| AT5G16810 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G09589 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.2e-32 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein;(source:Araport11) |
| AT5G55950 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT2G18240 | Rer1 family protein;(source:Araport11) |
| AT4G23490 | fringe-like protein (DUF604);(source:Araport11) |
| AT5G48655 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
| AT5G27870 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G75770 | hypothetical protein;(source:Araport11) |
| AT1G34630 | transmembrane protein;(source:Araport11) |
| AT3G52830 | ankyrin repeat protein;(source:Araport11) |
| AT1G67590 | Remorin family protein;(source:Araport11) |
| AT3G27680 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT4G32105 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G63941 | Pseudogene of AT5G09270 |
| AT4G09060 | hypothetical protein;(source:Araport11) |
| AT5G14730 | Unknown protein, expression induced by IDL7 and stress. |
| AT5G39350 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G51400 | Photosystem II 5 kD protein;(source:Araport11) |
| AT2G13115 | pseudogene of bZIP family transcription factor |
| AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G21940 | transmembrane protein;(source:Araport11) |
| AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
| AT5G48610 | myb-like protein X;(source:Araport11) |
| AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G68500 | hypothetical protein;(source:Araport11) |
| AT4G31960 | hypothetical protein;(source:Araport11) |
| AT5G43540 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G03520 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G21020 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G08740.1);(source:TAIR10) |
| AT5G15175 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT3G61930 | hypothetical protein;(source:Araport11) |
| AT3G49790 | Carbohydrate-binding protein;(source:Araport11) |
| AT1G73920 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT4G01505 | Encodes a Plantacyanin/Basic blue family protein [pseudogene] |
| AT4G03300 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G27780.1);(source:TAIR10) |
| AT4G21020 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G35980 | pseudogene of Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G03700 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT5G15190 | hypothetical protein;(source:Araport11) |
| AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G56100 | glycine-rich protein / oleosin;(source:Araport11) |
| AT5G23470 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G68470 | Exostosin family protein;(source:Araport11) |
| AT3G57830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G15910 | hypothetical protein;(source:Araport11) |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G44080 | F-box family protein;(source:Araport11) |
| AT2G43480 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
| AT3G29075 | glycine-rich protein;(source:Araport11) |
| AT1G22850 | SNARE associated Golgi protein family;(source:Araport11) |
| AT2G36320 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT2G15345 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G70209 | hypothetical protein;(source:Araport11) |
| AT1G77855 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT2G46308 | transmembrane protein;(source:Araport11) |
| AT2G27340 | N-acetylglucosaminylphosphatidylinositol de-N-acetylase family protein;(source:Araport11) |
| AT1G67785 | hypothetical protein;(source:Araport11) |
| AT1G11480 | eukaryotic translation initiation factor-like protein;(source:Araport11) |
| AT2G19320 | hypothetical protein;(source:Araport11) |
| AT1G74929 | hypothetical protein;(source:Araport11) |
| AT5G25550 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G15950 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT4G10730 | Protein kinase superfamily protein |
| AT5G29560 | caleosin-related family protein;(source:Araport11) |
| AT1G70949 | hypothetical protein;(source:Araport11) |
| AT5G12270 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G63420 | O-glucosyltransferase-like protein (DUF821);(source:Araport11) |
| AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G27657 | hypothetical protein;(source:Araport11) |
| AT4G12680 | transmembrane protein;(source:Araport11) |
| AT4G39838 | Natural antisense transcript overlaps with AT4G39840;(source:Araport11) |
| AT5G37710 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G31340 | myosin heavy chain-like protein;(source:Araport11) |
| AT5G19270 | reverse transcriptase-like protein;(source:Araport11) |
| AT3G16850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT4G38670 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT2G22790 | hypothetical protein;(source:Araport11) |
| AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT2G27310 | F-box family protein;(source:Araport11) |
| AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
| AT5G11070 | hypothetical protein;(source:Araport11) |
| AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
| AT3G61010 | Ferritin/ribonucleotide reductase-like family protein;(source:Araport11) |
| AT5G44060 | embryo sac development arrest protein;(source:Araport11) |
| AT5G23890 | GPI-anchored adhesin-like protein;(source:Araport11) |
| AT1G54850 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G63700 | zinc ion binding / DNA binding protein;(source:Araport11) |
| AT3G52230 | hypothetical protein;(source:Araport11) |
| AT5G44860 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
| AT2G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G53270 | Seed maturation protein;(source:Araport11) |
| AT1G32710 | Cytochrome c oxidase, subunit Vib family protein;(source:Araport11) |
| AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT2G28810 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT2G07000 | hypothetical protein;(source:Araport11) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT4G00305 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34540 | hypothetical protein;(source:Araport11) |
| AT5G42570 | B-cell receptor-associated 31-like protein;(source:Araport11) |
| AT3G18362 | None;(source:Araport11) |
| AT5G61190 | putative endonuclease or glycosyl hydrolase with C2H2-type zinc finger domain-containing protein;(source:Araport11) |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT5G50140 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G78910 | Pseudouridine synthase family protein;(source:Araport11) |
| AT5G13260 | myosin;(source:Araport11) |
| AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
| AT3G06780 | glycine-rich protein;(source:Araport11) |
| AT3G46450 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
| AT5G17165 | hypothetical protein;(source:Araport11) |
| AT2G28200 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT4G00840 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G13460 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G52590 | Putative thiol-disulfide oxidoreductase DCC;(source:Araport11) |
| AT3G42434 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 8.5e-111 P-value blast match to gb|AAL06419.1|AF378075_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
| AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G38905 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G46910 | Plastid-lipid associated protein PAP / fibrillin family protein;(source:Araport11) |
| AT3G54130 | Josephin family protein;(source:Araport11) |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT5G22820 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
| AT1G37100 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 5.2e-203 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G78995 | hypothetical protein;(source:Araport11) |
| AT5G57100 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT2G18560 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G40745 | hypothetical protein;(source:Araport11) |
| AT5G24970 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G58630 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT2G26380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G12600 | UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11) |
| AT5G03285 | other_RNA;(source:Araport11) |
| AT1G02110 | bZIP domain class transcription factor (DUF630 and DUF632);(source:Araport11) |
| AT1G07210 | Ribosomal protein S18;(source:Araport11) |
| AT2G18876 | Encodes a microtubule-associated protein. |
| AT2G21130 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G10350 | DNAJ heat shock family protein;(source:Araport11) |
| AT4G09432 | Natural antisense transcript overlaps with AT4G09430;(source:Araport11) |
| AT3G29310 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT1G12030 | phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11) |
| AT2G06500 | hAT family dimerization domain-containing protein;(source:Araport11) |
| AT1G78150 | N-lysine methyltransferase;(source:Araport11) |
| AT3G53040 | late embryogenesis abundant protein, putative / LEA protein;(source:Araport11) |
| AT3G25640 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G27420 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G61065 | 1,3-beta-glucan synthase component (DUF1218);(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT4G02005 | None;(source:Araport11) |
| AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT3G51250 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G38700 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT3G27330 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G51000 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G22750 | transmembrane protein;(source:Araport11) |
| AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT1G48830 | Ribosomal protein S7e family protein;(source:Araport11) |
| AT5G66580 | PADRE protein. |
| AT4G13615 | Uncharacterized protein family SERF;(source:Araport11) |
| AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G64970 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G21030 | BREVIS RADIX-like protein;(source:Araport11) |
| AT3G61826 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G19680 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G64255 | MuDR family transposase;(source:Araport11) |
| AT3G62820 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G42290 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G12210 | DNA binding protein;(source:Araport11) |
| AT4G00695 | Spc97/Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
| AT3G14160 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT3G52110 | interferon-activable protein;(source:Araport11) |
| AT4G10955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
| AT2G46780 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G31910 | Ulp1 protease family protein (DUF1985);(source:Araport11) |
| AT4G19550 | zinc ion binding / transcription regulator;(source:Araport11) |
| AT4G36980 | CLK4-associating serine/arginine-rich protein;(source:Araport11) |
| AT3G07150 | amino acid-ligase;(source:Araport11) |
| AT1G13930 | Involved in response to salt stress. Knockout mutants are hypersensitive to salt stress. The mRNA is cell-to-cell mobile. |
| AT5G16990 | molecular function has not been defined, was shown involved in oxidative stress tolerance. The mRNA is cell-to-cell mobile. |
| AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT5G42677 | Pseudogene of AT5G19630 |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT5G05220 | hypothetical protein;(source:Araport11) |
| AT3G19035 | transmembrane protein;(source:Araport11) |
| AT5G41400 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G61997 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G28630 | transcriptional regulator EFH1-like protein;(source:Araport11) |
| AT1G02070 | zinc ion-binding protein;(source:Araport11) |
| AT2G14840 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
| AT1G52855 | hypothetical protein;(source:Araport11) |
| AT2G25270 | transmembrane protein;(source:Araport11) |
| AT2G41710 | Integrase-type DNA-binding superfamily protein;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G56480 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G37650 | GRAS family transcription factor;(source:Araport11) |
| AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
| AT5G63380 | Encodes a peroxisomal protein involved in the activation of fatty acids through esterification with CoA. At5g63380 preferentially activates fatty acids with increased chain length (C9:0 to C8:0) and thus shares characteristics with long-chain fatty acyl-CoA synthases. Also able to catalyze the conversion of OPDA to its CoA ester and is therefore thought to be involved in the peroxisomal β-oxidation steps of jasmonic acid biosynthesis. |
| AT5G28262 | other_RNA;(source:Araport11) |
| AT1G25510 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G02430 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G09480 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase The mRNA is cell-to-cell mobile. |
| AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
| AT2G36630 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT3G10510 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
| AT1G14010 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G12940 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G67140 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G03437 | Pseudogene of AT4G03480; ankyrin repeat family protein |
| AT5G64980 | transcription factor;(source:Araport11) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT4G37480 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G21960 | transmembrane protein;(source:Araport11) |
| AT4G13530 | transmembrane protein;(source:Araport11) |
| AT1G21326 | VQ motif-containing protein;(source:Araport11) |
| AT1G34420 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT1G09520 | hypothetical protein;(source:Araport11) |
| AT3G59200 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G71350 | eukaryotic translation initiation factor SUI1 family protein;(source:Araport11) |
| AT4G01730 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G65840 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G47710 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT3G01322 | Encodes a ECA1 gametogenesis related family protein |
| AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
| AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G20898 | hypothetical protein;(source:Araport11) |
| AT1G07080 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G52980 | ER-based factor for assembly of V-ATPase;(source:Araport11) |
| AT5G51560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G25580 | CAP160 protein;(source:Araport11) |
| AT3G15200 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G44770 | transmembrane protein, putative (DUF626);(source:Araport11) |
| AT3G08650 | ZIP metal ion transporter family;(source:Araport11) |
| AT3G01350 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT5G58090 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G35360 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.5e-38 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT2G34450 | HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT1G11920 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G40008 | Natural antisense transcript overlaps with AT2G40010;(source:Araport11) |
| AT2G39950 | flocculation protein;(source:Araport11) |
| AT5G23680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT5G11700 | ephrin type-B receptor;(source:Araport11) |
| AT4G00780 | TRAF-like family protein;(source:Araport11) |
| AT1G73390 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G52905 | hypothetical protein;(source:Araport11) |
| AT3G61490 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G03937 | Encodes a defensin-like (DEFL) family protein. |
| AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT2G41190 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G52615 | other_RNA;(source:Araport11) |
| AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
| AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
| AT1G23070 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT1G27671 | pseudogene of DRM2/DMT7 (domain rearranged methyltransferase protein) |
| AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G21903 | MATE efflux family protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT1G52000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G30460 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G02110 | transcription coactivator;(source:Araport11) |
| AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
| AT2G31790 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
| AT1G04320 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G36600 | Late embryogenesis abundant (LEA) protein;(source:Araport11) |
| AT5G25240 | stress induced protein;(source:Araport11) |
| AT5G66810 | Ran-binding protein in the microtubule-organising centre protein;(source:Araport11) |
| AT1G27100 | Actin cross-linking protein;(source:Araport11) |
| AT1G12080 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
| AT5G66480 | bacteriophage N4 adsorption B protein;(source:Araport11) |
| AT3G28590 | transmembrane protein;(source:Araport11) |
| AT2G20724 | Annotated as pseudogene of unknown protein.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT2G28980 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.3e-43 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT3G18060 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G01865 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G33600 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G52430 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G18407 | Encodes a defensin-like (DEFL) family protein. |
| AT3G14595 | Ribosomal protein L18ae family;(source:Araport11) |
| AT3G50910 | netrin receptor DCC;(source:Araport11) |
| AT2G29660 | zinc finger (C2H2 type) family protein;(source:Araport11) |
| AT2G43590 | Chitinase family protein;(source:Araport11) |
| AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G21790 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT2G41250 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G49152 | Natural antisense transcript overlaps with AT5G49150;(source:Araport11) |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
| AT1G24580 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G36925 | hypothetical protein;(source:Araport11) |
| AT4G16550 | HSP20-like chaperone, expression is induced by stress. |
| AT2G37780 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G07460 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42430.1);(source:TAIR10) |
| AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G44608 | hypothetical protein;(source:Araport11) |
| AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G14500 | aldose 1-epimerase family protein;(source:Araport11) |
| AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G62770 | membrane-associated kinase regulator, putative (DUF1645);(source:Araport11) |
| AT4G26120 | Ankyrin repeat family protein / BTB/POZ domain-containing protein;(source:Araport11) |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G38401 | hypothetical protein;(source:Araport11) |
| AT2G24420 | DNA repair ATPase-like protein;(source:Araport11) |
| AT1G21510 | TPRXL;(source:Araport11) |
| AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G28790 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
| AT2G27440 | pseudogene of rac GTPase activating protein |
| AT4G14310 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G51390 | hypothetical protein;(source:Araport11) |
| AT1G28815 | hypothetical protein;(source:Araport11) |
| AT3G05835 | pre-tRNA tRNA-Ile (anticodon: TAT);(source:Araport11, TAIR10) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT5G49710 | RING finger protein;(source:Araport11) |
| AT5G41460 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
| AT3G09540 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G06868 | vitellogenin-like protein;(source:Araport11) |
| AT2G42220 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT1G07795 | forkhead box protein G1;(source:Araport11) |
| AT2G44500 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G50690 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G26880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G20230 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G64385 | transmembrane protein;(source:Araport11) |
| AT3G61160 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G19380 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT5G66050 | Wound-responsive family protein;(source:Araport11) |
