear WDR protein which displays functional homology to the Swd2 protein, an essential subunit of the yeast histone methylation COMPASS complex. APRF1 acts upstream of FLC and promotes flowering under long day conditions. |
AT5G61160 | anthocyanin 5-aromatic acyltransferase 1;(source:Araport11) |
AT1G25220 | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
AT3G54340 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies petal and stamen identities. Associates with PISTILLATA. |
AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
AT5G01310 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
AT4G21990 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. |
AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
AT1G52930 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
AT4G33920 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G06750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G51300 | Encodes a nuclear localized splicing factor homolog that is involved in alternative splicing of some mRNAs. |
AT1G09730 | Encodes a SUMO protease that positively regulates the transition to flowering in long and short days. Along with SPF2, its activity is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
AT3G18930 | RING/U-box superfamily protein;(source:Araport11) |
AT2G35910 | RING/U-box superfamily protein;(source:Araport11) |
AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46493 | RING/U-box superfamily protein;(source:Araport11) |
AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
AT1G78440 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. |
AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
AT5G15550 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
AT1G22500 | Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus. |
AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
AT4G09030 | Encodes arabinogalactan protein (AGP10). The mRNA is cell-to-cell mobile. |
AT3G01700 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
AT2G46330 | Encodes arabinogalactan protein (AGP16). |
AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
AT5G14380 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6 function results in decreased fertility due to defects in pollen tube growth. |
AT5G36925 | hypothetical protein;(source:Araport11) |
AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT5G46750 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. The mRNA is cell-to-cell mobile. |
AT1G24120 | encodes a DnaJ-like protein similar to ARG1 and ARL2 that are both involved in root and hypocotyl gravitropism response. However, null mutation in this gene does not result in defects in gravitropism. Gene is expressed in all tissues examined. |
AT4G08900 | Encodes an arginase, likely to be involved in polyamine biosynthesis in pollen. |
AT2G16500 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
AT5G52040 | Encodes an arginine/serine-rich splicing factor. Transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS41 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis. |
AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
AT5G21150 | AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
AT2G31510 | IBR domain-containing protein;(source:Araport11) |
AT5G19330 | Encodes an armadillo repeat protein involved in the abscisic acid response. The protein interacts with a transcription factor, ABF2, which controls ABA-dependent gene expression via the G-box-type ABA-responsive elements. |
AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
AT4G11560 | BAH domain protein which cooperates with PHD protein AIPP2 to read H3K27me3 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Responsible for preventing flowering by suppressing the expression of flowering genes. Binding of BDT1 to the H3K27me3 peptide, which is enhanced by PHD proteins, is critical for preventing early flowering. |
AT2G47760 | Encodes an α-1,3-mannosyltransferase. Plants with mutations in the ALG3 protein have abnormal gylcoslation profiles. They also exhibit abnormal responses to MAMPs possibly because the glycan properties of FL22 are affected. |
AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
AT2G22250 | Encodes a prokaryotic-type plastidic aspartate aminotransferase with glutamate/aspartate-prephenate aminotransferase (PAT) activity. |
AT3G02020 | encodes a monofunctional aspartate kinase |
AT3G18490 | Encodes ASPG1 (ASPARTIC PROTEASE IN GUARD CELL 1). Functions in drought avoidance through abscisic acid (ABA) signalling in guard cells. |
AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
AT3G61310 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G22810 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
AT5G51590 | Member of the 29 AT-hook family TFs involved in the development of root xylem. |
AT1G63470 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT5G62260 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G14465 | AT-hook protein. Overexpression results in early flowering in short and long days. |
AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
AT1G58080 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
AT3G47770 | ABC2 homolog 5;(source:Araport11) |
AT2G36910 | Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR1.Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AT3G28860. PGP1 mediates cellular efflux of IAA and interacts with PIN genes that may confer an accelerated vectoral component to PGP-mediated transport. The non-polar localization of PGP1 at root and shoot apices, where IAA gradient-driven transport is impaired, may be required to confer directionality to auxin transport in those tissues. The mRNA is cell-to-cell mobile. |
AT1G02520 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile. |
AT1G02530 | P-glycoprotein 12;(source:Araport11) |
AT3G28380 | P-glycoprotein 17;(source:Araport11) |
AT4G28630 | Half-molecule ABC transporter ATM1. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
AT4G28620 | Half-molecule ABC transporter ATM2. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
AT1G30420 | member of MRP subfamily |
AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT3G25620 | ABC-2 type transporter family protein;(source:Araport11) |
AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
AT1G53390 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G60740 | ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species. |
AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
AT4G15215 | pleiotropic drug resistance 13;(source:Araport11) |
AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
AT3G21580 | cobalt ion transmembrane transporter;(source:Araport11) |
AT1G67940 | member of NAP subfamily The mRNA is cell-to-cell mobile. |
AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress. |
AT1G60810 | One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase |
AT1G09430 | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity. |
AT3G19160 | Encodes cytokinin synthase. |
AT1G56310 | DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation. |
AT3G63380 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT4G29900 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
AT1G27770 | Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor. |
AT5G50230 | autophagy-related (ATG) gene |
AT3G06420 | Autophagy protein. |
AT5G66930 | meiotically up-regulated protein;(source:Araport11) |
AT5G43700 | Auxin inducible protein similar to transcription factors. |
AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
AT1G54990 | auxin response mutant (AXR4) The mRNA is cell-to-cell mobile. |
AT1G35520 | auxin response factor 15;(source:Araport11) |
AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
AT2G34680 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. |
AT3G59900 | Encodes ARGOS (Auxin-Regulated Gene Involved in Organ Size). Inducible by auxin. Involved in lateral organ size control. Transgenic plants expressing sense or antisense ARGOS cDNA display enlarged or reduced aerial organs, respectively. The alteration in organ size is attributable mainly to changes in cell number and the duration of organ growth. |
AT4G12980 | Activated by OXS2 under the treatment of salt. |
AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
AT1G27190 | Activated by TCP8/14/15/22, involved in modulation of GA-dependent stamen filament elongation. |
AT3G45260 | BIB is a member of the BIRD family of zinc finger proteins that includes JKD. BIB functions redundantly with JKD to retain SHR in the nucleus and thereby restrict SHR movement in root tissues. |
AT4G15370 | Encodes an oxidosqualene cyclase that primarily produces the tetracyclic triterpene baruol in vitro and when expressed in yeast. It can also make 22 other minor triterpenoid products with varying numbers of rings. |
AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
AT3G25710 | Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT2G18160 | Encodes a b-ZIP transcription factor. |
AT2G21230 | bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1. |
AT1G13600 | basic leucine-zipper 58;(source:Araport11) |
AT2G40070 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
AT5G01980 | RING/U-box superfamily protein;(source:Araport11) |
AT4G02660 | Beige/BEACH and WD40 domain-containing protein;(source:Araport11) |
AT3G60920 | beige/BEACH domain protein;(source:Araport11) |
AT1G77890 | One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis. |
AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
AT2G44480 | beta glucosidase 17;(source:Araport11) |
AT5G28510 | beta glucosidase 24;(source:Araport11) |
AT3G03640 | Encodes beta-glucosidase (GLUC). |
AT3G60120 | beta glucosidase 27;(source:Araport11) |
AT5G24540 | beta glucosidase 31;(source:Araport11) |
AT2G32860 | beta glucosidase 33;(source:Araport11) |
AT1G61820 | beta glucosidase 46;(source:Araport11) |
AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
AT2G32290 | beta-amylase 6;(source:Araport11) |
AT2G45880 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
AT4G26140 | putative beta-galactosidase |
AT1G45130 | beta-galactosidase 5;(source:Araport11) |
AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. Located in the extracellular matrix. Gene is expressed specifically in tissues undergoing secondary wall thickening. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT5G09730 | Encodes a protein similar to a beta-xylosidase located in the extracellular matrix. It is able to degrade terminal arabinosyl residues and likely participates in the in-vivo hydrolysis of arabinan. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
AT1G69160 | suppressor;(source:Araport11) |
AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
AT4G38200 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
AT4G35380 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
AT4G22840 | Sodium Bile acid symporter family;(source:Araport11) |
AT2G26900 | Sodium Bile acid symporter family;(source:Araport11) |
AT5G57590 | Encodes a bifunctional enzyme with both dethiobiotin synthetase and diaminopelargonic acid aminotransferase activities that is involved in biotin synthesis. |
AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
AT2G41370 | Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP2 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP2 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP3 expression is restricted to pedicel axils by BP and PNY; promotes KNAT6 (At1g23380) expression. |
AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
AT5G11250 | Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET. |
AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT1G73830 | Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
AT3G18550 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Role in flowering control. |
AT1G55510 | branched-chain alpha-keto acid decarboxylase E1 beta |
AT2G42160 | Encodes a RING domain containing protein BRIZ1. BRIZ1 (At2g42160) and BRIZ2 (At2g26000) proteins form a heteromeric E3 ligase complex required for seed germination and post-germination growth. |
AT5G11360 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
AT4G15400 | Encodes BIA1, a member of the BAHD acyltransferase family. Plays a role in controlling brassinosteroids levels, particularly in the root and hypocotyl in darkness. |
AT5G24630 | This gene is predicted to encode a protein that forms part of the topoisomerase VI complex. BIN4 is a nuclear-localized protein that can bind DNA. bin4 mutants are brassinolide-insensitive dwarves with severely reduced cell size in leaves, roots, and hypocotyls. Proper development of root hairs and trichomes is also disrupted in bin4 mutants and they have elevated levels of double strand breaks in their cotyledon cells. |
AT5G46570 | Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT5G59010 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT1G63500 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT4G03080 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
AT2G22640 | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Required for accumulation of SCAR1 protein in vivo. Selectively stabilizes SCAR2. |
AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
AT5G18930 | S-adenosylmethionine decarboxylase family member. |
AT3G50610 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
AT1G70810 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G64980 | Encodes a putative nucleotide-diphospho-sugar transferase required for pollen germination and tube growth. |
AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
AT4G01420 | Encodes calcineurin B-like protein 5 (CBL5). Overexpression confers tolerance to drought and salt stress. |
AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
AT5G04870 | A calcium-dependent protein kinase that can phosphorylate phenylalanine ammonia lyase (PAL), a key enzyme in pathogen defense.Phosphorylates, in vivo, the transcription factor ORE1, a master regulator of senescence. |
AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
AT5G12180 | member of Calcium Dependent Protein Kinase |
AT4G04720 | member of Calcium Dependent Protein Kinase |
AT4G04700 | member of Calcium Dependent Protein Kinase |
AT1G76040 | member of Calcium Dependent Protein Kinase |
AT5G54590 | Splice variant At5g54590.2 encodes CRLK1 (440-amino acid in length) calcium/calmodulin-regulated receptor-like kinase crucial for cold tolerance. CRLK1 is Primarily localized in the plasma membrane. |
AT1G06490 | Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding. |
AT5G21274 | Encodes a calmodulin isoform. Expressed in leaves. |
AT3G25600 | Calmodulin like protein. Paralog of CML15. |
AT1G76640 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G44460 | Calcium sensor. |
AT2G11520 | high overall homology to CRCK1 |
AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
AT5G12480 | calmodulin-domain protein kinase CDPK isoform 7 (CPK7) |
AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
AT3G56690 | encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined. |
AT5G26920 | Encodes a calmodulin-binding protein CBP60g (calmodulin binding protein 60-like.g). The calmodulin-binding domain is located near the N-terminus; calmodulin binding is dependent on Ca(2+). Inducible by both bacterial pathogen and MAMP (microbe-associated molecular pattern) treatments. Bacterial growth is enhanced in cbp60g mutants. cbp60g mutants also show defects in salicylic acid (SA) accumulation and SA signaling. |
AT1G78955 | Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system. |
AT4G34580 | Encodes COW1 (can of worms1), a phosphatidylinositol transfer protein essential for root hair tip growth. The N-terminus of the COW1 protein is 32% identical to an essential phosphatidylinositol transfer protein (PITP), the yeast Sec14 protein (sec14p) while the C-terminus is 34.5% identical to a late nodulin of Lotus japonicus, Nlj16. Expression of COW1 complements the growth defect associated with Sec14p dysfunction in yeast. GFP fused to the COW1 protein specifically accumulates at the site of root hair outgrowth. |
AT3G59090 | tobamovirus multiplication protein;(source:Araport11) |
AT5G02630 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT3G27740 | Encodes carbamoyl phosphate synthetase (CPS) small subunit (carA), also named as VEN6. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
AT1G29900 | Encodes carbamoyl phosphate synthetase (CPS) large subunit (CARB), also named as VEN3. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
AT3G63520 | Encodes a protein with 9-cis-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-trans-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-cis-double or allenic bonds. The mRNA is cell-to-cell mobile. |
AT4G26100 | Encodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization (member of CKL-B group). |
AT3G23340 | Member of CKL gene family (CKL-C group). |
AT5G57015 | Member of CKL gene family (member of CKL-B group). |
AT4G28860 | Member of CKL gene family (CKL-A group) |
AT4G28540 | Member of CKL gene family (CKL-C group). |
AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G16300 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G39530 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G39518 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G28370 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
AT1G73875 | Deadenylase. |
AT1G31530 | Deadenylase. |
AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
AT1G54115 | Involved in cation (Na and K) homeostasis. |
AT3G13320 | low affinity calcium antiporter CAX2 The mRNA is cell-to-cell mobile. |
AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
AT5G01690 | member of Putative Na+/H+ antiporter family |
AT3G03720 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. |
AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
AT1G65320 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
AT2G16940 | Splicing factor which interacts with IRR and SR45 to mediate pre-mRNA splicing to facilitate protein function, however not contributing to target specificity. |
AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
AT1G27820 | Deadenylase. |
AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
AT3G50530 | CDPK-related kinase |
AT1G50180 | Host immune receptor which recognizes the conserved effectors AvrE and HopAA1. |
AT1G09770 | Member of MYB3R- and R2R3- type MYB- encoding genes. Essential for plant innate immunity. Interacts with MOS4 and PRL1. The mRNA is cell-to-cell mobile. |
AT2G36190 | cwINV4 appears to function as a cell wall-localized invertase (that can catalyze the hydrolysis of sucrose into fructose and glucose) based on the phenotype of cwinv4 mutants. cwINV4 transcripts are expressed at high levels in lateral and median nectaries and this enzyme plays an important role in nectar production. Also expressed in ovary placenta and appears to play a role linking sugar sensing to ovule intitiation. |
AT3G13784 | cell wall invertase 5;(source:Araport11) |
AT5G16190 | encodes a gene similar to cellulose synthase |
AT2G32610 | encodes a gene similar to cellulose synthase |
AT2G32530 | encodes a gene similar to cellulose synthase |
AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
AT3G07330 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
AT1G15660 | Encodes a homologue of the human centromeric protein C (CENP-C). CENP-C co-localizes with the 180 bp centromeric regions of chromosomes throughout the cell cycle, but does not completely cover the 180 bp regions. |
AT3G23840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G62080 | Encodes a charged multi-vesicular body protein (CHMP7) homolog, that is an ESCRT-III-related protein and functions in the endosomal sorting pathway in humans. The Brassica homolog has been shown to be involved in plant growth and leaf senescence. |
AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
AT2G43570 | chitinase;(source:Araport11) |
AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
AT2G47910 | Encodes a chloroplast thylakoid membrane protein. Required for the assembly/accumulation of the NAD(P)H dehydrogenase complex of the photosynthetic electron transport chain. |
AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
AT1G80740 | ecotype Kl-0 chromomethylase (CMT1). A plant line expressing an RNAi construct directed against DMT4 has reduced agrobacterium-mediated tumor formation. |
AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
AT4G37970 | cinnamyl alcohol dehydrogenase 6;(source:Araport11) |
AT2G17570 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile. |
AT3G51890 | Clathrin light chain protein;(source:Araport11) |
AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
AT5G45780 | Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT1G63245 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
AT3G24225 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. Regulates root meristem size in a SCR and SHR-independent pathway. |