| AT4G08033 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G47980 | desiccation-like protein;(source:Araport11) |
| AT1G68300 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT2G15555 | other_RNA;(source:Araport11) |
| AT5G66053 | hypothetical protein;(source:Araport11) |
| AT2G22080 | transmembrane protein;(source:Araport11) |
| AT3G50625 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.1e-96 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT2G31130 | hypothetical protein;(source:Araport11) |
| AT3G46720 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G12850 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT2G20250 | hypothetical protein;(source:Araport11) |
| AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G64910 | Serine/Threonine-kinase;(source:Araport11) |
| AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
| AT3G48830 | tRNA nucleotidyltransferase/polyA polymerase family protein;(source:Araport11) |
| AT5G17750 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G15390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT2G27980 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT4G15120 | VQ motif-containing protein;(source:Araport11) |
| AT1G53200 | TAF RNA polymerase I subunit A;(source:Araport11) |
| AT2G11880 | None;(source:Araport11) |
| AT3G44950 | glycine-rich protein;(source:Araport11) |
| AT3G29720 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G51470 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G38790 | hypothetical protein;(source:Araport11) |
| AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G57785 | hypothetical protein;(source:Araport11) |
| AT5G03890 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G33590 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G48980 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G32480 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT5G37250 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G04000 | hypothetical protein;(source:Araport11) |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G35070 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT5G06220 | LETM1-like protein;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G09930 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
| AT1G18310 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G17640 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G60060 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
| AT5G49680 | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
| AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
| AT3G15251 | hypothetical protein;(source:Araport11) |
| AT1G18773 | acyl thioesterase-like protein;(source:Araport11) |
| AT5G61530 | small G protein family protein / RhoGAP family protein;(source:Araport11) |
| AT1G47970 | nucleolin;(source:Araport11) |
| AT1G10020 | formin-like protein (DUF1005);(source:Araport11) |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT3G23080 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G45450 | Double Clp-N motif-containing P-loop nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT1G63290 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G38365 | endonuclease/glycosyl hydrolase;(source:Araport11) |
| AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT3G29820 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 23%25 identity and 1.1e-09 P-value to GP|13786450|gb|AAK39575.1|AC025296_10|AC025296 putative reverse transcriptase {Oryza sativa};(source:TAIR10) |
| AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
| AT1G49570 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G54540 | Uncharacterized conserved protein (UCP012943);(source:Araport11) |
| AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT1G22403 | other_RNA;(source:Araport11) |
| AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
| AT1G63720 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G40011 | hypothetical protein;(source:Araport11) |
| AT1G27150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G71710 | DNAse I-like superfamily protein;(source:Araport11) |
| AT5G47590 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT5G41900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT4G15080 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G48950 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G28730 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT3G42798 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0043H09.1, similar to En/Spm-like transposon protein;(source:TAIR10) |
| AT3G48510 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT2G46290 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G53400 | Ubiquitin domain-containing protein;(source:Araport11) |
| AT1G73885 | AT-rich interactive domain protein;(source:Araport11) |
| AT5G04880 | pseudogene of ABC transporter family protein |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G60190 | Encodes a protein that can cleave residues from the C-terminus of RUB1 to prepare it for conjugation to target proteins. |
| AT5G53260 | Seed maturation protein;(source:Araport11) |
| AT2G24545 | Natural antisense transcript overlaps with AT2G24540;(source:Araport11) |
| AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G17975 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT3G17950 | transmembrane protein;(source:Araport11) |
| AT4G25870 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G29400 | oxidoreductase/transition metal ion-binding protein (DUF3531);(source:Araport11) |
| AT4G16330 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G27590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G37220 | Cold acclimation protein WCOR413 family;(source:Araport11) |
| AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G47300 | F-box family protein;(source:Araport11) |
| AT1G50732 | transmembrane protein;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT2G01580 | transmembrane protein;(source:Araport11) |
| AT1G47655 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G31030 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.0e-41 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G04090 | histidine-tRNA ligase;(source:Araport11) |
| AT1G52565 | cytochrome P450 family protein;(source:Araport11) |
| AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G52410 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
| AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
| AT5G24060 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT2G37480 | hypothetical protein;(source:Araport11) |
| AT4G08330 | hypothetical protein;(source:Araport11) |
| AT3G27910 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G19806 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT5G45745 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT4G05071 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G80850 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT4G31510 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT1G21830 | hypothetical protein;(source:Araport11) |
| AT4G32020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT2G13080 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
| AT5G12930 | inactive rhomboid protein;(source:Araport11) |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT2G43795 | corepressor;(source:Araport11) |
| AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G39720 | VQ motif-containing protein;(source:Araport11) |
| AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
| AT5G22160 | transmembrane protein;(source:Araport11) |
| AT4G29980 | fasciclin-like arabinogalactan protein;(source:Araport11) |
| AT5G54585 | hypothetical protein;(source:Araport11) |
| AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
| AT1G31150 | K-box region protein (DUF1985);(source:Araport11) |
| AT4G26820 | GrpE-like protein;(source:Araport11) |
| AT5G26010 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT3G55240 | Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype. |
| AT1G57540 | 40S ribosomal protein;(source:Araport11) |
| AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G21770 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G33610 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT1G77370 | Glutaredoxin family protein;(source:Araport11) |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT4G32860 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT2G22805 | Encodes a defensin-like (DEFL) family protein. |
| AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G46490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G18920 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G40470 | RNI-like superfamily protein;(source:Araport11) |
| AT4G24100 | Protein kinase superfamily protein |
| AT2G04190 | TRAF-like family protein;(source:Araport11) |
| AT5G49950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT3G02315 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT2G36145 | hypothetical protein;(source:Araport11) |
| AT5G50460 | secE/sec61-gamma protein transport protein;(source:Araport11) |
| AT5G63520 | F-box/LRR protein;(source:Araport11) |
| AT2G36030 | hypothetical protein;(source:Araport11) |
| AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G01610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G04040 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT1G78210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G12570 | Ortholog of maize IPE1 gene which is involved in pollen exine development. |
| AT5G52960 | tRNA dimethylallyltransferase;(source:Araport11) |
| AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT4G30830 | myosin-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G28463 | transmembrane protein;(source:Araport11) |
| AT5G65170 | VQ motif-containing protein;(source:Araport11) |
| AT3G49796 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G75730 | hypothetical protein;(source:Araport11) |
| AT5G01740 | Unknown gene, induced by abiotic stress treatments. |
| AT5G10190 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G22792 | pseudogene of F-box family protein |
| AT4G37175 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT4G21926 | hypothetical protein;(source:Araport11) |
| AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G05250 | hypothetical protein;(source:Araport11) |
| AT1G49990 | F-box family protein;(source:Araport11) |
| AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G01300 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G15548 | transmembrane protein;(source:Araport11) |
| AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G50850 | Putative methyltransferase family protein;(source:Araport11) |
| AT5G01210 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G39865 | transmembrane protein;(source:Araport11) |
| AT2G28140 | enabled-like protein (DUF1635);(source:Araport11) |
| AT1G12500 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G27460 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G27800 | Class II aminoacyl-tRNA and biotin synthetases superfamily protein;(source:Araport11) |
| AT1G48720 | Copia-like polyprotein/retrotransposon;(source:Araport11) |
| AT1G76440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT4G31310 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT3G30380 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
| AT1G01240 | transmembrane protein;(source:Araport11) |
| AT1G15330 | Cystathionine beta-synthase (CBS) protein;(source:Araport11) |
| AT1G28395 | hypothetical protein;(source:Araport11) |
| AT2G45360 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
| AT5G15000 | Encodes a ECA1 gametogenesis related family protein |
| AT3G07120 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G21720 | ArgH (DUF639);(source:Araport11) |
| AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT5G10070 | RNase L inhibitor protein-like protein;(source:Araport11) |
| AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
| AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT4G14500 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G52695 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
| AT3G13270 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G14450.1);(source:TAIR10) |
| AT4G37895 | Natural antisense transcript overlaps with AT4G37890;(source:Araport11) |
| AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
| AT1G24000 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G06570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G77810 | Galactosyltransferase family protein;(source:Araport11) |
| AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G60760 | hypothetical protein;(source:Araport11) |
| AT2G24440 | selenium binding protein;(source:Araport11) |
| AT5G51150 | Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11) |
| AT3G60540 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
| AT5G02580 | argininosuccinate lyase;(source:Araport11) |
| AT5G66660 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT5G47180 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT5G59990 | CCT motif family protein;(source:Araport11) |
| AT2G26520 | transmembrane protein;(source:Araport11) |
| AT2G05133 | Pseudogene of AT2G37680 |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT1G28135 | hypothetical protein;(source:Araport11) |
| AT3G49140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G39530 | hypothetical protein (DUF1997);(source:Araport11) |
| AT5G41060 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT4G04692 | pseudogene of expressed protein;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT2G36220 | hypothetical protein;(source:Araport11) |
| AT3G43690 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family protein, has a 1.4e-29 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G33550 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G36210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G07687 | Cytochrome c oxidase, subunit III;(source:Araport11) |
| AT4G20760 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G57230 | Thioredoxin superfamily protein;(source:Araport11) |
| AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G42760 | DUF1685 family protein;(source:Araport11) |
| AT1G15002 | Natural antisense transcript overlaps with AT1G15000;(source:Araport11) |
| AT2G15695 | peptide methionine sulfoxide reductase (Protein of unknown function DUF829, transmembrane 53);(source:Araport11) |
| AT3G62110 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G22241 | hypothetical protein;(source:Araport11) |
| AT3G24180 | Beta-glucosidase, GBA2 type family protein;(source:Araport11) |
| AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G52347 | None;(source:Araport11) |
| AT1G14345 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G44140 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G01260 | Carbohydrate-binding-like fold;(source:Araport11) |
| AT3G20680 | plant/protein (DUF1995);(source:Araport11) |
| AT4G16540 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT1G59950 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT2G03080 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-10 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10) |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G19930 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G40600 | appr-1-p processing enzyme family protein;(source:Araport11) |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
| AT2G21237 | transmembrane protein;(source:Araport11) |
| AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT1G31310 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G33180 | hypothetical protein;(source:Araport11) |
| AT1G01500 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT5G53410 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G42440 | pre-rRNA-processing TSR1-like protein;(source:Araport11) |
| AT5G44590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT1G21680 | DPP6 N-terminal domain-like protein;(source:Araport11) |
| AT2G15590 | spire, putative (DUF1685);(source:Araport11) |
| AT1G02816 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G22720 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G11560 | LETM1-like protein;(source:Araport11) |
| AT3G01570 | Oleosin family protein;(source:Araport11) |
| AT5G27238 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G14370 | CCT motif family protein;(source:Araport11) |
| AT5G03330 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT4G20250 | hypothetical protein;(source:Araport11) |
| AT3G50340 | hypothetical protein;(source:Araport11) |
| AT1G61795 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
| AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
| AT4G16630 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G33350 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G21600 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT1G27470 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G56810 | hypothetical protein;(source:Araport11) |
| AT2G25770 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G43000 | hypothetical protein;(source:Araport11) |
| AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
| AT5G45690 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT5G44310 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT2G30700 | GPI-anchored protein;(source:Araport11) |
| AT1G03270 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT2G15630 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G24010 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G18350 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G48610 | AT hook motif-containing protein;(source:Araport11) |
| AT3G27470 | lysine ketoglutarate reductase trans-splicing protein (DUF707);(source:Araport11) |
| AT5G64780 | holocarboxylase synthetase;(source:Araport11) |
| AT1G54310 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G52320 | kinesin-like protein;(source:Araport11) |
| AT1G75810 | transmembrane protein;(source:Araport11) |
| AT1G11010 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT5G10740 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G32020 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT3G44230 | transmembrane protein;(source:Araport11) |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT5G15500 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G53670 | hypothetical protein;(source:Araport11) |
| AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
| AT5G59740 | UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11) |
| AT1G12630 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT4G11380 | Adaptin family protein;(source:Araport11) |
| AT5G43770 | proline-rich family protein;(source:Araport11) |
| AT1G64710 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT5G02660 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (DUF627 and DUF629);(source:Araport11) |
| AT1G20890 | caveolin-1 protein;(source:Araport11) |
| AT3G26770 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G79630 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G23340 | carboxyl-terminal proteinase, putative (DUF239);(source:Araport11) |
| AT4G29905 | hypothetical protein;(source:Araport11) |
| AT2G46420 | helicase with zinc finger protein;(source:Araport11) |
| AT3G01520 | Encodes a universal stress protein (USP)-like protein that has been crystallized in complex with AMP, suggesting that it belongs to the ATP-binding USP subfamily. The mRNA is cell-to-cell mobile. |
| AT2G24580 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT1G18610 | Galactose oxidase/kelch repeat superfamily protein, induced by calcium. |
| AT5G01850 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G03340 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G77780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT1G69080 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT1G70870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G66890 | 50S ribosomal-like protein;(source:Araport11) |
| AT1G76878 | Natural antisense transcript overlaps with AT1G76880;(source:Araport11) |
| AT1G01250 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G05260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G29792 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-243 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G11320 | GDSL esterase/lipase;(source:Araport11) |
| AT3G56050 | Protein kinase family protein;(source:Araport11) |
| AT2G27180 | hypothetical protein;(source:Araport11) |
| AT1G80230 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT3G24640 | lyase;(source:Araport11) |
| AT2G32360 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G10370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G13820 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G20740 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G19920 | BTB/POZ domain protein;(source:Araport11) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G33785 | pseudogene of photosynthetic electron transfer B;(source:Araport11) |
| AT2G03000 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT1G78030 | hypothetical protein;(source:Araport11) |
| AT1G20940 | F-box family protein;(source:Araport11) |
| AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
| AT3G25870 | hypothetical protein;(source:Araport11) |
| AT5G36960 | hypothetical protein;(source:Araport11) |
| AT1G07590 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G78230 | Outer arm dynein light chain 1 protein;(source:Araport11) |
| AT2G37810 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G27990 | transmembrane protein;(source:Araport11) |
| AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT1G15175 | Natural antisense transcript overlaps with AT1G15170;(source:Araport11) |
| AT5G47380 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
| AT5G03660 | transcriptional activator (DUF662);(source:Araport11) |
| AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
| AT5G58800 | Quinone reductase family protein;(source:Araport11) |
| AT3G17365 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G26450 | hypothetical protein;(source:Araport11) |
| AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT1G52990 | thioredoxin family protein;(source:Araport11) |
| AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
| AT5G42610 | calcium uniporter (DUF607);(source:Araport11) |
| AT1G02700 | GATA transcription factor-like protein;(source:Araport11) |
| AT2G01913 | hypothetical protein;(source:Araport11) |
| AT1G26761 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT1G54955 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05145.1);(source:TAIR10) |
| AT5G57123 | hypothetical protein;(source:Araport11) |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT3G57970 | Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein;(source:Araport11) |
| AT4G09745 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G28540 | Tail-anchored (TA) OEP membrane protein which possesses a single C-terminal transmembrane domain targeting post-translationally to plastids. |
| AT2G18340 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G34630 | prostatic spermine-binding-like protein;(source:Araport11) |
| AT2G36470 | DUF868 family protein, putative (DUF868);(source:Araport11) |
| AT3G59670 | elongation factor;(source:Araport11) |
| AT3G42794 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.2e-05 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT2G40910 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G33630 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT5G51250 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G40670 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT2G17590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G21440 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT2G21510 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT5G28520 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT5G59080 | hypothetical protein;(source:Araport11) |
| AT3G56275 | pseudogene of expressed protein;(source:Araport11) |
| AT3G41979 | 5.8SrRNA |
| AT1G04560 | AWPM-19-like family protein;(source:Araport11) |
| AT1G14330 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G36100 | transmembrane protein;(source:Araport11) |
| AT3G42796 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-31 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G66330 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G13245 | snoRNA;(source:Araport11) |
| AT1G55265 | DUF538 family protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT3G20170 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G15960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G44757 | pseudogene of transmembrane protein;(source:Araport11) |
| AT5G24810 | ABC1 family protein;(source:Araport11) |
| AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40790 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT4G00370 | Encodes an inorganic phosphate transporter (PHT4;4) that can transport ascorbate and is located in the chloroplast envelope membrane. It has been shown to play a role in the xanthophyll cycle during photosynthesis and may be required for tolerance to strong light stress. |
| AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
| AT5G67360 | Encodes a subtilisin-like serine protease essential for mucilage release from seed coats. |
| AT3G54840 | Encodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome. . In its active state interferes with the assembly of GDP-bound ARA7, PUF2, and VPS9a by competitively binding to PUF2 to diminish endosomal transport mediated by canonical RAB5. |
| AT4G16640 | Matrix metalloprotease. |
| AT1G59970 | Matrix metalloproteinase important for root development and root bacterial communities. Modulates auxin/ABA signaling rendering the plant sensitive to drought stress and recruiting differential root bacterial communities. |
| AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. The mRNA is cell-to-cell mobile. |
| AT1G20823 | Encodes a RING E3 ubiquitin ligase ATL80. Involved in phosphate mobilization and cold stress response in sufficient phosphate growth conditions. The mRNA is cell-to-cell mobile. |
| AT3G09880 | Encodes B' regulatory subunit of PP2A (AtB'beta). Functions redundantly with the alpha subunit do maintain sister chromatid cohesion during meiosis. |
| AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
| AT5G66940 | Encodes a nuclear localized DOF-domain binding transcription factor. |
| AT3G62760 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G76410 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G18250 | encodes a thaumatin-like protein |
| AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
| AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT1G22490 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
| AT3G12300 | Similar to Bug22p in Paramecium, a conserved centrosomal/ciliary protein. This protein is widespread in eukaryotes harboring centrioles/cilia at some stage of their life cycles. Among eukaryotes devoid of centrioles/cilia, plants possess BUG22 genes whereas some fungi (at least ascomycetes) do not. |
| AT5G46390 | C-terminal peptidase |
| AT1G59620 | Encodes CW9. |
| AT4G29200 | Over-expressed by salt stress. |
| AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G40340 | Encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT5G55070 | Encodes the E2 subunit of the 2-oxoglutarate dehydrogenase. |
| AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G12130 | Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates. |
| AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT5G61840 | Encodes a UDP-Xyl:beta-(1,4)-xylosyl transferase. |
| AT1G08880 | Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10?20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
| AT2G40490 | Uroporphyrinogen decarboxylase;(source:Araport11) |
| AT5G24580 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G40490 | HLP1 is a member of the conserved hnRNP A/B family and contains RNA Recognition Motifs (RRM).It binds mRNA and appears to be involved in targeting alternative polyadenylation (APA). APA targets include genes involved in flowering. Loss of HLP1 function results causes late flowering under long and short day conditions. This phenotype is suppressed by loss of FLC. |
| AT3G18035 | A linker histone like protein |
| AT1G59860 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT2G29500 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G07400 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G02570 | Histone superfamily protein;(source:Araport11) |
| AT3G46030 | Histone superfamily protein;(source:Araport11) |
| AT2G28720 | Histone superfamily protein;(source:Araport11) |
| AT2G37470 | Histone superfamily protein;(source:Araport11) |
| AT3G53650 | Histone superfamily protein;(source:Araport11) |
| AT1G08170 | Histone superfamily protein;(source:Araport11) |
| AT3G45980 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases as well as the UBC1 and UBC2 E2 ubiquitin conjugating enzymes. Lysine 146 appears to be the site of the ubiquitin addition. |
| AT1G13370 | Histone superfamily protein;(source:Araport11) |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT4G22220 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
| AT1G32130 | The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. |
| AT1G70480 | Protein residing in the chloroplast outer membrane, has channel-like properties facilitating the export of the jasmonate precursor 12-oxophytodienoic acid (OPDA) from the chloroplast. |
| AT3G50240 | Encodes a kinesin-related protein. |
| AT5G15970 | Encodes a gene that can be induced by cold and abscisic acid and may be involved in cold acclimation and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT3G23670 | Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT3G24750 | Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root |
| AT3G27025 | Encodes a member of the LAZY gene family that is expressed in the shoot apex. |
| AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G03090 | MCCA is the biotinylated subunit of the dimer MCCase, which is involved in leucine degradation. Both subunits are nuclear coded and the active enzyme is located in the mitochondrion. |
| AT4G36820 | Mitochondrial calcium channel. |
| AT4G01883 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
| AT2G34620 | Mitochondrial transcription termination factor family member. |
| AT5G23930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G55580 | Encodes a mitochondrial transcription termination factor (mTERF) family protein. The gene product is targeted to the chloroplast nucleoid and mutants are affected in plastid gene expression and chloroplast development. Mutants, named as twirt1 (twr-1), display altered root meristem function resulting in short roots. Mutation also affects shoot meristem function. |
| AT2G39450 | Encodes a Golgi-localized manganese transporter that is involved in Mn tolerance. When expressed into yeast cells, this gene confer Mn2+ and Cu2+ tolerance. |
| AT2G40970 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G04370 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes NAMT1, a methyltransferase that methylates nicotinic acid to yield methyl nicotinate. |
| AT2G28250 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G20800 | Cell differentiation, Rcd1-like protein;(source:Araport11) |
| AT4G14660 | Non-catalytic subunit specific to DNA-directed RNA polymerase V; homologous to budding yeast RPB7 |
| AT3G61690 | Putative TNAase |
| AT3G57990 | Encodes a ?-barrel protein, named OEP40, locates in in the outer envelope of chloroplasts, and functions as a solute channel which is selectively permeable for glucose. |
| AT5G22240 | Ovate family protein;(source:Araport11) |
| AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
| AT4G22890 | Encodes PGRL1A, a transmembrane protein present in thylakoids. PGRL1A has a highly homologous isoform PGRL1B encoded by At4g11960. Plants lacking PGRL1 show perturbation of cyclic electron flow, similar to PGR5-deficient plants. PGRL1 and PGR5 interact physically and associate with PSI (photosystem I). The mRNA is cell-to-cell mobile. |
| AT5G65370 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT5G47400 | sphingomyelin phosphodiesterase;(source:Araport11) |
| AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile. |
| AT5G64040 | Encodes the only subunit of photosystem I located entirely in the thylakoid lumen. May be involved in the interaction between plastocyanin and the photosystem I complex. Phosphorylation of this protein is dependent on calcium. |
| AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G45910 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT1G74730 | Encodes a grana core localized protein, is homologous to RIG1. Mutant plants have reduced NPQ, affected organization of light-havesting complex II and an enhanced grana stacking. |
| AT1G71980 | RMR2 is a secretory pathway protein localized to the trans-golgi network. It belongs to a family of vacuolar sorting receptors. If forms heterodimers with RMR1. |
| AT3G13740 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
| AT5G11930 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT5G28060 | Ribosomal protein S24e family protein;(source:Araport11) |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT1G07140 | Encodes a putative Ran-binding protein (siRanBP). |
| AT1G21410 | AtSKP2;1 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. |
| AT1G77000 | AtSKP2;2 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. AtSKP2b may also be involved in the degradation of KRP1/ICK1, a CDK inhibitor. |
| AT2G28330 | hypothetical protein;(source:Araport11) |
| AT1G51355 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT1G14200 | E3 ligase involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G71890 | Encodes a sucrose transporter that is expressed in the endosperm. Mutants have delayed accumulation of fatty acids and embryo maturation. |
| AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
| AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
| AT4G34290 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G29310 | SecY protein transport family protein;(source:Araport11) |
| AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
| AT5G25100 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT5G15510 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT4G15480 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT1G16780 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT4G27260 | encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. It is involved in camalexin biosynthesis via conjugating indole-3-carboxylic acid (ICA) and cysteine (Cys). The mRNA is cell-to-cell mobile. |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
| AT5G21920 | One of four Arabidopsis homologs of bacterial ymlg proteins. |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT1G48130 | encodes a protein similar to the 1-cysteine (1-Cys) peroxiredoxin family of antioxidants. Expression is limited to seed (aleurone and embryo) and is not induced by ABA or drought. |
| AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
| AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
| AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT1G04220 | Encodes KCS2, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G51680 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. In addition to 4-coumarate, it also converts ferulate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, ferulic acid, caffeic acid and 5-OH-ferulic acid. At4CL1 was unable to use sinapic acid as substrate. |
| AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT5G57050 | Encodes a protein phosphatase 2C and is involved in ABA signal transduction. Binds fibrillin preprotein in vitro and in vivo. |
| AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G63350 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G64940 | ABC1K8 is a member of an atypical protein kinase family that is induced by heavy metals. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K7 in mediating lipid membrane changes in response to stress. The mRNA is cell-to-cell mobile. |
| AT1G13740 | Encodes a member of a small plant-specific gene family whose members interact with ABI5 and appear to be involved in mediating stress responses. AFP2 mutants affect a number of ABA mediated processes such as germination and response to osmotic and sugar stress. AFP2 nuclear localization is stress dependent. |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT2G46225 | Encodes a subunit of the WAVE complex. The WAVE complex is required for activation of ARP2/3 complex which functions in actin microfilament nucleation and branching. One of four ABI-like proteins. |
| AT1G62340 | Subtilisin-like serine protease required for epidermal surface formation in embryos and juvenile plants |
| AT5G57790 | Encodes a nuclear localized protein of unknown function that is involved in pollen and embryo sac development. |
| AT4G34000 | Encodes an ABA-responsive element-binding protein with similarity to transcription factors that is expressed in response to stress and abscisic acid. |
| AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
| AT4G25650 | Similar to ACD1. Leaves of antisense ACD1-like plants turn yellow in darkness like wild-type whereas antisense ACD1 plants remain dark after five days of dark treatment. |
| AT1G36180 | acetyl-CoA carboxylase 2 (ACC2) The mRNA is cell-to-cell mobile. |
| AT5G65890 | Member of ACT domain containing protein family. ACT domains are amino acid binding domains. Shows strongest expression in flowers and siliques. |
| AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
| AT3G01990 | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. |
| AT4G22780 | Member of a family of ACT domain containing proteins . ACT domains are involved in amino acid binding . |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT5G59880 | Encodes actin depolymerizing factor 3 (ADF3). |
| AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT5G56180 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. Member of nuclear ARP family of genes. |
| AT2G33385 | actin-related protein C2B;(source:Araport11) |
| AT1G74500 | Encodes a basic helix/loop/helix transcription factor that acts downstream of MP in root initiation. TMO7 protein moves to the hypophysis and to vascular cells, contributing to MP-dependent root formation. Promotes the correct definition of the hypophysis cell division plane. |
| AT5G16370 | acyl activating enzyme 5;(source:Araport11) |
| AT1G30520 | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT5G23050 | acyl-activating enzyme 17;(source:Araport11) |
| AT3G48990 | Encodes an oxalyl-CoA synthetase and is required for oxalate degradation, for normal seed development, and for defense against an oxalate-producing fungal pathogen. |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT3G50860 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
| AT2G19790 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT1G80050 | Encodes an adenosine phosphoribosyl transferase(E.C:2.4.2.7), a constitutively expressed enzyme involved in the one-step salvage of adenine to AMP. This isozyme has high affinity for cytokinins and is likely to be localized to the cytosol. |
| AT4G12440 | adenine phosphoribosyl transferase 4;(source:Araport11) |
| AT2G37250 | encodes adenylate kinase that is located in the chloroplast involved in the coordination of metabolism and growth |
| AT2G24765 | GTPase required for Golgi targeting of GRIP domain proteins. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner |
| AT2G22630 | Encodes a MADs domain containing protein involved in promoting flowering. Loss of function mutations show delayed flowering in long days and reduced levels of LFY and AP1 expression. |
| AT4G37940 | encodes a MADS box protein, highly expressed in the root. |
| AT2G26320 | AGAMOUS-like 33;(source:Araport11) |
| AT5G26650 | AGAMOUS-like 36;(source:Araport11) |
| AT1G77950 | Cooperates with the histone mark reader EBS to modulate seed germination under high temperature. |
| AT3G66656 | AGAMOUS-like 91;(source:Araport11) |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
| AT2G28800 | member of Chloroplast membrane protein ALBINO3 family. Similar to pea PPF1 and may play a role in plant senescence. |
| AT4G01800 | Encodes the ATPase subunit of the chloroplast Sec translocation machinery which plays an essential role in chloroplast biogenesis and the regulation of photosynthesis, the absence of which triggers a retrograde signal, eventually leading to a reprogramming of chloroplast and mitochondrial gene expression. |
| AT1G77120 | Catalyzes the reduction of acetaldehyde using NADH as reductant. Requires zinc for activity. Dimer. Anaerobic response polypeptide (ANP). Fermentation. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
| AT1G79440 | Encodes a mitochondrial succinic semialdehyde dehydrogenase (SSADH). Nomenclature according to Kirch, et al (2004). |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT4G20070 | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT1G69830 | Encodes a plastid-localized α-amylase. Expression is reduced in the SEX4 mutant. Loss of function mutations show normal diurnal pattern of starch accumulation/degradation. Expression follows circadian rhythms. |
| AT1G18460 | Alpha/beta hydrolase |
| AT2G24100 | ATP-dependent DNA helicase;(source:Araport11) |