AT1G05065 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT3G25905 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT2G31085 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
AT2G23950 | Encodes an LLR receptor kinase that is expressed in protophloem and is required for CLE peptide sensing in roots. One of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that acts as a co-regulator and has essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT3G44340 | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
AT5G55130 | putative molybdopterin synthase sulphurylase (cnx5) |
AT3G16860 | COBRA-like protein 8 precursor;(source:Araport11) |
AT1G16670 | Encodes a cold-activated plasma membrane protein cold-responsive protein kinase that phosphorylates 14-3-3 proteins. The phosphorylated 14-3-3 proteins shuttle from the cytosol to the nucleus, where they interact with and destabilize the key cold-responsive C-repeat-binding factor (CBF) proteins, modulate CBF stability and the response to cold stress. |
AT2G21385 | Encodes a chloroplast stroma localized protein that is found only in the green plant lineage. It is involved in assembly of the chloroplast ATP synthase complex. |
AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
AT5G16300 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
AT5G57660 | CONSTANS-like 5;(source:Araport11) |
AT5G05170 | Encodes a cellulose synthase isomer. CESA3 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA3, along with CESA1 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. The xylem cells in primary root have reduced cell expansion and higher than normal lignification. |
AT3G01490 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
AT1G61620 | Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile. |
AT4G00930 | Encodes COP1-interacting protein CIP4.1. |
AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
AT1G22920 | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. Required for the recovery of AUX/IAA repressor levels following recurrent heat stress to regulate auxin homeostasis. |
AT4G26430 | one of two genes encoding subunit 6 of COP9 signalosome complex |
AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
AT1G08830 | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. Activation of CSD1 in the cytoplasm involves both a CCS-dependent and -independent pathway. |
AT4G23600 | Encodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. |
AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
AT3G59420 | Encodes a membrane localized protein with similarity to receptor kinases which is involved in epidermal cell differentiation. Flowers of mutants have disorganized ovule integument growth and abnormal sepal margins. In the roots, mutants initiate more lateral roots but fewer laterals actually emerge due to defects in lateral root formation. Mutants also display disorganized columella. The root phenotypes can be traced to abnormalities in asymmetric divisions in the pericycle and root apex. Conflicting data regarding the role of the kinase domain- which may or may not be required for function. Complementation studies indicate that the C-terminal domain is also not required for signaling function. May be regulated by protein turnover which is mediated by endocytic processes. ACR4 phosphorylates the PROTEIN PHOSPHATASE 2A-3 (PP2A-3) catalytic subunit of the PP2A phosphatase holoenzyme and PP2A |
AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
AT3G28630 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
AT4G01710 | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
AT5G19380 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G11440 | Interacts with PAB (poly A binding protein) in yeast two hybrid experiments. Contains PAM2 motif, a PABC interacting domain. |
AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
AT5G53950 | Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2. Together with CUC3-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates the axillary meristem initiation, directly binding to the DA1 promoter. |
AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
AT2G46430 | Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance. |
AT3G17700 | cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile. |
AT2G46440 | Member of Cyclic nucleotide gated channel family. Positive regulator of resistance against avirulent fungal pathogen. The mRNA is cell-to-cell mobile. |
AT2G24610 | member of Cyclic nucleotide gated channel family |
AT4G30360 | member of Cyclic nucleotide gated channel family |
AT1G15570 | A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues. |
AT1G80370 | Encodes a A2-type cyclin. Contributes to the fine-tuning of local proliferation during plant development. |
AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
AT5G10440 | Encodes a cyclin involved in cell proliferation during stomatal cell lineage development. |
AT4G03270 | Cyclin D6, involved in cortex/endodermis asymmetric stem cell division. |
AT5G27620 | core cell cycle genes The mRNA is cell-to-cell mobile. |
AT5G63370 | CDKG1 interacts with the splicing factor RSZ33 to regulate proper splicing of Cals5 Pre-mRNA. |
AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
AT4G11320 | Papain family cysteine protease;(source:Araport11) |
AT3G61440 | Encodes a cysteine synthase isomer CysC1. The isomer is however less effective in cysteine biosynthesis. It is involved in beta-cyanoalanine biosynthesis, an intermediate of cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
AT4G23180 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile. |
AT4G23190 | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) |
AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23230 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23310 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11470 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23130 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
AT4G23140 | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
AT1G56060 | CYSTM3 is a mitochondrial protein that is induced by salt stress and is a negative regulator of salt stress. |
AT4G22340 | cytidinediphosphate diacylglycerol synthase 2;(source:Araport11) |
AT1G26340 | encodes a member of the cytochromes b5 family of proteins that localizes to the outer envelope of the chloroplast. The C-terminal portion of the protein appears to be capable of inserting into a plant microsomal membrane in vitro. |
AT2G46650 | member of Cytochromes b5 The mRNA is cell-to-cell mobile. |
AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
AT1G02410 | Encodes a member of the cytochrome c oxidase 11 protein family. It is an integral mitochondrial protein and likely plays an important role as a mitochondrial chaperone in COX complex assembly, affecting plant growth and pollen germination. |
AT1G69750 | cytochrome c oxidase 19-2;(source:Araport11) |
AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. The mRNA is cell-to-cell mobile. |
AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
AT5G04330 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT4G15393 | a member of the cytochrome P450 gene family. molecular function unknown. |
AT4G15398 | cytochrome P450 pseudogene |
AT4G15330 | cytochrome P450, family 705, subfamily A, polypeptide 1;(source:Araport11) |
AT4G15350 | member of CYP705A |
AT3G20110 | member of CYP705A |
AT4G15360 | member of CYP705A |
AT5G44620 | member of CYP706A |
AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
AT3G26190 | putative cytochrome P450 |
AT3G26200 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G26220 | cytochrome P450 monooxygenase |
AT2G28850 | member of CYP710A |
AT3G14610 | putative cytochrome P450 |
AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
AT2G45570 | member of CYP76C |
AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
AT5G36220 | member of CYP81D family of cytochrome p450s. This gene was originally called CYP91A1, but was later renamed to CYP81D1. |
AT4G37340 | member of CYP81D |
AT2G23190 | member of CYP81D |
AT4G37370 | member of CYP81D |
AT4G37400 | member of CYP81F |
AT5G10610 | member of CYP81K The mRNA is cell-to-cell mobile. |
AT4G31950 | member of CYP82C |
AT4G31940 | The gene encodes a cytochrome P450 enzyme, CYP82C. It is involved in the early Fe deficiency response.CYP82C4 hydroxylates fraxetin to generate sideretin (5-hydroxyfraxetin). Fraxetin and sideretin are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.The mRNA is cell-to-cell mobile. |
AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1;(source:Araport11) |
AT3G25180 | Encodes a cytochrome P450 monooxygenase (CYP82G1) that catalyzes the production of two volatile homoterpenes, TMTT and DMNT, although it is only likely to produce TMTT in planta. TMTT can be involved in attracting predatory insects to protect Arabidopsis plants from herbivorous pests. Homoterpene synthesis is also stimulated by fungal elicitors which increase the transcript levels of CYP82G1. |
AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
AT2G23180 | member of CYP96A |
AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
AT2G21910 | member of CYP96A |
AT4G15110 | member of CYP97B |
AT5G56970 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside. |
AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
AT3G44326 | Cytokinin induced F-Box protein. Forms a unique F-Box family with AT2G27310 and AT2G36090. It is primarily expressed in the root. |
AT1G57620 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
AT1G04270 | Encodes cytosolic ribosomal protein S15. |
AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
AT4G02850 | DAAR1 encodes a PLP-independent racemase that catalyzes the conversion from L-Ile to D-allo-Ile. |
AT3G17090 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G48420 | Encodes an enzyme that decomposes D-cysteine into pyruvate, H2S, and NH3. Only D-cysteine but not L-cysteine was converted by D-CDes to pyruvate, H2S, and NH3. There is conflicting evidence on its 1-aminocyclopropane-1-carboxylate deaminase activity. Involved in regulating ethylene levels. DCD enhances plant cadmium tolerance by promoting hydrogen sulfide production. |
AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT3G60140 | Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
AT5G03210 | Encodes a small polypeptide contributing to resistance to potyvirus. |
AT1G12840 | Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. The mRNA is cell-to-cell mobile. |
AT1G08370 | Encodes DCP1 involved in mRNA decapping. DCP1 forms a mRNA decapping complex with DCP2 (At5g13570) and VCS (VARICOSE) (At3g13300). However, unlike DCP2, DCP1 itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP2. |
AT5G13570 | Encodes DCP2 with mRNA decapping activity. DCP2 forms a mRNA decapping complex with DCP1 (At1g08370) and VCS (VARICOSE) (At3g13300). Recombinant DCP2 is enzymatically active in vitro, generating from capped mRNAs m7GDP, and 5?-phosphorylated mRNAs. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP1. |
AT3G19240 | Together with DEM1 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
AT1G64750 | Involved in the maintenance of genome integrity through homologous recombination. This function of DSS1 is performed through its interaction with the BRCA2 protein. |
AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
AT5G12290 | Encodes a mitochondrial outer membrane protein that is found in a complex with MIC60, TOM40, RISP and TOM20. Involved in galactoglycerolipid biosynthesis/lipid homeostasis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background. |
AT3G51520 | Encodes a functional acyl-CoA:diacylglycerol acyltransferase with different acyl-CoA substrate preferences and shows higher DAG to TAG conversion rate than AtDGAT1. It increases both C18:2 and C18:3 polyunsaturated fatty acids at the expense of C16:0. |
AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
AT5G07920 | Encodes a putative diacylglycerol kinase that is mainly expressed in roots, shoots and leaves, but its enzyme product was not active in vitro. |
AT4G24570 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile. |
AT5G20320 | Encodes an RNase III-like enzyme that catalyzes processing of trans-acting small interfering RNA precursors in a distinct small RNA biogenesis pathway. The protein is also involved in the production of 21-nt primary siRNAs from both inverted-repeat constructs and endogenous sequences, as well as the RDR6-dependent 21-nt secondary siRNAs involved in long-range cell-to-cell signaling. It binds DRB4, a ds-RNA binding protein. |
AT1G51360 | Involved in defense against fungal pathogens and located in cytosol. |
AT5G04130 | Encodes a protein that when expressed together with GYRA generates an active supercoiling DNA gyrase enzyme that shares similar properties to its bacterial counterpart, including sensitivity to gyrase-specific antibiotics. |
AT1G80030 | Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
AT5G59610 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G08130 | Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. In addition, it is an important component of the active DNA demethylation machinery and is indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. |
AT1G67630 | DNA polymerase alpha 2;(source:Araport11) |
AT1G10520 | Encodes a homolog of the mammalian DNA polymerase lambda that is involved in the repair of UV-B induced DNA damage. |
AT5G55310 | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. |
AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
AT3G19810 | BTB/POZ domain protein, putative (DUF177);(source:Araport11) |
AT2G46840 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype. Overexpression increases plant organ size, possibly by influencing the expression of the cell wall formation and auxin transporter genes that regulate cell size. |
AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
AT4G25670 | stress response NST1-like protein;(source:Araport11) |
AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
AT1G59660 | Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control. |
AT1G06770 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. The DRIP1-GFP fusion protein is nuclear-localized. DRIP1 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
AT2G30580 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. DRIP2 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
AT3G26932 | dsRNA-binding protein 3;(source:Araport11) |
AT1G05540 | hypothetical protein (DUF295);(source:Araport11) |
AT5G03390 | hypothetical protein (DUF295);(source:Araport11) |
AT1G68960 | hypothetical protein (DUF295);(source:Araport11) |
AT4G25920 | hypothetical protein (DUF295);(source:Araport11) |
AT3G21520 | Encodes a protein is directly or indirectly involved in membrane fission during breakdown of the ER and the tonoplast during leaf senescence and in membrane fusion during vacuole biogenesis in roots. The mRNA is cell-to-cell mobile. |
AT4G24310 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT3G02430 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT3G62230 | Target promoter of the male germline-specific transcription factor DUO1. Increases seed oil content by attenuating GL2 inhibition. Overexpression results in reduced trichome numbers. |
AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
AT4G03400 | Encodes a GH3-related gene involved in red light-specific hypocotyl elongation. Analysis of sense and antisense transgenic plants suggests that DFL2 is located downstream of red light signal transduction and determines the degree of hypocotyl elongation. |
AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
AT1G61210 | DWA3 encodes a DWD(DDB1 binding WD40) protein. Invitro analyses suggest its involvement in the negative regulation of ABA responses.One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT1G60500 | Dynamin related protein 4C;(source:Araport11) |
AT3G60190 | At3g60190 encodes Arabidopsis dynamin-related protein 1E, DRP1E, also known as EDR3, ADL4 and ADL1E, which is 624 amino acid residues long, has a predicted mass of 69.8 kDa and a pI of 7.5. Dynamin-related protein 1E belongs to a plant-specific subclass of dynamin-related proteins (DRP1), consisting of five members in Arabidopsis (A, B, C, D, E). This class is characterized by having an N-terminal GTPase domain, a central `dynamin 2` domain and a C-terminal GTPase effector domain (GED), a typical structure for plant dynamin-related proteins. However, this class lacks a PH domain and a proline-rich domain, which are found in classical animal dynamin-like proteins. Based on work on animal dynamins, the plant DRP1 proteins should be able to form polymeric structures that wrap around membranes to facilitate membrane tubulation and pinching off of vesicles, processes that are essential to vesicle trafficking and membrane compartmentalization. The edr3 mutation causes a P77L substitution in the G2 motif of the GTPase domain of DRP1E. edr3 mutant Arabidopsis plants display enhanced cell death in response to powdery mildew infection. |
AT5G42080 | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis. |
AT2G15690 | Encodes an atypical PPR-DYW protein containing five predicted PPR domains and a C-terminal DYW domain separated by an amino acid sequence that do not clearly correspond to an E domain. It is expressed in both the mitochondrion and chloroplast and is also involved in RNA editing in the mitochondrion and chloroplast as a core member of E+-type PPR editosomes. |
AT1G29710 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G36010 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. |
AT2G33850 | Stigmatic factor that plays a role during the early post-pollination stages. |
AT5G16260 | Encodes a RNA binding protein ELF9 (EARLY FLOWERING9). Loss of ELF9 function in the Wassilewskija ecotype causes early flowering in short days. ELF9 reduces SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO1) transcript levels, possibly via nonsense-mediated mRNA decay. The mRNA is cell-to-cell mobile. |
AT5G19700 | Encodes a MATE transporter involved in leaf senescence and iron homeostasis. |
AT4G32490 | early nodulin-like protein 4;(source:Araport11) |
AT3G18590 | early nodulin-like protein 5;(source:Araport11) |
AT3G20570 | early nodulin-like protein 9;(source:Araport11) |
AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
AT3G60500 | Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis. |
AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
AT5G20480 | Encodes a predicted leucine-rich repeat receptor kinase (LRR-RLK). Functions as the receptor for bacterial PAMP (pathogen associated molecular patterns) EF-Tu. |
AT5G56770 | transcription repressor-like protein;(source:Araport11) |
AT1G54270 | member of eIF4A - eukaryotic initiation factor 4A |
AT4G16355 | Produces a long non-coding RNA that enhances resistance against Pseudomonas syringe pv. tomato DC3000. It directly interacts with Mediator subunit 19a and enhances the expression of innate immune response genes, like PR1. |
AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
AT1G17455 | ELF4-like 4;(source:Araport11) |
AT5G64905 | elicitor peptide 3 precursor;(source:Araport11) |
AT5G09978 | elicitor peptide 7 precursor;(source:Araport11) |
AT5G22640 | EMB1211 is a MORN (multiple membrane occupation and recognition nexus) motif containing protein involved in embryo development and chloroplast biogenesis. The mRNA is cell-to-cell mobile. |
AT2G26060 | Encodes a homolog of the yeast Cytosolic Iron-sulfur protein Assembly protein CIA1. |
AT2G31340 | embryo defective 1381;(source:Araport11) |
AT1G06150 | Encodes a LHW-like protein with 79% amino acid identity to LHW. |
AT2G37920 | copper ion transmembrane transporter;(source:Araport11) |
AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
AT4G39620 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G29060 | elongation factor Ts family protein;(source:Araport11) |
AT3G20440 | Encodes BE1, a putative glycoside hydrolase. Involved in organogenesis and somatic embryogenesis by regulating carbohydrate metabolism. Mutation in BE1 has pleotrophic effect on the whole plant development. |
AT4G14590 | embryo defective 2739;(source:Araport11) |
AT5G39680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G63420 | Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA. |
AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
AT3G02660 | Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial;(source:Araport11) |
AT5G15540 | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
AT2G32590 | condensin complex subunit;(source:Araport11) |
AT5G40480 | embryo defective 3012;(source:Araport11) |
AT2G36000 | Encodes an mTERF protein localized in the chloroplast stroma. |
AT4G20740 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT5G14320 | Ribosomal protein S13/S18 family;(source:Araport11) |
AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G27270 | P-type PPR chloroplast localized protein required for group II intron splicing in chloroplasts. |