| AT5G10940 | ASG2 is farnesylated protein and this post-translational modification impacts its subcellular localization. It is the homolog of the human anti-obesity factor WDTC1 and is involved in the negative regulation of fatty acid biosynthesis. The non-farnesylated form displays a nucleo-cytosolic subcellular localization. The farnesylated form displays a cytosolic subcellular localization. Interaction with At4g05420 (DDB1a) was shown using BiFC approach. |
| AT1G01520 | RVE3 is one of eleven homologous MYB-like transcription factors in Arabidopsis and a member of the RVE8 clade. Plays a minor role in clock regulation. |
| AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
| AT2G37330 | Encodes an ABC transporter-like protein, without an ATPase domain, required for aluminum (Al) resistance/tolerance and may function to redistribute accumulated Al away from sensitive tissues in order to protect the growing root from the toxic effects of Al. |
| AT5G27610 | protein ALWAYS EARLY 1;(source:Araport11) |
| AT5G23810 | Encodes nonfunctional amino acid transporter. AAP7 is the most distantly related member of the AAP family, a group of well characterized amino acid transporters within the ATF1 superfamily. Expression of this gene has not been detected with RNA gel blots or promoter GUS studies. |
| AT1G17500 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein. ALA4 acts redundantly with ALA3, ALA5, ALA9, ALA10 and ALA11 in root and shoot development |
| AT3G27870 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. The mRNA is cell-to-cell mobile. |
| AT4G36920 | Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. |
| AT4G38220 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
| AT3G14180 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT1G72200 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G23980 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G07040 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44578 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09030 | Encodes arabinogalactan protein (AGP10). The mRNA is cell-to-cell mobile. |
| AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
| AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
| AT5G65390 | arabinogalactan protein 7;(source:Araport11) |
| AT1G48410 | Encodes an RNA Slicer that selectively recruits microRNAs and siRNAs. There is currently no evidence that AGO1 Slicer is in a high molecular weight RNA-induced silencing complex (RISC). Mutants are defective in post-transcriptional gene silencing and have pleiotropic developmental and morphological defects. Through its action on the regulation of ARF17 expression, the protein regulates genes involved at the cross talk between auxin and light signaling during adventitious root development. AGO1 seems to be targeted for degradation by silencing suppressor F-box-containing proteins from Turnip yellow virus and Cucurbit aphid-borne yellow virus. |
| AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
| AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
| AT5G66200 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
| AT2G16220 | Stress induced gene. Mutants show increased sensitivity to arsenate. |
| AT1G68310 | Encodes a protein that has been shown to specifically interact with a sequence motif, PIEPPPHH, in the cytoplasmic tail of a membrane protein that directs the protein from the ER to vacuoles where it is internalized. Required for both leaf adaxial?abaxial polarity formation and normal cell proliferation. It is part of a protein complex with CIA1, NAR1, and MET18, which are highly conserved in eukaryotes and are involved in the biogenesis of cytosolic and nuclear Fe-S proteins. |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT5G11520 | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. |
| AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT2G37630 | Encodes a MYB-domain protein involved in specification of the leaf proximodistal axis. Mutation results in lobed and dissected leaves with a characteristic asymmetry. Homologous to the Antirrhinum PHANTASTICA (PHAN) and maize ROUGH SHEATH2 (RS2) genes Asymmetric placement of auxin response at the distal leaf tip precedes visible asymmetric leaf growth. Acts alongside AXR1 to exclude BP expression in leaves and with PIN1 to repress BP and promote lateral organ growth. Interacts physically with AS2 to form a complex that binds to the BP promoter and silences BP. Also functions as a regulator of the plant immune response. |
| AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
| AT2G45430 | Encodes a nuclear localized AT hook domain containing protein that can bind AT rich DNA in vitro. Overexpression of the gene results in delayed flowering. Is likely to act redundantly with AHL18, AHL27 and AHL29 in the regulation of flowering. It is also involved in both photo- and skotomorphogenesis. |
| AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT3G62690 | Encodes a RING-H2 zinc finger protein related to ATL2. The ATL gene family is represented by fifteen sequences that contain, in addition to the RING, a transmembrane domain which is located in most of them towards the N-terminal end. |
| AT3G22890 | encodes ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of Arabidopsis. It may also participate in selenium metabolism. The mRNA is cell-to-cell mobile. |
| AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
| AT5G61690 | ABC2 homolog 15;(source:Araport11) |
| AT5G44110 | Encodes a member of the NAP subfamily of ABC transporters whose expression pattern is regulated by light and sucrose. |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT5G09930 | ABCF2 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein, GCN20. |
| AT5G64840 | ABCF5 is one of five members of the ABCF gene family in Arabidopsis, which are homologs of the yeast ABCF protein GCN20. |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT1G19800 | Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT1G03905 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
| AT2G45170 | Involved in autophagy. Under nutrient starvation the protein localizes to autophagosomes. Involved in submergence (hypoxia) tolerance; ethanol induces autophagy. |
| AT3G60640 | Autophagy protein. |
| AT3G61960 | autophagy gene |
| AT3G53930 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G62000 | Encodes an auxin response factor. Mutants have many defects including enlarged rosette leaves, reduced fertility, later senescence, hypocotyl elongation defects, enlarged seeds and enlarged cotyledons. May not mediate auxin effects. Increase in seed size due to increased cell proliferation. The mRNA is cell-to-cell mobile. |
| AT1G78100 | F-box family protein;(source:Araport11) |
| AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
| AT3G21880 | Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570). |
| AT1G68520 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G25440 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G68190 | B-box zinc finger family protein;(source:Araport11) |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G18080 | B-S glucosidase 44;(source:Araport11) |
| AT5G15160 | BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT3G25710 | Encodes a basic helix-loop-helix transcription factor that is expressed in the hypophysis-adjacent embryo cells, and is required and partially sufficient for MP-dependent root initiation. Involved in response to phosphate starvation. Negative regulator of root hair development, anthocyanin formation and Pi content. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT1G75390 | basic leucine-zipper 44;(source:Araport11) |
| AT3G49760 | basic leucine-zipper 5;(source:Araport11) |
| AT2G22850 | basic leucine-zipper 6;(source:Araport11) |
| AT1G68880 | basic leucine-zipper 8;(source:Araport11) |
| AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G07220 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT4G02660 | Beige/BEACH and WD40 domain-containing protein;(source:Araport11) |
| AT5G08130 | Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
| AT3G18070 | beta glucosidase 43;(source:Araport11) |
| AT5G46690 | beta HLH protein 71;(source:Araport11) |
| AT5G18670 | putative beta-amylase BMY3 (BMY3) |
| AT5G55700 | In vitro assay indicates no beta-amylase activity of BAM4. However mutation in BAM4 impairs starch breakdown. BAM4 may play a regulatory role. |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT5G65940 | hydrolyzes beta-hydroxyisobutyryl-CoA |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
| AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
| AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT5G49550 | Putative homolog of mammalian BLOC-1 Subunit 2. Protein - protein interaction with BLOS1. |
| AT3G52740 | Plant specific protein.BIC1 and BIC2 inhibit cryptochrome function by blocking blue light-dependent cryptochrome dimerization.Light activated transcription of BICs is mediated by cryptochromes. |
| AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT5G05840 | replication factor C subunit, putative (DUF620);(source:Araport11) |
| AT4G39400 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase involved in brassinosteroid signal transduction. BRI1 ligand is brassinolide which binds at the extracellular domain. Binding results in phosphorylation of the kinase domain which activates the BRI1 protein leading to BR responses. Residue T-1049 and either S-1044 or T-1045 were essential for kinase function in vitro and normal BRI1 signaling in planta. The structure of BRI1 ligand-binding domain has been determined at 2.5A resolution. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. BRI1 appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through its effects on FLC expression levels, as uncovered by double mutant analyses. This most likely occurs as a result of BRI1-dependent effects on histone acetylation, but not histone triMeH3K4 methylation, at the FLC locus. The mRNA is cell-to-cell mobile. |
| AT5G01630 | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with with both Rad51 and Dss1(I) or both Dmc1 and Dss1(I) in a tripartite complex. |
| AT5G60880 | Encodes BASL (BREAKING OF ASYMMETRY IN THE STOMATAL LINEAGE), a regulator of asymmetric divisions. In asymmetrically dividing stomatal-lineage cells, BASL accumulates in a polarized crescent at the cell periphery before division, and then localizes differentially to the nucleus and a peripheral crescent in self-renewing cells and their sisters after division. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT4G00020 | Ortholog of breast cancer susceptibility protein 2. Essential at meiosis. Interacts with either AtRad51 or AtDmc1 and ATDSS1(I). Involved in embryo sac development and defense gene transcription during plant immune responses. |
| AT5G20540 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT5G42750 | Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment. |
| AT1G19350 | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes. Works with BRAVO to regulate QC division in the root. AT1G19350.3(BES1-L) is the long isoform of BES1. It contains an additive N-terminal NLS compared with the canonical BES1-S. This recently evolved isoform is expressed specifically in the Arabidopsis lineage |
| AT2G38740 | HAD-type phosphosugar phosphatase. |
| AT2G40400 | Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development. |
| AT5G63160 | BTB and TAZ domain protein. Short-lived nuclear-cytoplasmic protein targeted for degradation by the 26S proteosome pathway. Acts redundantly with BT2 and BT3 during female gametophyte development. |
| AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
| AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
| AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
| AT1G19490 | Putative bZIP transcription factor. Expression is induced by drought and mutants are sensitive to drought. |
| AT5G51990 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature. |
| AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT4G25470 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature, abscisic acid, and circadian rhythm. Overexpressing this gene leads to increased freeze tolerance and induces the expression level of 85 cold-induced genes and reduces the expression level of 8 cold-repressed genes, which constitute the CBF2 regulon. Mutations in CBF2 increases the expression level of CBF1 and CBF3, suggesting that this gene may be involved in a negative regulatory or feedback circuit of the CBF pathway. |
| AT2G23440 | transmembrane protein;(source:Araport11) |
| AT5G23060 | Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium. |
| AT4G38810 | SnRK2-Interacting Calcium Sensor. Encodes two different isoforms that can both inhibit SnRK2. The longer form (AT4G38810.2) is calcium dependant, the other is not. |
| AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT2G13680 | Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen. |
| AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
| AT3G56800 | encodes a calmodulin |
| AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. The gene itself is Al inducible, and AtALMT1 expression is partially repressed in camta2 mutant. The mRNA is cell-to-cell mobile. |
| AT3G16940 | Calmodulin binding transcription factor. Mutants display increased salt tolerance during early germination. Involved in regulation of salt stress responsive genes. |
| AT5G61790 | calnexin 1;(source:Araport11) |
| AT1G09210 | Encodes one of three Arabidopsis calreticulins.Post-transcriptionally regulates together with CRT1 VAMP721/722 levels under ER stress. |
| AT3G05520 | Encodes a capping protein that acts as a phosphatidic acid biosensor and key transducer of fluxes in membrane signaling phospholipids into changes in actin cytoskeleton dynamics. |
| AT5G16080 | carboxyesterase 17;(source:Araport11) |
| AT4G04870 | Encodes a protein with cardiolipin synthase activity that is localized to the mitochondiria. |
| AT4G28860 | Member of CKL gene family (CKL-A group) |
| AT1G03700 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G79780 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G73875 | Deadenylase. |
| AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
| AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
| AT2G25090 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance. |
| AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
| AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
| AT2G38490 | member of AtCIPKs |
| AT3G44260 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT1G02730 | Encodes a gene similar to cellulose synthase. Knock-out mutant has reduced growth, reduced xylan level and reduced xylan synthase activity in stems.It's expression is cell cycle dependent and it appears to function in cell plate formation. |
| AT2G47450 | A component of the chloroplast signal recognition particle pathway that is involved in LHCP targeting. It is downregulated in response to high light. It recognizes the DPLG motif in Lhcb1. The mRNA is cell-to-cell mobile. |
| AT5G56500 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
| AT3G14870 | hypothetical protein (DUF641);(source:Araport11) |
| AT3G27170 | member of Anion channel protein family The mRNA is cell-to-cell mobile. |
| AT1G44446 | Encodes chlorophyllide a oxygenase which converts chlorophyllide a to chlorophyllide b by catalyzing two successive hydroxylations at the 7-methyl group of chlorophyllide a . Mutants are deficient in pigments that associate with thylakoid membrane proteins, lacking chlorophyll b and light-harvesting proteins of photosystem II. The protein was shown through cross-linking experiments to interact with Toc75, Toc34, Tic40, Tic20 and Tic22. |
| AT1G29920 | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II. |
| AT4G13010 | Oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT5G57180 | Transcription regulator responsible for specific upregulation of the translocon genes atToc33 and atToc75 in leaves. Involved in protein import into chloroplast. |
| AT3G14330 | Encodes a pentatricopeptide repeat protein involved in chloroplast mRNA editing. Mutants display defects in C-U editing of psbE. |
| AT5G03940 | mutant has Yellow first leaves; Chloroplast Signal Recognition Particle Subunit |
| AT5G66650 | Chloroplast localized mitochondrial calcium uniporter. |
| AT5G39520 | Plastid localized transmembrane protein involved in ABA mediated leaf senescence and stomatal movement. |
| AT5G16390 | Encodes for the biotin carboxyl-carrier subunit of the multi-enzyme plastidial acetyl-coenzyme A carboxylase complex. |
| AT5G55740 | Encodes a member of the E+ subgroup of the PPR protein family, containing the E and E+ motifs following a tandem array of PPR motifs. It also contains an unknown motif consisting of 15 aa, which is highly conserved in some PPR proteins, including CRR4. CRR21 is involved in RNA editing of the site 2 of ndhD (ndhD-2),which encodes a subunit of the NDH complex. The RNA editing changes aa 128 from Ser to Leu. Mutants have impaired NDH complex activity. |
| AT2G01590 | Likely a subunit of the chloroplast NAD(P)H dehydrogenase complex, involved in PSI cyclic electron transport. Located in the membrane fraction of chloroplast. Mutant has impaired NAD(P)H dehydrogenase activity. |
| AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT2G46830 | Encodes a transcriptional repressor that performs overlapping functions with LHY in a regulatory feedback loop that is closely associated with the circadian oscillator of Arabidopsis. Binds to the evening element in the promoter of TOC1 and represses TOC1 transcription. CCA1 and LHY colocalize in the nucleus and form heterodimers in vivo. CCA1 and LHY function synergistically in regulating circadian rhythms of Arabidopsis. CCA1 binds the GI promoter. |
| AT2G23410 | Encodes cis-prenyltransferase involved in dolichol biosynthesis. |
| AT5G58782 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT2G42790 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT2G20760 | Clathrin light chain protein;(source:Araport11) |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT4G38060 | hypothetical protein;(source:Araport11) |
| AT1G29390 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. |
| AT2G15970 | encodes an alpha form of a protein similar to the cold acclimation protein WCOR413 in wheat. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. The mRNA is cell-to-cell mobile. |
| AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT2G17870 | Encodes COLD SHOCK DOMAIN PROTEIN 3 (CSP3), involved in the acquisition of freezing tolerance. |
| AT4G33980 | Acts with COR27 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
| AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
| AT5G03730 | Homologous to the RAF family of serine/threonine protein kinases. Negative regulator in the ethylene signal transduction pathway. Interacts with the putative ethylene receptors ETR1 and ERS. Constitutively expressed. |
| AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
| AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
| AT2G47400 | CP12-1 encodes a small peptide found in the chloroplast stroma. It belongs to the CP12 gene family thought to be involved in the formation of a supramolecular complex with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) embedded in the Calvin cycle. The mRNA is cell-to-cell mobile. |
| AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
| AT1G03880 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G44120 | Encodes a 12S seed storage protein. The Landsberg erecta genome contains another copy of 12S globulin gene, CRA2, which is located tandemly with CRA1. Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G51020 | Encodes CRL (CRUMPLED LEAF), a protein localized in the outer envelope membrane of plastids. Mutation in this gene affects the pattern of cell division, cell differentiation and plastid division. |
| AT3G07340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G24850 | Binds flavin adenine dinucleotide and DNA. It does not have photolyase activity, and it is likely to act as photoreceptor. Closely related to Synechocystis cryptochrome. |
| AT5G25540 | Expressed protein contains PAM2 PABC interacting domain. |
| AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
| AT4G20320 | Cytidine triphosphate synthase. |
| AT4G34490 | CYCLASE ASSOCIATED PROTEIN |
| AT2G46430 | Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance. |
| AT5G54250 | member of Cyclic nucleotide gated channel family, downstream component of the signaling pathways leading to HR resistance. mutant plants exhibit gene-for-gene disease resistance against avirulent Pseudomonas syringae despite the near-complete absence of the hypersensitive response (HR). Salicylic acid accumulation in dnd2 mutants is completely PAD4-independent. |
| AT1G20610 | Cyclin B2;(source:Araport11) |
| AT4G34160 | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
| AT3G21870 | cyclin p2;(source:Araport11) |
| AT2G44740 | cyclin p4;(source:Araport11) |
| AT5G39660 | Dof-type zinc finger domain-containing protein, identical to H-protein promoter binding factor-2a GI:3386546 from (Arabidopsis thaliana). Interacts with LKP2 and FKF1, but its overexpression does not change flowering time under short or long day conditions. |
| AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
| AT5G50375 | Converts pentacyclic cyclopropyl sterols to conventional tetracyclic sterols. CPI1 function during and just after division and support gravitropism by establishing polar PIN2 localization. Required for endocytosis of PIN2 |
| AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
| AT5G47550 | Putative phytocystatin expressed in seedlings and induced by heat stress and abscisic acid. Overexpression increases germination rate and heat stress tolerance. CYS5 is a target of ABF1 and ABF3 transcriptional regulators which bind to its promoter. |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT3G03630 | Encodes a protein that possesses S-sulfocysteine synthase activity and lacks O-acetylserien(thiol)lyase activity. |
| AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT4G10040 | Encodes cytochrome c. Promoter directs preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and in anthers. Double mutants with CYTC-1 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT3G30290 | a member of cytochrome P450 gene family |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT1G33730 | cytochrome P450, family 76, subfamily C, polypeptide 5;(source:Araport11) |
| AT1G11600 | member of CYP77B |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT4G37400 | member of CYP81F |
| AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
| AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
| AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT2G27690 | Encodes a CYP94C1. Has highest omega-hydroxylase activity with 9,10-epoxystearic acid, while also metabolized lauric acid (C12:0) and C18 unsaturated fatty acids. Gene expression is induced in response to wounding and jasmonic acid treatment. |
| AT4G15110 | member of CYP97B |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G56970 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on N6-(2-isopentenyl)adenine 9-riboside. |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
| AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT3G61630 | CRF6 encodes one of the six cytokinin response factors. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
| AT1G04270 | Encodes cytosolic ribosomal protein S15. |
| AT1G04410 | predicted to encode a cytosolic malate dehydrogenase. |
| AT4G02860 | Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11) |
| AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT5G20250 | encodes a member of glycosyl hydrolase family 36. Expression is induced within 3 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
| AT3G20550 | Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL. |
| AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
| AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
| AT5G05280 | Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway. |
| AT5G16710 | DHAR3 protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide.Encodes 30-40% of extractable leaf GSH-dependent DHAR activity. Single knockout mutants show unaltered ascorbate and glutathione status in optimal and oxidative stress conditions.Makes a minor contribution to glutathione oxidation in response to increased intracellular hydrogen peroxide (catalase deficiency) (PMID:28381499). |
| AT4G26630 | Encodes a chromatin-associated protein that specifically binds histones H3 and H4 and contributes to modulation of Arabidopsis chromatin structure and function. |
| AT3G20210 | Encodes a vacuolar processing enzyme with caspase-1-like activity that is specifically expressed in inner integument of developing seeds. Mutants display abnormal seed coat development. It is speculated to be involved in cell death of limited cell layers, the purpose of which is to form a seed coat. |
| AT1G65520 | encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
| AT4G29330 | DERLIN-1;(source:Araport11) |
| AT3G23637 | Member of a family of small polypeptides found only in angiosperm lineages.Contains a conserved 29 amino acid domain (RTF or DVL domain). |
| AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
| AT1G63900 | Encodes a RING-type ubiquitin E3 ligase of the chloroplast outer membrane that associates with TOC complexes and mediates ubiquitination of TOC components, promoting their degradation. It not only regulates chloroplast protein import but also targets components of the peroxisome protein import apparatus, PEX13 in particular. Several studies have been done to examine the peroxisomal localization of this protein, with varying interpretations. |
| AT5G09470 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
| AT3G11670 | Responsible for the final assembly of galactolipids in photosynthetic membranes. Provides stability to the PS I core complex (e.g. subunits PsaD, PsaE). |
| AT2G45440 | Encodes a protein that likely has dihydropicolinate synthase activity based on its mutant phenotype of decreased lysine levels and increased aspartate levels. The mutant also has increased levels of threonine. The enzyme is predicted to localize to the chloroplast. |
| AT2G40840 | Encodes a cytosolic protein with transglucosidase and amylomaltase activity. It is an essential component of the pathway from starch to sucrose and cellular metabolism in leaves at night. The protein binds to heteroglycans and utilizes glucose, mannose and xylose as acceptors. Fucose and galactose can also act as acceptors but less efficiently than the previous three. It was also was also recently reported to act on maltodextrins. On the other hand, arabinose and fructose were not efficiently used. Its role probably includes metabolizing maltose exported from the chloroplast. Studies using maltose extracted from the double mutant be2-1 be3-2 showed that this enzyme is preferentially active of β-maltose. The mRNA is cell-to-cell mobile. |
| AT3G22880 | Expression of the AtDMC1 is restricted to pollen mother cells in anthers and to megaspore mother cells in ovules. Similar to meiosis-specific yeast DMC gene. |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT5G58900 | R-R-type MYB protein |
| AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G37590 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT4G38000 | DNA binding with one finger 4.7;(source:Araport11) |
| AT2G17880 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT2G42750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
| AT4G25670 | stress response NST1-like protein;(source:Araport11) |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT1G27461 | Nuclear localized protein involved in osmotic stress tolerance. |
| AT3G60460 | Encodes an R2R3 myb transcription factor that is required for male gamete formation, specifically for entry of the generative cell into mitosis. Specifically expressed in the male germline. |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
| AT1G12610 | Encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in delayed flowering and dwarfism, reduction of gibberellic acid biosynthesis, and increased tolerance to high levels of salt. This gene is expressed in all tissues examined, but most abundantly expressed in upper stems. Overexpression of this gene is also correlated with increased expression of GA biosynthetic genes and RD29A (a cold and drought responsive gene). Under salt stress it induces the expression of GAOX7, which encodes ad C20-GA inhibitor. |
| AT1G60540 | Annotated as pseudogene of the dynamin family.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT2G23990 | early nodulin-like protein 11;(source:Araport11) |
| AT1G76180 | Encodes a dehydrin protein whose expression is induced early on in response to dehydration stress. This gene's expression to cold occurs in two waves, with early induction occurring within 1 h and secondary induction occurring 5 h after the beginning of cold stress. Expression is also induced in response to ABA but not in response to 2,4-D, BA, and GA3. ERD14 protein is capable of binding Ca2+, especially when the protein is phosphorylated. |
| AT1G20450 | Encodes a gene induced by low temperature and dehydration. Inhibits e.coli growth while overexpressed. Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer cold tolerance. Localized to membranes and cytoplasm. |
| AT1G18330 | EARLY-PHYTOCHROME-RESPONSIVE1 |
| AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
| AT5G64720 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT3G63060 | EDL3 is an F-box protein involved that mediated the regulation of abscisic acid signalling. |
| AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
| AT3G18980 | EIN2 targeting protein1;(source:Araport11) |
| AT2G43400 | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. |
| AT3G06470 | ELO family protein containing a characteristic histidine motif which binds to AtCb5-B, interacts with AtBI-1. Together with AtCb5-B interacts with KCR1, PAS2, and CER10, which are essential for the synthesis of VLCFAs. |
| AT1G75000 | ELO family protein. |
| AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
| AT3G63490 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
| AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT2G36640 | Encodes putative phosphotyrosine protein belonging to late embryogenesis abundant (LEA) protein in group 3 that might be involved in maturation and desiccation tolerance of seeds. RFLP and CAPS mapping place it on chromosome 4 but the nucleotide sequence maps it to chromosome 2. |
| AT5G66460 | Encodes a endo-beta-mannanase involved in seed germination and silique dehiscence. |
| AT1G07670 | TPLATE complex protein involved in clathrin-mediated endocytosis. |
| AT4G21600 | Encodes a protein with mismatch-specific endonuclease activity with a preference for T/G, A/G, and G/G of single base mismatches. It also has the ability to cleave indel types of mismatches (heteroduplexes with loops). |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile. |
| AT4G19040 | Encodes a PH and START domain-containing protein that mediates resistance to pathogenic fungi. Resistance requires salicylic acid signalling. Mutants are resistant to E. cichoracearum. Expressed throughout plant tissues and possibly localized to membranes /mitochondrion. |
| AT5G22090 | EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance. |
| AT1G01380 | ETC1 is involved in trichome and root hair patterning in Arabidopsis. |
| AT3G05600 | Encodes a cytosolic epoxide hydrolase capable of acting on 9,10-epoxystearic acid and on 12,13- epoxyoctadec-9-enoic acid that is involved in the synthesis of poly-hydroxylated cutin monomers. |
| AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
| AT2G35700 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Thought to be involved in secondary cell wall metabolism. |
| AT4G29960 | EBS7 encodes a plant specific, endoplasmic reticulum localized protein that is involved in endoplasmic reticulum-associated degradation (ERAD). It interacts with the ERAD component AtHRD1a and may regulate HRD1a stability. Identified in a screen for supressors of a mutation in bri1 that causes bri1 to be retained in the ER. Loss of EBS7 function restores BR sensitivity in the bri1-9 mutant allele. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G47220 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-2). The protein contains one AP2 domain. Functions as activator of GCC box?dependent transcription. Positive regulator of JA-responsive defense genes and resistance to F. oxysporum and enhances JA inhibition of root elongation. |
| AT3G15210 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-4). The protein contains one AP2 domain. Acts as a negative regulator of JA-responsive defense gene expression and resistance to the necrotrophic fungal pathogen Fusarium oxysporum and antagonizes JA inhibition of root elongation. The mRNA is cell-to-cell mobile. |
| AT5G47230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT4G17490 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-6). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. It is involved in the response to reactive oxygen species and light stress. Involved in regulating root architecture and the response to cold stress. |
| AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT2G44940 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G11400 | One of the 2 genes that code for the G subunit of eukaryotic initiation factor 3 (EIF3). The mRNA is cell-to-cell mobile. |
| AT4G33630 | Encodes one of the two plastid proteins EXECUTER (EX1, AT4G33630) and EX2 (AT1G27510). Mediates singlet oxygen induced programmed cell death. |
| AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT5G09440 | EXORDIUM like 4;(source:Araport11) |
| AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G55500 | expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT5G05290 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G39700 | putative expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G61340 | Encodes a F-box protein induced by various biotic or abiotic stress. |
| AT4G05010 | F-box family protein;(source:Araport11) |
| AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT4G12730 | AF333971 Arabidopsis thaliana fasciclin-like arabinogalactan-protein 2 (Fla2) mRNA, complete cds. Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT3G63170 | Encodes a plastid stroma localized fatty acid binding protein involved in fatty acid metabolism. |
| AT5G11460 | FCS like zinc finger 10 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT1G78020 | FCS like zinc finger 6 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT1G10960 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G15140 | FAD/NAD(P)-binding oxidoreductase;(source:Araport11) |
| AT4G04020 | Fibrillin precursor protein. The fibrillin preprotein, but not the mature protein interacts with ABI2. Regulated by abscisic acid response regulators. Involved in abscisic acid-mediated photoprotection. The mRNA is cell-to-cell mobile. |
| AT5G19940 | Enables plants to cope with moderate light stress and affects cadmium tolerance. |
| AT4G00030 | Plastid-lipid associated protein PAP / fibrillin family protein;(source:Araport11) |
| AT1G12200 | Putative flavin monooxygenase. |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
| AT5G10140 | MADS-box protein encoded by FLOWERING LOCUS C - transcription factor that functions as a repressor of floral transition and contributes to temperature compensation of the circadian clock. Expression is downregulated during cold treatment. Vernalization, FRI and the autonomous pathway all influence the state of FLC chromatin. Both maternal and paternal alleles are reset by vernalization, but their earliest activation differs in timing and location. Histone H3 trimethylation at lysine 4 and histone acetylation are associated with active FLC expression, whereas histone deacetylation and histone H3 dimethylation at lysines 9 and 27 are involved in FLC repression. Expression is also repressed by two small RNAs (30- and 24-nt) complementary to the FLC sense strand 3? to the polyA site. The small RNAs are most likely derived from an antisense transcript of FLC. Interacts with SOC1 and FT chromatin in vivo. Member of a protein complex. |
| AT2G41705 | Encodes a fluoride export protein. |
| AT5G43870 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G58160 | Class II formin; modulator of pollen tube elongation. |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
| AT3G59480 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT1G43670 | Encodes a fructose-1,6-bisphosphatase. This enzyme, in addition to catalyzing the formation of fructose-6-phosphate for sucrose biosynthesis, appears to play a role in fructose-mediated signaling that is independent of its enzymatic activity. atcfbp-1/fins1 mutants have reduced photosynthetic rates, elevated levels of starch and reduced levels of sucrose during the day. Although the protein is expected to be cytosolic, a GFP-tagged version localizes to the cytoplasm and the nucleus. The mRNA is cell-to-cell mobile. |
| AT2G21330 | fructose-bisphosphate aldolase 1;(source:Araport11) |
| AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
| AT3G47060 | encodes an FtsH protease that is localized to the chloroplast |
| AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
| AT1G20110 | Encodes a protein that is localized to the peripheral membrane of late endosomal compartments. Involved in the regulation of mulitivesicular/prevacuolar compartment protein sorting. Loss of function mutations are embryo lethal. Regulates IRT1-dependent metal transport and metal homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G01120 | bZIP (basic leucine zipper) transcription factor that binds to the G-box regulatory element found in many plant promoters. GBF2 nuclear localization is increased by blue light |
| AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
| AT5G45580 | GARP-G2-like transcription factor involved in low temperature regulation of flavonoid biosynthesis. |
| AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
| AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G30500 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT1G56600 | GolS2 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS2 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS2 have increased tolerance to salt, chilling, and high-light stress. |
| AT1G09350 | Predicted to encode a galactinol synthase |
| AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G75620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT3G57620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G63510 | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. |
| AT3G48680 | Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex. The mRNA is cell-to-cell mobile. |
| AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
| AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
| AT2G28340 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G45050 | Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT3G59410 | Encodes an eIF2alpha kinase that can bind uncharged tRNA via its C-terminus and can phosphorylate both eIF2alpha homologues in Arabidopsis. |
| AT5G13630 | Encodes magnesium chelatase involved in plastid-to-nucleus signal transduction. |
| AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
| AT1G22770 | Together with CONSTANTS (CO) and FLOWERING LOCUS T (FT), GIGANTEA promotes flowering under long days in a circadian clock-controlled flowering pathway. GI acts earlier than CO and FT in the pathway by increasing CO and FT mRNA abundance. Located in the nucleus. Regulates several developmental processes, including photoperiod-mediated flowering, phytochrome B signaling, circadian clock, carbohydrate metabolism, and cold stress response. The gene's transcription is controlled by the circadian clock and it is post-transcriptionally regulated by light and dark. Forms a complex with FKF1 on the CO promoter to regulate CO expression. The mRNA is cell-to-cell mobile. |
| AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
| AT3G27260 | Kinase like protein with similarity to yeast BDF1 and human RING3 protein, which have two bromodomains GTE8 has a single bromodomain |
| AT5G08000 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and binds callose. |
| AT4G04970 | encodes a gene similar to callose synthase The mRNA is cell-to-cell mobile. |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT4G11600 | Encodes glutathione peroxidase. Exhibits moderate binding affinity with dinotefuran. |
| AT1G63460 | Encodes GPX8 (glutathione peroxidase 8). Involved in the suppression of oxidative damages in nucleus and cytosol. The mRNA is cell-to-cell mobile. |
| AT1G78380 | Encodes a glutathione transferase that is a member of Tau GST gene family. Expression is induced by drought stress, oxidative stress, and high doses of auxin and cytokinin. naming convention according to Wagner et al. (2002) The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G02790 | GST functions in reductive deglutathionylation of glutathione conjugates of quercetin. |