AT1G01960 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34860 | DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development. |
AT3G10000 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
AT4G37890 | Involved in shoot regenaration from root explants. |
AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
AT4G00310 | Putative membrane lipoprotein;(source:Araport11) |
AT1G10745 | Encodes a Maternally expressed gene (MEG) family protein |
AT5G11530 | Involved in regulating reproductive development |
AT5G64360 | EIP9 interacts with EMF1 to regulate flowering. It functions partially redundantly with SDJ2 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
AT1G71220 | Encodes UDP-glucose:glycoprotein glucosyltransferase. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
AT2G44440 | Emsy N Terminus (ENT) domain-containing protein;(source:Araport11) |
AT5G67270 | encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
AT5G05460 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
AT4G21590 | Encodes a putative endonuclease but no demonstrable endonuclease activity, either towards single stranded DNA or mismatches, has been seen in vitro. Activated by AGAMOUS in a cal-1, ap1-1 background. Expressed in the floral meristem and during stamen development. |
AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
AT2G38960 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO2 is mainly present in the Ox2 redox state. |
AT3G09030 | EAP3 is a cytolsolic BTB/POZ-domain protein involved in trafficking of PEN3. |
AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
AT5G05190 | hypothetical protein (DUF3133);(source:Araport11) |
AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
AT1G11300 | The annotation for At1g11300 in TAIR10 is incorrect. This locus has been split into two At1g11300 (symbol: EGM1) and At1g11305 (symbol: EGM2) (Olivier Loudet, personal communication, 2013-04-03). See Comment field for revised annotation. |
AT4G31820 | A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development. |
AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
AT3G13437 | Brassicaceae specific gene. Overexpression results in Verticillium wilt resistance. |
AT4G16210 | enoyl-CoA hydratase/isomerase A;(source:Araport11) |
AT1G60550 | enoyl-CoA hydratase/isomerase D;(source:Araport11) |
AT2G20875 | Encodes a secretory peptide EPF1 involved in stomatal development. EPF1 is related to EPF2 which controls asymmetric cell divisions during stomatal devlopment. Its transcript levels change after inducing MUTE expression in a mute background. |
AT3G13898 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT3G20290 | Encodes AtEHD1, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD2, At4g05520). |
AT4G05520 | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290). |
AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile. |
AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
AT5G07310 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting. |
AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT5G43410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Expression of ERF96 is induced by pathogens, JA and ethylene and over expression leads to increased resistance to resistance to necrotrophic pathogens. It is a nuclear localized, transcriptional activator that binds to GCC elements that is involved in positive regulation of ABA responses. |
AT2G40940 | Ethylene receptor, subfamily 1. Has histidine kinase activity. |
AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
AT1G05010 | Encodes 1-aminocyclopropane-1-carboxylate oxidase |
AT1G73730 | Encodes a putative transcription factor involved in ethylene and sulfate starvation signalling. Isolated DNA binding domain has been shown to bind DNA in vitro. |
AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT5G58550 | Encodes a paralog of ETO1, which is a negative regulator of ACS5 (a key enzyme in ethylene biosynthesis pathway). EOL2 also interacts with and inhibits the activity of ACS5. |
AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile. |
AT5G27700 | Cytosolic ribosomal protein. Similar to EVR1 and redundant with EVR1. Also enhances VAR2 mutant varigation, but to a lesser extent than evr1. |
AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
AT1G10180 | LOW protein: exocyst complex component-like protein;(source:Araport11) |
AT4G02350 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile. |
AT1G47550 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. It binds phosphoinositide lipids. |
AT5G03540 | AtEXO70A1 is a member of EXO70 gene family, putative exocyst subunits, conserved in land plants. It plays a central role in Casparian strip formation, generating a transient positional information that will be translated into a precisely localized cell wall modification. |
AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G13990 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane and is not found to colocalize with or interact with core exocyst subunits. |
AT3G29400 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G61010 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT2G39380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G09520 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT2G20750 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT3G45960 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G35190 | proline-rich extensin-like family protein;(source:Araport11) |
AT3G28550 | Proline-rich extensin-like family protein;(source:Araport11) |
AT4G08370 | Proline-rich extensin-like family protein;(source:Araport11) |
AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
AT1G70990 | Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility. |
AT1G76930 | Encodes an Arabidopsis extensin gene that belongs to cell-wall hydroxyproline-rich glycoproteins. The cross-link of extensins enforces cell wall strength. Transgenic plants overexpressing this gene show an increase in stem thickness. |
AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
AT3G14100 | Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes. |
AT1G21760 | This gene is predicted to encode an F-box protein that is evolutionarily conserved between Arabidopsis and other eukaryotes including S.cerevisiae and humans. It may play a role in regulating translation under conditions of temperature stress. FBP7 transcript levels are increased at high and low temperatures. The mRNA is cell-to-cell mobile. |
AT4G05010 | F-box family protein;(source:Araport11) |
AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
AT5G38270 | F-box family protein;(source:Araport11) |
AT1G15910 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
AT1G13790 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
AT5G28530 | FAR1-related sequence 10;(source:Araport11) |
AT1G76320 | FAR1-related sequence 4;(source:Araport11) |
AT4G33360 | Encodes an NAD+-dependent dehydrogenase that oxidizes farnesol more efficiently than other prenyl alcohol substrates. |
AT5G47770 | Encodes a protein with farnesyl diphosphate synthase activity. |
AT5G63910 | Encodes a farnesylcysteine lyase (EC 1.8.3.5) involved in a salvage /detoxification pathway of farnesylcysteine (FC) residues that are liberated during the degradation of prenylated proteins. Because FC is a competitive inhibitor of prenylcysteine methyltransferases involved in the down-regulation of ABA signaling, fcly mutants with elevated FC levels are hypersensitive to ABA. The protein also appears to be glycosylated when translated in vitro in the presence of microsomal membranes and it likely requires FAD for enzymatic activity. |
AT5G64630 | Chromatin Assembly Factor-1 (CAF-1) p60 subunit. Involved in organization of the shoot and root apical meristems. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. |
AT5G55730 | Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development. |
AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. The mRNA is cell-to-cell mobile. |
AT2G38550 | Mediates fatty acid transport from plastid. |
AT3G20510 | Encodes a member of the Tmemb_14 family that is predicted to be localized to the membranes of the secretory pathway. The mRNA is cell-to-cell mobile. |
AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
AT4G13985 | FBD-associated F-box protein;(source:Araport11) |
AT5G11460 | FCS like zinc finger 10 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
AT1G47400 | Involved in regulation of iron deficiency response genes. Overexpression results in hyperaccumulation of Fe and Mn. |
AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
AT3G26080 | localized to chloroplasts |
AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
AT4G22910 | FIZZY-related 2;(source:Araport11) |
AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
AT2G30120 | protein FLC EXPRESSOR;(source:Araport11) |
AT2G19190 | Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6. |
AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
AT5G64870 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot3 is found in membrane nanodomains. |
AT4G09180 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G51140 | Encodes a basic helix-loop-helix-type transcription factor involved in photoperiodism flowering. Binds to the E-box cis-element in the CONSTANS (CO) promoter to regulate flowering. Interacts with CFL1 and along with CFLAP2 negatively regulates cuticle development. Binds to the potassium channel gene KAT1 as a dimer. The DNA-binding capacity is inhibited in response to ABA through phosphorylation-dependent monomerization. |
AT4G27760 | Encodes an oxidoreductase required for vegetative shoot apex development. Mutants display disruptions in leaf positioning and meristem maintenance. |
AT3G63300 | Encodes a pleckstrin homology domain- and DUF828-containing protein. Mutants have defects in leaf vascular pattering, with vascular bundles that fail to meet distally in both the cotyledons and leaves. Necessary to the formation of the closed leaf vascular pattern characteristic of dicot leaves in response to auxin. Redundant with FKD2. FKD1 may influence PIN1 localization in an auxin dependent manner. proposed to be a key component of the auxin canalization pathway. FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT3G07540 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
AT1G34260 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
AT3G48480 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
AT2G31390 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
AT4G26520 | Aldolase superfamily protein;(source:Araport11) |
AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
AT1G49710 | Encodes a protein with core α1,3-fucosyltransferase activity. |
AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
AT2G15370 | Predicted fucosyltransferase, based on similarity to FUT1, but not functionally redundant with FUT1. |
AT3G16700 | Fumarylacetoacetate hydrolase homolog. |
AT4G24740 | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
AT3G63010 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The mRNA is cell-to-cell mobile. |
AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
AT3G06260 | Encodes a protein with putative galacturonosyltransferase activity. |
AT1G02720 | Encodes a protein with putative galacturonosyltransferase activity. |
AT5G49150 | Encodes a transmembrane domain containing protein expressed in sperm cells. Mutants are defective in gamete fusion. Target promoter of the male germline-specific transcription factor DUO1. |
AT4G39640 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
AT5G15230 | Encodes gibberellin-regulated protein GASA4. Promotes GA responses and exhibits redox activity. |
AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
AT3G51080 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT2G20570 | Encodes GLK1, Golden2-like 1, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK2, Golden2-like 2, is encoded by At5g44190. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. GLK1 is also a member of the GARP transcription factor family. |
AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G54000 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G54010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G60550 | Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. |
AT1G22300 | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Might act as a stabilization factor to mediate the oligomerization of REM on the plasma membrane. |
AT3G02520 | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). |
AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
AT3G05930 | germin-like protein (GLP8) |
AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
AT1G14920 | Similar to a putative transcription factor and transcriptional coactivators. Repressor of GA responses and involved in gibberellic acid mediated signaling. Member of the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. GAI may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. |
AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
AT3G17203 | a pseudogene initially named GA2ox5 and thought to be a member of the gibberellin 2-oxidase enzyme family. It was later shown to have a large DNA insert in the putative gene model. |
AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
AT5G07200 | encodes a gibberellin 20-oxidase. |
AT1G79840 | Glabra 2, a homeodomain protein affects epidermal cell identity including trichomes, root hairs, and seed coat. It also down-regulates seed oil content. Expressed in atrichoblasts and required to suppress root hair development. Also expressed abundantly during early seed development. Directly regulated by WER. |
AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
AT1G68360 | Encodes a nuclear localized member of the C2H2 family of TFIIIA transcription factors.GIS3 is involved in trichome initiation and development downstream of GA and cytokinin signaling. GIS regulates the expression GIS and GIS2. |
AT5G15050 | Encodes GlcAT14B. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
AT2G41760 | Controls the expression of specific defence-response genes, activates the synthesis pathway for the phytoalexin camalexin and influences basal resistance to Pseudomonas syringae pv tomato (Pst). |
AT1G65440 | Related to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. It encodes a putative WG/GW-repeat protein involved in the regulation of apical-basal polarity of embryo |
AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
AT3G27260 | Kinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain |
AT5G13110 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is most highly expressed in root. |
AT5G40760 | Encodes a cytosolic glucose-6-phosphate dehydrogenase that is insensitive to reduction by DTT and whose mRNA is expressed ubiquitously. The mRNA is cell-to-cell mobile. |
AT1G67490 | Encodes an alpha-glucosidase I enzyme that catalyzes the first step in N-linked glycan processing. Localized to the endoplasmic reticulum (ER). |
AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
AT1G09610 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
AT5G17330 | Encodes one of two isoforms of glutamate decarboxylase. The mRNA is cell-to-cell mobile. |
AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
AT2G17260 | Encodes a glutamate receptor. Involved in calcium-programmed stomatal closure. |
AT5G11210 | member of Putative ligand-gated ion channel subunit family |
AT1G42540 | member of Putative ligand-gated ion channel subunit family |
AT2G32400 | Glr5 |
AT5G64050 | Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
AT3G48730 | glutamate-1-semialdehyde 2,1-aminomutase 2;(source:Araport11) |
AT5G63570 | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile. |
AT4G25760 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT5G57685 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT5G37600 | encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT5G40370 | Glutaredoxin family protein;(source:Araport11) |
AT2G43350 | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. |
AT1G02920 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
AT4G02520 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
AT1G59670 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G10360 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G53680 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G02780 | Encodes a member of the lambda family of glutathione transferases. It has thiol transferase activity and self S-glutathionylation activity in vitro. |
AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
AT4G25840 | glycerol-3-phosphatase 1;(source:Araport11) |
AT1G06520 | sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile. |
AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
AT5G07550 | member of Oleosin-like protein family |
AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
AT2G05380 | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile. |
AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
AT3G22580 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G36150 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G22650 | lipid transfer protein;(source:Araport11) |
AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
AT1G32930 | Galactosyltransferase family protein;(source:Araport11) |
AT1G64185 | Vicinal oxygen chelate (VOC) superfamily member. |
AT2G35110 | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs. Its ER localization is independent of upstream SPK1 activation signaling and the physical association with the WAVE/SCAR Regulatory complex binding partner SRA1. ER-localized NAP1 has little colocalization with actin and represent the inactive pool of NAP1 in these cell types. |
AT5G06110 | Encodes a ZRF1 chromatin regulator. Functions in regulating plant growth and development. |
AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
AT1G53130 | Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space. |
AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
AT2G06200 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower |
AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
AT4G34460 | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. It seems to be involved in the calcium-mediated response to extracellular ATP. |
AT5G48650 | Negative regulator of defense response to Pseudomonas syringae pv. tomato through altered stomatal and apoplastic immunity. |
AT5G60730 | One of 3 GET paralogs in Arabidopsis. GET3c is a mitochondrion localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
AT3G47950 | mutant has Slight reduction in root and shoot growth; Exaggerated defects in salt stress; Plasma Membrane H+ ATPase |
AT2G24520 | plasma membrane H+-ATPase;(source:Araport11) |
AT5G20140 | Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress. |
AT4G28490 | Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile. |
AT1G28440 | HAESA-like 1;(source:Araport11) |
AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
AT4G13550 | Heat stress inducible plastid monogalactosyldiacylglycerol lipase. |
AT5G10010 | myosin-H heavy protein;(source:Araport11) |
AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
AT5G62020 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
AT1G51670 | hypothetical protein;(source:Araport11) |
AT1G06330 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G50740 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
AT3G46290 | Encodes HERCULES1 (HERK1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
AT3G23640 | heteroglycan glucosidase 1;(source:Araport11) |
AT1G47840 | Encodes a putative hexokinase. |
AT2G21045 | Arsenate reductase. Contributes to QTL for arsenate tolerance. Col is resistant and Kas-1 represents sensitive strain. |
AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
AT3G09650 | RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit. |
AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
AT4G35570 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha. |
AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
AT2G30470 | HSI2 is a member of the ABI3 family of B3 domain proteins and functions as an active repressor of the Spo minimal promoter through the EAR motif. It contains a plant-specific B3 DNA-binding domain. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50?M ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. HSI2 is also an epigenetic repressor as it also contains functional plant homeodomain-like (PHD-L) and zinc-finger Cys- and Trp-containing (CW) domains associated with epigenetic regulation. The PHD-L domain of HSI2 is connected to promoting trimethylation of Lys-27 on histone 3 (H3K27me3), while the CW domain can bind directly to H3K4me3. Through these domains, HSI2 represses the seed maturation program during seed germination by repressing transcription of the core LAFL (LEC1, ABI3, FUS3, and LEC2) seed developmental transcriptional regulators. In developing A. thaliana embryos, HSI2 suppresses expression of a large number of genes, many identified as targets of FUS3. However, the absence of HSI2 had no effect on transcript levels of the LAFL regulators and the levels of measured metabolites and phytohormones (ABA, auxin, and JA derivatives) in developing Arabidopsis embryos. HSI2 likely fine-tunes seed maturation by repressing genes involved in early embryogenesis that are not required later for seed maturation and desiccation. |
AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
AT5G10720 | member of Histidine Kinase |
AT1G03430 | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT3G21510 | Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT3G29350 | Encodes AHP2, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function in His-to-Asp phosphorelay signal transduction and as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT5G63890 | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
AT3G27360 | Histone superfamily protein;(source:Araport11) |
AT1G55970 | HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain. |
AT3G44680 | Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD. |
AT5G61070 | Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation. |
AT3G54560 | Encodes HTA11, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA9) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
AT4G32880 | member of homeodomain-leucine zipper family, acting as a differentiation-promoting transcription factor of the vascular meristems. |
AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
AT2G18350 | homeobox protein 24;(source:Araport11) |
AT5G60480 | homeobox protein 26;(source:Araport11) |
AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
AT3G60390 | Encodes homeobox protein HAT3. |
AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT5G17320 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
AT3G11945 | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
AT3G54420 | encodes an EP3 chitinase that is expressed during somatic embryogenesis in 'nursing' cells surrounding the embryos but not in embryos themselves. The gene is also expressed in mature pollen and growing pollen tubes until they enter the receptive synergid, but not in endosperm and integuments as in carrot. Post-embryonically, expression is found in hydathodes, stipules, root epidermis and emerging root hairs. |
AT1G56110 | NOP56-like protein |
AT3G19210 | Encodes RAD54, a member of the SWI2/SNF2 family of DNA-stimulated ATPases. Functions in DNA repair via homologous recombination. |
AT5G59750 | monofunctional riboflavin biosynthesis protein RIBA 3;(source:Araport11) |
AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
AT1G04050 | Encodes SUVR1, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
AT3G23100 | A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. Yeast two-hybrid analysis demonstrated a strong interaction between A. thaliana DNA ligase IV and the A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. This interaction is shown to be mediated via the tandem BRCA C-terminal domains of A. thaliana DNA ligase IV protein. |
AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
AT5G54730 | yeast autophagy 18 F-like protein;(source:Araport11) |
AT2G31270 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. Located in nucleus and chloroplast. |
AT1G10030 | Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor. |
AT4G16440 | Encodes a [FeFe]-hydrogenase-like protein named Gollum (for Growth in different Oxygen LeveLs inflUences Morphogenesis). Heterologous expression of Gollum in E. coli indicates that it probably contains two [Fe-S] clusters with different magnetic properties. Sequence alignment analysis indicates that these two clusters would be topologically equivalent to the mesial and proximal [Fe-S] centers of [FeFe]-hydrogenases. Knockdown mutants (RNAi) show a dwarf phenotype at the normal atmospheric partial oxygen pressure of 21 kPa. This dwarf phenotype could be rescued by growing the plant under low oxygen pressure (5kPa), suggesting a role for this gene in oxygen sensing. |
AT3G08950 | Encodes HCC1, homologue of the copper chaperone SCO1 (synthesis of cytochrome c oxidase 1) from the yeast Saccharomyces cerevisiae. SCO1 encodes a mitochondrial protein that is essential for the correct assembly of complex IV in the respiratory chain. HCC1 is localized in the mitochondrion. A chimeric yeast Sco1-Arabidopsis HCC1 protein complements yeast Sco1 activity. Embryos of hcc1 mutants became arrested at various developmental stages, mostly at the heart stage. |
AT2G17265 | Encodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts. Mutation of this gene results in higher level of the amino acid homoserine and resistance to downy mildew pathogen Hyaloperonospora arabidopsidis. |
AT1G12270 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G18360 | Host immune receptor which recognizes the conserved effector HopB1. |
AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT3G50950 | Encodes a canonical CC-type NLR protein that is required for the recognition of the T3SE HopZ1a as well as several other Hop effectors from the pathogenic bacteria P. syringae. |
AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G25790 | Encodes a nuclear localized member of the GARP family of transcription factors. Along with AtNIGT1/HRS1 it is involved in nitrate and phosphate signaling in the root. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
AT3G63070 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. The mRNA is cell-to-cell mobile. |
AT2G42820 | HVA22-like protein F;(source:Araport11) |
AT2G36020 | HVA22-like protein J;(source:Araport11) |
AT1G20050 | C-8 sterol isomerase that also plays a role in miRNA function. |
AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
AT5G08280 | Encodes a protein with porphobilinogen deaminase activity. This protein is targeted to the chloroplast. Mutants spontaneously develop chlorotic leaf lesions in the absence of pathogen attack, resembling the phenotype of lesion-mimic mutants. It has been shown to interact with the PPR protein AtECB2 for chloroplast RNA editing. |
AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
AT1G79870 | Hydroxyphenylpyruvate reductase (HPPR), which catalyzes the reduction of 4-hydroxyphenylpyruvic acid (pHPP) to 4-hydroxyphenyllactic acid (pHPL). Together with HPPR3 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
AT2G25300 | Encodes a hydroxyproline O-galactosyltransferase. |
AT1G67700 | multidrug resistance protein;(source:Araport11) |
AT5G61460 | Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
AT5G49230 | Identified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction. |
AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
AT3G21760 | Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside. |
AT3G01100 | unknown protein, has cDNAs and ESTs associated to it |
AT1G05575 | transmembrane protein;(source:Araport11) |
AT3G10020 | plant/protein;(source:Araport11) |
AT5G27760 | Hypoxia-responsive family protein;(source:Araport11) |
AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
AT1G68100 | member of IAA-alanine resistance protein 1 |
AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
AT5G54140 | encodes a protein similar to IAA amino acid conjugate hydrolase |
AT1G17210 | IAP-like protein 1;(source:Araport11) |
AT4G30410 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT2G32320 | Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C). |
AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G33890 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
AT1G33930 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
AT3G06720 | Encodes importin alpha involved in nuclear import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
AT4G27640 | Nuclear import receptor for GRF-interacting factors (GIFs),roles in ovule development. |
AT1G48490 | Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network. |
AT3G07610 | IBM1 likely encodes a protein with histone H3mK9 demethylation activity. It may preferentially demethylate H3mK9 at low-copy loci to protect them from silencing by nearby heterochromatin by preventing the spread of cytosine methylation. BONSAI (At1g73177) is hypermethylated in ibm1 mutants. ibm1 mutants have morphological defects that become apparent at the F3 generation, including small narrow leaves, arrested flower development, and faulty pollen development. These phenotypes cannot result solely from the BONSAI hypermethylation. Aberrant phenotypes in ibm1 mutants in both DNA methylation and plant development can be suppressed by mutations in the KYP H3K9 methyltransferase or the CMT3 non CG-cytosine methylase. |
AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
AT4G02670 | indeterminate(ID)-domain 12;(source:Araport11) |
AT3G50700 | zinc finger protein, similar to maize Indeterminate1 (ID1) |
AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
AT3G23030 | auxin inducible gene expressed in the nucleus |
AT5G25890 | encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene. |
AT1G04100 | Auxin induced gene, IAA10 (IAA10). |
AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
AT5G64667 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
AT4G16480 | Encodes a high affinity H+:myo-inositol symporter. The only other compound shown to be transported was pinitol, a methylated derivative of myo-inositol. The mRNA is cell-to-cell mobile. |
AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
AT1G05630 | Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light?stimulated increase in cytosolic calcium ion. |
AT5G46950 | One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo. |
AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
AT5G07240 | Member of IQ67 (CaM binding) domain containing family. |
AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
AT2G26180 | Transient Expression of Pro35S:YFP-IQD5 in leaves of N. benthamiana alters microtubule organization.Member of IQ67 (CaM binding) domain containing family. |
AT4G19690 | The gene encodes Fe2+ transporter protein. It is a member of the Zrt/Irt-like protein (ZIP) family of transporters. AtIRT1 has broad specificity for divalent heavy metals, mediating the transport of zinc, manganese, cobalt and cadmium under Fe-deficient conditions. IRT1 is monoubiquitinated to promote endocytic trafficking. The mRNA is cell-to-cell mobile. |
AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
AT5G67210 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
AT4G35260 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
AT3G02780 | Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that it functions in the mevalonate, but not the MEP biosynthetic pathway. |
AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
AT5G19040 | Encodes cytokinin synthase. |
AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
AT4G13430 | Encodes a methylthioalkylmalate isomerase involved in glucosinolate biosynthesis. |
AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
AT3G16460 | Mannose-binding protein |
AT1G58160 | At1g58160 in Col-0 has been shown to be a pseudogene due to a stop codon in the first exon (PMID:22307853). Its functional copy in other ecotypes (Bay-0) encodes JAX1, a jacalin-type lectin gene that confers resistance against potexviruses. |
AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
AT3G55970 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
AT1G63490 | Histone demethylase belonging to the KDM5/JARID1 family which plays crucial roles in response to dehydration stress and abscisic acid (ABA). Directly binds the chromatin of OPEN STOMATA 1 (OST1) and demethylated H3K4me3 for the regulation of OST1 mRNA abundance, thereby modulating the dehydration stress response. |
AT5G11800 | member of Putative potassium proton antiporter family |
AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT1G70300 | potassium transporter |
AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT5G08390 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT5G23430 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT3G52890 | KCBP-interacting protein kinase interacts specifically with the tail region of KCBP |
AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
AT4G05190 | ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts. |
AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
AT4G32040 | A member of Class II KN1-like homeodomain transcription factors factors (together with KNAT3 and KNAT4), with greatest homology to the maize knox1 homeobox protein. Regulates photomorphogenic responses and represses late steps in gibberellin biosynthesis. KNAT5 promoter activity showed cell-type specific pattern along longitudinal root axis, primarily in the epidermis of the distal end of primary root elongation zone. |
AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
AT1G74910 | KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1. |
AT5G04290 | Encodes SPT5-Like, a member of the nuclear SPT5 (Suppressor of Ty insertion 5) RNA polymerase (RNAP) elongation factor family that is characterized by the presence of a carboxy-terminal extension with more than 40 WG/GW motifs. Interacts with AGO4. Required for RNA-directed DNA methylation. The mRNA is cell-to-cell mobile. |
AT1G16970 | Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. |
AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
AT5G60320 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G45420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G45440 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G53810 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT4G02410 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G10530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G32800 | protein kinase family protein;(source:Araport11) |
AT3G55550 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G43690 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G59700 | Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000. |
AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
AT4G28680 | Encodes a stress-induced tyrosine decarboxylase (TyrDC). Recombinant (His)6-TyrDC expressed in E. coli catalyzes the conversion of L-tyrosine to tyramine. Recombinant TyrDC forms tetramers. |
AT5G21160 | Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover. |
AT5G46250 | RNA-binding protein;(source:Araport11) |
AT5G01190 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G03260 | LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
AT2G30210 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
AT1G18850 | PCP2 encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1. |
AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
AT1G52690 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT5G63090 | Involved in lateral organ development |
AT4G38360 | LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways. |
AT5G38210 | Protein kinase family protein;(source:Araport11) |
AT2G40190 | Encodes a putative alpha-1,2-mannosyltransferase in N-linked glycoprotein (homologous to yeast ALG11). Plays vital roles in cell-wall biosynthesis and abiotic stress response. Located in endoplasmic reticulum membrane. |
AT5G01560 | Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
AT3G19020 | Pollen expressed protein required for pollen tube growth. Along with other members of the LRX family, interacts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
AT1G49490 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
AT4G22880 | encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation. |
AT2G32700 | Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion and mediates aluminium sensitivity through PECTIN METHYLESTERASE46-modulated root cell wall pectin methylesterification. |
AT5G64813 | The LIP1 gene encodes a small GTPase that influences the light input pathway of the plant circadian network. An MBP:LIP1 fusion protein has GTP hydrolyzing abilities in vitro. In plants, LIP1 seems to play a negative role in regulating circadian period that can be suppressed by light. LIP1 also seems to negatively affect light-pulse-dependent resetting of the clock, especially during the first portion of the subjective evening. LIP1 expression levels are not significantly affected by the circadian clock in seedlings grown under LL conditions. The levels of the YFP:LIP1 protein expressed under the control of the 35S promoter, shows a low amplitude variation, with protein levels peaking near the beginning of subjective night under LL conditions. In hypocotyl epidermal cells of dark and light-grown seedlings, a YFP:LIP1 fusion protein can be seen in the cytoplasm and the nucleus, and does not cluster in nuclear speckles. LIP1 may also be involved in photomorphogenesis. The mRNA is cell-to-cell mobile. |
AT5G58500 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT1G78600 | light-regulated zinc finger protein 1;(source:Araport11) |
AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
AT5G66450 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon2) and LPPepsilon1, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
AT4G05210 | Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile. |
AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
AT2G28500 | LOB domain-containing protein 11;(source:Araport11) |
AT2G45410 | LOB domain-containing protein 19;(source:Araport11) |
AT3G26660 | LOB domain-containing protein 24;(source:Araport11) |
AT3G27650 | LOB domain-containing protein 25;(source:Araport11) |
AT3G27940 | LOB domain-containing protein 26;(source:Araport11) |
AT5G35900 | LOB domain-containing protein 35;(source:Araport11) |
AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
AT1G10920 | Encodes LOV1, a disease susceptibility gene that, paradoxically, is a member of the NBS-LRR resistance gene family. Conditions susceptibility to the fungus Cochliobolus victoriae and victorin-dependent induction of defense-associated proteins. Saturation mutagenesis identified 59 lov mutations that all display reduced susceptibility to vitorin. Mutations in known defense response pathways do not prevent susceptibility to C. victoriae. |
AT3G05780 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT5G03270 | lysine decarboxylase family protein;(source:Araport11) |
AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
AT2G47240 | Encodes an acyl-CoA synthetase that acts on long-chain and very-long-chain fatty acids, involved in cuticular wax and cutin biosynthesis The mRNA is cell-to-cell mobile. |
AT1G64400 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT4G23850 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT2G04350 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT5G15580 | Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function. |
AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT1G02910 | Mutants defective in this gene were shown to have a reduced PSII content (overall reduction in the levels of several PSII subunits) and a disrupted grana stack structure. The N-terminal half of the protein contains two tetratricopeptide repeat (TPR) motifs that are arranged tandemly, each consisting of a 34-residue degenerate consensus sequence. The N-terminal sequence is rich in positive and hydroxylated amino acid residues. |
AT5G51545 | Encodes LPA2 (low psii accumulation2), an intrinsic thylakoid membrane protein required for efficient assembly of Photosystem II. |
AT5G48905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G11760 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G04945 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29285 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G10535 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G09153 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G23167 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G06985 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
AT5G47077 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G02135 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G14365 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
AT4G21610 | Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains. |
AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
AT2G17120 | Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsCEBiP. |
AT1G21880 | Encodes a lysin-motif protein mediating bacterial peptidoglycan sensing and immunity to bacterial infection. Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsLYP4 and OsLYP6. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT2G33580 | Encodes a putative LysM-containing receptor-like kinase. LYK5 is a major chitin receptor and forms a chitin-induced complex with related kinase CERK1. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
AT5G65080 | Is upregulated during vernalization and regulates flowering time. Encodes MADS-domain protein. Two variants encoding proteins of 198 and 184 amino acids have been reported. |
AT3G19640 | Transmembrane magnesium transporter. One of nine family members. |