| AT1G79530 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT4G17550 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
| AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
| AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
| AT5G49720 | Encodes a membrane-bound endo-1,4-beta-D-glucanase, involved in cellulose biosynthesis. Loss-of-function mutants have severe cellulose-deficient phenotypes. During cell elongation, KOR1 is associated with Golgi apparatus and early endosome. Inhibition of cellulose biosynthesis promoted a redistribution of KOR1 in subcellular locations. These observations suggest that deposition of cellulose involves the intracellular cycling of KOR1. |
| AT4G24260 | Encodes a protein with similarity to endo-1,4-b-glucanases. KOR3 is induced by nemotodes and is expressed in syncitia induced by Heterodera schachtii.May be involved in the development and function of syncitia. |
| AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT1G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G62220 | Encodes a Golgi apparatus-localized galactosyltransferase involved in galactosyl-substitution of xyloglucan at position 2. |
| AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
| AT1G32900 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
| AT5G52210 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT5G57350 | member of Plasma membrane H+-ATPase family |
| AT2G24520 | plasma membrane H+-ATPase;(source:Araport11) |
| AT4G00150 | Belongs to one of the LOM (LOST MERISTEMS) genes: AT2G45160 (LOM1), AT3G60630 (LOM2) and AT4G00150 (LOM3). LOM1 and LOM2 promote cell differentiation at the periphery of shoot meristems and help to maintain their polar organization. |
| AT4G14830 | 17.6 kDa class II heat shock protein;(source:Araport11) |
| AT4G16660 | heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT3G51910 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
| AT4G21320 | Encodes heat-stress-associated 32-kD protein. Up-regulated by heat shock. Thermotolerance in a knockout mutant was compromised following a long recovery period (> 24 h) after acclimation heat shock treatment. |
| AT1G56210 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G02960 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G39700 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G24150 | heptahelical transmembrane protein HHP3 |
| AT5G62940 | HCA2 induces the formation of interfascicular cambium and regulates vascular tissue development in the aerial parts of the plant. Evidence from both gain of function and dominant negative alleles. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
| AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
| AT5G36170 | Required for normal processing of polycistronic plastidial transcripts |
| AT1G48620 | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
| AT1G20696 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT5G10720 | member of Histidine Kinase |
| AT3G27360 | Histone superfamily protein;(source:Araport11) |
| AT5G10980 | Histone superfamily protein;(source:Araport11) |
| AT5G09740 | Encodes an enzyme with histone acetyltransferase activity. HAM2 primarily acetylate histone H4, but also display some ability to acetylate H3. Prior acetylation of lysine 5 on histone H4 reduces radioactive acetylation by either HAM2. |
| AT2G18050 | encodes a structurally divergent linker histone whose gene expression is induced by dehydration and ABA. The mRNA is cell-to-cell mobile. |
| AT1G55250 | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT5G06710 | Homeobox-leucine zipper protein. |
| AT2G18550 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G24660 | homeobox protein 22;(source:Araport11) |
| AT2G18350 | homeobox protein 24;(source:Araport11) |
| AT3G50890 | homeobox protein 28;(source:Araport11) |
| AT4G36740 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
| AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
| AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
| AT3G03260 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
| AT3G44530 | Encodes a nuclear localized WD-repeat containing protein involved in negative regulation of knox gene expression via epigenetic mechanism of chromatin re-organization. It is a part of the HISTONE REGULATOR complex that deposits histones in a DNA synthesis-independent manner and affects both nucleosome occupancy and the maintenance of transcriptional silencing. Interacts physically and genetically with AS1. Expressed in meristem and leaf primordia. Homozygous mutants are embryo lethal. Phenotype of cosuppressed lines is variable but show effects on leaf development similar to as1/as2. |
| AT2G22450 | riboflavin biosynthesis protein;(source:Araport11) |
| AT2G23670 | homolog of Synechocystis YCF37;(source:Araport11) |
| AT3G54710 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. |
| AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
| AT4G13940 | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile. |
| AT4G31750 | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
| AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
| AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
| AT1G68010 | Encodes hydroxypyruvate reductase. |
| AT1G72770 | mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. The mRNA is cell-to-cell mobile. |
| AT1G67700 | multidrug resistance protein;(source:Araport11) |
| AT3G10020 | plant/protein;(source:Araport11) |
| AT4G24110 | NADP-specific glutamate dehydrogenase;(source:Araport11) |
| AT5G27760 | Hypoxia-responsive family protein;(source:Araport11) |
| AT3G18485 | Encodes a novel protein with no predicted membrane-spanning domains that is polymorphic among Arabidopsis accessions. The protein may modulate a metal transporter. Mutants are resistant to IAA-Leu, IAA-Phe, and the divalent metals cobalt and manganese but remain sensitive to free IAA; they are defective in lateral root formation and primary root elongation. |
| AT1G17210 | IAP-like protein 1;(source:Araport11) |
| AT2G32320 | Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C). |
| AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
| AT3G07610 | IBM1 likely encodes a protein with histone H3mK9 demethylation activity. It may preferentially demethylate H3mK9 at low-copy loci to protect them from silencing by nearby heterochromatin by preventing the spread of cytosine methylation. BONSAI (At1g73177) is hypermethylated in ibm1 mutants. ibm1 mutants have morphological defects that become apparent at the F3 generation, including small narrow leaves, arrested flower development, and faulty pollen development. These phenotypes cannot result solely from the BONSAI hypermethylation. Aberrant phenotypes in ibm1 mutants in both DNA methylation and plant development can be suppressed by mutations in the KYP H3K9 methyltransferase or the CMT3 non CG-cytosine methylase. |
| AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
| AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
| AT2G46990 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA20 lacks the conserved degron (domain II) found in many family members, and IAA20 fusion proteins are stable in Arabidopsis seedlings. IAA20 transcripts are induced by auxin treatment, and overexpression of IAA20 leads to defects in gravitropism, root development, root meristem maintenance, etiolation, and cotyledon vascular development. |
| AT2G04550 | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1. |
| AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
| AT2G01900 | Encodes an inositol polyphosphate phosphatidylinositol 5-phosphatase that is expressed in roots and is involved in mediating salt tolerance through endocytosis. |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G01110 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G23060 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT3G22190 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
| AT1G27600 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT5G19040 | Encodes cytokinin synthase. |
| AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
| AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
| AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT5G51710 | member of Putative potassium proton antiporter family |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G44730 | kinesin-like protein 1;(source:Araport11) |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT1G18140 | putative laccase, a member of laccase family of genes (with 17 members in Arabidopsis). |
| AT5G01040 | putative laccase, knockout mutant showed early flowering |
| AT3G19260 | LAG1 homolog. Loss of function mutant is sensitive to AAL-toxin. LOH2 is presumed to function in sphingolipid metabolism. It encodes a ceramide synthase essential for production of LCFA-ceramides (mainly C16). Uses palmitoyl-CoA and dihydroxy LCB substrates. |
| AT2G03740 | Late embryogenesis abundant protein. Associates with and stabilizes membranes as part of cryoprotective response. |
| AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
| AT1G32560 | Encodes LEA4-1, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. |
| AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
| AT1G52690 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT5G63090 | Involved in lateral organ development |
| AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
| AT2G47780 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
| AT4G15470 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT2G40100 | Lhcb4:3 protein (Lhcb4.3, light harvesting complex of photosystem II The mRNA is cell-to-cell mobile. |
| AT1G15820 | Lhcb6 protein (Lhcb6), light harvesting complex of photosystem II. |
| AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT3G47470 | Encodes a chlorophyll a/b-binding protein that is more similar to the PSI Cab proteins than the PSII cab proteins. The predicted protein is about 20 amino acids shorter than most known Cab proteins. |
| AT1G76570 | Chlorophyll A-B binding family protein;(source:Araport11) |
| AT1G43130 | like COV 2;(source:Araport11) |
| AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
| AT2G38540 | Non-specific lipid transfer protein. Binds calmodulin in a Ca2+-independent manner. Localized to the cell wall. Specifically expressed in L1 epidermal layer. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. The mRNA is cell-to-cell mobile. |
| AT5G59320 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. The mRNA is cell-to-cell mobile. |
| AT2G24260 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT4G30980 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT1G31320 | LOB domain-containing protein 4;(source:Araport11) |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT1G68510 | LOB domain protein. |
| AT5G47040 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT5G06300 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G50150 | LOTR1 protein has an unknown function. It contains both DUF4409 and DUF239 domains. Loss of function mutations show defects in formation of the Casparian band- which is correlated with mis localization of CASP1. |
| AT4G36910 | Encodes a single cystathionine beta-synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
| AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT5G63190 | Encodes a member of the MRF (MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR) gene family under TOR control that is transcriptionally induced by dark and starvation. MRF1 can be phosphorylated in vitro by S6K1 and S6K2. |
| AT3G48390 | MA3 domain-containing protein;(source:Araport11) |
| AT5G65060 | MADS domain protein - flowering regulator that is closely related to FLC |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT4G20900 | Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein. |
| AT2G18170 | MAP kinase 7;(source:Araport11) |
| AT1G32320 | member of MAP Kinase Kinase |
| AT3G02570 | Encodes a protein with phosphomannose isomerase activity. |
| AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G19350 | Encodes a the C-terminal domain of poly(A) binding proteins. MPC is imprinted such that only the maternal allele is expressed in the endosperm. MPC is silenced by the action of MET1 and its expression is promoted by DEM. |
| AT4G34830 | Encodes MRL1, a conserved pentatricopeptide repeat protein, required for stabilization of rbcL mRNA. |
| AT1G26665 | Mediator complex, subunit Med10;(source:Araport11) |
| AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT1G79340 | Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. The mRNA is cell-to-cell mobile. |
| AT1G53670 | 1-Cys methionine sulfoxide reductase. |
| AT2G23590 | Encodes a protein shown to have carboxylesterase activity in vitro. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
| AT1G01183 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC. Accumulation of the pri-miRNA165a transcript is increased by the activity of the miPEP165 peptide which is encoded within the pri-miRNA165a transcript. |
| AT4G21595 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAGCCAAGGAUGACUUGCCG |
| AT5G04275 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AGAAUCUUGAUGAUGCUGCAU. Pri-mRNA coordinates for MIR172b (converted to TAIR10 based on PMID19304749): Chr5: 1188916-1187500 (reverse), length: 1417 bp; exon coordinates: exon 1: 1188916 to 1188742, exon 2: 1188623 to 1188583, exon 3: 1188383 to 1188133, exon 4: 1187852 to 1187500; mature miRNA and miRNA* are located on exon 3. |
| AT5G41663 | Encodes a microRNA that targets several TCP family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGGACUGAAGGGAGCUCCCU. Pri-mRNA coordinates for MIR319b (converted to TAIR10 based on PMID19304749): Chr5: 16660967-16660095 (reverse), length: 873 bp; exon coordinates: exon 1: 16660967 to 16660095; mature miRNA and miRNA* are located on exon 1. |
| AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
| AT1G70645 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UACGCAUUGAGUUUCGUUGCU |
| AT1G61224 | Encodes a microRNA that targets several Jacalin lectin family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCAUGGUCAGAUCCGUCAUCC |
| AT4G21362 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAACAUGGUUUAUUAGGAA |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT4G35920 | Encodes an integral plasma membrane protein. Functionally complements the yeast mid1 mutant, a deficiency of Ca2+ influx. Involved in Ca2+ influx and mechanical sensing in roots. An over-expression line showed increased Ca2+ uptake than the wild type plant. The primary root of a knock-out mutant failed to penetrate a harder agar medium from a softer medium. |
| AT2G04540 | Encodes a mitochondrial beta-ketoacyl-ACP synthase. |
| AT5G09590 | heat shock protein 70 (Hsc70-5); nuclear |
| AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT5G55090 | member of MEKK subfamily |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT5G66850 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
| AT5G49880 | Encodes a spindle assembly checkpoint protein MAD1. The mRNA is cell-to-cell mobile. |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT2G42620 | The mutations at MAX2 cause increased hypocotyl and petiole elongation in light-grown seedlings. Positional cloning identifies MAX2 as a member of the F-box leucine-rich repeat family of proteins. MAX2 is identical to ORE9, a proposed regulator of leaf senescence. Involved in positive regulation of light responses. The mRNA is cell-to-cell mobile. |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT2G03720 | Involved in root hair development |
| AT2G16640 | multimeric translocon complex in the outer envelope membrane 132;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT5G17980 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G16505 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT1G69560 | Encodes LOF2 (LATERAL ORGAN FUSION2), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF1 (At1g26780). |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
| AT3G62610 | Member of the R2R3 factor gene family. Together with MYB12 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT1G25340 | putative transcription factor (MYB116) |
| AT1G26780 | Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560). |
| AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT3G24310 | snapdragon myb protein 305 homolog (myb) |
| AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT3G50060 | Encodes a member of the R2R3 transcription factor gene family. Expressed in response to potassium deprivation and auxin. Involved in lateral root development. Interacts with ARF7 and regulates the expression of some auxin responsive genes. |
| AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT3G47600 | Encodes a putative transcription factor (MYB94). |
| AT5G62320 | Encodes a putative transcription factor (MYB99). |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
| AT2G22240 | ** Referred to as MIPS1 in Mitsuhashi et al 2008. Myo-inositol-1-phosphate synthase isoform 2. Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
| AT5G55470 | member of Sodium proton exchanger family |
| AT2G46770 | NAC transcription factor NST1. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls and siliques. An NST1 promoter fusion was detected in various tissues in which lignified secondary walls develop. Both MYC2 and MYC4 bind to the NST1 promoter and appear to regulate its expression in response to blue light. |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
| AT3G04060 | NAC046 is a member of the NAC domain containing family of transcription factors. It was identified in a screen for regulators of chlorophyll protein gene expression. Mutants in NAC046 have delayed senescence and increased CHL content suggesting a role in regulation of senescence and chlorophyll degradation. |
| AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
| AT4G01550 | Encodes a plasma-membrane bound NAC transcription factor, whose controlled proteolytic activation allows it to enter the nucleus. |
| AT5G07680 | NAC domain containing protein 80;(source:Araport11) |
| AT5G22290 | Encodes ANAC089, a membrane-tethered transcription factor that negatively regulates floral initiation. Also controls ER-stress-induced programmed cell death. |
| AT3G61910 | NAC transcription factor NST2. NST1 and NST2 are redundant in regulating secondary wall thickening in anther walls. NST2 promoter was particularly strong in anther tissue. |
| AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
| AT4G21490 | NAD(P)H dehydrogenase B3;(source:Araport11) |
| AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
| AT1G74880 | Encodes subunit NDH-O of NAD(P)H:plastoquinone dehydrogenase complex (Ndh complex) present in the thylakoid membrane of chloroplasts. This subunit is thought to be required for Ndh complex assembly. |
| AT5G67440 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT1G03470 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the nuclear membrane and the vacuolar membrane. |
| AT3G61970 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G64170 | LNK1 is a member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex.Functions as a transcriptional coactivator. |
| AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
| AT3G25882 | encodes a kinase that physically interacts with NPR1/NIM1 |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G08100 | Encodes a high-affinity nitrate transporter. |
| AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
| AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile. |
| AT1G52880 | Transcription factor with a NAC domain. Homologous to the petunia gene NAM which is required for the development of the shoot. Expressed in the embryo. |
| AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
| AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT4G22920 | Similar to the tomato senescence-inducible chloroplast stay-green protein 1. It is upregulated during maximal senescence in the Arabidopsis life cycle, especially in senescent leaves. Acts antagonistically with SGR2 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT1G64280 | This gene is a key regulator of the salicylic acid (SA)-mediated systemic acquired resistance (SAR) pathway. It is similar to the transcription factor inhibitor I kappa B, and contains ankyrin repeats. It confers resistance to the pathogens Pseudomonas syringae and Peronospora parasitica in a dosage-dependent fashion. Although transgenic Arabidopsis plants overexpressing NPR1 acquire enhanced sensitivity to SA and (benzothiadiazole) BTH, they display no obvious detrimental morphological changes and do not have elevated pathogenesis-related gene expression until activated by inducers or pathogens. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G27300 | NTL8 is a membrane-associated NAC transcription factor that binds both TRY and TCL1. Overexpression results in fewer trichomes. |
| AT2G20470 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G30640 | Protein kinase family protein;(source:Araport11) |
| AT5G12840 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
| AT1G72830 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT2G37060 | nuclear factor Y, subunit B8;(source:Araport11) |
| AT1G56170 | Encodes a protein with similarity to a subunit of the CCAAT promoter motif binding complex of yeast.One of two members of this class (HAP5B) and expressed in vegetative and reproductive tissues. Involved in the regulation of response to nutrient levels. |
| AT1G08970 | Encodes a NUCLEAR FACTOR-Y C (NF-YC) homologue NF-YC9. NF-YC3., NF-YC4 and NF-YC9 redundantly modulate GA- and ABA-mediated seed germination. |
| AT1G79150 | binding protein;(source:Araport11) |
| AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
| AT5G47240 | nudix hydrolase homolog 8;(source:Araport11) |
| AT5G04900 | Encodes a chlorophyll b reducatase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT3G50410 | Arabidopsis Dof protein containing a single 51-amino acid zinc finger DNA-binding domain, which may play an important roles in plant growth and development. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT3G55370 | Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots. |
| AT4G16370 | Encodes a phloem-specific iron transporter that is essential for systemic iron signaling and redistribution of iron and cadmium. It loads iron into the phloem, facilitates iron recirculation from the xylem to the phloem, and regulates both shoot-to-root iron signaling and iron redistribution from mature to developing tissues. |
| AT5G02120 | Encodes a one helix protein homologous to cyanobacterial high-light inducible proteins. The protein is localized to the thylakoid membrane and its transcript is transiently induced by exposure to high light conditions. The mRNA is cell-to-cell mobile. |
| AT5G44785 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
| AT2G29760 | Encodes a chloroplast RNA editing factor. |
| AT4G08180 | OSBP(oxysterol binding protein)-related protein 1C;(source:Araport11) |
| AT5G57240 | OSBP(oxysterol binding protein)-related protein 4C;(source:Araport11) |
| AT2G27350 | Encodes an otubain-like histone deubiquitinase involved in chromatin modification and regulation of plant gene expression. |
| AT1G05420 | ovate family protein 12;(source:Araport11) |
| AT3G52525 | ovate family protein 6;(source:Araport11) |
| AT2G41900 | AtOXS2 specifcally entered the nuclear under salt stress. Te specifc nuclear localization of AtOXS2 could play a role in salt tolerance at the molecular level. Tese results implied that AtOXS2 might target some downstream cis-elements which are required for salt stress responses |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT2G02710 | Encodes a putative blue light receptor protein. |
| AT2G39220 | Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus. |
| AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
| AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
| AT1G61590 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G28690 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT1G04980 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT4G14713 | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter. |
| AT4G14720 | PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
| AT2G47670 | PMEI6 pectin methylesterase inhibitor functions in establishing a patter of homogalacturonan methylesterification of seed coat cell wall proteins . |
| AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
| AT5G04960 | Encodes a protein that modulates the activity of pectin methylesterase within the cell wall. |
| AT4G27650 | Encodes Arabidopsis homolog of Drosophila pelota protein. Functions in RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT3G21865 | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. |
| AT3G04460 | RING finger protein involved in peroxisome biogenesis. Also involved in peroxisomal import of nitric oxide synthase. Has been demonstrated to have E3 ubiquitin ligase activity. |
| AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
| AT5G02460 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT3G61060 | phloem protein 2-A13;(source:Araport11) |
| AT5G52120 | phloem protein 2-A14;(source:Araport11) |
| AT3G53000 | phloem protein 2-A15;(source:Araport11) |
| AT1G09155 | phloem protein 2-B15;(source:Araport11) |
| AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT1G20860 | Encodes Pht1;8, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT3G58830 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase that localizes to chloroplasts in above ground plant parts and mitochondria in root tips and root hairs and is involved in the synthesis of plastidial Phosphatidylglycerol (PG). This enzyme is responsible for the second step of PG synthesis. Mutants show reduced root growth. |
| AT1G03050 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. The mRNA is cell-to-cell mobile. |
| AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
| AT2G46500 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. Phosphorylates PUFD1 and RPN10 in vitro. |
| AT2G03890 | Phosphoinositide kinase which undergo autophosphorylation and phosphorylate serine/threonine residues of protein substrates. Contains phosphoinositide 3/4-kinase and ubiquitin-like domains. The mRNA is cell-to-cell mobile. |
| AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT3G13670 | MUT9-like protein kinase. Contributes to phosphorylation of photoexcited CRY2. Interaction with CRY2 occurs via the non catalytic PPKC domain.MLK4 phosphorylates the conserved H2A serine 95 residue. Synthetic mutants that cannot phosphorylate H2AS95 fail to complement the late flowering phenotype suggesting that MLK4 promotes long day flowering via phosphorylation.MLK4 is required for H2A295 phosphorylation of GI. |
| AT1G68650 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT3G54890 | Encodes a component of the light harvesting complex associated with photosystem I. |
| AT1G61520 | PSI type III chlorophyll a/b-binding protein (Lhca3*1) The mRNA is cell-to-cell mobile. |
| AT1G45474 | Encodes a component of the light harvesting complex of photosystem I. |
| AT1G19150 | PSI type II chlorophyll a/b-binding protein (Lhca2*1) mRNA, The mRNA is cell-to-cell mobile. |
| AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT1G52230 | Phosphorylation of this protein is dependent on calcium. The mRNA is cell-to-cell mobile. |
| AT1G08380 | Encodes subunit O of photosystem I. |
| AT3G27690 | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. The mRNA is cell-to-cell mobile. |
| AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
| AT2G30570 | Encodes PsbW, a protein similar to photosystem II reaction center subunit W. Loss of PsbW destabilizes the supramolecular organization of PSII. |
| AT1G06680 | Encodes a 23 kD extrinsic protein that is part of photosystem II and participates in the regulation of oxygen evolution. Phosphorylation of this protein is dependent on calcium. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the stroma. The mRNA is cell-to-cell mobile. |
| AT4G21280 | Encodes the PsbQ subunit of the oxygen evolving complex of photosystem II. |
| AT1G79040 | Encodes for the 10 kDa PsbR subunit of photosystem II (PSII). This subunit appears to be involved in the stable assembly of PSII, particularly that of the oxygen-evolving complex subunit PsbP. Mutants defective in this gene have reduced amounts of subunits PsbP and PsbQ in PSII. In turn, assembly of PsbR is dependent on the presence of PsbJ. |
| AT3G21055 | Encodes photosystem II 5 kD protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which also has a plastid-encoded paralog (PsbTc). |
| AT1G62390 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G20360 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT2G42870 | Encodes PHYTOCHROME RAPIDLY REGULATED1 (PAR1), an atypical basic helix-loop-helix (bHLP) protein. Closely related to PAR2 (At3g58850). Up regulated after simulated shade perception. Acts in the nucleus to control plant development and as a negative regulator of shade avoidance response. Functions as transcriptional repressor of auxin-responsive genes SAUR15 (AT4G38850) and SAUR68 (AT1G29510). |
| AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G06570 | Mutation of the PDS1 locus disrupts the activity of p-hydroxyphenylpyruvate dioxygenase (HPPDase), the first committed step in the synthesis of both plastoquinone and tocopherols in plants. |
| AT1G73590 | Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins. |
| AT2G01420 | Encodes a putative auxin efflux carrier that is localized in developing and mature root meristems. It is involved in the maintenance of embryonic auxin gradients. A role for AtPIN4 in generating a sink for auxin below the quiescent center of the root meristem that is essential for auxin distribution and patterning is proposed. In the root, PIN4 is detected around the quiescent center and cells surrounding it, and localizes basally in provascular cells. PIN4 expression is upregulated in brassinosteroid-insensitive mutant (PMID 16141452). |
| AT2G26700 | Member of AGC VIIIa Kinase gene family. Encodes PID2, a homolog of PID. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G32100 | Encodes a pinoresinol reductase involved in lignan biosynthesis. Expressed strongly in roots and less strongly in stems. Shows specificity for pinoresinol and not lariciresinol. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT5G20240 | Floral homeotic gene encoding a MADS domain transcription factor. Required for the specification of petal and stamen identities. |
| AT3G02800 | Encodes an atypical dual-specificity phosphatase. |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT1G08990 | plant glycogenin-like starch initiation protein 5;(source:Araport11) |
| AT4G16600 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
| AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
| AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT2G40120 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
| AT1G10522 | Encodes PRIN2 (plastid redox insensitive 2). PRIN2 mutants are impaired in PEP (plastid-encoded RNA polymerase) activity and high light-dependent plastid redox signalling to the nucleus. |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G09210 | plastid transcriptionally active 13;(source:Araport11) |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT1G67960 | POD1 is involved in pollen tube guidence and early embryo patterning. |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT5G51120 | Encodes a homolog of the protein PABN1, a polyadenylation factor subunit. |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT1G48100 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT4G05320 | One of five polyubiquitin genes in A. thaliana. These genes encode the highly conserved 76-amino acid protein ubiquitin that is covalently attached to substrate proteins targeting most for degradation. Polyubiquitin genes are characterized by the presence of tandem repeats of the 228 bp that encode a ubiquitin monomer. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
| AT1G04690 | potassium channel beta subunit 1;(source:Araport11) |
| AT4G18290 | Encodes KAT2, a member of the Shaker family potassium ion (K+) channel. Critical to stomatal opening induced by blue light. Critical to circadian rhythm of stomatal opening. Involved in plant development in response to high light intensity. Under high light intensity, the mutant plant produced less biomass compared to the wild type. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT5G51700 | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
| AT1G44910 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
| AT3G19670 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. Ubiquitously expressed and localize to the nucleus. |
| AT3G11397 | prenylated RAB acceptor 1.A3;(source:Araport11) |
| AT3G19170 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers |
| AT2G19770 | Encodes profilin 5, originally named profilin 4 (PRO4/PFN4). Low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Pollen-specific plant profilin present predominantly in mature pollen and growing pollen tubes. |
| AT5G14300 | prohibitin 5;(source:Araport11) |
| AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT5G04270 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G55480 | Encodes a member of a novel plant protein family containing a PDZ, a K-box, and a TPR motif. mRNA but not protein levels decrease after wounding. ZKT is phosphorylated at Thr and Ser residues after wounding. The mRNA is cell-to-cell mobile. |
| AT2G33700 | Encodes a putative protein phosphatase 2C that positively regulates salt tolerance in abscisic acid-dependent manner. |
| AT5G50240 | L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced. |
| AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT5G66570 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO1 is the major isoform in the wild-type. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. The mRNA is cell-to-cell mobile. |
| AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT5G60100 | Encodes pseudo-response regulator 3 (APRR3/PRR3). PRR3 transcript levels vary in a circadian pattern with peak expression at dusk under long and short day conditions. PRR3 affects the period of the circadian clock and seedlings with reduced levels of PRR3 have shorter periods, based on transcriptional assays of clock-regulated genes. PRR3 is expressed in the vasculature of cotyledons and leaves where it may help stabilize the TOC1 protein by preventing interactions between TOC1 and the F-box protein ZTL. |
| AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
| AT2G46790 | Pseudo-response regulator PRR9. Involved in clock function. PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR9. Interact with TOC1 in a yeast two-hybrid assay. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR7 to regulate hypocotyl growth under photoperiodic conditions. |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT3G50110 | Encodes a phosphatase with low in vitro tyrosine phosphatase activity that is NOT capable of dephosphorylating in vitro the 3'phosphate group of PI3P, PI(3,4)P2. |
| AT1G21620 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G30840 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT5G02950 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT2G38310 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. The mRNA is cell-to-cell mobile. |
| AT2G40330 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
| AT5G54960 | pyruvate decarboxylase-2 |
| AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile. |
| AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
| AT5G47200 | AtRabD2b encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. The mRNA is cell-to-cell mobile. |
| AT5G65270 | RAB GTPase homolog A4A;(source:Araport11) |
| AT3G02540 | Encodes a member of the RADIATION SENSITIVE23 (RAD23) family: AT1G16190(RAD23A), AT1G79650(RAD23B), AT3G02540(RAD23C), AT5G38470(RAD23D). RAD23 proteins play an essential role in the cell cycle, morphology, and fertility of plants through their delivery of UPS (ubiquitin/26S proteasome system) substrates to the 26S proteasome. |
| AT3G26000 | RIPF1 is an F-Box E3 ligase that interacts with the ABA receptor RCAR3 and appears to be responsible for facilitating its turnover. |
| AT5G48330 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT1G07390 | receptor like protein 1;(source:Araport11) |
| AT1G74200 | receptor like protein 16;(source:Araport11) |
| AT5G49290 | receptor like protein 56;(source:Araport11) |
| AT5G67280 | receptor-like kinase;(source:Araport11) |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT1G15290 | Encodes REDUCED CHLOROPLAST COVERAGE 3 (REC3). Contributes to establishing the size of the chloroplast compartment. |
| AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
| AT4G38630 | Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
| AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
| AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
| AT2G45820 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. |
| AT3G57540 | Remorin family protein;(source:Araport11) |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT1G74810 | HCO3- transporter family;(source:Araport11) |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
| AT1G03120 | responsive to abscisic acid 28;(source:Araport11) |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT2G33380 | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxy-octadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. |
| AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile. |
| AT3G56140 | DUF399 family protein, putative (DUF399 and DUF3411);(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT5G17300 | Myb-like transcription factor that regulates hypocotyl growth by regulating free auxin levels in a time-of-day specific manner. |
| AT5G37260 | Encodes a MYB family transcription factor Circadian 1 (CIR1). Involved in circadian regulation in Arabidopsis. |
| AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
| AT1G66350 | Negative regulator of GA responses, member of GRAS family of transcription factors. Also belongs to the DELLA proteins that restrain the cell proliferation and expansion that drives plant growth. RGL1 may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Rapidly degraded in response to GA. Involved in flower and fruit development. |
| AT5G40950 | ribosomal protein large subunit 27;(source:Araport11) |
| AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
| AT3G56580 | Encodes a functional E3 ubiquitin ligase involved in the dehydration stress response and regulation of proline biosynthesis. |
| AT5G22920 | Encodes a protein with sequence similarity to RING, zinc finger proteins. Loss of function mutations show reduced (15%) stomatal aperture under non stress conditions. |
| AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
| AT2G40830 | Encodes an E3 ubiquitin ligase for the GA-receptor GID1 that functions as a negative regulator of GA signaling in seedlings and seeds by inducing ubiquitin-dependent proteolysis of GID1s. Tyr321 phosphorylation of GARU by TAGK2 inactivates GARU. |
| AT3G11770 | RICE1 is a 23kDa protein with 3?- 5? exoribonuclease activity. It is expressed ubiquitously and localized to the cytoplasm. When RICE1 and its paralog RICE2 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage. |
| AT5G65900 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G55150 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT3G54760 | RRM1 interacts with SUVH9 and FVE and has an auxiliary role in RNA-directed DNA methylation. |
| AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
| AT1G64440 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Mutants in RHD1 have abnormally shaped root hairs with a bulbous region at the base. Allelic to REB1 encoding a UDP-D-glucose 4-epimerase involved in cell wall biosynthesis.Involved in growth and cell wall carbohydrate biosynthesis. |
| AT4G22080 | root hair specific 14;(source:Araport11) |
| AT4G16515 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G24580 | Encodes a Rho GTPase-activating protein that interacts with ROP1 (a Rho GTPase) and regulates pollen tube development. This protein can be observed at the apical tip of growing pollen tubes and on endocytic vesicles traveling to this region of the pollen tube. |
| AT1G13245 | ROTUNDIFOLIA like 17;(source:Araport11) |
| AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT5G15950 | Adenosylmethionine decarboxylase family protein;(source:Araport11) |
| AT3G23700 | Encodes a chloroplast-localized S1 domain-containing protein with RNA chaperone activity that affects the splicing and processing of chloroplast transcripts and plays a role in seedling growth in the presence of ABA. Binds the chloroplast psbA RNA and some other chloroplast RNAs. Required for the stability of the chloroplast ndhC RNA. Inhibits ribosome association with psbA RNA and ycf1 RNA. Not required for the splicing of chloroplast trnL, as had been reported previously. |
| AT3G51830 | putative transmembrane protein G5p (AtG5) mRNA, complete. autophagy-related (ATG) gene |