AT1G17930 | Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing. |
AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
AT1G66170 | Encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to nuclear euchromatin specifically during diplotene. Required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. |
AT4G20900 | Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein. |
AT1G72250 | Malectin domain kinesin. |
AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
AT5G43710 | Glycosyl hydrolase family 47 protein;(source:Araport11) |
AT1G01560 | Member of MAP Kinase family. Flg22-induced activation is blocked by AvrRpt2. |
AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
AT4G29810 | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
AT4G26070 | Member of MAP Kinase Kinase. Likely functions in a stress-activated MAPK pathway. Can phosphorylate the MAPK AtMPK4, in response to stress. Gets phosphorylated by MEKK1 in response to wounding. |
AT1G15400 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
AT5G11850 | MAP3 kinase involved phosphorylation of a critical Ser171 for OST1/SnRK2.6 activation. |
AT2G34790 | Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. |
AT2G35340 | helicase domain-containing protein;(source:Araport11) |
AT3G43160 | maternal effect embryo arrest 38;(source:Araport11) |
AT3G46330 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G13610 | DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
AT4G08850 | MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated. |
AT1G23230 | Mediator tail subunit, involved in transcriptional regulation. Mediator Complex Subunit, interacts with MED2, MED5, MED16 in the Regulation of Phenylpropanoid Biosynthesis. |
AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
AT2G03070 | Encodes a subunit of the Mediator complex. Regulates plant defense and flowering. |
AT5G38990 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT5G39020 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT5G39030 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT3G26980 | membrane-anchored ubiquitin-fold protein 4 precursor;(source:Araport11) |
AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G52870 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. The mRNA is cell-to-cell mobile. |
AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
AT1G79310 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
AT1G16420 | Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0. |
AT3G58810 | Member of Zinc transporter (ZAT) family. Contributes to basic cellular Zn tolerance and controls Zn partitioning, particularly under conditions of high rates of Zn influx into the root symplasm. Localizes to the vacuolar membrane. |
AT3G12100 | Cation efflux family protein;(source:Araport11) |
AT5G56795 | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The MT1b gene, however, is indicated to be inactive. |
AT2G36880 | methionine adenosyltransferase 3;(source:Araport11) |
AT3G25740 | Encodes a plastid localized methionine aminopeptidase. Formerly called MAP1C, now called MAP1B. |
AT3G03780 | Encodes a cytosolic methionine synthase, involved in methionine regeneration via the activated methyl cycle (or SAM cycle) |
AT1G33990 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
AT2G44160 | methylenetetrahydrofolate reductase MTHFR2 mRNA, complete The mRNA is cell-to-cell mobile. |
AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
AT5G13130 | Member of the microrchidia protein family which have been described as epigenetic regulators and plant immune mediators, contains a hallmark GHKL-type ATPase domain in N-terminus. Possible role in the development of reproductive tissues. |
AT1G66795 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC |
AT2G39175 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160a (converted to TAIR10 based on PMID19304749): Chr2: 16339853-16341886 (forward), length: 2034 bp; exon coordinates: exon 1: 16339853 to 16340469, exon 2: 16341621 to 16341886; mature miRNA and miRNA* are located on exon 1. |
AT1G01183 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC. Accumulation of the pri-miRNA165a transcript is increased by the activity of the miPEP165 peptide which is encoded within the pri-miRNA165a transcript. |
AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT5G45307 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
AT1G19371 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
AT3G11435 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
AT3G23125 | Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC |
AT2G39885 | Encodes a microRNA that targets several TIR1/AFB family members and one bHLH family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCCAAAGGGAUCGCAUUGAUCC. Targets are F-box proteins and bHLH transcription factor. Specifically cleaves AFB3 transcripts, controlling AFB3 mRNA accumulation in roots in response to nitrate exposure. Pri-mRNA coordinates for MIR393a (converted to TAIR10 based on PMID19304749): Chr2: 16652027-16652572 (forward), length: 546 bp; exon coordinates: exon 1: 16652027 to 16652572; mature miRNA and miRNA* are located on exon 1. |
AT2G22668 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:ATGAGTTGGGTCTAACCCATAACT |
AT1G60025 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TTTTGGAAATTTGTCCTTACG |
AT4G03445 | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG |
AT4G03455 | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG |
AT2G22496 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUCUGCUAUGUUGCUGCUCAU |
AT4G14811 | Encodes a microRNA that targets CHX18. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCUUCGUGAAUAUCUGGCA |
AT3G59884 | Encodes a microRNA that targets several SPX C3HC4 RING zinc finger family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUAGAUGACCAUCAACAAACU |
AT1G32713 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CAAAUUAAAGCUUCAAGGUAG |
AT2G02741 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: ACACUGAAGGACCUAAACUAAC |
AT2G35630 | Member of the MAP215 family of microtubule-associated proteins required to establish interphase arrays of cortical microtubules.Mutants have defects in cytokinesis during pollen development. Vegetative phenotypes observed in temperature sensitive mutants include left-handed organ twisting, isotropic cell expansion and impairment of root hair polarity. The mRNA is cell-to-cell mobile. |
AT4G26760 | microtubule-associated protein 65-2;(source:Araport11) |
AT1G24764 | Member of the MAP70 protein family. |
AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G26700 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
AT3G45290 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO3 belongs to the clade IV, with AtMLO2, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in primary root and lateral root primordia, in fruit abscission zone, in vascular system of cotyledons and in trichomes of young leaves,; it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT3G28917 | mini zinc finger 2;(source:Araport11) |
AT1G44900 | Encodes MCM2 (MINICHROMOSOME MAINTENANCE 2), a protein essential to embryo development. Overexpression results in altered root meristem function. |
AT3G14395 | Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones. |
AT1G66345 | Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I. |
AT1G54220 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
AT3G18580 | Member of the family of canonical mitochondrial DNA binding proteins. Single-stranded binding protein which does not interfere with MMEJ. |
AT1G74120 | Encodes a mitochondrial transcription termination factor mTERF15. Required for mitochondrial nad2 intron 3 splicing and functional complex I activity. |
AT5G64950 | mTERF family protein which functions in the regulation of mtDNA transcription. |
AT3G45640 | Encodes a mitogen-activated kinase whose mRNA levels increase in response to touch, cold, salinity stress and chitin oligomers.Also functions in ovule development. Heterozygous MPK3 mutants in a homozygous MPK6 background are female sterile due to defects in integument development. MPK3 can be dephosphorylated by MKP2 in vitro. The mRNA is cell-to-cell mobile. |
AT1G59580 | encodes a mitogen-activated kinase involved in innate immunity The mRNA is cell-to-cell mobile. |
AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
AT5G55090 | member of MEKK subfamily |
AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
AT5G66850 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
AT3G55270 | Encodes MAP kinase phosphatase 1 (MKP1). Loss of MKP1 results in hypersensitivity to acute UV-B stress, but without impairing UV-B acclimation. |
AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
AT5G05680 | Encodes MOS7 (Modifier of snc1,7), homologous to human and Drosophila melanogaster nucleoporin Nup88. Resides at the nuclear envelope. Modulates the nuclear concentrations of certain defense proteins regulates defense outputs. |
AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
AT2G28390 | SAND family protein;(source:Araport11) |
AT1G63940 | monodehydroascorbate reductase 6;(source:Araport11) |
AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
AT1G02740 | MRG1 and MRG2 proteins act as readers of H3K4me3/H3K36me3 marked chromatin. They interact with each other as well as several other protein classes, to modulate the activity of flowering genes. |
AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G08060 | Encodes a transcriptional silencer that is required for proper expression of PRR/NLR immune receptor genes. |
AT1G07360 | Encodes MAC5A, a component of the MOS4-associated complex (MAC) that contributes to snc1- mediated autoimmunity. MAC is a highly conserved nuclear protein complex associated with the spliceosome. Homologues include AT1G07360 (MAC5A), AT2G29580 (MAC5B) and AT5G07060 (MAC5C). |
AT2G33780 | VQ motif-containing protein;(source:Araport11) |
AT1G53500 | encodes a putative NDP-L-rhamnose synthase, an enzyme required for the synthesis of the pectin rhamnogalacturonan I, the major component of Arabidopsis mucilage. Gene is involved in seed coat mucilage cell development. Mutant analyses suggest that MUM4 is required for complete mucilage synthesis, cytoplasmic rearrangement and seed coat development. |
AT1G04150 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
AT2G35240 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT2G20370 | Encodes a xyloglucan galactosyltransferase located in the membrane of Golgi stacks that is involved in the biosynthesis of fucose. It is also involved in endomembrane organization. It is suggested that it is a dual-function protein that is responsible for actin organization and the synthesis of cell wall materials. The mRNA is cell-to-cell mobile. |
AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores. |
AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT3G05850 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
AT3G24320 | Encodes a DNA binding protein that promotes re-arrangements of mitochondrial genome. Mutations affects mitochondrial gene expression, and impairs mitochondrial function. Dual targeting of the protein to mitochondria and chloroplasts caused by alternative translation initiation. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity. |
AT3G18524 | Encodes a DNA mismatch repair homolog of human MutS gene, MSH6. MSH2 is involved in maintaining genome stability and repressing recombination of mismatched heteroduplexes.There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2 has different binding specificity to different mismatches in combination with MSH3, MSH6, or MSH7. |
AT3G12820 | Member of the R2R3 factor gene family. |
AT3G02940 | Encodes a putative transcription factor (MYB107). |
AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
AT1G25340 | putative transcription factor (MYB116) |
AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
AT1G74080 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB122). |
AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
AT5G40330 | Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1. |
AT2G39880 | Encodes a putative transcription factor (MYB25). |
AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
AT1G74650 | Member of the R2R3 factor gene family. |
AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
AT4G28110 | Member of the R2R3 factor gene family. Expression is induced in response to desiccation, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion. |
AT5G16600 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
AT1G18570 | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile. |
AT3G01530 | Member of the R2R3 factor gene family.MYB57 interacts with JAZ proteins, and functions redundantly with MYB21 and MYB24 to regulate stamen development. Promote flavonol biosynthesis through regulation of FLS1 gene expression. |
AT1G16490 | Member of the R2R3 factor gene family. |
AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
AT1G79180 | Member of the R2R3 factor gene family. |
AT5G14750 | Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC). |
AT3G12720 | Member of the R2R3 factor gene family. |
AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
AT2G23290 | Member of the R2R3 factor gene family. |
AT5G07700 | Encodes a putative transcription factor (MYB76). |
AT3G49690 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation. |
AT5G26660 | myb domain protein 86;(source:Araport11) |
AT4G37780 | encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family. |
AT5G10280 | Encodes a putative transcription factor (MYB92). |
AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
AT5G62320 | Encodes a putative transcription factor (MYB99). |
AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. The mRNA is cell-to-cell mobile. |
AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
AT3G19960 | member of Myosin-like proteins |
AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
AT5G66910 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.1. |
AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
AT5G11790 | Plays a role in dehydration stress response. |
AT1G01010 | NAC domain containing protein 1;(source:Araport11) |
AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
AT1G32510 | NAC domain containing protein 11;(source:Araport11) |
AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
AT5G04410 | NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile. |
AT1G61110 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
AT3G01600 | NAC domain containing protein 44;(source:Araport11) |
AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
AT3G44350 | NAC domain containing protein 61;(source:Araport11) |
AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
AT5G39820 | NAC domain containing protein 94;(source:Araport11) |
AT5G46590 | Transcription factor required for the initiation of cell division during wound healing. Redundantly involved with ANAC071 in the process of "cambialization". |
AT5G07710 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
AT4G28220 | Encodes an external type II NADPH dehydrogenase in the plant mitochondrial electron transport chain that modulates NADP(H) reduction levels, which in turn affect central metabolism and growth, and interact with defense signaling. |
AT2G47490 | Encodes a chloroplast-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
AT5G25880 | The malic enzyme (EC 1.1.1.40) encoded by the ATNADP-ME3 is presumably cytosolic and restricted in its expression by both developmental and cell-specific signals. |
AT2G23050 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT3G17850 | Protein kinase which together with IRE3 plays an important role in controlling root skewing and maintaining the microtubule network. |
AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
AT5G53730 | Phloem specific membrane protein. Overexpression causes defects in sugar export with reduced levels of phloem sugars. |
AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
AT1G32340 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not detected under normal conditions and in response to cucumber mosaic virus or spermine. |
AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
AT2G16485 | Encodes NERD (Needed for RDR2-independent DNA methylation), a plant-specific GW repeat- and PHD finger-containing protein involved in siRNA-dependent DNA methylation. |
AT1G74360 | NILR1 encodes a serine/threonine kinase involved in defense response to nematodes. |
AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
AT5G04950 | Encodes a nicotianamide synthase. |
AT5G56080 | Encodes a protein with nicotianamine synthase activity. Its transcript levels rise in roots in response to zinc deficiency and rise in leaves in response to elevated levels of zinc. |
AT3G13050 | Encodes a plant nicotinate transporter than can also transport trigonelline (N-methylnicotinate). |
AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
AT3G12200 | Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT1G20640 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
AT1G31885 | NOD26-like intrinsic protein 3;(source:Araport11) |
AT5G37820 | NOD26-like intrinsic protein 4;(source:Araport11) |
AT3G06100 | Encodes NIP7;1, an anther-specific boric acid transporter of the aquaporin superfamily regulated by an unusual tyrosine in helix 2 of the transport pore. |
AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
AT3G03540 | Encodes a nonspecific phospholipase C. Located in the cytosol. Involved in the conversion of phospholipids to glycolipids under phosphate deprivation conditions. |
AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
AT5G18110 | Putative cap-binding protein;(source:Araport11) |
AT4G28910 | Encodes a transcriptional repressor that functions in the jasmonic acid (JA) signalling pathway, root development, and has a key role in leaf development, likely due to the transcriptional regulation of CYCD3 expression. Transcriptional repressor that accumulates in short-day conditions. Regulates together with FRS7 and FRS12 glucosinolate biosynthesis. |
AT1G48240 | member of NPSN Gene Family |
AT1G09000 | NPK1-related protein kinase 1S |
AT4G19660 | Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
AT1G72125 | Major facilitator superfamily protein;(source:Araport11) |
AT1G72120 | Major facilitator superfamily protein;(source:Araport11) |
AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
AT2G02020 | Major facilitator superfamily protein;(source:Araport11) |
AT4G13350 | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
AT1G13400 | Along with JAG, it is involved in stamen and carpel development. Expression is limited to the adaxial side of lateral organs. Activated by AGAMOUS in a cal-1, ap1-1 background. |
AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
AT3G53340 | nuclear factor Y, subunit B10;(source:Araport11) |
AT1G29940 | Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A). |
AT1G63020 | Encodes one of two alternative largest subunits of a putative plant-specific RNA polymerase IV (aka RNA polymerase D). Required for posttranscriptional gene silencing. |
AT1G32070 | Encodes a acetyltransferase (NSI) that is localized in the nucleus and chloroplast. It interacts with the geminivirus movement protein NSP. This interaction is required for viral infection and systemic spread. Acetylates the viral coat protein (CP) in vitro, but not NSP. NSP inhibits NSI activity in vitro. In the chloroplast NSI functions in the dynamic reorganization thylakoid membrane complexes. NSI is highly transcribed in phloem and in xylem parenchyma cells, and in the apical meristem and guard cells, within young tissues in Arabidopsis, and its expression is turned off as tissues mature.Mutants have reduced melatonin and anthocyanin levels and do not accumulate the PSI-LHCII state transition complex.The protein has distinct lysine acetylation and relaxed N-terminal acetylation specificities on chloroplast proteins as determined by in vitro as well as in vivo analyses using quantitative protein mass spectrometry (PMID:32633465). |
AT1G74350 | Encodes nMAT4, a maturase factor required for nad1 pre-mRNA processing and maturation. Essential for holocomplex I biogenesis in Arabidopsis mitochondria. |
AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G60420 | Reduce transmission through pollen. The mRNA is cell-to-cell mobile. |
AT5G56950 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
AT3G13782 | Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
AT5G20070 | nudix hydrolase homolog 19;(source:Araport11) |
AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
AT3G10620 | Encodes a ppGpp pyrophosphohydrolase. |
AT1G79690 | Encodes a dual activity enzyme which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase. |
AT2G04430 | nudix hydrolase homolog 5;(source:Araport11) |
AT5G47240 | nudix hydrolase homolog 8;(source:Araport11) |
AT3G22460 | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity. |
AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