| AT2G37050 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G75060 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT5G52510 | SCARECROW-like 8;(source:Araport11) |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT4G36490 | SEC14-like 12;(source:Araport11) |
| AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
| AT1G11890 | Member of SEC22 Gene Family; regulates cell morphogenesis via affecting cytoskeleton organization and stabilities. |
| AT1G09180 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. |
| AT3G55800 | Encodes the chloroplast enzyme sedoheptulose-1,7-bisphosphatase (SBPase), involved in the carbon reduction of the Calvin cycle. Increase in SBPase activity in transgenic lines accumulate up to 50% more sucrose and starch than wild-type. The mRNA is cell-to-cell mobile. |
| AT5G07190 | Gene is expressed preferentially in the embryo and encodes a unique protein of unknown function. |
| AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
| AT3G57520 | SIP2 encodes a raffinose-specific alpha-galactosidase that catalyzes the breakdown of raffinose into alpha-galatose and sucrose. This enzyme may function in unloading raffinose from the phloem as part of sink metabolism. Although it was originally predicted to act as a raffinose synthase (RS), that activity was not observed for recombinant SIP2. |
| AT5G16460 | Membrane protein involved in lipid droplet biogenesis primarily in embryos. |
| AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
| AT5G13170 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT3G02040 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. The mRNA is cell-to-cell mobile. |
| AT1G24260 | Member of the MADs box transcription factor family. SEP3 is redundant with SEP1 and 2. Flowers of SEP1/2/3 triple mutants show a conversion of petals and stamens to sepals.SEP3 forms heterotetrameric complexes with other MADS box family members and binds to the CArG box motif. |
| AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
| AT3G10410 | SERINE CARBOXYPEPTIDASE-LIKE 49;(source:Araport11) |
| AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT2G17700 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT2G05900 | Predicted to encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. |
| AT3G61740 | Encodes SET domain containing protein that acts redundantly with ATX4/5 to regulate histone H3-K4 methylation. Involved in bolting/flowering time together with ATX1 and ATX4. |
| AT5G62090 | Encodes a protein that functions with LUH to promote Al binding to the root cell wall. |
| AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
| AT4G24190 | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
| AT2G18120 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
| AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
| AT2G41312 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
| AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G51680 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. |
| AT2G45950 | SKP1-like 20;(source:Araport11) |
| AT3G61415 | SKP1-like 21;(source:Araport11) |
| AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
| AT5G67250 | Encodes an SKP1 interacting partner (SKIP2).Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,2, and 3. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
| AT3G51200 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G61900 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G10990 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT1G62750 | Nuclear encoded protein consists of the five domains conserved in EF-G proteins, with two GTP-binding sites in the first domain, and an additional transit peptide at the N-terminus. Localized in chloroplasts. Point mutation results in a delay in the onset of germination. At early developmental stage embryos still contain undifferentiated proplastids. The greening of cotyledons is severely impaired in light-grown mutant sco1 seedlings, whereas the following true leaves develop normally as in wild-type plants. |
| AT3G05030 | Encodes a vacuolar K+/H+ exchanger essential for active K+ uptake at the tonoplast and involved in regulating stomatal closure. |
| AT1G03790 | Encodes SOMNUS (SOM), a nucleus-localized CCCH-type zinc finger protein. SOM negatively regulates light-dependent seed germination downstream of PIL5 (AT2G20180). |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
| AT4G27330 | Encodes a putative transcription factor that is required for the initiation of both micro- and megagametogenesis and is expressed in the sporogenous tissue of the anther and the ovule. SPL is a chalaza identity gene that share overlapping functions in establishing the prospective chalaza of the ovule. It also plays a central role in patterning both the proximal-distal and the adaxial-abaxial axes in the ovule and generally interacts with YABBY proteins in vitro. Mutant is defective in the differentiation of primary sporogenous cells into microsporocytes, and does not properly form the anther wall. Regulator of anther cell differenctiation. Interacts with TPL and TCP proteins. |
| AT5G24160 | squalene monooxygenase 6;(source:Araport11) |
| AT5G18830 | Encodes a member of the Squamosa Binding Protein family of transcriptional regulators. SPL7 is expressed highly in roots and appears to play a role in copper homeostasis. Mutants are hypersensitive to copper deficient conditions and display a retarded growth phenotype. SPL7 binds to the promoter of the copper responsive miRNAs miR398b and miR389c. |
| AT5G24300 | SSI is a plastidial enzyme and crucial for the synthesis of normal amylopectin in the leaves of Arabidopsis. The absence of SSI results in a deficiency in the number of shorter glucans which in turn affect the formation and connection of the amylopectin clusters in starch. |
| AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
| AT1G44000 | STAY-GREEN-like protein;(source:Araport11) |
| AT5G35770 | A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. |
| AT3G02580 | Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf phenotype. |
| AT4G22756 | Encodes a member of the SMO1 family of sterol 4alpha-methyl oxidases. More specifically functions as a 4,4-dimethyl-9beta,19-cyclopropylsterol-4alpha-methyl oxidase. Works together with SMO1-1 to maintain correct sterol composition and balance auxin and cytokinin activities during embryogenesis. |
| AT4G30620 | Homolog of STIC2, recent duplication. |
| AT5G65590 | Encodes a plant-specific Dof-type transcription factor expressed in maturing guard cells, but not in guard mother cells. It regulates essential processes of stomatal guard cell maturation and functions as a key transcription factor regulating the final stages of guard cell differentiation. |
| AT2G25110 | Encodes an endoplasmic reticulum protein SDF2 (stromal-derived factor-2). Forms a complex SDF2-ERdj3B-BiP that is required for the proper accumulation of the surface-exposed leucine-rich repeat receptor kinases EFR. EFR is involved in PAMP (pathogen associated molecular patterns) triggered immunity. |
| AT5G06820 | STRUBBELIG-receptor family 2;(source:Araport11) |
| AT3G51060 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC) |
| AT5G59120 | SBT4.13 subtilase. Activity is inhibited by SPI-1. |
| AT5G65165 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds, and markedly decline during germination. |
| AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
| AT2G02860 | encodes a sucrose transporter in sieve elements and a number of sink tissues and cell types. Gene expression is induced by wounding. |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
| AT5G07010 | Encodes a sulfotransferase that acts specifically on 11- and 12-hydroxyjasmonic acid. Transcript levels for this enzyme are increased by treatments with jasmonic acid (JA), 12-hydroxyJA, JA-isoleucine, and 12-oxyphytodienoic acid (a JA precursor). |
| AT1G04770 | SDI2 is a member of a small family of TPR proteins in Arabidopsis. Like SDI1 it is induced by low sulfer and appears to play a role in negative regulation of glucosinolate biosynthesis. |
| AT1G67810 | Encodes a protein capable of stimulating the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. SufE2:GFP localizes to the chloroplasts where it is likely to play a role in iron-sulfur cluster assembly. Transcript levels for this gene are high in the pollen relative to other organs based on RT-PCR analysis. The mRNA is cell-to-cell mobile. |
| AT3G14205 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT3G60400 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
| AT2G45070 | Sec61 Beta Subunit |
| AT5G51330 | Encodes novel protein involved in sister chromatid cohesion and meiotic chromosome organization during both male and female meiosis. Gene has two alternate transcripts which produce two similar proteins, one 57 aa shorter than the other. |
| AT3G05710 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP42, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
| AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
| AT5G67180 | target of early activation tagged (EAT) 3;(source:Araport11) |
| AT3G13445 | TBP (TATA binding protein) associates with TAF(II)s (TBP-associated factors) to form the TFIID general transcription factor complex |
| AT1G55520 | TATA-box binding protein. Required for basal transcription. Acts facilitating the recruitment of TFIID to the promoter, which together with the RNA polymerase form the preinitiation complex. |
| AT2G18000 | TBP-associated factor 14;(source:Araport11) |
| AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT5G08330 | Circadian oscillator protein which interacts with bZIP63 and regulates a response of the circadian oscillator to sugar. Is not required for the sugar-induced circadian phase advance in the morning; regulates a response of CCA1 to sugars. |
| AT3G15030 | Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation. |
| AT2G20080 | hypothetical protein;(source:Araport11) |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT2G01960 | Member of TETRASPANIN family |
| AT5G57810 | Member of TETRASPANIN family |
| AT2G19580 | Member of TETRASPANIN family |
| AT3G45600 | Member of TETRASPANIN family |
| AT2G42580 | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT1G75030 | encodes a PR5-like protein |
| AT2G29630 | Encodes a protein involved in thiamin biosynthesis. The protein is an iron-sulfur cluster protein predicted to catalyze the conversion of 5-aminoimidazole ribonucleotide (AIR) to hydroxymethylpyrimidine (HMP) or hydroxymethylpyrimidine phosphate (HMP-P). A severe reduction of THIC levels in plants decreases vitamin B1 (thiamin diphosphate (TPP)) levels and also leads to changes in the levels of numerous other metabolites since so many primary metabolic enzymes require a TPP co-factor. thiC mutants are chlorotic and arrest in their development at the cotyledon stage. A N-terminal targeting sequence directs the THIC protein to the chloroplast stroma. A conserved TPP-binding site is located in the 3' UTR of the At2g29630.2 gene model, and is predicted to function as a riboswitch. The riboswitch controls the formation of transcripts with alternative 3' UTR lengths, which affect mRNA accumulation and protein production. THIC transcripts are observed in seedlings 5 or more days after germination, and light promotes the expression of this gene. Recessive mutant isolated by Redei. Leaves but not cotyledons white, lethal; restored to normal by thiamine or 2,5-dimethyl-4-aminopyrimidine. |
| AT5G32470 | The classical thiamin-requiring th2-1 mutation corresponds to At5g32470, encoding a HAD (haloacid dehalogenase) family phosphatase fused to a TenA (thiamin salvage) family protein. The HAD domain is a thiamin monophosphate-selective phosphatase, and the TenA domain has the expected thiamin salvage activity. |
| AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
| AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT4G01050 | hydroxyproline-rich glycoprotein family protein, contains a rhodanese homology domain. Required for anchoring the FNR flavoenzyme to the thylakoid membranes and sustaining high efficiency photosynthetic linear electron flow. The mRNA is cell-to-cell mobile. |
| AT1G77490 | Encodes a chloroplastic thylakoid ascorbate peroxidase tAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT3G63180 | TIC-like protein;(source:Araport11) |
| AT2G46640 | Encodes TAC1 (Tiller Angle Control 1). Influences axillary branch growth angle. Inflorescence stems of TAC1 mutants are vertically oriented and have axillary shoots with narrow branch angles. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT5G61380 | Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization. The mRNA is cell-to-cell mobile. |
| AT1G32400 | TOM2A encodes a 280 amino acid putative four-pass transmembrane protein with a C-terminal farnesylation signal, essential for efficient multiplication of tobacco mosaic viruses. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT4G32760 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT1G01695 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT3G24630 | hypothetical protein;(source:Araport11) |
| AT3G63430 | zinc finger CCCH domain protein;(source:Araport11) |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT2G29530 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM9, AtTIM10 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
| AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
| AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
| AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G22190 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G12430 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G06410 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G17460 | Arabidopsis thaliana myb family transcription factor (At1g17460) |
| AT1G72650 | Arabidopsis thaliana myb family transcription factor (At1g72650) |
| AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G70230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G56330 | Involved in posttranscriptional modification of plastid tRNA. |
| AT2G47770 | Encodes a membrane-bound protein designated AtTSPO (Arabidopsis thaliana TSPO-related). AtTSPO is related to the bacterial outer membrane tryptophan-rich sensory protein (TspO) and the mammalian mitochondrial 18 kDa Translocator Protein (18 kDa TSPO), members of the TspO/MBR domain-containing membrane proteins. Mainly detected in dry seeds, but can be induced in vegetative tissues by osmotic or salt stress or abscisic acid treatment. Located in endoplasmic reticulum and the Golgi stacks. It is degraded through the autophagy pathway. |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT5G01075 | Encodes a small ER-localized protein that is strongly expressed in seeds and regulates both embryo development and accumulation of storage compounds. At the cellular level, TWS1 is responsible for cuticle deposition on epidermal cells and organization of the endomembrane system. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
| AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
| AT4G10970 | UAP56-interacting factor1, binds single stranded RNA and, along with UIEF2,,appears to play a role in nuclear export of RNA. |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT1G53025 | Ubiquitin-conjugating enzyme family protein;(source:Araport11) |
| AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
| AT3G45180 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
| AT5G02880 | encodes a ubiquitin-protein ligase containing a HECT domain. There are six other HECT-domain UPLs in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
| AT1G12780 | Encodes a UDP-glucose epimerase that catalyzes the interconversion of the sugar nucleotides UDP-glucose UDP-galactose via a UDP-4-keto-hexose intermediate. Responsive to stress. |
| AT2G41490 | UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT3G56040 | UDP-glucose pyrophosphorylase 3;(source:Araport11) |
| AT2G29740 | UDP-glucosyl transferase 71C2;(source:Araport11) |
| AT1G07260 | Encodes a uridine diphosphate-glycosyltransferase that acts on methyl salicylate (MeSA) to form MeSA glucosides in vitro and in vivo and facilitates negative regulation of the SAR response by modulating homeostasis of MeSA and SA. |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT3G21560 | Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi. |
| AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
| AT2G22500 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
| AT4G00080 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G47470 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. The mRNA is cell-to-cell mobile. |
| AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
| AT2G40900 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G08300 | nodulin MtN21-like transporter family protein |
| AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G01430 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G01440 | nodulin MtN21-like transporter family protein |
| AT5G07050 | nodulin MtN21-like transporter family protein |
| AT3G15620 | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
| AT1G76030 | One of three genes encoding the vacuolar ATP synthase subunit B1. This subunit was shown to interact with the gene product of hexokinase1 (ATHXK1). This interaction, however, is solely restricted to the nucleus. The protein binds to and co-localizes with F-actin, bundles F-actin to form higher-order structure, and stabilizes actin filaments in vitro. The mRNA is cell-to-cell mobile. |
| AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
| AT2G21410 | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation. |
| AT3G21710 | transmembrane protein;(source:Araport11) |
| AT3G24440 | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
| AT1G26670 | member of VTI1 Gene Family. Normally localizes to the transgolgi network and plasma membrane. A dominant mutation (zip1) alters the subcellular localization of VTI12 and suppresses loss of function mutation (zag1) of VTI11. Interacts with members of the SYP family. Involved in protein trafficking to protein storage vacuoles. |
| AT4G23630 | VIRB2-interacting protein 1;(source:Araport11) |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
| AT1G72290 | Encodes a Kunitz-protease inhibitor, a water-soluble chlorophyll protein involved in herbivore resistance activation. |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT4G32330 | WDL5 is an target of EIN3 that co-localizes with cortical microtubles. It its thought to function to stabilize microtubles during ethylene induced hypocotyl elongation. |
| AT2G35880 | Microtubule-stabilizing protein. |
| AT2G26570 | Encodes a coiled-coil protein WEB1 (weak chloroplast movement under blue light 1). WEB1, together with another coiled-coil protein WEB2/PMI2 (At1g66840), maintains the chloroplast photorelocation movement velocity. |
| AT3G18750 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
| AT5G56210 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
| AT2G34830 | member of WRKY Transcription Factor; Group II-e |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT3G23280 | Encodes a ubiquitin ligase that is a novel player in ethylene signaling involved in negatively regulating apical hook curvature, with alternative splicing controlling dual targeting to the nuclear and cytoplasmic compartments. |
| AT4G13090 | xyloglucan endotransglucosylase/hydrolase 2;(source:Araport11) |
| AT1G14720 | member of Glycoside Hydrolase Family 16 |
| AT5G65730 | xyloglucan endotransglucosylase/hydrolase 6;(source:Araport11) |
| AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
| AT1G74380 | xyloglucan xylosyltransferase 5;(source:Araport11) |
| AT3G17650 | Arabidopsis thaliana metal-nicotianamine transporter YSL5 |
| AT3G27020 | Arabidopsis thaliana metal-nicotianamine transporter YSL6 |
| AT1G04180 | YUCCA 9;(source:Araport11) |
| AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
| AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT1G67030 | Encodes a novel C2H2 zinc finger protein containing only a single zinc finger which plays a key role in regulating trichome development by integrating GA and cytokinin signaling. The mRNA is cell-to-cell mobile. |
| AT2G46800 | Encodes a member of the zinc transporter (ZAT) and cation diffusion facilitator (CDF) families. It is expressed throughout the plant, especially in dividing, differentiating and expanding cells. The protein is localized to the vacuolar membrane. Mediates Zn ion homeostasis. |
| AT5G43170 | Encodes zinc finger protein. mRNA levels are elevated in response to high salinity and low temperature. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G59520 | encodes a metal ion transporter whose expression is regulated by copper. |