AT5G60850 | Encodes a zinc finger protein. |
AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
AT1G05510 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT5G51210 | Encodes oleosin3, a protein found in oil bodies, involved in seed lipid accumulation. |
AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
AT5G55930 | oligopeptide transporter |
AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
AT5G53510 | oligopeptide transporter |
AT1G17370 | Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA. |
AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
AT5G59200 | Encodes a chloroplast RNA editing factor. |
AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
AT2G35720 | Encodes OWL1, a J-domain protein involved in perception of very low light fluences. |
AT4G12620 | Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime. |
AT2G37560 | Origin Recognition Complex subunit 2. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts strongly with all ORC subunits. |
AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
AT5G59420 | OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11) |
AT1G28120 | Deubiquitinase with preference towards M1 and K48 linkages. |
AT3G52420 | encodes a 7 kDa chloroplast outer envelope membrane protein. |
AT1G16000 | Member of the Arabidopsis 7-kDa OEP family. Tail-anchored (TA) membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
AT5G04820 | ovate family protein 13;(source:Araport11) |
AT2G36050 | ovate family protein 15;(source:Araport11) |
AT3G52540 | ovate family protein 18;(source:Araport11) |
AT5G19650 | Transcriptional repressor of KNOX family transcription factors. Encodes pluripotency and stemness, upregulated in LRP cells. |
AT2G20330 | DDB1-CUL4 ASSOCIATED FACTOR (DCAF) protein. |
AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
AT4G24520 | Encodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism. |
AT4G30210 | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. The mRNA is cell-to-cell mobile. |
AT5G39860 | Encodes PRE1 (PACLOBUTRAZOL RESISTANCE1). PRE1 and IBH1 form a pair of antagonistic HLH/bHLH transcription factors that function downstream of BZR1 to mediate brassinosteroid regulation of cell elongation. BNQ1 is directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
AT3G28857 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT4G14990 | Topoisomerase II-associated protein PAT1;(source:Araport11) |
AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
AT5G12360 | Encodes a protein that protects meiotic centromere cohesion. |
AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
AT5G06370 | PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway. |
AT3G55450 | PBS1-like 1;(source:Araport11) |
AT2G07180 | Protein kinase superfamily protein;(source:Araport11) |
AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
AT4G17660 | Protein kinase superfamily protein;(source:Araport11) |
AT1G76370 | Protein kinase superfamily protein;(source:Araport11) |
AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
AT1G61860 | Protein kinase superfamily protein;(source:Araport11) |
AT1G77510 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner. |
AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
AT1G17750 | Encodes PEPR2, a plasma membrane leucine-rich repeat receptor kinase functioning as a receptor for the Pep1 and Pep2 peptides. Pep1 and Pep2 are amino acids that induce the transcription of defense-related genes. |
AT5G07460 | ubiquitous enzyme that repairs oxidatively damaged proteins. Methionine sulfoxide reductase activity. Mutant lacking reductase activity showed increased protein oxidation, nitration and glycation of specific amino acid residues during darkness. |
AT1G31050 | Together with PFA2 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT4G11290 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT5G66390 | Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
AT1G47750 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
AT5G14520 | Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression. |
AT4G39230 | encodes a protein whose sequence is similar to phenylcoumaran benzylic ether reductase (PCBER), which catalyzes NADPH-dependent reduction of 8-5' linked lignans such as dehydrodiconiferyl alcohol to give isodihydrodehydrodiconiferyl alcohol. |
AT1G65390 | Phloem Protein2 family gene encoding a two-domain protein containing predicted lectin and Toll/Interleukin-1 receptor domains, which is induced upon spider mite attack and improves the ability to defend against T. urticae by participating in the tight regulation of hormonal cross talk upon mite feeding. |
AT3G61060 | phloem protein 2-A13;(source:Araport11) |
AT2G26820 | phloem protein 2-A3;(source:Araport11) |
AT1G33920 | phloem protein 2-A4;(source:Araport11) |
AT5G45090 | phloem protein 2-A7;(source:Araport11) |
AT1G56240 | phloem protein 2-B13;(source:Araport11) |
AT1G56250 | Encodes an F-box protein that can functionally replace VirF, regulating levels of the VirE2 and VIP1 proteins via a VBF-containing SCF complex. It is thought to be involved in DNA integration and T-DNA degradation. |
AT2G02310 | phloem protein 2-B6;(source:Araport11) |
AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT2G32830 | Encodes Pht1;5, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT1G20860 | Encodes Pht1;8, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT2G29650 | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. |
AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
AT5G64070 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta1. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta1 is 83% identical to PI-4kbeta2 encoded by At5g09350. Interacts with the RabA4b GTPase. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta2, leads to the formation of abnormal root hairs. |
AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
AT4G16700 | Encodes a mitochondrial phosphatidylserine decarboxylase. Expressed mainly in roots and flowers. |
AT1G17710 | Encodes a phosphoethanolamine/phosphocholine phosphatase. It is likely to be involved in the liberation of inorganic phosphate from intracellular sources. Expression is upregulated in the shoot of cax1/cax3 mutant. |
AT4G29470 | Encodes one of the four Arabidopsis phospholipase PLA2 parologs: AT2G06925 (PLA2-ALPHA), AT2G19690 (PLA2-BETA), AT4G29460 (PLA2-GAMMA) and AT4G29470 (PLA2-DELTA). Involved in pollen development and germination and tube growth. |
AT3G55940 | Phospholipase C family member. Double mutants with PLC5 show defects in seed coat mucilage, leaf serration and over-expression improves drought tolerance. |
AT1G13680 | Encodes a phospholipase C-like protein that serves as a convergence point for fumonisin B1 and extracellular ATP signalling, and functions in Arabidopsis stress response to fumonisin B1. |
AT3G15730 | Encodes phospholipase D alpha 1 (PLD alpha 1). Positive regulator of abscisic acid (ABA) mediated stomatal movements. PLD alpha 1 plays an important role in seed deterioration and aging in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT3G47390 | Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant. |
AT1G68650 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
AT4G39710 | FK506-binding protein 16-2;(source:Araport11) |
AT4G02770 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD1) |
AT1G03130 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
AT4G12800 | Encodes subunit L of photosystem I reaction center. |
AT5G20360 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT3G19050 | PHRAGMOPLAST ORIENTING KINESIN 2 is one of the two Arabidopsis homologs isolated in yeast two-hybrid screen for interaction partners of maize gene TANGLED1 (TAN1). Based on sequence homology in their motor domains, POK1 and POK2 belong to the kinesin-12 class which also includes the well-characterized group of phragmoplast-associated kinesins AtPAKRPs. Both kinesins are composed of an N-terminal motor domain throughout the entire C terminus and putative cargo binding tail domains. The expression domains for POK2 constructs were broader than those for POK1; both are expressed in tissues enriched for dividing cells. The phenotype of pok1/pok2 double mutants strongly resembles that of maize tan1 mutants, characterized by misoriented mitotic cytoskeletal arrays and misplaced cell walls. |
AT1G03980 | Encodes a protein with phytochelatin synthase activity which binds Cd2+ and Cd-glutathione complexes with high affinity. The protein has been postulated to be involved in Cd2+ tolerance. AtPCS2 expression appears to be less than that of AtPCS1, explaining the inability of endogenous AtPCS2 to substitute for AtPCS1 in the cad1-3 mutant (AtPCS1 null). |
AT5G48150 | Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. |
AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
AT1G22280 | Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus. |
AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
AT1G13590 | Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus. |
AT3G44735 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. |
AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
AT4G37720 | Probable phytosulfokines 6 precursor, coding for a unique plant peptide growth factor. |
AT1G54570 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
AT3G26840 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
AT2G25170 | Encodes a SWI/SWF nuclear-localized chromatin remodeling factor of the CHD3 group. Involved in post-germination repression of embryonic development. Acts with GA to establish repression of embryonic genes upon germination. Protein preferentially accumulates in differentiating tissues. Loss of function alleles are associated with expression of embryonic traits in adult plants and derepression of embryonic genes such as PHEROS1. Is an extragenic suppressor of slr2 (SSL2). Mutations in PKL (SSL2) restores lateral root formation in the slr2 mutant slr-1. It was proposed that PKL/SSL2-mediated chromatin remodeling negatively regulates auxin-mediated LR formation in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT4G31900 | chromatin remodeling factor;(source:Araport11) |
AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
AT1G66520 | formyltransferase;(source:Araport11) |
AT3G48500 | PEP complex component. |
AT2G01190 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT4G32260 | ATPase, F0 complex, subunit B/B, bacterial/chloroplast;(source:Araport11) |
AT1G68450 | VQ motif-containing protein;(source:Araport11) |
AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
AT1G71090 | Auxin efflux carrier family protein;(source:Araport11) |
AT1G76520 | Auxin efflux carrier family protein;(source:Araport11) |
AT1G76530 | Auxin efflux carrier family protein;(source:Araport11) |
AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
AT2G18660 | Encodes PNP-A (Plant Natriuretic Peptide A). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. PNP-A contains a signal peptide domain and is secreted into the extracellular space. Co-expression analyses using microarray data suggest that PNP-A may function as a component of plant defence response and SAR in particular, and could be classified as a newly identified PR protein. It is stress responsive and can enhance its own expression. |
AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
AT1G49780 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
AT1G01680 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G04210 | Arabidopsis thaliana CDC48-interacting UBX-domain protein (PUX4) |
AT1G14570 | Encodes a nuclear UBX-containing protein that can bridge ubiquitin to AtCDC48A. |
AT2G16070 | An integral outer envelope membrane protein (its homolog in A thaliana PDV1), component of the plastid division machinery. Similar to ARC6, PDV2 localizes to a continuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. |
AT5G20610 | Encodes a member of a plant specific C2 domain containing gene family. Along with PMI, it appears to be involved in chloroplast and nuclear relocation in response to light. |
AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
AT1G32440 | encodes a chloroplast pyruvate kinase beta subunit. The enzyme is less active than the other chloroplast pyruvate kinase beta subunit encoded by AT5G52920. Involved in seed oil biosynthesis. Can partially complement the AT5G52920 mutant. |
AT5G52920 | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. The mRNA is cell-to-cell mobile. |
AT3G20840 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
AT2G16535 | Encodes a Maternally expressed gene (MEG) family protein |
AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
AT2G36660 | polyadenylate-binding protein, putative / PABP, putative. Member of the class III family of PABP proteins. |
AT2G25850 | Encodes a poly(A) polymerase. Located in the nucleus. |
AT2G31865 | poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
AT1G65840 | encodes a peroxisomal polyamine oxidase, involved in the back-conversion polyamine degradation pathway. Among the five polyamine oxidases in the Arabidopsis genome, PAO4 is the major isoform in root peroxisomes. The mRNA is cell-to-cell mobile. |
AT1G70370 | Polygalacturonase involved in cell wall modification. |
AT2G41850 | ADPG2. |
AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
AT2G16530 | Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal |
AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
AT4G39920 | Microtubule-folding cofactor, produces assembly-competent alpha-/beta-tubulin heterodimers. |
AT2G31370 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT4G22200 | Encodes AKT2, a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential. AKT2 belongs to the Shaker family K+ channels which include the following groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT1G49800 | Homolog of PIP1. |
AT5G44585 | Precursor of serine-rich endogenous peptide which regulates defense response and root elongation. Has properties of phytocytokines, activates the phospholipid signaling pathway, regulates reactive oxygen species response, and is perceived in a BAK1 co-receptor-dependent manner. |
AT5G49510 | prefoldin 3;(source:Araport11) |
AT5G07110 | Encodes PRA1.B6, an isoform of the PRA1 (Prenylated Rab acceptors) family. PRAs bind to prenylated Rab proteins and possibly aids in targeting Rabs to their respective compartments. PRA1.B6 localizes to the Golgi apparatus and its ER-to-Golgi trafficking and localization to the Golgi apparatus are regulated by multiple sequence motifs in both the C- and N-terminal cytoplasmic domains. |
AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
AT1G29850 | Encodes a protein that by its interaction with HAM acetyltransferases plays an important role during DNA damage responses induced by UV-B radiation and participates in programmed cell death programs. |
AT1G03860 | prohibitin 2 |
AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots. |
AT1G10620 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G24400 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G54970 | encodes a proline-rich protein that is specifically expressed in the root. The mRNA is cell-to-cell mobile. |
AT4G38770 | Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant. |
AT3G06300 | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. The mRNA is cell-to-cell mobile. |
AT2G17720 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
AT1G20380 | Putative prolyl oligopeptidase, associated with quantitive disease resistance to S. sclerotiorum. |
AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
AT4G16570 | protein arginine methyltransferase 7;(source:Araport11) |
AT5G47420 | PAWH2 along with PAWH1 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
AT5G38900 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G51690 | 55 kDa B regulatory subunit of phosphatase 2A mRNA, |
AT4G10050 | esterase/lipase/thioesterase family protein;(source:Araport11) |
AT5G55260 | Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase. |
AT3G56930 | Protein S-acyl transferase 4 (PAT4). Mutants display defects in root hair elongation. Along with SCN1 , it may be involved in targeting of ROP2 to the plasma membrane. |
AT5G56610 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT1 in root. For PTPMT2.1, lower expression levels were detected in leaf and stem as compared to the other tissues. |
AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
AT2G42840 | Encodes a putative extracellular proline-rich protein is exclusively expressed in the L1 layer of vegetative, inflorescence and floral meristems and the protoderm of organ primordia. |
AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
AT3G15340 | Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. |
AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
AT1G34320 | Ikzf5 (DUF668);(source:Araport11) |
AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
AT3G19420 | Encodes a phosphatase with low in vitro tyrosine phosphatase activity that is capable of dephosphorylating in vitro the 3'phosphate group of PI3P, PI(3,4)P2, and PI(3,5)P2 and may be an effector of lipid signaling. The mRNA is cell-to-cell mobile. |
AT2G47060 | Encodes Pto-interacting 1-4 (PTI1-4), a member of the PTI1-like serine/threonine protein kinases that share strong sequence identity to the tomato PTI1 kinase. |
AT4G08840 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G35850 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT3G24270 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G22240 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G47603 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
AT3G52820 | purple acid phosphatase 22;(source:Araport11) |
AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
AT1G52940 | Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea. |
AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
AT4G14180 | Encodes a protein that is involved in meiotic recombination and is required for meiotic double strand break repair. |
AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. The mRNA is cell-to-cell mobile. |
AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
AT5G12200 | Encodes a protein with dihydropyrimidine amidohydrolase activity. It localizes to the secretory system and plays a role in uracil metabolism. |
AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
AT4G21800 | Encodes QQT2. Required for early embryo development. qqt1 mutant lines are embryo-defective. Participates in the organization of microtubules during cell division. Interacts with QQT1 (encoded by AT5G22370). |
AT1G15020 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
AT1G49890 | Together with QWRF1 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
AT5G44150 | Connects together with RST1 the cytosolic RNA exosome to the Ski complex. |
AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11) |
AT1G16920 | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
AT5G45750 | RAB GTPase homolog A1C;(source:Araport11) |
AT4G18430 | RAB GTPase homolog A1E;(source:Araport11) |
AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
AT5G65270 | RAB GTPase homolog A4A;(source:Araport11) |
AT5G47520 | RAB GTPase homolog A5A;(source:Araport11) |
AT1G43890 | ras-related small GTPase |
AT4G35950 | A member of ROP GTPases gene family-like. GTP binding protein Arac6. |
AT3G46930 | Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses. |
AT3G29780 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT5G01770 | Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutations in this gene have no visible effects on embryo or plant development. |
AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
AT1G74190 | receptor like protein 15;(source:Araport11) |
AT2G15040 | pseudogene of receptor like protein 53;(source:Araport11) |
AT2G15080 | receptor like protein 19;(source:Araport11) |
AT1G17240 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. |
AT2G32680 | NLP20 LRR receptor protein involved in PAMP mediated immunity. |
AT3G05360 | receptor like protein 30;(source:Araport11) |
AT3G05660 | receptor like protein 33;(source:Araport11) |
AT3G11080 | receptor like protein 35;(source:Araport11) |
AT3G23010 | receptor like protein 36;(source:Araport11) |
AT3G23110 | receptor like protein 37;(source:Araport11) |
AT3G23120 | receptor like protein 38;(source:Araport11) |
AT1G28340 | receptor like protein 4;(source:Araport11) |
AT4G04220 | receptor like protein 46;(source:Araport11) |
AT1G34290 | receptor like protein 5;(source:Araport11) |
AT5G25910 | putative disease resistance protein induced by chitin oligomers. |
AT5G27060 | receptor like protein 53;(source:Araport11) |
AT1G47890 | receptor like protein 7;(source:Araport11) |
AT1G58190 | receptor like protein 9;(source:Araport11) |
AT5G60900 | Encodes a receptor-like protein kinase. |
AT4G16950 | Contains a putative nucleotide binding site and leucine-rich repeats. Similar to the plant resistance genes N and L6, and to the toll and interleukin-1 receptors. Confers resistance to Peronospora parasitica.Redundant function together with SIKIC1 and 3 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
AT5G43470 | Confers resistance to Peronospora parasitica. In arabidopsis ecotype Dijon-17, HRT-mediated signaling is dependent on light for the induction of hypersensitive response and resistance to turnip crinkle virus. |
AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
AT5G27680 | RECQ helicase SIM;(source:Araport11) |
AT5G63540 | Encodes RMI1. Suppresses somatic crossovers. Essential for resolution of meiotic recombination intermediates. |
AT2G47700 | RING/U-box superfamily protein;(source:Araport11) |
AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
AT4G04340 | Encodes a plasma membrane localized hyperosmolality gated calcium channel that is expressed in guard cells and roots. |
AT1G19360 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
AT3G26090 | Encodes AtRGS1, a putative membrane receptor for D-glucose. Also functions as a regulator of G-protein signaling. Has GTPase-accelerating activity. Regulates the activity of AtGPA1. Lines over-expressing the gene are more tolerant to dehydration and root elongation. These phenotypes are dependent on ABA. Nuclear localization of the protein is dependent on ABA. RGS1 endocytosis is induced by JA which promotes its dissociation from GPA1. |
AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
AT1G49480 | Encodes a nuclear-localized DNA-binding protein that interacts with ITN1 at the PM and nuclei in vivo and may regulate ITN's subcellular localization. |
AT3G57540 | Remorin family protein;(source:Araport11) |
AT1G77470 | Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent. |
AT5G02030 | Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP. |
AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
AT2G16210 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
AT3G07040 | Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1. |
AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
AT1G12220 | Resistance gene, mediates resistance against the bacterial pathogen Pseudomonas syringae. Contains a putative nucleotide binding site composed of kinase-1a (or P-loop), kinase-2a, and putative kinase-3a domains, 13 imperfect leucine-rich repeats, a potential leucine zipper, and two uncharacterized motifs that are well conserved in products of previously isolated R genes. Confers resistance to Pseudomonas syringae strains that express avrPphB. |
AT5G46470 | Encodes RPS6 (RESISTANT TO P. SYRINGAE 6), a member of the TIR-NBS-LRR class resistance protein. The mRNA is cell-to-cell mobile. |
AT5G45260 | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2. |
AT1G09090 | NADPH-oxidase AtrbohB plays a role in seed after-ripening. Major producer of superoxide in germinating seeds. AtrbohB pre-mRNA is alternatively spliced in seeds in a hormonally and developmentally regulated manner. ABA caused accumulation of AtrbohB-? mRNA and prevented prevented AtrbohB-a mRNA expression in fresh seeds. |
AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
AT1G67710 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Affects ABA-JA crosstalk. |
AT1G49190 | member of Response Regulator: B- Type |
AT5G26594 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family . It appears to be expressed in floral buds, mature flowers, and pollen. But, unlike the related ARR22 protein, it does not appear to be expressed at the seed:funiculus junction. |
AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT5G24660 | response to low sulfur 2;(source:Araport11) |
AT5G24655 | response to low sulfur 4;(source:Araport11) |
AT5G25610 | responsive to dehydration 22 (RD22) mediated by ABA |
AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
AT3G10260 | Reticulon family protein;(source:Araport11) |
AT4G02960 | a copia-type retrotransposon element containing LTRs and encoding a polyprotein. This retro element exists in two loci in Landsberg erecta but only once in Columbia |
AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile. |
AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
AT3G03450 | Encodes a DELLA protein, a member of the GRAS superfamily of putative transcription factors. DELLA proteins restrain the cell proliferation and expansion that drives plant growth. Negative regulator of the response to GA in controlling seed germination. GA triggers the degradation of RGL2 protein in a process blocked by both proteasome inhibitors and serine/threonine phosphatase inhibitors. The protein undergoes degradation in response to GA via the 26S proteasome. RGL2 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Regulates GA-promoted seed germination. Involved in flower and fruit development. |
AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT4G01750 | Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT2 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. The mRNA is cell-to-cell mobile. |
AT1G78570 | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli. |
AT3G14790 | rhamnose biosynthesis 3;(source:Araport11) |
AT5G45160 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
AT2G21790 | encodes large subunit of ribonucleotide reductase involved in the production of deoxyribonucleoside triphosphates (dNTPs) for DNA replication and repair |
AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
AT2G36620 | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
AT4G11370 | Encodes a putative RING-H2 finger protein RHA1a. |
AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
AT1G29740 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
AT1G72530 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT3G58510 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT3G54490 | NRPE5-like protein of unknown function; homologous to budding yeast RPB5 |
AT1G60650 | Encodes one of the zinc finger-containing glycine-rich RNA-binding proteins involved in cold tolerance: AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b), AT5G04280 (AtRZ-1c). It also, along with AtRZ-1c, plays important roles in plant development, pre- mRNA splicing, and general gene expression. |
AT1G17640 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
AT1G47490 | RNA-binding protein 47C;(source:Araport11) |
AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
AT1G14790 | Encodes RNA-dependent RNA polymerase. While not required for virus-induced post-transcriptional gene silencing (PTGS), it can promote turnover of viral RNAs in infected plants. Nomenclature according to Xie, et al. (2004). Involved in the production of Cucumber Mosaic Virus siRNAs. |
AT4G15417 | RNAse II-like 1;(source:Araport11) |
AT3G20420 | double-stranded RNA binding / ribonuclease III. Required for 3' external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo. Localizes in the nucleus and cytoplasm. |
AT4G29180 | root hair specific 16;(source:Araport11) |
AT5G67400 | root hair specific 19;(source:Araport11) |
AT2G03830 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT1G25490 | One of three genes encoding phosphoprotein phosphatase 2A regulatory subunit A; Recessive ethylene-response mutant EER1 displays increased ethylene sensitivity in the hypocotyl and stem |
AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
AT3G56070 | rotamase cyclophilin 2 (ROC2) exhibiting peptidyl-prolyl cis-trans isomerase activity involved in signal transduction. |
AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
AT1G17235 | This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation. |
AT3G46613 | Encodes a small is a member of an angiosperm specific gene family. |
AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
AT2G20310 | Encodes RPM1 Interacting Protein 13 (RIN13), a resistance protein interactor shown to positively enhance resistance function of RPM1. |
AT3G25070 | Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile. |
AT1G54440 | Rrp6-like protein, controls RNA-directed DNA methylation by helping with the retention of noncoding RNAs in normal cells. |
AT1G19900 | RUBY encodes a secreted galactose oxidase involved in cell wall modification. |
AT5G66990 | RWP-RK domain-containing protein;(source:Araport11) |
AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
AT4G39460 | Encodes a plastid metabolite transporter required for the import of S-Adenosylmethionine from the cytosol. Impaired function of SAMT1 led to decreased accumulation of prenyllipids and mainly affected the chlorophyll pathway. |
AT4G32300 | S-domain-2 5;(source:Araport11) |
AT1G12800 | SDP is a chloroplast localized RNA binding protein that is required for plastid rRNA processing. Plants harboring a mutation in SDP have numerous defects including reduced chlorophyll content, poor growth, yellow leaves and abnormal chloroplasts. |
AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
AT2G31380 | a B-box zinc finger protein that interacts with COP1. contains a novel 11 amino acid motif at the C-terminus (also found at the N-terminus of HY5) that is involved in the COP1 interaction. |
AT1G27730 | Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress. |
AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
AT5G60410 | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. Regulates leaf cell division and expansion through salicylic acid accumulation. signaling |
AT5G52810 | SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936). |
AT3G13570 | encodes an SC35-like splicing factor of 30 kD that is localized to the nuclear specks. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT3G54220 | Encodes a member of a novel family having similarity to DNA binding proteins containing basic-leucine zipper regions; scr is expressed in cortex/endodermal initial cells and in the endodermal cell lineage. Regulates the radial organization of the root. Is required cell-autonomously for distal specification of the quiescent center, which in turn regulates stem cell fate of immediately surrounding cells. SCR appears to be a direct target of SHR. SCR and SCR-LIKE 23 act redundantly in bundle sheath cell fate specification. |
AT3G12900 | S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil. |
AT4G10767 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT1G60987 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
AT1G11890 | Member of SEC22 Gene Family; regulates cell morphogenesis via affecting cytoskeleton organization and stabilities. |
AT1G32050 | SCAMP family protein;(source:Araport11) |
AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
AT1G66580 | senescence associated gene 24;(source:Araport11) |
AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
AT1G27060 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
AT5G09640 | encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase. |
AT3G25420 | serine carboxypeptidase-like 21;(source:Araport11) |
AT1G61130 | serine carboxypeptidase-like 32;(source:Araport11) |
AT3G17180 | serine carboxypeptidase-like 33;(source:Araport11) |
AT1G28110 | serine carboxypeptidase-like 45;(source:Araport11) |
AT2G33530 | serine carboxypeptidase-like 46;(source:Araport11) |
AT1G15000 | serine carboxypeptidase-like 50;(source:Araport11) |
AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
AT5G26780 | Encodes a protein with serine hydroxymethyltransferase activity which is thought to be localized in the mitochondrial matrix. SHM2 expression fails to rescue the conditional lethal phenotype of the shm1-1 mutant, defective in SHM1. |
AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
AT1G11870 | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
AT4G27910 | Encodes a SET domain containing protein, putative H3K4 methyltransferase. Involved in bolting/flowering time together with ATX1 and ATX3. |
AT1G43850 | Encodes a transcriptional co-regulator of AGAMOUS, that functions with LEUNIG to repress AG in the outer floral whorls. |
AT4G34660 | SH3 domain-containing protein;(source:Araport11) |
AT4G18060 | SH3 domain-containing protein;(source:Araport11) |
AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
AT5G11190 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT5G25390 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT4G16960 | Redundant function together with SIKIC1 and 2 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
AT1G64860 | Subunit of chloroplast RNA polymerase, confers the ability to recognize promoter sequences on the core enzyme |
AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
AT3G15390 | Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing. |
AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
AT1G70060 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). The mRNA is cell-to-cell mobile. |
AT1G10230 | Involved in protein degradation. One target is PHR1. |
AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
AT2G23630 | SKU5 similar 16;(source:Araport11) |
AT4G38420 | SKU5 similar 9;(source:Araport11) |
AT5G48170 | encodes an F-box protein whose protein sequence is similar to SLY1, which belongs to SCF-SLY1 E3 ligase complex. SCF-SLY1 E3 ligase degrades DELLA proteins that are involved in promoting growth. Overexpression of SLY2 can partially compensate sly1-10 mutant phenotype of dwarfism. |
AT3G59810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT2G43810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT3G56950 | One of the Major Intrinsic Proteins(MIPs) which facilitate the passive transport of small molecules across membranes.Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER. Probably involved in the alleviation of ER stress; the lack of SIP2;1 reduces both pollen germination and pollen tube elongation. |
AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G12955 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G11100 | SNF2 domain-containing protein / helicase domain-containing protein / zinc finger protein-like protein;(source:Araport11) |
AT5G60750 | Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities. |
AT1G26470 | chromatin modification-like protein;(source:Araport11) |
AT1G26210 | AtSOFL1 acts redundantly with AtSOFL2 as positive regulator of cytokinin levels. |
AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
AT2G37390 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT5G61210 | membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation The mRNA is cell-to-cell mobile. |
AT2G13800 | somatic embryogenesis receptor-like kinase 5;(source:Araport11) |
AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
AT5G10150 | SOK2 is a DUF966 domain containing protein of unknown function. Expressed in discrete domains of the PM. In root endodermis and embryo, expression is in inner basal edges and in basal |
AT3G46110 | DUF966 domain containing protein, expressed during embryogenesis. |
AT5G59790 | SOK5 is a DUF966 domain containing protein expressed in early embryos. |
AT4G11110 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA2 primarily regulates seedling development in darkness and has little function in light-grown seedlings or adult plants. |
AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
AT3G45590 | Encodes a catalytic subunit of tRNA splicing endonuclease. |
AT4G27330 | Encodes a putative transcription factor that is required for the initiation of both micro- and megagametogenesis and is expressed in the sporogenous tissue of the anther and the ovule. SPL is a chalaza identity gene that share overlapping functions in establishing the prospective chalaza of the ovule. It also plays a central role in patterning both the proximal-distal and the adaxial-abaxial axes in the ovule and generally interacts with YABBY proteins in vitro. Mutant is defective in the differentiation of primary sporogenous cells into microsporocytes, and does not properly form the anther wall. Regulator of anther cell differenctiation. Interacts with TPL and TCP proteins. |
AT2G47070 | member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA. |
AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
AT3G15270 | Encodes a member of the SPL (squamosa-promoter binding protein-like)gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. Contains the SBP-box, which encodes the SBP-domain, required and sufficient for interaction with DNA. It is involved in regulation of flowering and vegetative phase change. Its temporal expression is regulated by the microRNA miR156. The target site for the microRNA is in the 3'UTR. |
AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
AT1G44000 | STAY-GREEN-like protein;(source:Araport11) |
AT2G41770 | Regulates the assembly and trafficking of cellulose synthase complexes. |
AT5G35770 | A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. |
AT5G42890 | sterol carrier protein 2;(source:Araport11) |
AT3G07020 | encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. ugt80a2 mutant plants have reduced steryl glycoside and acyl steryl glycoside levels and reduced seed size. ugt80a2/b1 double mutants have normal levels of celluose and normal cold stress tolerance. |
AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
AT3G48860 | coiled-coil protein;(source:Araport11) |
AT3G57480 | SAP1 is a protein of unknown function whose expression is responsive to abiotic stressors including metals, salt, and ABA. Over expression confers increased tolerance to a variety of abiotic stressors. |
AT4G34190 | Encodes a stress enhanced protein that localizes to the thylakoid membrane and whose mRNA is upregulated in response to high light intensity. It may be involved in chlorophyll binding. |
AT1G51840 | kinase-like protein;(source:Araport11) |
AT1G51850 | Malectin-like receptor-like kinase involved in MAMP mediated stomatal immunity. Interacts with BAK1/FLS2 signaling complex and subsequently phosphorylates and activates SLAC1. |
AT1G51805 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G25380 | stress-associated protein 10;(source:Araport11) |
AT1G74000 | encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis. |
AT1G08470 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
AT5G06820 | STRUBBELIG-receptor family 2;(source:Araport11) |
AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
AT1G73100 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. |
AT4G21650 | Subtilase family protein;(source:Araport11) |
AT5G59090 | subtilase 4.12;(source:Araport11) |
AT1G71950 | SPI-1 is a member of the I9 inhibitor family. It is an inhibitor of SBT4.13 subtilase. |
AT3G10380 | Subunit of the Putative Arabidopsis Exocyst Complex |
AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
AT5G62575 | Encodes subunit 7 of mitochondrial complex II (succinate dehydrogenase complex) and participates in the respiratory chain. It contributes to anchoring succinate dehydrogenase to the inner mitochondrial membrane. The mRNA is cell-to-cell mobile. |
AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
AT3G43190 | Encodes a protein with sucrose synthase activity (SUS4). |
AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
AT3G19940 | Encodes a hexose-H(+) symporter that catalyzes the high-affinity uptake of glucose, galactose and mannose that is induced under low-glucose conditions in pollen tubes. |
AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
AT5G10180 | Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation. |
AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
AT5G13550 | Encodes a sulfate transporter. |
AT3G01910 | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
AT1G13430 | Encodes a sulfotransferase. Unlike the related ST4A protein (At2g14920), in vitro experiements show that this enzyme does not act brassinosteroids. ST4C is expressed in the roots and transcript levels rise in response to cytokinin treatment. |
AT1G67810 | Encodes a protein capable of stimulating the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. SufE2:GFP localizes to the chloroplasts where it is likely to play a role in iron-sulfur cluster assembly. Transcript levels for this gene are high in the pollen relative to other organs based on RT-PCR analysis. The mRNA is cell-to-cell mobile. |
AT2G20610 | Confers auxin overproduction. Mutants have an over-proliferation of lateral roots. Encodes a C-S lyase involved in converting S-alkylthiohydroximate to thiohydroximate in glucosinolate biosynthesis. Induced in epidermal cells attacked by powdery mildew. The RTY enzyme is expected to function as a dimer (or a higher order multimeric complex), as all RTY-related enzymes with a defined crystal structure are known to form dimers or tetramers. |
AT1G14320 | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. |
AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
AT1G33410 | Encodes a nucleoporin that regulates CONSTANS (CO) protein stability through affecting nuclear pore complex localization of an E3-ubiquitin ligase, HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES1 (HOS1), which destabilizes CO protein in the morning period. |
AT2G31880 | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity. |
AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
AT1G25580 | Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage. |
AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
AT1G66980 | Encodes SNC4 (suppressor of npr1-1, constitutive 4), an atypical receptor-like kinase with two predicted extracellular glycerophosphoryl diester phosphodiesterase domains. |
AT1G56500 | Encodes a thylakoid membrane protein with thioredoxin-like and beta-propeller domains located in the lumen and a haloacid-dehalogenase domain exposed to the chloroplast stroma. The protein's role may be to prevent formation of a slowly reversible form of antenna quenching, thereby maintaining the efficiency of light harvesting. The mRNA is cell-to-cell mobile. |
AT4G25120 | Encodes a homolog of the yeast SRS2 (Suppressor of RAD Six-screen mutant 2) helicase. The Arabidopsis SRS2 is a functional 3?- to 5?-helicase. Biochemical studies show that SRS2 disrupts recombinogenic DNA intermediates and facilitates single strand annealing. |
AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
AT2G47620 | Homologous to yeast SWI3 and a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3C, the other two members of the SWI3 family. |
AT1G21700 | a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). |
AT2G47210 | myb-like transcription factor family protein;(source:Araport11) |
AT1G08560 | member of SYP11 syntaxin Gene Family |
AT3G24350 | member of Glycoside Hydrolase Family 17 |
AT2G18260 | member of SYP11 Gene Family |
AT3G11820 | Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment. |
AT3G52400 | syntaxin protein, involved in the negative regulation of defense pathways such as programmed cell death, salicylic acid signalling pathway, jasmonic acid signalling pathway |
AT1G11250 | member of SYP12 Gene Family |
AT3G03800 | member of SYP13 Gene Family |
AT3G61450 | syntaxin of plants 73 (SYP73) |
AT5G12850 | CCCH-type zinc finger protein with ARM repeat domain-containing protein;(source:Araport11) |
AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT5G14720 | Membrane-localized protein kinase which regulates thermomorphogenesis. |
AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
AT1G72010 | Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT3G27010 | Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes. |
AT1G67770 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined. |
AT1G61120 | Encodes a geranyllinalool synthase that produces a precursor to TMTT, a volatile plant defense C16-homoterpene. GES transcript levels rise in response to alamethicin, a fungal peptide mixture that damages membranes. This transcriptional response is blocked in JA biosynthetic and JA signaling mutants, but GES transcript levels still rise in response to alamethicin in mutants with salicylic acid and ethylene biosynthetic and/or signaling defects. GES transcripts also accumulate in response to a larval infestation. This enzyme does not localize to the plastids, and it may be present in the cytosol or endoplasmic reticulum. The mRNA is cell-to-cell mobile. |
AT5G23030 | Member of TETRASPANIN family |
AT2G03840 | TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development. |
AT2G01960 | Member of TETRASPANIN family |
AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
AT1G22940 | Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media. |
AT5G39950 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
AT1G45145 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
AT1G59730 | Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1. |
AT3G08710 | Associated to plasma membrane. Moves cell to cell, suggesting a role in intercellular communication. The redox reaction between oxidized AtGPX3 and reduced AtTRXh9 is realized through the forming and breaking of disulfide bonds via the active sites of Cys4 and Cys57 in AtTRXh9. |
AT1G43560 | thioredoxin Y2;(source:Araport11) |
AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
AT3G55160 | THADA is an orphan gene in Arabidopsis thaliana. It is the only DUF2428 domain containing protein in the genome. |
AT5G61380 | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. The mRNA is cell-to-cell mobile. |
AT5G44920 | Encodes a KASH domain protein that localizes to the nuclear envelope and affects nuclear morphology. |
AT1G72950 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT1G72870 | TIR-NBS gene. |
AT1G72890 | NBS TIR protein. |
AT2G27170 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
AT2G02180 | Necessary for the efficient multiplication of tobamoviruses. The mRNA is cell-to-cell mobile. |
AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
AT5G16880 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT1G21380 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT1G76970 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT5G05570 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT4G11780 | GAR2-like protein;(source:Araport11) |
AT4G28760 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
AT5G43880 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
AT4G25430 | hypothetical protein;(source:Araport11) |
AT2G17550 | RB1-inducible coiled-coil protein;(source:Araport11) |
AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
AT5G46700 | Encodes a transmembrane protein of the tetraspanin (TET) family, one of 17 members found in Arabidopsis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. Required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. |
AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
AT5G49615 | trans-acting siRNA (tasi-RNA) |
AT2G38560 | Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. |
AT2G45290 | Transketolase;(source:Araport11) |
AT5G50810 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. |
AT5G43970 | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
AT3G17970 | Integral chloroplast outer membrane protein. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT3G24660 | member of Receptor kinase-like protein family |
AT5G48100 | Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. |
AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
AT5G35550 | TT2 encodes a R2R3 MYB domain putative transcription factor that acts as a key determinant in the proanthocyanidin accumulation of developing seed. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT4G23790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues.A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G40150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
AT5G01620 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).TBL35 are required only for xylan 3-O-monoacetylation and 2,3-di-O-acetylation. The biochemical phenotype can be observed in tbl35 esk1, double mutant and tbl34 tbl35 esk1 triple mutants. |
AT1G48880 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G27695 | TGD5 encodes a small glycine rich protein that is localized to the chloroplast envelope and is a component of the ER to plastid lipid trafficking pathway. TGD5 interacts with other components of this pathway including TGD1, TGD2, TGD3, and TGD4. |
AT1G45231 | Encodes a trimethylguanosine synthase that is required for chilling tolerance. tgs1 mutant have a striking chilling sensitive phenotype in which leaf and flower development are dramatically disrupted after long-term chilling treatment. |
AT2G21170 | Encodes a plastidic triose phosphate isomerase. Mutants with reduced pdTPI levels have difficulty transitioning from heterotrophic to autotrophic growth. The related phenotypes, such as chlorosis in light-grown seedlings may result from an accumulation of dihydroxyacetone phosphate (DHAP) and methylglyoxal (MG) in these mutants. Both splice variants appear to be expressed, but the At2g21170.2 variant appears to have a much narrower expression range limited to roots. |
AT4G20850 | Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant. |
AT5G53200 | Encodes a R3MYB transcription inhibitor that regulates trichome patterning. Mutants produce trichome clusters whereas other transcriptional inhibitors involved in this patterning are involved in trichome density regulation. Natural hypofunctional alleles producing trichome development in fruits have been found. |
AT1G68720 | Encodes the chloroplastic A-to-I tRNA editing enzyme. |
AT1G78190 | Trm112p-like protein;(source:Araport11) |
AT3G21300 | RNA methyltransferase family protein;(source:Araport11) |
AT4G17610 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT4G04670 | Met-10+ like family protein / kelch repeat-containing protein;(source:Araport11) |
AT2G43510 | Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory. |
AT1G23320 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. This gene appears to be expressed at a very low level during seedling development. Triple mutant analyses implicate this gene in embryonic development. |
AT1G76900 | Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM. |
AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
AT4G14960 | Encodes an alpha-tubulin isoform required for right handed helical growth. |
AT5G07350 | RNA binding protein with nuclease activity essential for stress response. Involved in mechanisms acting on mRNAs entering the secretory pathway. Functionally redundant with TSN2. |
AT5G61780 | Involved in the regulation of AtGA20ox3 expression, as well as seed germination. The mRNA is cell-to-cell mobile. |
AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
AT2G29400 | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
AT2G35635 | encodes a ubiquitin-like protein that contains tandem repeats of the ubiquitin coding region, but at least one repeat per gene encodes a protein with amino acid substitutions. The mRNA is cell-to-cell mobile. |
AT4G17510 | ubiquitin C-terminal hydrolase 3;(source:Araport11) |
AT1G50490 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells. |
AT5G50430 | ubiquitin-conjugating enzyme 33;(source:Araport11) |
AT3G45180 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
AT1G32850 | ubiquitin-specific protease 11;(source:Araport11) |
AT5G06600 | Encodes a ubiquitin-specific protease which together with UBP13 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
AT1G04860 | Encodes a ubiquitin-specific protease. |
AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
AT3G59360 | UDP-galactose transporter 6;(source:Araport11) |
AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
AT5G17310 | UDP-glucose pyrophosphorylase 2;(source:Araport11) |
AT2G29730 | UDP-glucosyl transferase 71D1;(source:Araport11) |
AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
AT5G59580 | UDP-glucosyl transferase 76E1;(source:Araport11) |
AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
AT4G34135 | The At4g34135 gene encodes a flavonol 7-O-glucosyltransferase (EC 2.4.1.237) that glucosylates also with a 20 fold lower activity flavonols (kaempferol and quercetin) at the 3-O-position. |
AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT3G55700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G76670 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT1G21070 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT5G42420 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT1G14140 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT2G22500 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT1G49320 | Encodes USPL1, a BURP domain protein targeted to the protein storage vacuoles. Overexpression of USPL1 affects seed development, protein storage vacuoles and lipid vesicles morphology and function. |
AT2G31670 | Stress responsive alpha-beta barrel domain protein;(source:Araport11) |
AT1G67550 | Encodes a nickel-containing urea hydrolase involved in nitrogen recycling. It requires three urease accessory proteins for its activation. The mRNA is cell-to-cell mobile. |
AT2G35035 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
AT1G26440 | Encodes a ureide permease, uptake assays in yeast mutants indicated the longer splice variant is a cellular importer for allantoin, uracil and xanthine. Encodes 2 splice variants, UPS5L and UPS5S, which under nonstress conditions may function in allantoin degradation for nutrient recycling, whereas under stress, both genes may be involved in vesicular export allowing allantoin translocation from roots to shoots. |
AT2G37450 | nodulin MtN21-like transporter family protein |
AT5G13670 | nodulin MtN21-like transporter family protein |
AT1G25270 | nodulin MtN21-like transporter family protein |
AT4G01450 | nodulin MtN21-like transporter family protein |
AT5G40212 | Pseudogene of AT5G40240; nodulin MtN21 family protein |
AT5G59920 | Isolated in a screen for UV-B insensitive mutants using a hypocotyl growth inhibition assay. Mutants are defective in a number of UV-B responses. |
AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
AT1G78900 | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. The mRNA is cell-to-cell mobile. |
AT3G03090 | Encodes a vacuolar membrane-localized glucose transporter that can also transport fructose. Mutations in these gene have effects on seed germination and time to flowering. |
AT1G64200 | vacuolar H+-ATPase subunit E isoform 3;(source:Araport11) |
AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
AT3G01390 | Subunit G of the vacuolar membrane ATPAse complex |
AT5G53530 | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
AT3G61770 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
AT2G14720 | encodes a vacuolar sorting receptor |
AT2G34940 | VACUOLAR SORTING RECEPTOR 5;(source:Araport11) |
AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
AT2G38020 | necessary for proper vacuole formation and morphogenesis in Arabidopsis |
AT3G60600 | Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2. |
AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G02120 | Encodes VAD1 (Vascular Associated Death1), a regulator of cell death and defense responses in vascular tissues. VAD1 is a putative membrane associated protein and contains a GRAM domain. vad1 is a lesion mimic mutant that exhibits light conditional appearance of propagative HR (hypersensitive response)-like lesions along the vascular system. The mRNA is cell-to-cell mobile. |
AT2G42400 | VOZ transcription factor which acts as positive regulator of several salt-responsive genes. Functionally redundant in salt stress with VOZ1. |
AT5G54790 | CTD small phosphatase-like protein;(source:Araport11) |
AT4G29260 | VSP3 is a secreted acid phosphatase. |
AT5G61150 | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. Member of PAF-C complex. |
AT1G61040 | Encodes a yeast Paf1C subunit homolog required for the expression of the MADS box gene FLC and other members of the FLC/MAF MADS-box gene family. Member of PAF-C complex. |
AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
AT2G32670 | member of Synaptobrevin -like protein family |
AT3G54300 | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
AT4G30160 | Encodes a major actin filament bundling protein that is involved in root hair growth through regulating actin organization in a Ca2+-dependent manner. |
AT3G49480 | F-Box Gene regulated by Agrobacterium virulence protein VirD5 and essential for Agrobacterium-mediated plant transformation. |
AT1G43700 | Encodes a VirE2-interacting protein. VIP1 mediates nuclear translocation of VirE2 via its amino half, and interacts with histone H2A via it carboxyl half. Involved in osmosensory response. The mRNA is cell-to-cell mobile. |
AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
AT4G37710 | VQ motif-containing protein;(source:Araport11) |
AT1G21210 | cell wall-associated ser/thr kinase involved in cell elongation and lateral root development |
AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
AT1G16160 | WAK-like kinase The mRNA is cell-to-cell mobile. |
AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
AT1G21270 | cytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase. |
AT1G58070 | WALLIN is an actin binding protein involved in ROP11 mediated xylem pit patterning. |
AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT1G70950 | Microtubule-stabilizing protein. Module with MREL57 regulates microtubule disassembly to mediate stomatal closure in response to drought stress and ABA treatment. MREL57 interacts with, ubiquitinates and degrades WDL7, effect is enhanced by ABA. |
AT5G06690 | Encodes a thioredoxin (WCRKC1) localized in chloroplast stroma. Contains a WCRKC motif. Functions in redox cascade with 2CPA and 2CPB via the ferredoxin-thioredoxin reductase (FTR)/thioredoxin (Trx) pathway to mediate the light-responsive reductive control of target proteins. Oxidizes redox-regulated proteins. |
AT1G71260 | Encodes WHY2, a homolog of the potato p24 protein. It shares the conserved KGKAAL domain, a putative DNA-binding domain, with potato p24 and is localized to mitochondria and not the nucleus. WHY2 is a member of the Whirly family proteins present mainly in the plant kingdom performing various activities related to DNA metabolism. Crystal structure of Solanum tuberosum WHY2, a close homolog of Arabidopsis WHY2, reveal that Whirly proteins bind to single strand DNA to promote accurate repair of DNA double-strand breaks over an error-prone repair pathway. |
AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT1G11060 | Encodes one of two redundant proteins (the other is WAPL2) that are involved in prophase removal of cohesion during meiosis. Double mutants with wapl2 exhibit reduced fertility due to defects in meiosis and also some abnormal embryo development in rare cases where embryos are formed. |
AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
AT5G41570 | member of WRKY Transcription Factor; Group II-c |
AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
AT4G18170 | Member of WRKY Transcription Factor; Group II-c. Involved in the activation of salicylic acid biosynthesis genes ICS1 and PBS3. In the ovule, it is expressed in hypodermal somatic cells and appears to play a role in supression of megasporocyte cell fate. In the leaf if is upstream of FHY3 and regulates light-mediated leaf senescence. |
AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
AT5G24110 | member of WRKY Transcription Factor; Group III |
AT2G38470 | Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance. |
AT2G34830 | member of WRKY Transcription Factor; Group II-e |
AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
AT5G26170 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
AT2G40740 | member of WRKY Transcription Factor; Group III |
AT1G69310 | Encodes WRKY57, a member of the WRKY Transcription Factor. Activation of WRKY57 confers drought tolerance. |
AT2G25000 | Pathogen-induced transcription factor. Forms protein complexes with itself and with WRKY40. Coexpression with WRKY18 or WRKY40 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
AT1G29860 | member of WRKY Transcription Factor; Group II-c |
AT5G15130 | member of WRKY Transcription Factor; Group II-b; contribute to basal immunity. The mRNA is cell-to-cell mobile. |
AT5G46350 | member of WRKY Transcription Factor; Group II-c |
AT3G49210 | WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
AT3G18010 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages. |
AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT2G28840 | Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3. |
AT4G14365 | hypothetical protein;(source:Araport11) |
AT5G64530 | xylem NAC domain 1;(source:Araport11) |
AT2G13820 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G57540 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. |
AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
AT4G13090 | xyloglucan endotransglucosylase/hydrolase 2;(source:Araport11) |
AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
AT4G18990 | xyloglucan endotransglucosylase/hydrolase 29;(source:Araport11) |
AT1G32170 | xyloglucan endotransglycosylase-related protein (XTR4) The mRNA is cell-to-cell mobile. |
AT3G54380 | SAC3/GANP/Nin1/mts3/eIF-3 p25 family;(source:Araport11) |
AT1G63700 | Member of MEKK subfamily, a component of the stomatal development regulatory pathway. Mutations in this locus result in embryo lethality. |
AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
AT2G32930 | Encodes a zinc finger protein. |
AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
AT1G05300 | member of Fe(II) transporter isolog family |
AT2G04032 | zinc transporter 7 precursor;(source:Araport11) |
AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT1G80730 | Encodes a zinc finger protein and is expressed at high levels in the shoot apex, including the apical meristem, developing leaves and the developing vascular system. expression induced three days post germination. T-DNA insertion mutant has a dominant phenotype in leaf initiation. |
AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT5G65930 | encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches. |
AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |