| AT5G64010 | U2 small nuclear ribonucleoprotein auxiliary factor-like protein;(source:Araport11) |
| AT3G53400 | peptide upstream protein;(source:Araport11) |
| AT2G12670 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.9e-29 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G14280 | LL-diaminopimelate aminotransferase;(source:Araport11) |
| AT5G52950 | LIM domain protein;(source:Araport11) |
| AT4G10470 | hypothetical protein;(source:Araport11) |
| AT5G62550 | microtubule-associated futsch-like protein;(source:Araport11) |
| AT2G42140 | VQ motif-containing protein;(source:Araport11) |
| AT2G43460 | Ribosomal L38e protein family;(source:Araport11) |
| AT5G02890 | Encodes a protein with similarity to transferases in plants and fungi. |
| AT5G06930 | nucleolar-like protein;(source:Araport11) |
| AT5G52850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G34810 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
| AT3G48640 | transmembrane protein;(source:Araport11) |
| AT1G62422 | hypothetical protein;(source:Araport11) |
| AT1G58040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G51990 | O-methyltransferase family protein;(source:Araport11) |
| AT1G27090 | glycine-rich protein;(source:Araport11) |
| AT5G63941 | Pseudogene of AT5G09270 |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT4G03020 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G28600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G12670 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G13455 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-12 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10) |
| AT5G28928 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
| AT1G67060 | peptidase M50B-like protein;(source:Araport11) |
| AT5G15175 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT3G61930 | hypothetical protein;(source:Araport11) |
| AT5G13140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT3G47800 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT5G43120 | ARM-repeat/Tetratricopeptide repeat (TPR)-like protein;(source:Araport11) |
| AT1G70780 | hypothetical protein;(source:Araport11) |
| AT5G48020 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G52180 | transmembrane protein 161AB protein;(source:Araport11) |
| AT1G65352 | Encodes a defensin-like (DEFL) family protein. |
| AT5G24830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G33200 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 28%25 identity and 4.2e-16 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
| AT1G11905 | B-cell receptor-associated protein 31-like protein;(source:Araport11) |
| AT5G20160 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT3G57810 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G75050 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G17590 | Putative membrane lipoprotein;(source:Araport11) |
| AT1G77340 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G29300 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G03038 | other_RNA;(source:Araport11) |
| AT4G03460 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G13500 | hypothetical protein;(source:Araport11) |
| AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
| AT5G57080 | transmembrane protein;(source:Araport11) |
| AT1G73510 | hypothetical protein;(source:Araport11) |
| AT1G43005 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G52640 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G62095 | Pseudogene of AT1G11820; hydrolase, hydrolyzing O-glycosyl compounds |
| AT4G14615 | sporulation-specific protein;(source:Araport11) |
| AT1G56140 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT4G19530 | Encodes a TIR-NB-LRR resistance protein. Transient expression in tobacco induces cell death. |
| AT2G19660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G63240 | DNAse I-like superfamily protein;(source:Araport11) |
| AT4G13270 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G75180 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
| AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G46340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
| AT2G02050 | NADH-ubiquinone oxidoreductase B18 subunit;(source:Araport11) |
| AT1G20132 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G05540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G34320 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT1G33020 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G35690 | hypothetical protein (DUF241);(source:Araport11) |
| AT1G16950 | transmembrane protein;(source:Araport11) |
| AT5G56061 | Pseudogene of AT5G56050 |
| AT5G44090 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
| AT3G52980 | Zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
| AT5G21100 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT4G00040 | Chalcone and stilbene synthase family protein;(source:Araport11) |
| AT5G27140 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
| AT1G13410 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G12270 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G31425 | pseudogene of Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G11405 | hypothetical protein;(source:Araport11) |
| AT2G17490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-199 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT4G12680 | transmembrane protein;(source:Araport11) |
| AT5G08600 | U3 ribonucleoprotein (Utp) family protein;(source:Araport11) |
| AT1G28375 | transmembrane protein;(source:Araport11) |
| AT4G28790 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G19530 | transmembrane protein;(source:Araport11) |
| AT1G28700 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G47330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G13250 | RING finger protein;(source:Araport11) |
| AT1G33415 | Natural antisense transcript overlaps with AT1G33420 and AT1G33430;(source:Araport11) |
| AT2G37750 | hypothetical protein;(source:Araport11) |
| AT3G44810 | F-box family protein;(source:Araport11) |
| AT1G61760 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G11070 | hypothetical protein;(source:Araport11) |
| AT5G15700 | Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast. |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
| AT2G39445 | Phosphatidylinositol N-acetylglucosaminyltransferase, GPI19/PIG-P subunit;(source:Araport11) |
| AT2G21110 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G10450 | 14-3-3 family protein;(source:Araport11) |
| AT5G19440 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
| AT3G43420 | hypothetical protein;(source:Araport11) |
| AT3G16900 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G03790 | ankyrin repeat family protein / regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT5G32440 | Ubiquitin system component Cue protein;(source:Araport11) |
| AT2G32500 | Stress responsive alpha-beta barrel domain protein;(source:Araport11) |
| AT3G54460 | SNF2 domain-containing protein / helicase domain-containing protein / F-box family protein;(source:Araport11) |
| AT1G03350 | BSD domain-containing protein;(source:Araport11) |
| AT5G54460 | wound-responsive protein-like protein;(source:Araport11) |
| AT1G61900 | hypothetical protein;(source:Araport11) |
| AT5G60760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G35640 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G58060 | RNA helicase family protein;(source:Araport11) |
| AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G06050 | Putative methyltransferase family protein;(source:Araport11) |
| AT2G34360 | MATE efflux family protein;(source:Araport11) |
| AT3G14920 | Peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase A protein;(source:Araport11) |
| AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G15590 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT5G50140 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G11730 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G04920 | Ribosomal protein S24e family protein;(source:Araport11) |
| AT2G13460 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT3G30390 | Encodes a putative amino acid transporter. |
| AT5G05320 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT4G10080 | transmembrane protein;(source:Araport11) |
| AT4G30240 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT2G42180 | cotton fiber protein;(source:Araport11) |
| AT3G56230 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G47495 | hypothetical protein;(source:Araport11) |
| AT3G42280 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-71 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G12010 | nuclease;(source:Araport11) |
| AT1G43666 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G04090 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
| AT1G80870 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G17650 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
| AT5G04980 | DNAse I-like superfamily protein;(source:Araport11) |
| AT3G57570 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G23970 | hypothetical protein;(source:Araport11) |
| AT2G38090 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT1G07210 | Ribosomal protein S18;(source:Araport11) |
| AT5G64160 | plant/protein;(source:Araport11) |
| AT1G24320 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT5G58150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G42395 | hypothetical protein;(source:Araport11) |
| AT5G37145 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-29 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT2G16015 | hypothetical protein;(source:Araport11) |
| AT3G13940 | DNA binding / DNA-directed RNA polymerase;(source:Araport11) |
| AT5G37690 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G38370 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G08610 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G15560 | hypothetical protein;(source:Araport11) |
| AT1G07330 | dentin sialophosphoprotein;(source:Araport11) |
| AT5G64550 | loricrin-like protein;(source:Araport11) |
| AT3G57120 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G22120 | coiled-coil protein;(source:Araport11) |
| AT4G16720 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
| AT1G23270 | hypothetical protein;(source:Araport11) |
| AT1G54600 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G61097 | Expressed protein;(source:Araport11) |
| AT1G76980 | patatin-like phospholipase domain protein;(source:Araport11) |
| AT3G50420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G20460 | NADH-ubiquinone oxidoreductase chain;(source:Araport11) |
| AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT1G60630 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G34833 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.7e-165 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT1G48830 | Ribosomal protein S7e family protein;(source:Araport11) |
| AT5G57887 | transmembrane protein;(source:Araport11) |
| AT5G55100 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT4G13615 | Uncharacterized protein family SERF;(source:Araport11) |
| AT1G33102 | hypothetical protein;(source:Araport11) |
| AT3G28320 | UPF0496 protein; Commonly-enriched candidate LPS-interacting PM-associated proteins from the three affinity chromatography systems with LPS chemotype Xcc 8530 as ligand. |
| AT2G34110 | hypothetical protein;(source:Araport11) |
| AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G25310 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G29786 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G43320.1);(source:TAIR10) |
| AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
| AT1G69480 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT1G75610 | pseudogene of Histone superfamily protein;(source:Araport11) |
| AT1G56400 | F-box family protein;(source:Araport11) |
| AT5G33382 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-126 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT1G52820 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G14830 | transposable_element_gene;(source:Araport11);retrotransposon family;(source:TAIR10) |
| AT5G64395 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G24310 | TPRXL;(source:Araport11) |
| AT4G01670 | hypothetical protein;(source:Araport11) |
| AT4G10955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G21300 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-15 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G03260 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G55640 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT4G19550 | zinc ion binding / transcription regulator;(source:Araport11) |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G07150 | amino acid-ligase;(source:Araport11) |
| AT3G49832 | pseudogene of kelch repeat-containing F-box family |
| AT3G15530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G48770 | ATP/DNA binding protein;(source:Araport11) |
| AT4G10000 | Thioredoxin family protein;(source:Araport11) |
| AT3G49030 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT2G39960 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
| AT4G34330 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT2G29370 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G23605 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT3G18170 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT5G05220 | hypothetical protein;(source:Araport11) |
| AT5G36930 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G13070 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT2G17300 | hypothetical protein;(source:Araport11) |
| AT2G04590 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-28 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G52855 | hypothetical protein;(source:Araport11) |
| AT5G52620 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G56270 | RPB1a;(source:Araport11) |
| AT2G40004 | transmembrane protein;(source:Araport11) |
| AT4G26660 | kinesin-like protein;(source:Araport11) |
| AT5G16420 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G35960 | Protein kinase family protein;(source:Araport11) |
| AT1G20240 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT5G65880 | transmembrane protein;(source:Araport11) |
| AT3G30300 | O-fucosyltransferase family protein;(source:Araport11) |
| AT3G61840 | auxin response factor, putative (DUF688);(source:Araport11) |
| AT4G15860 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-43 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT4G13820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G15128 | other_RNA;(source:Araport11) |
| AT4G08695 | pseudogene of ribosomal protein L2;(source:Araport11) |
| AT1G65870 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G14910 | MAR-binding filament-like protein;(source:Araport11) |
| AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT4G16162 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G19720 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT3G10580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT1G56020 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT2G19130 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G29110 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT2G01422 | other_RNA;(source:Araport11) |
| AT5G25330 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G30880 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT3G01513 | hypothetical protein;(source:Araport11) |
| AT1G19010 | hypothetical protein;(source:Araport11) |
| AT1G57650 | ATP binding protein;(source:Araport11) |
| AT3G55690 | hypothetical protein;(source:Araport11) |
| AT1G22910 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G40420 | Encodes a putative amino acid transporter. |
| AT5G51500 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G38695 | Gag-Pol polyprotein/retrotransposon;(source:Araport11) |
| AT5G18840 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G30080 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
| AT5G60615 | Encodes a defensin-like (DEFL) family protein. |
| AT1G19170 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G76954 | Encodes a defensin-like (DEFL) family protein. |
| AT2G18770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
| AT3G14220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G30470 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G11740 | ankyrin repeat family protein;(source:Araport11) |
| AT1G66460 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G53075 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
| AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G47765 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G25615 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.0e-122 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT5G66600 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G25490 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT2G38995 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT5G38378 | Thionin-like gene involved in resistance against the beet cyst nematode (Heterodera schachtii). |
| AT1G09690 | Translation protein SH3-like family protein;(source:Araport11) |
| AT1G69030 | BSD domain-containing protein;(source:Araport11) |
| AT1G72500 | inter alpha-trypsin inhibitor, heavy chain-like protein;(source:Araport11) |
| AT1G32583 | A microRNA MIR400 is derived from the first intron of At1g32583 in the 5'UTR. A stress-induced alternative splicing event in At1g32583 resulted in greater accumulation of miR400 primary transcripts and a low level of mature miR400. |
| AT4G02485 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G26190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G10030 | aspartate/glutamate/uridylate kinase family protein;(source:Araport11) |
| AT2G31420 | B3 domain protein (DUF313);(source:Araport11) |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G17350 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT5G52720 | Copper transport protein family;(source:Araport11) |
| AT1G21950 | transmembrane protein;(source:Araport11) |
| AT2G22590 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G50295 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G01202 | Natural antisense transcript overlaps with AT3G01200;(source:Araport11) |
| AT5G05795 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT4G39280 | phenylalanyl-tRNA synthetase, putative / phenylalanine-tRNA ligase;(source:Araport11) |
| AT1G11125 | hypothetical protein;(source:Araport11) |
| AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G76200 | NADH dehydrogenase ubiquinone 1 beta subcomplex subunit;(source:Araport11) |
| AT1G31090 | F-box family protein;(source:Araport11) |
| AT2G06560 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.8e-38 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G31790 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G37570 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G52200 | PLAC8 family protein;(source:Araport11) |
| AT5G02960 | Ribosomal protein S12/S23 family protein;(source:Araport11) |
| AT4G30570 | Glucose-1-phosphate adenylyltransferase family protein;(source:Araport11) |
| AT4G06660 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.8e-275 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G29010 | Biotin/lipoate A/B protein ligase family;(source:Araport11) |
| AT1G31983 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT5G55055 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT4G08210 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G05280 | ERV-F (C)1 provirus ancestral Env polyprotein, putative (DUF604);(source:Araport11) |
| AT3G51130 | transmembrane protein;(source:Araport11) |
| AT2G35920 | RNA helicase family protein;(source:Araport11) |
| AT5G32800 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-66 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G04210 | Encodes a putative Raf-related kinase. |
| AT3G18060 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT1G72780 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G77910 | transmembrane protein;(source:Araport11) |
| AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G30990 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G14460 | hypothetical protein;(source:Araport11) |
| AT3G16220 | Putative eukaryotic LigT;(source:Araport11) |
| AT5G62340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT2G43590 | Chitinase family protein;(source:Araport11) |
| AT5G37170 | O-methyltransferase family protein;(source:Araport11) |
| AT5G33432 | similar to En/Spm-like transposon |
| AT3G46850 | Subtilase family protein;(source:Araport11) |
| AT1G68400 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT5G12920 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G53440 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT3G15800 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT2G47330 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G01590 | DNA-directed RNA polymerase III subunit;(source:Araport11) |
| AT3G25550 | F-box family protein;(source:Araport11) |
| AT1G43600 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G08360 | KOW domain-containing protein;(source:Araport11) |
| AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
| AT1G44608 | hypothetical protein;(source:Araport11) |
| AT5G60090 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G11940 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT3G56250 | hypothetical protein;(source:Araport11) |
| AT5G63130 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G76610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
| AT1G49032 | hypothetical protein;(source:Araport11) |
| AT3G61870 | plant/protein;(source:Araport11) |
| AT4G14460 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-253 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G29635 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 7.7e-111 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G11175 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT4G24265 | homeobox protein;(source:Araport11) |
| AT1G54020 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G56270 | WEB family protein (DUF827);(source:Araport11) |
| AT2G27830 | hypothetical protein;(source:Araport11) |
| AT5G60350 | hypothetical protein;(source:Araport11) |
| AT5G07685 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-118 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT1G60320 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G14820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G60110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT2G23230 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT3G11590 | golgin family A protein;(source:Araport11) |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT3G49150 | F-box/FBD/LRR protein;(source:Araport11) |
| AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11) |
| AT5G62510 | F-box family protein;(source:Araport11) |
| AT3G22180 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G14550 | pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G03230 | GCK domain-containing protein;(source:Araport11) |
| AT3G50690 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G26880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT2G16310 | pseudogene of endoplasmatic reticulum retrieval protein 1B;(source:Araport11) |
| AT4G21630 | Subtilase family protein;(source:Araport11) |
| AT3G62850 | zinc finger protein-like protein;(source:Araport11) |
| AT3G45252 | Encodes a ECA1 gametogenesis related family protein |
| AT5G07675 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT2G03850 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G50140 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G29270 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G57010 | calmodulin-binding family protein;(source:Araport11) |
| AT1G35143 | transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G52950.1);(source:TAIR10) |
| AT2G30310 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G15415 | The protein encoded by this gene was identified as a part of pollen proteome by mass spec analysis. It has weak homology to LEA (late embryo abundant) proteins. Encodes protein phosphatase 2A (PP2A) B'gamma subunit. Targeted to nucleus and cytosol. |
| AT4G22000 | tyrosine sulfotransferase-like protein;(source:Araport11) |
| AT1G46554 | other_RNA;(source:Araport11) |
| AT5G55896 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-49 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G36040 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30610.1);(source:TAIR10) |
| AT5G35344 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G64010 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT5G26710 | Glutamyl/glutaminyl-tRNA synthetase, class Ic;(source:Araport11) |
| AT3G02340 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G36500 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 8.7e-93 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
| AT3G52240 | transcriptional regulator ATRX;(source:Araport11) |
| AT1G48800 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT4G17480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G24550 | major centromere autoantigen B-like protein;(source:Araport11) |
| AT5G57610 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT4G13575 | hypothetical protein;(source:Araport11) |
| AT4G18930 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
| AT1G44125 | Natural antisense transcript overlaps with AT1G44120;(source:Araport11) |
| AT5G20800 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, predicted non-LTR reverse ranscriptase sequence fragments;(source:TAIR10) |
| AT3G28370 | spindle assembly checkpoint component;(source:Araport11) |
| AT1G28600 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G03290 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G39535 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT3G21210 | zinc ion binding protein;(source:Araport11) |
| AT5G53820 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT4G09450 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT5G54148 | sarcosine dehydrogenase-2C protein;(source:Araport11) |
| AT2G40630 | Uncharacterized conserved protein (UCP030365);(source:Araport11) |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT2G18115 | pseudogene of glycine-rich protein;(source:Araport11) |
| AT5G53486 | transmembrane protein;(source:Araport11) |
| AT1G13160 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G58880 | LRR protein;(source:Araport11) |
| AT5G28464 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 9.6e-23 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G43910 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G28673 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.1e-40 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT1G60240 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT3G10590 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT2G22520 | hypothetical protein;(source:Araport11) |
| AT1G62766 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 6.1e-299 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G11600 | hypothetical protein;(source:Araport11) |
| AT1G07870 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G61390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G06630 | protein kinase family protein;(source:Araport11) |
| AT2G23067 | Putative membrane lipoprotein;(source:Araport11) |
| AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT2G42720 | FBD, F-box, Skp2-like and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G31790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G18310 | glycosyl hydrolase family 81 protein;(source:Araport11) |
| AT5G50335 | hypothetical protein;(source:Araport11) |
| AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT2G30660 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT5G07670 | RNI-like superfamily protein;(source:Araport11) |
| AT5G59460 | scarecrow-like transcription factor 11 (SCL11);(source:Araport11) |
| AT5G45085 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT3G47210 | hypothetical protein (DUF247);(source:Araport11) |
| AT2G17140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G67855 | hypothetical protein;(source:Araport11) |
| AT5G37240 | hypothetical protein;(source:Araport11) |
| AT5G54040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT1G61060 | F-box family protein;(source:Araport11) |
| AT4G39860 | hematological/neurological-like protein;(source:Araport11) |
| AT1G80620 | S15/NS1, RNA-binding protein;(source:Araport11) |
| AT2G15760 | calmodulin-binding protein (DUF1645);(source:Araport11) |
| AT1G71695 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G59190 | subtilase family protein;(source:Araport11) |
| AT3G12440 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT2G43390 | hypothetical protein;(source:Araport11) |
| AT3G27030 | transmembrane protein;(source:Araport11) |
| AT4G05495 | pseudogene of temperature sensing protein-like protein;(source:Araport11) |
| AT5G54940 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT3G07310 | phosphoserine aminotransferase, putative (DUF760);(source:Araport11) |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G12950 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT4G08867 | hypothetical protein;(source:Araport11) |
| AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT5G42430 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G56530 | tRNA-splicing ligase (DUF239);(source:Araport11) |
| AT4G14620 | hypothetical protein (DUF506);(source:Araport11) |
| AT1G14890 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G49570 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G52060 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G44020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G29095 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
| AT3G22510 | Pre-rRNA-processing protein TSR2, conserved region;(source:Araport11) |
| AT1G66870 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT5G38950 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G27430 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G06744 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G52280 | Myosin heavy chain-related protein;(source:Araport11) |
| AT5G09770 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
| AT1G20390 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.5e-251 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G06170 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT4G18905 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT2G41473 | F-box family protein;(source:Araport11) |
| AT1G21973 | Encodes a Plant thionin family protein [pseudogene] |
| AT3G42550 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G45920 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT2G01410 | NHL domain-containing protein;(source:Araport11) |
| AT5G64150 | RNA methyltransferase family protein;(source:Araport11) |
| AT5G39240 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT1G62480 | Vacuolar calcium-binding protein-like protein;(source:Araport11) |
| AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
| AT3G46370 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G10240 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G72410 | COP1-interacting protein-like protein;(source:Araport11) |
| AT1G49030 | PLAC8 family protein;(source:Araport11) |
| AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G16680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G44450 | alpha amino-terminal protein methyltransferase;(source:Araport11) |
| AT1G44941 | hypothetical protein;(source:Araport11) |
| AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G30970 | hypothetical protein;(source:Araport11) |
| AT3G10430 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G51190 | Ribosomal protein L2 family;(source:Araport11) |
| AT1G42150 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 5.3e-161 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
| AT1G47300 | F-box family protein;(source:Araport11) |
| AT5G26617 | reverse transcriptase-like protein;(source:Araport11) |
| AT4G04130 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT3G42690.1);(source:TAIR10) |
| AT5G22310 | trichohyalin-like protein;(source:Araport11) |
| AT2G15910 | CSL zinc finger domain-containing protein;(source:Araport11) |
| AT4G00600 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT3G04180 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G53550 | FBD-like domain family protein;(source:Araport11) |
| AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT3G01311 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT2G07806 | hypothetical protein;(source:Araport11) |
| AT5G05790 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT5G59930 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G59590 | jacalin lectin family protein;(source:Araport11) |
| AT4G29570 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT5G49920 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G51055 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT5G44710 | 37S ribosomal protein S27;(source:Araport11) |
| AT5G41850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G60450 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G12190 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G61280 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT4G20190 | hypothetical protein;(source:Araport11) |
| AT3G59260 | pirin;(source:Araport11) |
| AT5G40960 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G46100 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G20720 | amino-terminal region of chorein;(source:Araport11) |
| AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT4G20340 | Transcription factor TFIIE, alpha subunit;(source:Araport11) |
| AT2G40560 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G19420 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT4G16790 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
| AT5G54585 | hypothetical protein;(source:Araport11) |
| AT4G25660 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT5G59900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G14070 | wound-responsive protein-like protein;(source:Araport11) |
| AT1G29090 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G29620 | transposable_element_gene;(source:Araport11);transposase IS4 family protein, contains Pfam profile: PF01609 transposase DDE domain;(source:TAIR10) |
| AT2G34280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G37510 | Ribonuclease III family protein;(source:Araport11) |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT2G39870 | hypothetical protein;(source:Araport11) |
| AT5G26790 | transmembrane protein;(source:Araport11) |
| AT3G49550 | hypothetical protein;(source:Araport11) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G16920 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT1G68930 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G44780 | translation initiation factor;(source:Araport11) |
| AT1G54355 | Natural antisense transcript overlaps with AT1G54350;(source:Araport11) |
| AT3G14560 | Its transcript is targeted by miR824. |
| AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G29840 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G49950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G40350 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT4G32360 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
| AT3G44190 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G18600 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G44400 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT3G43230 | RING/FYVE/PHD-type zinc finger family protein;(source:Araport11) |
| AT5G53650 | ABC transporter A family protein;(source:Araport11) |
| AT3G29577 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.0e-133 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT3G58410 | TRAF-like family protein;(source:Araport11) |
| AT2G09800 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-162 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT2G16340 | hypothetical protein;(source:Araport11) |
| AT1G02810 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G46192 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G50190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G01220 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT5G55610 | isopentenyl-diphosphate delta-isomerase;(source:Araport11) |
| AT2G11015 | hypothetical protein (DUF3287);(source:Araport11) |
| AT3G46260 | kinase-like protein;(source:Araport11) |
| AT5G65170 | VQ motif-containing protein;(source:Araport11) |
| AT4G08580 | microfibrillar-associated protein-like protein;(source:Araport11) |
| AT4G29990 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT4G21580 | oxidoreductase, zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G22600 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G65380 | MATE efflux family protein;(source:Araport11) |
| AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
| AT5G08580 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT2G47570 | 60S ribosomal protein L18;(source:Araport11) |
| AT3G29153 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-238 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G03876 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT5G67020 | hypothetical protein;(source:Araport11) |
| AT4G21926 | hypothetical protein;(source:Araport11) |
| AT5G62900 | PADRE protein down-regulated after infection by S. sclerotiorum. |
| AT4G33945 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G15830 | hypothetical protein;(source:Araport11) |
| AT3G05937 | hypothetical protein;(source:Araport11) |
| AT1G26950 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT5G33360.1);(source:TAIR10) |
| AT3G54120 | Reticulon family protein;(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G67300 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G65230 | transmembrane protein, putative (DUF2358);(source:Araport11) |
| AT3G59850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
| AT2G23910 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G00467 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G12334 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT2G36970 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G28140 | enabled-like protein (DUF1635);(source:Araport11) |
| AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT1G10990 | transmembrane protein;(source:Araport11) |
| AT1G10580 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G31370 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT4G21437 | unknown pseudogene |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G14460 | AAA-type ATPase family protein;(source:Araport11) |
| AT3G46186 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT2G03350 | DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11) |
| AT4G02541 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT3G06778 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G75340 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G36090 | F-box family protein;(source:Araport11) |
| AT4G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G12640 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G17960 | phospholipid hydroperoxide glutathione peroxidase;(source:Araport11) |
| AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
| AT5G48760 | Ribosomal protein L13 family protein;(source:Araport11) |
| AT1G64890 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G26340 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G11340 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT4G08160 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT2G28400 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G31240 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G27610 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G28690 | hypothetical protein;(source:Araport11) |
| AT5G44630 | Encodes a sesquiterpene synthase involved in generating all of the group B sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in intrafloral nectaries. |
| AT4G22640 | LTPG protein |
| AT2G17705 | methionine-S-oxide reductase;(source:Araport11) |
| AT3G60050 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
| AT5G05830 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G28850 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT5G42505 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-23 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
| AT3G18860 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G11400 | ARID/BRIGHT DNA-binding , ELM2 domain and myb-like DNA-binding domain-containing protein;(source:Araport11) |
| AT1G49260 | mechanosensitive ion channel-like protein;(source:Araport11) |
| AT2G06060 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G26660 | Prefoldin chaperone subunit family protein;(source:Araport11) |
| AT1G64100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT5G39490 | F-box family protein;(source:Araport11) |
| AT5G20000 | AAA-type ATPase family protein;(source:Araport11) |
| AT1G30600 | Subtilase family protein;(source:Araport11) |
| AT5G35805 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
| AT3G29385 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT3G09505 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
| AT5G65520 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G44010 | fanconi anemia group F protein (FANCF);(source:Araport11) |
| AT4G18310 | hypothetical protein;(source:Araport11) |
| AT2G39320 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G32600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G37700 | hypothetical protein;(source:Araport11) |
| AT5G12060 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G48750 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G36680 | Modifier of rudimentary (Mod(r)) protein;(source:Araport11) |
| AT4G29630 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT1G15860 | defective in cullin neddylation protein (DUF298);(source:Araport11) |
| AT5G06940 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
| AT1G71015 | PADRE protein. |
| AT4G31980 | PPPDE thiol peptidase family protein;(source:Araport11) |
| AT2G03430 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G48500 | pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11) |
| AT4G38932 | Natural antisense transcript overlaps with AT4G38930;(source:Araport11) |
| AT1G01400 | hypothetical protein;(source:Araport11) |
| AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G01275 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT4G22545 | pseudogene of expressed protein;(source:Araport11) |
| AT5G14840 | pseudogene of hypothetical protein;(source:Araport11) |
| AT1G51040 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G08800 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G08480 | VQ motif-containing protein;(source:Araport11) |
| AT2G17280 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
| AT4G10010 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G04900 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
| AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT1G02570 | transmembrane protein;(source:Araport11) |
| AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
| AT2G15590 | spire, putative (DUF1685);(source:Araport11) |
| AT2G47970 | Nuclear pore localization protein NPL4;(source:Araport11) |
| AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11) |
| AT5G55620 | hypothetical protein;(source:Araport11) |
| AT1G31430 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT3G49115 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G21910 | MATE efflux family protein;(source:Araport11) |
| AT2G43610 | Chitinase family protein;(source:Araport11) |
| AT1G65940 | pseudogene of Dof-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G35735 | Auxin-responsive family protein;(source:Araport11) |
| AT3G50730 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G30200 | Plant transposase (Ptta/En/Spm family);(source:Araport11) |
| AT4G20250 | hypothetical protein;(source:Araport11) |
| AT3G43540 | initiation factor 4F subunit (DUF1350);(source:Araport11) |
| AT2G20790 | clathrin adaptor complexes medium subunit family protein;(source:Araport11) |
| AT3G08780 | BRISC complex subunit Abro1-like protein;(source:Araport11) |
| AT4G16563 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G71480 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT2G44970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G32110 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT1G58248 | Encodes a Plant thionin family protein |
| AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT3G08600 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT3G45490 | reverse transcriptase-like protein;(source:Araport11) |
| AT3G62160 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G62370 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G01710 | acyl-CoA thioesterase II;(source:Araport11) |
| AT4G14345 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G04235 | hypothetical protein;(source:Araport11) |
| AT2G30695 | bacterial trigger factor;(source:Araport11) |
| AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G02970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G35425 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G05360 | hypothetical protein;(source:Araport11) |
| AT2G19200 | pseudogene of hypothetical protein (DUF626);(source:Araport11) |
| AT2G23321 | hypothetical protein;(source:Araport11) |
| AT4G21620 | glycine-rich protein;(source:Araport11) |
| AT2G30670 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G04047 | Encodes a defensin-like (DEFL) family protein. |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT5G60070 | ankyrin repeat family protein;(source:Araport11) |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT1G51035 | hypothetical protein;(source:Araport11) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT2G23160 | F-box family protein;(source:Araport11) |
| AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G43340 | hypothetical protein (DUF1685);(source:Araport11) |
| AT3G57450 | hypothetical protein;(source:Araport11) |
| AT4G15710 | cystatin-like protein;(source:Araport11) |
| AT3G12050 | Aha1 domain-containing protein;(source:Araport11) |
| AT4G32390 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT4G22040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-193 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G43140 | Cullin family protein;(source:Araport11) |
| AT1G75870 | hypothetical protein;(source:Araport11) |
| AT2G44120 | Ribosomal protein L30/L7 family protein;(source:Araport11) |
| AT2G46995 | hypothetical protein;(source:Araport11) |
| AT1G75460 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT3G59120 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G21790 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G49725 | GTP-binding protein, HflX;(source:Araport11) |
| AT3G60440 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT1G46840 | F-box family protein;(source:Araport11) |
| AT1G45140 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-37 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G16220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
| AT3G15536 | Unknown gene The mRNA is cell-to-cell mobile. |
| AT5G44080 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT3G59300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G32275 | Expressed protein;(source:Araport11) |
| AT3G14410 | Nucleotide/sugar transporter family protein |
| AT3G52500 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G27875 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G59068 | Natural antisense transcript overlaps with AT3G59070;(source:Araport11) |
| AT1G28327 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT1G01250 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT5G03560 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G66780 | late embryogenesis abundant protein;(source:Araport11) |
| AT5G28210 | mRNA capping enzyme family protein;(source:Araport11) |
| AT3G60710 | F-box family protein. |
| AT3G14820 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G14450 | NADH dehydrogenase (ubiquinone)s;(source:Araport11) |
| AT1G79570 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
| AT4G28570 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G60910 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G12540 | hypothetical protein;(source:Araport11) |
| AT1G75230 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G03365 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G29755 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 5.5e-180 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT2G44925 | hypothetical protein;(source:Araport11) |
| AT1G02260 | Divalent ion symporter;(source:Araport11) |
| AT3G46360 | transmembrane protein;(source:Araport11) |
| AT5G43450 | encodes a protein whose sequence is similar to ACC oxidase |
| AT5G23390 | polygalacturonase inhibitor (DUF639);(source:Araport11) |
| AT3G04300 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT3G19920 | BTB/POZ domain protein;(source:Araport11) |
| AT2G05410 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT1G62530 | hypothetical protein (DUF863);(source:Araport11) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G14970 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G41890 | curculin-like (mannose-binding) lectin family protein / PAN domain-containing protein;(source:Araport11) |
| AT5G11620 | SWIM zinc finger family protein / mitogen-activated protein kinase kinase kinase (MAPKKK)-like protein;(source:Araport11) |
| AT2G03000 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30650 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT2G04110 | pseudogene of expressed protein;(source:Araport11) |
| AT1G66530 | Arginyl-tRNA synthetase, class Ic;(source:Araport11) |
| AT1G45015 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT5G65320 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G47100 | hypothetical protein;(source:Araport11) |
| AT2G05390 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-200 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT3G45940 | Glycosyl hydrolases family 31 protein;(source:Araport11) |
| AT4G16920 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G42179 | transposable_element_gene;(source:Araport11);contains InterPro domain Arabidopsis retrotransposon ORF-1 protein;(source:TAIR10) |
| AT2G36240 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT2G38790 | hypothetical protein;(source:Araport11) |
| AT3G48515 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
| AT4G22900 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G07040 | plant/protein;(source:Araport11) |
| AT1G30860 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G61230 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G12660 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
| AT4G21110 | G10 family protein;(source:Araport11) |
| AT1G01225 | NC domain-containing protein-like protein;(source:Araport11) |
| AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT4G10400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G56850 | hypothetical protein;(source:Araport11) |
| AT1G53370 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT2G02660 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G45020 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
| AT5G67411 | GRAS family transcription factor;(source:Araport11) |
| AT1G64800 | DNA binding / transcription factor;(source:Araport11) |
| AT1G24265 | bZIP transcription factor, putative (DUF1664);(source:Araport11) |
| AT4G16140 | proline-rich family protein;(source:Araport11) |
| AT5G37010 | rho GTPase-activating protein;(source:Araport11) |
| AT3G13510 | carboxyl-terminal peptidase, putative (DUF239);(source:Araport11) |
| AT5G43910 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
| AT5G07090 | Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
| AT5G48430 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G18340 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT3G22421 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G09750 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT2G03240 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT5G46300 | hypothetical protein;(source:Araport11) |
| AT4G01455 | tRNA-Glu (anticodon: TTC) |
| AT1G21440 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
| AT4G13580 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT5G59080 | hypothetical protein;(source:Araport11) |
| AT1G61890 | MATE efflux family protein;(source:Araport11) |
| AT1G53815 | F-box family protein;(source:Araport11) |
| AT5G66330 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G40400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G12200 | transposable_element_gene;(source:Araport11);similar to polyprotein [Oryza sativa] (GB:BAB03249.1);(source:TAIR10) |
| AT3G49200 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT1G07135 | glycine-rich protein;(source:Araport11) |
| AT5G26622 | Beta-galactosidase related protein;(source:Araport11) |
| AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G56830 | Similar in sequence to NPQ6 and NPQ7, but loss of function mutant does not exhibit a nonphotochemical quenching phenotype. |
| AT3G04250 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G35490 | bZIP family transcription factor;(source:Araport11) |
| AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT2G46250 | myosin heavy chain-like protein;(source:Araport11) |
| AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G33780 | electron transporter, putative (DUF179);(source:Araport11) |
| AT4G06497 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.0e-48 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G18150 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G15350 | G14 enzyme |
| AT1G70360 | F-box family protein;(source:Araport11) |
| AT2G38590 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G27400 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT1G47640 | seven transmembrane domain protein;(source:Araport11) |
| AT5G45640 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G22470 | Hypothetical protein;(source:Araport11). Target of SR45. |
| AT2G40435 | transcription factor SCREAM-like protein;(source:Araport11) |
| AT3G50290 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G02070 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G26450 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT2G28040 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G52680 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G11000 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT4G04221 | Natural antisense transcript overlaps with AT4G04220;(source:Araport11) |
| AT3G04020 | hypothetical protein;(source:Araport11) |
| AT5G52020 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT3G29734 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 6.5e-179 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT3G42713 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT1G13490 | hypothetical protein (DUF1262);(source:Araport11) |
| AT5G44540 | Tapetum specific protein TAP35/TAP44;(source:Araport11) |
| AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
| AT2G22942 | growth factor;(source:Araport11) |
| AT1G73090 | WD repeat protein;(source:Araport11) |
| AT1G68238 | transmembrane protein;(source:Araport11) |
| AT4G32420 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G10750 | enhanced disease resistance-like protein (DUF1336);(source:Araport11) |
| AT4G24920 | secE/sec61-gamma protein transport protein;(source:Araport11) |
| AT2G35750 | transmembrane protein;(source:Araport11) |
| AT1G49520 | SWIB complex BAF60b domain-containing protein;(source:Araport11) |
| AT3G63445 | Natural antisense transcript overlaps with AT3G63440;(source:Araport11) |
| AT4G27510 | 2-isopropylmalate synthase;(source:Araport11) |
| AT2G21080 | Ras guanine nucleotide exchange factor K;(source:Araport11) |
| AT5G28515 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G27900 | CCT motif family protein;(source:Araport11) |
| AT3G58230 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
| AT5G07571 | Oleosin family protein;(source:Araport11) |
| AT1G63820 | CCT motif family protein;(source:Araport11) |
| AT3G08740 | elongation factor P (EF-P) family protein;(source:Araport11) |
| AT5G35660 | Glycine-rich protein family;(source:Araport11) |
| AT3G49190 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT1G53625 | hypothetical protein;(source:Araport11) |
| AT4G21950 | hypothetical protein;(source:Araport11) |
| AT1G13200 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G70209 | hypothetical protein;(source:Araport11) |
| AT4G28670 | cysteine-rich RECEPTOR-like kinase, putative (DUF26);(source:Araport11) |
| AT5G27505 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.5e-26 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G15770 | RNA binding protein;(source:Araport11) |
| AT1G64035 | pseudogene of serpin 2;(source:Araport11) |
| AT3G32387 | pseudogene of casein lytic proteinase B3;(source:Araport11) |
| AT5G43745 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
| AT1G56555 | transmembrane protein;(source:Araport11) |
| AT5G37445 | pseudogene of hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G31480 | hypothetical protein;(source:Araport11) |
| AT1G22930 | T-complex protein 11;(source:Araport11) |
| AT1G05140 | Peptidase M50 family protein;(source:Araport11) |
| AT4G26210 | Mitochondrial ATP synthase subunit G protein;(source:Araport11) |
| AT2G04050 | MATE efflux family protein;(source:Araport11) |
| AT3G06310 | Cox19-like CHCH family protein;(source:Araport11) |
| AT1G53420 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT4G19430 | hypothetical protein;(source:Araport11) |
| AT4G36245 | pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10) |
| AT1G15010 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT1G12510 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT3G22010 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT1G49920 | MuDR family transposase;(source:Araport11) |
| AT3G06410 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT3G21040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-20 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G06530 | ARM repeat superfamily protein;(source:Araport11) |
| AT2G22760 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G17280 | oxidoreductase-like protein, amino-terminal protein;(source:Araport11) |
| AT4G29580 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT3G58980 | F-box family protein;(source:Araport11) |
| AT1G06475 | transmembrane protein;(source:Araport11) |
| AT3G23245 | hypothetical protein;(source:Araport11) |
| AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT1G50760 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT4G03290 | EF hand calcium-binding protein family;(source:Araport11) |
| AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
| AT4G23860 | PHD finger protein-like protein;(source:Araport11) |
| AT1G33475 | SNARE-like superfamily protein;(source:Araport11) |
| AT3G13280 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G09876 | hypothetical protein;(source:Araport11) |
| AT5G25170 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT5G44860 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
| AT3G21540 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT4G23930 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT4G32000 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G06545 | transmembrane protein;(source:Araport11) |
| AT3G50520 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT5G50175 | transmembrane protein;(source:Araport11) |
| AT1G61830 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G28591 | Pseudogene of AT1G28610; GDSL-motif lipase, putative |
| AT1G51802 | Encodes a defensin-like (DEFL) family protein. |
| AT3G42580 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G12100.1);(source:TAIR10) |
| AT2G25780 | hypothetical protein (DUF1677);(source:Araport11) |
| AT3G15470 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G06630 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G14743 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
| AT5G60720 | electron transporter, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G35110 | hypothetical protein;(source:Araport11) |
| AT5G42510 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
| AT2G42970 | pre-tRNA tRNA-Arg (anticodon: ACG);(source:Araport11, TAIR10) |
| AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G56520 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G10620 | methyltransferase;(source:Araport11) |
| AT4G27380 | hypothetical protein;(source:Araport11) |
| AT5G57860 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G22635 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
| AT1G64340 | Serine/Threonine-kinase;(source:Araport11) |
| AT2G38905 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT5G16010 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein;(source:Araport11) |
| AT4G13180 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G45990 | ribosomal RNA small subunit methyltransferase G;(source:Araport11) |
| AT4G04423 | hypothetical protein;(source:Araport11) |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G61540 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
| AT5G11475 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT4G17080 | Histone H3 K4-specific methyltransferase SET7/9 family protein;(source:Araport11) |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT2G43932 | Pseudogene of AT2G43940; thiol methyltransferase, putative |
| AT1G50210 | pseudogene of NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G79720 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G80690 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT2G46455 | OxaA/YidC-like membrane insertion protein;(source:Araport11) |
| AT1G64140 | WRKY transcription factor;(source:Araport11) |
| AT2G37510 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G05520 | Outer membrane OMP85 family protein;(source:Araport11) |
| AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT4G17612 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT2G18876 | Encodes a microtubule-associated protein. |
| AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT4G32765 | pre-tRNA tRNA-Ser (anticodon: CGA);(source:Araport11, TAIR10) |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT1G48840 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT3G29310 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G28200 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, various predicted proteins, Arabidopsis thaliana;(source:TAIR10) |
| AT1G53340 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G03640 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT1G07750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G36000 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT3G51760 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G05591 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to Athila retroelement ORF2, putative;(source:TAIR10) |
| AT1G47930 | pseudogene of Glutamyl/glutaminyl-tRNA synthetase;(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT1G77730 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT1G33030 | O-methyltransferase family protein;(source:Araport11) |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT1G10410 | CW14 protein (DUF1336);(source:Araport11) |
| AT4G35985 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT2G44670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT1G21990 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G22080 | ubiquitin carboxyl-terminal hydrolase-like protein;(source:Araport11) |
| AT4G30100 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G40711 | hypothetical protein;(source:Araport11) |
| AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G03858 | Pseudogene of AT5G03960; IQD12 (IQ-domain 12); calmodulin binding protein |
| AT1G71460 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT4G08750 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G08760.1);(source:TAIR10) |
| AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G09690 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G34640 | peptidase;(source:Araport11) |
| AT5G17760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G24320 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G45500 | RNI-like superfamily protein;(source:Araport11) |
| AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
| AT1G74010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G52070 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G43310 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G45590 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G03210 | Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11) |
| AT4G15765 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT5G30495 | Fcf2 pre-rRNA processing protein;(source:Araport11) |
| AT4G12270 | Copper amine oxidase family protein;(source:Araport11) |
| AT2G32140 | transmembrane receptor;(source:Araport11) |
| AT1G69900 | Actin cross-linking protein;(source:Araport11) |
| AT5G42840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G48205 | Encodes a Plant thionin family protein |
| AT1G58010 | pseudogene of R-protein L3 B;(source:Araport11) |
| AT1G21475 | hypothetical protein (DUF506);(source:Araport11) |
| AT1G48145 | plant mobile domain protein;(source:Araport11) |
| AT5G16250 | transmembrane protein;(source:Araport11) |
| AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
| AT4G09784 | histone deacetylase;(source:Araport11) |
| AT2G22730 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G31890 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G55020 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
| AT1G61200 | homeobox-leucine zipper protein-like protein;(source:Araport11) |
| AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT3G48240 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G18485 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G12408 | pseudogene of zinc knuckle (CCHC-type) family protein |
| AT5G37230 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G51750 | hypothetical protein;(source:Araport11) |
| AT5G65860 | ankyrin repeat family protein;(source:Araport11) |
| AT1G10740 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G36659 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G19620 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT1G57860 | Translation protein SH3-like family protein;(source:Araport11) |
| AT4G05380 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT3G42150 | transmembrane protein;(source:Araport11) |
| AT4G21192 | Cytochrome c oxidase biogenesis protein Cmc1-like protein;(source:Araport11) |
| AT5G46940 | pectin methylesterase inhibitor |
| AT3G09250 | Nuclear transport factor 2 (NTF2) family protein;(source:Araport11) |
| AT2G13975 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
| AT2G24350 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G58795 | Natural antisense transcript overlaps with AT3G58790;(source:Araport11) |
| AT1G21670 | DPP6 amino-terminal domain protein;(source:Araport11) |
| AT3G10585 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G39330 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT5G15240 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT4G23580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G44280 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G01380 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G16810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G43760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT2G02890 | F-box family protein;(source:Araport11) |
| AT3G53430 | Ribosomal protein L11 family protein;(source:Araport11) |
| AT4G03437 | Pseudogene of AT4G03480; ankyrin repeat family protein |
| AT3G62570 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT2G04520 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT1G15900 | transmembrane protein;(source:Araport11) |
| AT3G45120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10) |
| AT1G70985 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G52610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.0e-18 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT3G59200 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G27300 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G07470 | Transcription factor IIA, alpha/beta subunit;(source:Araport11) |
| AT4G04790 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G23145 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
| AT2G25210 | Ribosomal protein L39 family protein;(source:Araport11) |
| AT3G58770 | hypothetical protein;(source:Araport11) |
| AT1G45100 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G16460 | zinc finger CCCH domain protein;(source:Araport11) |
| AT5G10890 | myosin heavy chain-like protein;(source:Araport11) |
| AT2G25737 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT4G37553 | Natural antisense transcript overlaps with AT4G37550 and AT4G37560;(source:Araport11) |
| AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G24733 | pseudogene of CCoAMT (caffeoyl-CoA 3-O-methyltransferase) |
| AT5G22315 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT1G28610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G67488 | Natural antisense transcript overlaps with AT5G67490;(source:Araport11) |
| AT3G60420 | phosphoglycerate mutase family protein;(source:Araport11) |
| AT2G17785 | zinc-binding protein-like protein;(source:Araport11) |
| AT3G05060 | SAR DNA-binding protein, putative, strong similarity to SAR DNA-binding protein-1 (Pisum sativum) GI:3132696; contains Pfam profile PF01798: Putative snoRNA binding domain; encodes NOP58-like protein |
| AT4G02655 | transmembrane protein;(source:Araport11) |
| AT1G78040 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G03960 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT3G07380 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT3G61490 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G03880 | sterol O-acyltransferase, putative (DUF1639);(source:Araport11) |
| AT4G20810 | transcription initiation factor IIE (TFIIE) alpha subunit family protein / general transcription factor TFIIE family protein;(source:Araport11) |
| AT1G02020 | nitroreductase family protein;(source:Araport11) |
| AT5G41640 | Mutants have decreased tolerance to osmotic stress. |
| AT1G26921 | hypothetical protein;(source:Araport11) |
| AT1G04457 | Pseudogene of AT2G33450; 50S ribosomal protein L28, chloroplast (CL28) |
| AT3G02160 | Bromodomain transcription factor;(source:Araport11) |
| AT5G05657 | late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G19850 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G19250 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
| AT4G21605 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G11860 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT4G10700 | F-box/kelch-repeat protein;(source:Araport11) |
| AT1G02470 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT5G07340 | Calreticulin family protein;(source:Araport11) |
| AT3G03700 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT1G68240 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G28610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G27495 | Encodes a defensin-like (DEFL) family protein. |
| AT1G27921 | Natural antisense transcript overlaps with AT1G27920;(source:Araport11) |
| AT3G46420 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G08106 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.7e-28 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G65280 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G22970 | hypothetical protein (DUF506);(source:Araport11) |
| AT1G79120 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G29870 | Aquaporin-like superfamily protein;(source:Araport11) |
| AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G08740 | hypothetical protein;(source:Araport11) |
| AT2G45040 | Matrixin family protein;(source:Araport11) |
| AT5G43180 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT4G07800 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G13250.1);(source:TAIR10) |
| AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT5G06420 | Zinc finger (CCCH-type/C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G69630 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G06990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G55340 | hypothetical protein (DUF1639);(source:Araport11) |
| AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
| AT5G05020 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G49580 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT5G41730 | Protein kinase family protein;(source:Araport11) |
| AT5G46010 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G53690 | Protein of unknown function that is homologous to At5g41010, which encodes a non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
| AT1G13609 | Encodes a defensin-like (DEFL) family protein. |
| AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
| AT1G12020 | hypothetical protein;(source:Araport11) |
| AT2G04010 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.3e-76 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G09385 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G30450 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT3G27700 | zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein;(source:Araport11) |
| AT3G28330 | F-box family protein-like protein;(source:Araport11) |
| AT5G18630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G63990 | Inositol monophosphatase family protein;(source:Araport11) |
| AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
| AT5G37520 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
| AT1G05950 | hypothetical protein;(source:Araport11) |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT1G57810 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 29%25 identity and 1.1e-12 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G50330 | pseudogene of methylesterase PCR A;(source:Araport11) |
| AT5G42235 | Encodes a defensin-like (DEFL) family protein. |
| AT1G24485 | ER protein carbohydrate-binding protein;(source:Araport11) |
| AT3G24680 | transposable_element_gene;(source:Araport11);similar to zinc finger protein, putative [Arabidopsis thaliana] (TAIR:AT2G15520.1);(source:TAIR10) |
| AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G47400 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G48390 | RNI-like superfamily protein;(source:Araport11) |
| AT4G02230 | Ribosomal protein L19e family protein;(source:Araport11) |
| AT5G09711 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G26610 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G56770 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G59130 | Subtilase family protein;(source:Araport11) |
| AT2G19060 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT5G40900 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT4G03120 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G02690 | hypothetical protein;(source:Araport11) |
| AT1G71370 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G23360 | GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11) |
| AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G12835 | hypothetical protein;(source:Araport11) |
| AT3G10970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G36130 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G45620 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
| AT4G21745 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
| AT5G64430 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G09540 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G06636 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-74 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G62130 | AAA-type ATPase family protein;(source:Araport11) |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT1G49960 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT2G21560 | nucleolar-like protein;(source:Araport11) |
| AT5G40545 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT2G38570 | hypothetical protein;(source:Araport11) |
| AT5G22440 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT1G20225 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G22104 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G47770 | Beta-galactosidase related protein;(source:Araport11) |
| AT4G17790 | SNARE associated Golgi protein family;(source:Araport11) |
| AT3G49055 | ATP-binding protein;(source:Araport11) |
| AT1G52510 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G06470 | Nucleotide/sugar transporter family protein;(source:Araport11) |
| AT3G15534 | hypothetical protein;(source:Araport11) |
| AT4G32290 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G05770 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G76020 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G01667 | hypothetical protein;(source:Araport11) |
| AT5G46200 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT1G08360 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT1G60150 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 28%25 identity and 3.6e-07 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
| AT3G44700 | transmembrane protein;(source:Araport11) |
| AT5G18470 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G19110 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G38750 | asparaginyl-tRNA synthetase family;(source:Araport11) |
| AT2G11970 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.1e-30 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT3G16060 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G11530 | Vacuolar protein sorting 55 (VPS55) family protein;(source:Araport11) |
| AT4G26580 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G36650 | CHUP1-like protein;(source:Araport11) |
| AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
| AT1G75760 | ER lumen protein retaining receptor family protein;(source:Araport11) |
| AT1G58050 | RNA helicase family protein;(source:Araport11) |
| AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G03341 | cold-regulated protein;(source:Araport11) |
| AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G40680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G52065.1);(source:TAIR10) |
| AT1G57730 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03900 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
| AT5G35180 | ENHANCED DISEASE RESISTANCE protein (DUF1336);(source:Araport11) |
| AT4G19730 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G38760 | nucleoporin (DUF3414);(source:Araport11) |
| AT5G03870 | Glutaredoxin family protein;(source:Araport11) |
| AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT2G24735 | other_RNA;(source:Araport11) |
| AT4G04693 | pseudogene of F-box family protein;(source:Araport11) |
| AT4G16475 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
| AT4G14650 | hypothetical protein;(source:Araport11) |
| AT3G51150 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT2G36885 | translation initiation factor;(source:Araport11) |
| AT1G52800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G14746 | neurogenic locus notch-like protein;(source:Araport11) |
| AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G28671 | hypothetical protein;(source:Araport11) |
| AT5G16960 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT4G17310 | hypothetical protein;(source:Araport11) |
| AT3G47010 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT3G58890 | RNI-like superfamily protein;(source:Araport11) |
| AT1G78800 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G32740 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT2G05060 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G26750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G31772 | Encodes a defensin-like (DEFL) family protein. |
| AT1G70380 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G56690 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G45460 | transmembrane protein;(source:Araport11) |
| AT3G21945 | cysteine-rich repeat secretory protein;(source:Araport11) |
| AT1G08035 | hypothetical protein;(source:Araport11) |
| AT5G13970 | midasin-like protein;(source:Araport11) |
| AT1G73750 | alpha/beta hydrolase family protein;(source:Araport11) |
| AT3G17640 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G52530 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT5G42765 | plasma membrane fusion protein;(source:Araport11) |
| AT1G02380 | transmembrane protein;(source:Araport11) |
| AT5G50840 | alpha-taxilin-like protein;(source:Araport11) |
| AT3G49668 | Natural antisense transcript overlaps with AT3G49670;(source:Araport11) |
| AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G41330 | Glutaredoxin family protein;(source:Araport11) |
| AT1G52540 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G54000 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G30930 | hypothetical protein;(source:Araport11) |
| AT3G29033 | glycine-rich protein;(source:Araport11) |
| AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT3G45090 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G22180 | hypothetical protein;(source:Araport11) |
| AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
| AT2G33796 | FBD-like domain family protein;(source:Araport11) |
| AT4G37440 | hypothetical protein;(source:Araport11) |
| AT4G28811 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT5G61970 | signal recognition particle-related / SRP-like protein;(source:Araport11) |
| AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G35555 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-177 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G28190 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
| AT3G09430 | peptide transporter family protein;(source:Araport11) |
| AT1G58025 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT2G43240 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G01830 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT5G27400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein; CONTAINS InterPro DOMAIN/s: Methyltransferase-16, putative (InterPro:IPR019410); BEST Arabidopsis thaliana protein match is: D-aminoacid aminotransferase-like PLP-dependent enzymes superfamily protein (TAIR:AT5G27410.2). Note that the At5g27410.2 gene model (TAIR10) of the adjacent locus has been obsoleted due to the lack of experimental support. |
| AT1G71840 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G24040 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G60750 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT3G18300 | hypothetical protein;(source:Araport11) |
| AT1G79990 | coatomer subunit beta-2;(source:Araport11) |
| AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G04404 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT3G57470 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
| AT3G56300 | Cysteinyl-tRNA synthetase, class Ia family protein;(source:Araport11) |
| AT4G32050 | neurochondrin family protein;(source:Araport11) |
| AT1G75550 | glycine-rich protein;(source:Araport11) |
| AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
| AT5G12410 | THUMP domain-containing protein;(source:Araport11) |
| AT3G12340 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT1G40104 | hypothetical protein;(source:Araport11) |
| AT5G64501 | pseudogene of pyrophosphorylase 6;(source:Araport11) |
| AT5G47590 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT2G21440 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G29150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G62030 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G53590 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT5G28690 | carboxylate clamp-TPR protein (DUF1685);(source:Araport11) |
| AT1G05660 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G06760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.4e-38 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G39580 | zinc finger C3H1 domain protein;(source:Araport11) |
| AT3G51090 | coiled-coil 90B-like protein (DUF1640);(source:Araport11) |
| AT5G18940 | Mo25 family protein;(source:Araport11) |
| AT3G29764 | pseudogene of DNA-directed RNA polymerase family protein;(source:Araport11) |
| AT2G01090 | Ubiquinol-cytochrome C reductase hinge protein;(source:Araport11) |
| AT2G37420 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT1G58130 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G15300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G53260 | Seed maturation protein;(source:Araport11) |
| AT3G45220 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT2G03270 | DNA-binding protein;(source:Araport11) |
| AT4G15755 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G47200 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT4G21215 | transmembrane protein;(source:Araport11) |
| AT3G13061 | Natural antisense transcript overlaps with AT3G13060;(source:Araport11) |
| AT4G16330 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G01930 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G04020 | calmodulin binding protein;(source:Araport11) |
| AT2G30925 | transmembrane protein;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT5G14495 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
| AT1G61360 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT2G39850 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G03360 | Glycosyltransferase family 61 protein;(source:Araport11) |
| AT3G47341 | transmembrane protein;(source:Araport11) |
| AT2G27060 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT2G38800 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT2G07420 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-170 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G35660 | erythroid differentiation factor-like protein;(source:Araport11) |
| AT2G21580 | Ribosomal protein S25 family protein;(source:Araport11) |
| AT1G75300 | encodes a protein whose sequence is similar to an isoflavone reductase |
| AT3G23760 | transferring glycosyl group transferase;(source:Araport11) |
| AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT3G52210 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G35120 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT5G41540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G41908 | hypothetical protein;(source:Araport11) |
| AT5G43211 | hypothetical protein;(source:Araport11) |
| AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G39880 | transmembrane protein;(source:Araport11) |
| AT5G59600 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G21830 | hypothetical protein;(source:Araport11) |
| AT5G45020 | Glutathione S-transferase family protein;(source:Araport11) |
| AT4G00170 | Plant VAMP (vesicle-associated membrane protein) family protein;(source:Araport11) |
| AT1G29560 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G11655 | hypothetical protein;(source:Araport11) |
| AT2G24670 | B3 domain protein (DUF313);(source:Araport11) |
| AT3G07350 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
| AT2G40200 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G20990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G23790 | calcium uniporter (DUF607);(source:Araport11) |
| AT2G47485 | hypothetical protein;(source:Araport11) |
| AT1G20130 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G66110 | hypothetical protein (DUF577);(source:Araport11) |
| AT4G09440 | hypothetical protein (DUF577);(source:Araport11) |
| AT2G17525 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G09850 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT3G62725 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-41 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G01750 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT4G15750 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
| AT3G01960 | hypothetical protein;(source:Araport11) |
| AT5G25340 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G38500 | B3 domain protein (DUF313);(source:Araport11) |
| AT4G26820 | GrpE-like protein;(source:Araport11) |
| AT3G24700 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G32960 | BRISC/BRCA1-A complex protein;(source:Araport11) |
| AT1G55152 | hypothetical protein;(source:Araport11) |
| AT1G09890 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT1G48530 | proteasome inhibitor-like protein;(source:Araport11) |
| AT1G47730 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G49990 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT1G11700 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G32130 | ER membrane protein complex subunit-like protein (DUF2012);(source:Araport11) |
| AT5G13350 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT4G18920 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G45530 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G47790 | SMAD/FHA domain-containing protein;(source:Araport11) |
| AT2G15240 | UNC-50 family protein;(source:Araport11) |
| AT1G71970 | hypothetical protein;(source:Araport11) |
| AT1G59850 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G34330 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G58000 | VQ motif-containing protein;(source:Araport11) |
| AT1G31100 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.7e-35 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G22217 | Encodes a defensin-like (DEFL) family protein. |
| AT3G28310 | hypothetical protein (DUF677);(source:Araport11) |
| AT2G36030 | hypothetical protein;(source:Araport11) |
| AT3G58430 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT5G08310 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G30830 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT2G01610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G07470 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30600.1);(source:TAIR10) |
| AT3G23470 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
| AT3G02900 | Low-density receptor-like protein;(source:Araport11) |
| AT1G12570 | Ortholog of maize IPE1 gene which is involved in pollen exine development. |
| AT3G46600 | GRAS family transcription factor;(source:Araport11) |
| AT5G56369 | Encodes a defensin-like (DEFL) family protein. |
| AT1G04778 | hypothetical protein;(source:Araport11) |
| AT3G57840 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G49740 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT5G41890 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G33890 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G27900 | coiled-coil protein;(source:Araport11) |
| AT2G43600 | Chitinase family protein;(source:Araport11) |
| AT3G52260 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G65720 | transmembrane protein;(source:Araport11) |
| AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT4G12735 | Encodes a peroxisomal protein. |
| AT4G39590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G02760 | RNI-like superfamily protein;(source:Araport11) |
| AT1G71730 | hypothetical protein;(source:Araport11) |
| AT5G15680 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G59530 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G04150 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G07572 | hypothetical protein;(source:Araport11) |
| AT4G20680 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT5G45095 | hypothetical protein;(source:Araport11) |
| AT2G35612 | copper amine oxidase family protein;(source:Araport11) |
| AT1G14960 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G78810 | hypothetical protein;(source:Araport11) |
| AT1G50750 | aminotransferase-like, mobile domain protein;(source:Araport11) |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT1G26900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G13810 | Restriction endonuclease, type II-like superfamily protein;(source:Araport11) |
| AT1G26590 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G03080 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT1G20060 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
| AT1G33510 | pseudogene of Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G01030 | enolase, putative (DUF3527);(source:Araport11) |
| AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
| AT3G46710 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT5G44530 | Subtilase family protein;(source:Araport11) |
| AT1G01240 | transmembrane protein;(source:Araport11) |
| AT1G36110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G22550 | NAD(P)H-quinone oxidoreductase subunit, putative (DUF581);(source:Araport11) |
| AT1G26920 | zinc finger CCHC domain protein;(source:Araport11) |
| AT3G61185 | Encodes a defensin-like (DEFL) family protein. |
| AT3G26140 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G36515 | trichohyalin-like protein;(source:Araport11) |
| AT1G21480 | Exostosin family protein;(source:Araport11) |
| AT1G67430 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT4G11540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G37895 | Natural antisense transcript overlaps with AT4G37890;(source:Araport11) |
| AT3G06920 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G13730 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT4G31520 | SDA1 family protein;(source:Araport11) |
| AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT4G19910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G21470 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT2G18570 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G15020 | hypothetical protein;(source:Araport11) |
| AT3G26390 | hypothetical protein;(source:Araport11) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT2G27375 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10) |
| AT3G10195 | Encodes a defensin-like (DEFL) family protein. |
| AT3G46280 | kinase-like protein;(source:Araport11) |
| AT4G16447 | hypothetical protein;(source:Araport11) |
| AT2G42660 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT1G07473 | hypothetical protein;(source:Araport11) |
| AT3G54980 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G51370 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G40720 | C3H4 type zinc finger protein (DUF23);(source:Araport11) |
| AT3G24250 | glycine-rich protein;(source:Araport11) |
| AT5G43550 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT2G42710 | Ribosomal protein L1p/L10e family;(source:Araport11) |
| AT2G42760 | DUF1685 family protein;(source:Araport11) |
| AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT2G36180 | EF hand calcium-binding protein family;(source:Araport11) |
| AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G01700 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT4G30040 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G14103 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G14345 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT2G27500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G27420 | bromodomain testis-specific protein;(source:Araport11) |
| AT2G06660 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.3e-43 P-value blast match to GB:S20478 hypothetical protein (Mariner_Tc1-element) (Drosophila melanogaster);(source:TAIR10) |
| AT2G46300 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G29830 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G69610 | zinc finger FYVE domain protein, putative (DUF1666);(source:Araport11) |
| AT4G16540 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT5G38895 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G37870 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G36052 | Natural antisense transcript overlaps with AT4G36050;(source:Araport11) |
| AT3G07940 | Calcium-dependent ARF-type GTPase activating protein family;(source:Araport11) |
| AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G03080 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-10 P-value blast match to GB:AAC24836 pol polyprotein (Ty1_Copia-element) (Candida albicans);(source:TAIR10) |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT1G34545 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-112 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
| AT1G30250 | hypothetical protein;(source:Araport11) |
| AT3G42791 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-56 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT4G11385 | hypothetical protein;(source:Araport11) |
| AT1G12960 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT4G38980 | hypothetical protein;(source:Araport11) |
| AT1G30180 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-115 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G24165 | hypothetical protein;(source:Araport11) |
| AT4G26375 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
| AT2G33180 | hypothetical protein;(source:Araport11) |
| AT1G04720 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT4G26190 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G14630 | XRI1-like protein;(source:Araport11) |
| AT5G41550 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
| AT2G05200 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.3e-42 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G16892 | other_RNA;(source:Araport11) |
| AT1G23201 | GCK domain protein;(source:Araport11) |
| AT1G02816 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G22720 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G49860 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G14370 | CCT motif family protein;(source:Araport11) |
| AT1G30790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G75990 | PAM domain (PCI/PINT associated module) protein;(source:Araport11) |
| AT5G03330 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G23370 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
| AT1G26460 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G03130 | BRCT domain-containing DNA repair protein;(source:Araport11) |
| AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G02840 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT4G17990 | hypothetical protein;(source:Araport11) |
| AT5G04120 | Encodes a cofactor-dependent phosphoglycerate mutase (dPGM) - like protein with phosphoserine phosphatase activity that may be responsible for serine anabolism. |
| AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
| AT5G51880 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G28915 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.3e-24 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G52370 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT4G18180 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G58930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G10460 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G48800 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT3G46382 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0416D03.16, similar to non-LTR reverse transcriptase, putative;(source:TAIR10) |
| AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
| AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G18700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT4G01897 | dihydroorotate dehydrogenase;(source:Araport11) |
| AT5G18540 | E3 ubiquitin-protein ligase;(source:Araport11) |
| AT5G63070 | Ribosomal protein S19 family protein;(source:Araport11) |
| AT2G45340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G26940 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT5G67550 | transmembrane protein;(source:Araport11) |
| AT3G45851 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT1G70518 | other_RNA;(source:Araport11) |
| AT2G36780 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G06148 | hypothetical protein;(source:Araport11) |
| AT2G05435 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.5e-19 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT1G49500 | transcription initiation factor TFIID subunit 1b-like protein;(source:Araport11) |
| AT5G04730 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT3G54570 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
| AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT5G18037 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT2G36724 | transmembrane protein;(source:Araport11) |
| AT2G18720 | Translation elongation factor EF1A/initiation factor IF2gamma family protein;(source:Araport11) |
| AT3G23255 | tRNA dimethylallyltransferase;(source:Araport11) |
| AT2G46535 | hypothetical protein;(source:Araport11) |
| AT3G28200 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G19150 | Ankyrin repeat family protein;(source:Araport11) |
| AT4G23915 | Encodes an alanine tRNA with the anticodon CGC that recognizes the alanine codon GCG. |
| AT2G03130 | Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11) |
| AT5G16360 | NC domain-containing protein-like protein;(source:Araport11) |
| AT1G69460 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G66250 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G45510 | RING/U-box protein;(source:Araport11) |
| AT4G01895 | systemic acquired resistance (SAR) regulator protein NIMIN-1-like protein;(source:Araport11) |
| AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
| AT5G37530 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G12915 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.4e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G71865 | PyrD;(source:Araport11) |
| AT5G03810 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G68410 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G75890 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G18820 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
| AT4G28940 | Phosphorylase superfamily protein;(source:Araport11) |
| AT4G14020 | Rapid alkalinization factor (RALF) family protein;(source:Araport11) |
| AT5G52760 | Copper transport protein family;(source:Araport11) |
| AT2G09840 | nucleic acid/zinc ion-binding protein;(source:Araport11) |
| AT3G60238 | other_RNA;(source:Araport11) |
| AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
| AT5G04250 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G69710 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT2G13274 | Pseudogene of AT2G13150; transcription factor |
| AT3G60510 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
| AT1G22460 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G65000 | F-box only protein;(source:Araport11) |
| AT4G11900 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT2G04290 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.1e-36 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G16650 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G22850 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G33467 | hypothetical protein;(source:Araport11) |
| AT2G20720 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G02450 | Ribosomal protein L36e family protein;(source:Araport11) |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G80200 | transmembrane protein;(source:Araport11) |
| AT1G45904 | pseudogene of photosystem II reaction center protein G;(source:Araport11) |
| AT5G58800 | Quinone reductase family protein;(source:Araport11) |
| AT5G06590 | hypothetical protein;(source:Araport11) |
| AT1G56630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G26010 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G38870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
| AT5G23970 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G60460 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
| AT1G76870 | transcription factor;(source:Araport11) |
| AT4G22490 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT2G01913 | hypothetical protein;(source:Araport11) |
| AT1G54955 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05145.1);(source:TAIR10) |
| AT5G43015 | Mutator-like transposase family, has a 2.3e-39 P-value blast match to GB:AAA21566 mudrA of transposon= MuDR (MuDr-element) (Zea mays) |
| AT5G43105 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-39 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT2G26790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G22410 | Class-II DAHP synthetase family protein;(source:Araport11) |
| AT4G06658 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-182 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT1G30430 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT2G35140 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT1G63295 | Remorin family protein;(source:Araport11) |
| AT5G54850 | hexon;(source:Araport11) |
| AT3G47070 | thylakoid soluble phosphoprotein;(source:Araport11) |
| AT4G28070 | AFG1-like ATPase family protein;(source:Araport11) |
| AT5G19485 | transferases/nucleotidyltransferase;(source:Araport11) |
| AT2G33320 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G18420 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
| AT4G02715 | flocculation FLO11-like protein;(source:Araport11) |
| AT5G55900 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
| AT2G10830 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G48770 | hypothetical protein (DUF1639);(source:Araport11) |
| AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT2G29070 | Ubiquitin fusion degradation UFD1 family protein;(source:Araport11) |
| AT3G17265 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G24805 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G19740 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G65274 | ARP2/3 complex 16 kDa subunit (p16-Arc);(source:Araport11) |
| AT3G42190 | transposable_element_gene;(source:Araport11);similar to cysteine-type peptidase [Arabidopsis thaliana] (TAIR:AT3G42820.1);(source:TAIR10) |
| AT5G08440 | transmembrane protein;(source:Araport11) |
| AT1G55430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G31150 | ATP binding / ATPase;(source:Araport11) |
| AT4G12423 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT3G50210 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G11230 | transmembrane protein, putative (DUF761);(source:Araport11) |
| AT1G15120 | Ubiquinol-cytochrome C reductase hinge protein;(source:Araport11) |
| AT4G20790 | Leucine-rich repeat protein kinase family protein |
| AT3G49950 | GRAS family transcription factor;(source:Araport11) |
| AT3G28412 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
| AT5G37480 | maltase-glucoamylase, intestinal protein;(source:Araport11) |
| AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT1G54920 | hypothetical protein;(source:Araport11) |
| AT1G67420 | Zn-dependent exopeptidases superfamily protein;(source:Araport11) |
| AT4G37520 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G25950 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT3G21650 | Encodes protein phosphatase 2A (PP2A) B'zeta subunit. Targeted to mitochondria. |
| AT5G27280 | Zim17-type zinc finger protein;(source:Araport11) |
| AT5G23510 | hypothetical protein;(source:Araport11) |
| AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT3G25460 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G08580 | hypothetical protein;(source:Araport11) |
| AT1G12663 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. |
| AT3G47000 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT4G31960 | hypothetical protein;(source:Araport11) |
| AT1G03520 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G19750 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT1G21020 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G08740.1);(source:TAIR10) |
| AT5G04390 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT2G33175 | transmembrane protein;(source:Araport11) |
| AT5G17380 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT3G11510 | Ribosomal protein S11 family protein;(source:Araport11) |
| AT5G51180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G54240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35170 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G58193 | snoRNA;(source:Araport11) |
| AT5G59350 | transmembrane protein;(source:Araport11) |
| AT5G38670 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G34020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G36130 | Ribosomal protein L2 family;(source:Araport11) |
| AT1G24350 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT2G25185 | Encodes a defensin-like (DEFL) family protein. |
| AT1G51000 | hypothetical protein;(source:Araport11) |
| AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G28535 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-97 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT2G20970 | lipid-binding protein;(source:Araport11) |
| AT5G53440 | LOW protein: zinc finger CCCH domain protein;(source:Araport11) |
| AT5G39955 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.7e-26 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G14250 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is split into two UBX domain-containing pseudogenes: one retains the original name: AT4G14250 (Chr4:8213237..8211984), one given a new locus identifier AT4G14245 (Chr4:8210231..8208985). Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT4G10390 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G15910 | hypothetical protein;(source:Araport11) |
| AT1G68390 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G58830 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G32160 | Phox (PX) domain-containing protein;(source:Araport11) |
| AT4G36648 | other_RNA;(source:Araport11) |
| AT3G50380 | vacuolar protein sorting-associated protein, putative (DUF1162);(source:Araport11) |
| AT5G42730 | pseudogene similar to ACT domain-containing protein, similar to F-box family protein |
| AT3G22800 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G30290 | unknown protein |
| AT4G32930 | hypothetical protein;(source:Araport11) |
| AT2G12770 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-24 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT4G24750 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT5G40000 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G11390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G23090 | transmembrane protein;(source:Araport11) |
| AT3G12970 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT2G25320 | TRAF-like family protein;(source:Araport11) |
| AT1G34046 | Ankyrin-repeat containing protein;(source:Araport11) |
| AT2G19320 | hypothetical protein;(source:Araport11) |
| AT2G38350 | hypothetical protein;(source:Araport11) |
| AT5G62730 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G37290 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G16670 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT2G31050 | Cupredoxin superfamily protein;(source:Araport11) |
| AT5G11130 | Exostosin family protein;(source:Araport11) |
| AT2G06340 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G35780 | N-lysine methyltransferase;(source:Araport11) |
| AT4G26950 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G28170 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35110.1);(source:TAIR10) |
| AT3G27895 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G56670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G06000 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G66620 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT4G27657 | hypothetical protein;(source:Araport11) |
| AT3G02832 | other_RNA;(source:Araport11) |
| AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT1G56620 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G59140 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT2G41450 | N-acetyltransferase;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
| AT2G15550 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G16410.1);(source:TAIR10) |
| AT2G43235 | phosphoribosylformylglycinamidine synthase;(source:Araport11) |
| AT5G27043 | pseudogene of cell division cycle 20.2;(source:Araport11) |
| AT2G26692 | Natural antisense transcript overlaps with AT2G26690;(source:Araport11) |
| AT5G02000 | hypothetical protein;(source:Araport11) |
| AT1G19160 | F-box family protein;(source:Araport11) |
| AT1G45211 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT2G47680 | zinc finger (CCCH type) helicase family protein;(source:Araport11) |
| AT1G50020 | tubulin alpha-6 chain;(source:Araport11) |
| AT1G27710 | Glycine-rich protein family;(source:Araport11) |
| AT2G30100 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT3G44630 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G47940 | DNAJ heat shock family protein;(source:Araport11) |
| AT3G43250 | coiled-coil protein (DUF572);(source:Araport11) |
| AT5G47229 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G60590 | DHBP synthase RibB-like alpha/beta domain-containing protein;(source:Araport11) |
| AT5G07980 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G54920 | polyadenylate-binding protein interacting protein;(source:Araport11) |
| AT4G25410 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G01542 | Natural antisense transcript overlaps with AT5G01540;(source:Araport11) |
| AT2G05720 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT1G12450 | SNARE associated Golgi protein family;(source:Araport11) |
| AT3G17550 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G06780 | glycine-rich protein;(source:Araport11) |
| AT5G46105 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT1G65920 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT2G28755 | UDP-D-glucuronate carboxy-lyase-like protein;(source:Araport11) |
| AT3G48550 | SHOOT GRAVITROPISM-like protein;(source:Araport11) |
| AT1G04780 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G12590 | hypothetical protein;(source:Araport11) |
| AT5G50130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G51730 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G10690 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-256 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G20990 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G32436 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 8.5e-34 P-value blast match to GB:CAB39733 rotease, reverse transcriptase, ribonuclease H, integrase (Gypsy_Ty3-element) (Drosophila buzzatii);(source:TAIR10) |
| AT5G10320 | ATP synthase subunit B;(source:Araport11) |
| AT2G23680 | Cold acclimation protein WCOR413 family;(source:Araport11) |
| AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G54095 | DUF1677 family protein, putative (DUF1677);(source:Araport11) |
| AT1G22010 | hypothetical protein;(source:Araport11) |
| AT3G51280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G13755 | Encodes a defensin-like (DEFL) family protein. |
| AT3G16880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G13448 | Natural antisense transcript overlaps with AT1G13450;(source:Araport11) |
| AT1G27670 | transmembrane protein;(source:Araport11) |
| AT1G26773 | hypothetical protein;(source:Araport11) |
| AT3G04230 | Ribosomal protein S5 domain 2-like superfamily protein;(source:Araport11) |
| AT3G60972 | other_RNA;(source:Araport11) |
| AT5G27990 | Pre-rRNA-processing protein TSR2, conserved region;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G19895 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G24696 | transcriptional factor B3 family protein;(source:Araport11) |
| AT1G06420 | DNA ligase-like protein;(source:Araport11) |
| AT5G64090 | hyccin;(source:Araport11) |
| AT3G28640 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G76270 | O-fucosyltransferase family protein;(source:Araport11) |
| AT5G05130 | DNA/RNA helicase protein;(source:Araport11) |
| AT4G16165 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT5G24155 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT3G57160 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT1G49250 | ATP-dependent DNA ligase;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT4G36560 | transmembrane protein;(source:Araport11) |
| AT4G17250 | transmembrane protein;(source:Araport11) |
| AT4G19865 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT5G41401 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G09510 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
| AT1G58265 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT1G19070 | F-box family protein;(source:Araport11) |
| AT1G30930 | F-box family protein;(source:Araport11) |
| AT5G38870 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G33905 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT1G16705 | p300/CBP acetyltransferase-related protein-like protein;(source:Araport11) |
| AT3G46500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G59770 | Protein-tyrosine phosphatase-like, PTPLA;(source:Araport11) |
| AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G24290 | AAA-type ATPase family protein;(source:Araport11) |
| AT1G27000 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
| AT1G78820 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT5G59850 | Ribosomal protein S8 family protein;(source:Araport11) |
| AT1G16820 | vacuolar ATP synthase catalytic subunit-related / V-ATPase-related / vacuolar proton pump-like protein;(source:Araport11) |
| AT3G62580 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G28680 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT5G31821 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT3G61660 | hypothetical protein;(source:Araport11) |
| AT4G34670 | Ribosomal protein S3Ae;(source:Araport11) |
| AT3G53330 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT3G06770 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G16024 | hypothetical protein;(source:Araport11) |
| AT3G49820 | hypothetical protein;(source:Araport11) |
| AT5G65490 | suppressor-like protein;(source:Araport11) |
| AT4G02170 | cotton fiber protein;(source:Araport11) |
| AT3G46810 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G19860 | transmembrane protein, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT5G35450 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT2G31930 | protein of unknown function |
| AT1G31080 | F-box family protein;(source:Araport11) |
| AT2G36430 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT1G29140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT4G09770 | TRAF-like family protein;(source:Araport11) |
| AT4G25690 | stress response NST1-like protein;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G20060 | Ribosomal protein L4/L1 family;(source:Araport11) |
| AT1G34230 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBb0041J06.18, blastp match of 33%25 identity and 2.8e-10 P-value to GP|27818010|dbj|BAC55773.1||AP005176 OSJNBb0041J06.18 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
| AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G10750 | FBD domain family;(source:Araport11) |
| AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
| AT4G28920 | hypothetical protein (DUF626);(source:Araport11) |
| AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT5G47540 | Mo25 family protein;(source:Araport11) |
| AT3G26805 | pseudogene of Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT4G12150 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G35732 | hypothetical protein;(source:Araport11) |
| AT1G06260 | Cysteine peptidase,activity detected in leaf and flower. |
| AT2G29320 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
| AT5G49800 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G50040 | formin-like protein, putative (DUF1005);(source:Araport11) |
| AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G49307 | Expressed protein;(source:Araport11) |
| AT4G26675 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT3G05545 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G03880 | Thioredoxin family protein;(source:Araport11) |
| AT2G14840 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
| AT4G28830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G79100 | arginine/serine-rich protein-like protein;(source:Araport11) |
| AT5G53710 | hypothetical protein;(source:Araport11) |
| AT5G67620 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT1G59630 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G36460 | transmembrane protein;(source:Araport11) |
| AT1G02420 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G31130 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
| AT1G18130 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT2G12340 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.6e-31 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G04495 | transmembrane protein;(source:Araport11) |
| AT2G12475 | Encodes a defensin-like (DEFL) family protein. |
| AT1G28310 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT1G29600 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT2G34750 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
| AT2G26500 | cytochrome b6f complex subunit (petM);(source:Araport11) |
| AT1G03290 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT5G54530 | serine protease, putative (Protein of unknown function, DUF538);(source:Araport11) |
| AT1G43680 | nucleic acid-binding/zinc ion-binding protein;(source:Araport11) |
| AT5G12940 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT4G24590 | RING finger protein;(source:Araport11) |
| AT2G41342 | hypothetical protein;(source:Araport11) |
| AT3G43910 | MutS2;(source:Araport11) |
| AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G62450 | DNA mismatch repair protein;(source:Araport11) |
| AT1G11280 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G23670 | OBP32pep protein, putative (DUF220);(source:Araport11) |
| AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT1G68420 | Class II aaRS and biotin synthetases superfamily protein;(source:Araport11) |
| AT3G60040 | F-box family protein;(source:Araport11) |
| AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
| AT4G01730 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G30790 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.0e-149 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT4G22320 | golgin family A protein;(source:Araport11) |
| AT2G32840 | proline-rich family protein;(source:Araport11) |
| AT3G56730 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G35760 | Beta-galactosidase related protein;(source:Araport11) |
| AT1G28260 | Telomerase activating protein Est1;(source:Araport11) |
| AT1G78550 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G13110 | BSD domain-containing protein;(source:Araport11) |
| AT5G55360 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT5G43790 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT2G38370 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
| AT2G10537 | other_RNA;(source:Araport11) |
| AT3G29034 | transmembrane protein;(source:Araport11) |
| AT3G44770 | transmembrane protein, putative (DUF626);(source:Araport11) |
| AT4G24175 | kinesin-like protein;(source:Araport11) |
| AT2G34270 | hypothetical protein;(source:Araport11) |
| AT5G38820 | Encodes a putative amino acid transporter. |
| AT1G57660 | Translation protein SH3-like family protein;(source:Araport11) |
| AT2G14878 | other_RNA;(source:Araport11) |
| AT1G75570 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
| AT5G23665 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT2G46550 | transmembrane protein;(source:Araport11) |
| AT5G59450 | GRAS family transcription factor;(source:Araport11) |
| AT1G14550 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G24510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G66220 | Chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT1G23910 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G58260 | TRAF-like family protein;(source:Araport11) |
| AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
| AT2G04115 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT1G73390 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT3G53740 | Ribosomal protein L36e family protein;(source:Araport11) |
| AT1G09900 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT3G10250 | histidine-tRNA ligase;(source:Araport11) |
| AT3G42178 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-197 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G19200 | hypothetical protein;(source:Araport11) |
| AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT2G01990 | XRI1-like protein;(source:Araport11) |
| AT4G15590 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-50 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G14890 | potassium transporter;(source:Araport11) |
| AT2G40990 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G50220 | F-box family protein;(source:Araport11) |
| AT3G16415 | pseudogene of myrosinase-binding protein 2;(source:Araport11) |
| AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G54780 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT1G52000 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G41360 | galactose oxidase/kelch repeat protein;(source:Araport11) |
| AT4G16190 | Papain family cysteine protease;(source:Araport11) |
| AT4G17585 | aluminum activated malate transporter family protein;(source:Araport11) |
| AT4G36790 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G04190 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G17064 | Pseudogene of AT2G17080 |
| AT5G59760 | hypothetical protein (DUF1635);(source:Araport11) |
| AT5G43100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G37670 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G66770 | GRAS family transcription factor;(source:Araport11) |
| AT1G04140 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
| AT3G45560 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT3G03040 | F-box/RNI-like superfamily protein. Idenfitied in GWAS as locus involved in response to the defense molecule, allyl glucosinolate. |
| AT4G01533 | other_RNA;(source:Araport11) |
| AT5G01570 | plectin-like protein;(source:Araport11) |
| AT2G05330 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT1G27100 | Actin cross-linking protein;(source:Araport11) |
| AT5G50361 | hypothetical protein;(source:Araport11) |
| AT3G55890 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT2G20740 | Tetraspanin family protein;(source:Araport11) |
| AT2G33000 | ubiquitin-associated (UBA)/TS-N domain-containing protein-like protein;(source:Araport11) |
| AT3G15909 | hypothetical protein;(source:Araport11) |
| AT4G19450 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G10070 | KH domain-containing protein;(source:Araport11) |
| AT3G07110 | Ribosomal protein L13 family protein;(source:Araport11) |
| AT3G10290 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT2G29654 | transmembrane protein;(source:Araport11) |
| AT3G04715 | Based on qRT-PCR data, this annotated pseudogene is expressed and upregulated in response to infection with the yellow strain of Cucumber mosaic virus in C24 and Col-0. Exhibited higher levels of H3K27me3; H3K27me3 was significantly decreased (fourfold) in response to infection with CMV(Y). |
| AT5G52490 | Fibrillarin family protein;(source:Araport11) |
| AT3G54940 | Papain family cysteine protease;(source:Araport11) |
| AT2G37362 | Natural antisense transcript overlaps with AT2G37360;(source:Araport11) |
| AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT2G27260 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G02670 | hypothetical protein;(source:Araport11) |
| AT3G16750 | hypothetical protein;(source:Araport11) |
| AT3G18350 | Plant protein of unknown function (DUF639);(source:TAIR10) |
| AT3G48745 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT5G49560 | Putative methyltransferase family protein;(source:Araport11) |
| AT5G27902 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.3e-51 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT2G19150 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G19010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G30840 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT1G50050 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT2G36720 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT5G25400 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G77500 | DUF630 family protein, putative (DUF630 and DUF632);(source:Araport11) |
| AT4G26240 | histone-lysine N-methyltransferase;(source:Araport11) |
| AT5G53600 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT5G26600 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT4G12900 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
| AT1G57850 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G39235 | hypothetical protein;(source:Araport11) |
| AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT3G58877 | hypothetical protein;(source:Araport11) |
| AT5G16450 | Ribonuclease E inhibitor RraA/Dimethylmenaquinone methyltransferase;(source:Araport11) |
| AT1G14670 | Endomembrane protein 70 protein family;(source:Araport11) |
| AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G15270 | glucosyltransferase-like protein;(source:Araport11) |
| AT5G51390 | hypothetical protein;(source:Araport11) |
| AT1G61440 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT3G05170 | Phosphoglycerate mutase family protein;(source:Araport11) |
| AT3G53390 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G49580 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G11150 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G40205 | Ribosomal protein L41 family;(source:Araport11) |
| AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G57330 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT5G35680 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT5G51470 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT1G08440 | aluminum activated malate transporter family protein;(source:Araport11) |
| AT3G42545 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.5e-26 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G13840 | GRAS family transcription factor;(source:Araport11) |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT1G18210 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT2G47200 | hypothetical protein;(source:Araport11) |
| AT5G19100 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G14060 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus) |
| AT1G62075 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-28 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
| AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G52605 | Natural antisense transcript overlaps with AT3G52610;(source:Araport11) |
| AT3G10200 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G10946 | hypothetical protein;(source:Araport11) |
| AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
| AT1G53790 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G34560 | transmembrane protein;(source:Araport11) |
| AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT2G20465 | Encodes a defensin-like (DEFL) family protein. |
| AT4G33860 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT3G59695 | Natural antisense transcript overlaps with AT3G59690;(source:Araport11) |
| AT4G39290 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G30570 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 7.9e-38 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
| AT5G25070 | neurofilament light protein;(source:Araport11) |
| AT2G29860 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G56200 | Encodes a transcription factor expressed in the female gametophyte. |
| AT1G28695 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT1G78760 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G41110 | meiosis chromosome segregation family protein;(source:Araport11) |
| AT4G19160 | transglutaminase family protein;(source:Araport11) |
| AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
| AT4G15460 | glycine-rich protein;(source:Araport11) |
| AT3G61500 | BPS1-like protein;(source:Araport11) |
| AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G03820 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G35820 | 2-oxoglutarate-dependent dioxygenase |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT3G13070 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
| AT5G35073 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.3e-39 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
| AT1G80800 | pseudogene of Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT4G08076 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-64 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G16560 | Per1-like family protein;(source:Araport11) |
| AT4G01740 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
| AT4G28820 | HIT-type Zinc finger family protein;(source:Araport11) |
| AT5G03510 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT2G17940 | WEB family protein (DUF827);(source:Araport11) |
| AT4G08730 | RNA-binding protein;(source:Araport11) |
| AT5G08320 | E2F-associated phosphoprotein;(source:Araport11) |
| AT5G25425 | glycine-rich protein;(source:Araport11) |
| AT1G33420 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT5G51670 | hypothetical protein (DUF668);(source:Araport11) |
| AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
| AT5G03020 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT1G32780 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
| AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
| AT3G53080 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
| AT1G67130 | F-box family protein;(source:Araport11) |
| AT1G73050 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT3G56180 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G14800 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.1e-83 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
| AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT1G11620 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G62800 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G03670 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G11040 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT4G28900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT4G03410 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT4G35510 | PHD finger-like protein;(source:Araport11) |
| AT1G71240 | chromosome-partitioning protein, putative (DUF639);(source:Araport11) |
| AT3G21352 | transmembrane protein;(source:Araport11) |
| AT3G09915 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G15480 | fiber (DUF1218);(source:Araport11) |
| AT3G28220 | TRAF-like family protein;(source:Araport11) |
| AT5G56790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G19890 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G19140 | exopolysaccharide production negative regulator;(source:Araport11) |
| AT5G58210 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G65495 | hypothetical protein;(source:Araport11) |
| AT5G24915 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-38 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G28088 | Low temperature and salt responsive protein family;(source:Araport11) |
| AT3G23970 | F-box family protein;(source:Araport11) |
| AT2G18690 | transmembrane protein;(source:Araport11) |
| AT5G45790 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G11410 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G05240 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G74580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G19940 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G67010 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT5G48575 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
| AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
| AT5G13560 | structural maintenance of chromosomes protein;(source:Araport11) |
| AT2G15300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT3G25490 | Protein kinase family protein;(source:Araport11) |
| AT4G40011 | hypothetical protein;(source:Araport11) |
| AT5G56075 | methyltransferase small domain protein, putative (DUF2431);(source:Araport11) |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT1G70640 | octicosapeptide/Phox/Bem1p (PB1) domain-containing protein;(source:Araport11) |
| AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT3G51980 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G43730 | transposable_element_gene;(source:Araport11);pseudogene, similar to ring-infested erythrocyte surface antigen, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287;(source:TAIR10) |
| AT3G06335 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT2G16670 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-190 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT2G22720 | SPT2 chromatin protein;(source:Araport11) |
| AT5G13760 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT3G20150 | Kinesin motor family protein;(source:Araport11) |
| AT3G30740 | pseudogene of Ribosomal protein S25 family protein;(source:Araport11) |
| AT5G24206 | other_RNA;(source:Araport11) |
| AT2G39750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G09160 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G33180 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-05 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT2G06296 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G07160 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT2G03020 | Heat shock protein HSP20/alpha crystallin family;(source:Araport11) |
| AT2G01580 | transmembrane protein;(source:Araport11) |
| AT5G38393 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G04840 | Ribosomal protein S3Ae;(source:Araport11) |
| AT5G53990 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G22100 | Inositol-pentakisphosphate 2-kinase family protein;(source:Araport11) |
| AT2G19890 | hypothetical protein;(source:Araport11) |
| AT4G06640 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 6.4e-159 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
| AT3G60990 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT1G74790 | catalytics;(source:Araport11) |
| AT5G37340 | ZPR1 zinc-finger domain protein;(source:Araport11) |
| AT4G21213 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G75800 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT3G43825 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.3e-106 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G46050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G54290 | Translation initiation factor SUI1 family protein;(source:Araport11) |
| AT5G48050 | Copia-like polyprotein/retrotransposon;(source:Araport11) |
| AT5G01215 | Natural antisense transcript overlaps with AT5G01210;(source:Araport11) |
| AT5G22460 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G44400 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G25810 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT1G63960 | Copper transport protein family;(source:Araport11) |
| AT3G25590 | micronuclear linker histone polyprotein-like protein;(source:Araport11) |
| AT1G06320 | hypothetical protein;(source:Araport11) |
| AT5G39460 | F-box family protein;(source:Araport11) |
| AT3G27880 | hypothetical protein (DUF1645);(source:Araport11) |
| AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT5G46660 | protein kinase C-like zinc finger protein;(source:Araport11) |
| AT1G16025 | hypothetical protein;(source:Araport11) |
| AT2G24592 | hypothetical protein;(source:Araport11) |
| AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
| AT5G48657 | defense protein-like protein;(source:Araport11) |
| AT5G38010 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G21000 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-22 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G21080 | ABC transporter-like protein;(source:Araport11) |
| AT5G08139 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G64670 | Ribosomal protein L18e/L15 superfamily protein;(source:Araport11) |
| AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT4G16748 | other_RNA;(source:Araport11) |
| AT4G01671 | transmembrane protein;(source:Araport11) |
| AT5G25770 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G43980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G03180 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G75360 | transmembrane protein;(source:Araport11) |
| AT3G58280 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G34970 | Trimeric LpxA-like enzyme;(source:Araport11) |
| AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
| AT2G44660 | ALG6, ALG8 glycosyltransferase family;(source:Araport11) |
| AT3G50880 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT4G33140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT3G15770 | hypothetical protein;(source:Araport11) |
| AT1G67180 | zinc finger (C3HC4-type RING finger) family protein / BRCT domain-containing protein;(source:Araport11) |
| AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
| AT2G04190 | TRAF-like family protein;(source:Araport11) |
| AT3G57930 | rho GTPase-activating gacO-like protein;(source:Araport11) |
| AT1G20490 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G34925 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.3e-38 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G10320 | tRNA synthetase class I (I, L, M and V) family protein;(source:Araport11) |
| AT5G17390 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT5G39473 | pseudogene of DC1 (domain-containing protein) |
| AT3G58210 | TRAF-like family protein;(source:Araport11) |
| AT2G47550 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G75280 | isoflavone reductase, putative, identical to SP:P52577 Isoflavone reductase homolog P3 (EC 1.3.1.-) {Arabidopsis thaliana}; contains Pfam profile PF02716: isoflavone reductase. Involved in response to oxidative stress. The mRNA is cell-to-cell mobile. |
| AT2G32050 | cell cycle control-like protein (DUF572);(source:Araport11) |
| AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT2G30680 | callose synthase-like protein;(source:Araport11) |
| AT1G21470 | hypothetical protein;(source:Araport11) |
| AT3G62730 | desiccation-like protein;(source:Araport11) |
| AT5G22860 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G34412 | EKC/KEOPS complex subunit tprkb-like protein;(source:Araport11) |
| AT5G05250 | hypothetical protein;(source:Araport11) |
| AT5G28637 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-23 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT4G27680 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G44713 | hypothetical protein;(source:Araport11) |
| AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
| AT1G12380 | hypothetical protein;(source:Araport11) |
| AT2G18969 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
| AT1G67105 | other_RNA;(source:Araport11) |
| AT2G45010 | PLAC8 family protein;(source:Araport11) |
| AT3G43280 | hypothetical protein;(source:Araport11) |
| AT3G06760 | Drought-responsive family protein;(source:Araport11) |
| AT1G48720 | Copia-like polyprotein/retrotransposon;(source:Araport11) |
| AT1G18540 | Ribosomal protein L6 family protein;(source:Araport11) |
| AT1G07560 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G39785 | hypothetical protein (DUF1666);(source:Araport11) |
| AT2G05510 | Glycine-rich protein family;(source:Araport11) |
| AT4G10170 | SNARE-like superfamily protein;(source:Araport11) |
| AT1G19200 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT3G22070 | proline-rich family protein;(source:Araport11) |
| AT2G32750 | Exostosin family protein;(source:Araport11) |
| AT3G17152 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT1G20800 | F-box family protein |
| AT4G20100 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
| AT1G44835 | YbaK/aminoacyl-tRNA synthetase-associated domain-containing protein;(source:Araport11) |
| AT5G59240 | Ribosomal protein S8e family protein;(source:Araport11) |
| AT5G42223 | Encodes a defensin-like (DEFL) family protein. |
| AT2G20500 | hypothetical protein;(source:Araport11) |
| AT4G36530 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G41685 | Mitochondrial outer membrane translocase complex, subunit Tom7;(source:Araport11) |
| AT1G48960 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
| AT4G30390 | UDP-arabinopyranose mutase;(source:Araport11) |
| AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT1G69450 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G15560 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G58412 | Encodes a Plant thionin family protein |
| AT4G09630 | transmembrane protein (DUF616);(source:Araport11) |
| AT1G25370 | hypothetical protein (DUF1639);(source:Araport11) |
| AT5G39410 | Saccharopine dehydrogenase;(source:Araport11) |
| AT2G10990 | pseudogene of reverse transcriptase-like protein;(source:Araport11) |
| AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G38100 | SABATH family methyltransferase. |
| AT1G05860 | INO80 complex subunit D-like protein;(source:Araport11) |
| AT2G31345 | transmembrane protein;(source:Araport11) |
| AT1G78720 | SecY protein transport family protein;(source:Araport11) |
| AT5G02580 | argininosuccinate lyase;(source:Araport11) |
| AT5G11820 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G59990 | CCT motif family protein;(source:Araport11) |
| AT1G28135 | hypothetical protein;(source:Araport11) |
| AT3G01800 | Ribosome recycling factor;(source:Araport11) |
| AT1G42515 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G45570.1);(source:TAIR10) |
| AT1G61320 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G39865 | Glutaredoxin family protein;(source:Araport11) |
| AT1G51823 | hypothetical protein;(source:Araport11) |
| AT5G24370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G22520 | spindle assembly abnormal protein;(source:Araport11) |
| AT5G19570 | transmembrane protein;(source:Araport11) |
| AT4G13710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G36420 | Ribosomal protein L12 family protein;(source:Araport11) |
| AT1G54930 | GRF zinc finger / Zinc knuckle protein;(source:Araport11) |
| AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT3G43005 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.3e-32 P-value blast match to O22273 /233-373 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G17830 | Plasma-membrane choline transporter family protein;(source:Araport11) |
| AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT4G08056 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
| AT1G44045 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.8e-19 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G48185 | transmembrane protein;(source:Araport11) |
| AT1G52347 | None;(source:Araport11) |
| AT1G31000 | F-box/associated interaction domain protein;(source:Araport11) |
| AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT3G26539 | hypothetical protein;(source:Araport11) |
| AT1G78260 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G21690 | MATE efflux family protein;(source:Araport11) |
| AT5G07380 | hypothetical protein;(source:Araport11) |
| AT2G20280 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G34590 | Transketolase family protein;(source:Araport11) |
| AT1G08125 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G04760 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT5G47860 | Gut esterase (DUF1350);(source:Araport11) |
| AT1G11145 | hypothetical protein (DUF674);(source:Araport11) |
| AT3G26130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT1G71910 | hypothetical protein;(source:Araport11) |
| AT1G70570 | anthranilate phosphoribosyltransferase;(source:Araport11) |
| AT3G33545 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative non-LTR retroelement reverse transcriptase, similar to reverse transcriptase - Arabidopsis thaliana retrotransposon Ta11-1. GB:S65812 (S65812);(source:TAIR10) |
| AT5G01480 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G67640 | hypothetical protein;(source:Araport11) |
| AT5G11940 | Subtilase family protein;(source:Araport11) |
| AT4G26880 | Stigma-specific Stig1 family protein;(source:Araport11) |
| AT2G36835 | hypothetical protein;(source:Araport11) |
| AT4G26020 | 4/1 protein short form protein;(source:Araport11) |
| AT4G12617 | B3 domain protein;(source:Araport11) |
| AT2G45700 | sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
| AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
| AT5G58510 | Rab3 GTPase-activating protein catalytic protein;(source:Araport11) |
| AT4G18220 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
| AT3G16070 | LOW protein: ATP-dependent RNA helicase-like protein;(source:Araport11) |
| AT1G01870 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT2G25740 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
| AT2G19300 | hypothetical protein;(source:Araport11) |
| AT1G24240 | Ribosomal protein L19 family protein;(source:Araport11) |
| AT2G25040 | pseudogene of casein lytic proteinase B4;(source:Araport11) |
| AT2G45685 | Natural antisense transcript overlaps with AT2G45680;(source:Araport11) |
| AT2G04230 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G52910 | fiber (DUF1218);(source:Araport11) |
| AT3G09500 | Ribosomal L29 family protein;(source:Araport11) |
| AT5G14450 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G25770 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT1G26890 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT5G38005 | other_RNA;(source:Araport11) |
| AT5G58990 | 28S ribosomal S34 protein;(source:Araport11) |
| AT2G19340 | Oligosaccharyltransferase complex/magnesium transporter family protein;(source:Araport11) |
| AT3G10915 | Reticulon family protein;(source:Araport11) |
| AT3G23880 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G13225 | snoRNA;(source:Araport11) |
| AT5G66340 | hypothetical protein;(source:Araport11) |
| AT5G35970 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G43405 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43940.1);(source:TAIR10) |
| AT4G00985 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
| AT5G61570 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G28780 | PIF1 helicase;(source:Araport11) |
| AT1G64500 | A member of a protein family found in plants and animals that contain conserved C-terminal glutaredoxin-like and putative zinc-binding cysteine-rich domains. It is involved in light stimulated actin bundling and chloroplast movement. The mRNA is cell-to-cell mobile. |
| AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G18350 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G03667 | Asparagine synthase family protein;(source:Araport11) |
| AT1G27030 | hypothetical protein;(source:Araport11) |
| AT3G24230 | Pectate lyase family protein;(source:Araport11) |
| AT1G08230 | Codes for a H+-driven, high affinity gamma-aminobutyric acid (GABA) transporter. Localized at the plasma membrane. In planta, AtGAT1 expression was highest in flowers and under conditions of elevated GABA concentrations such as wounding or senescence. |
| AT1G52810 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G65780 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G14580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G10450 | Ribosomal protein L6 family;(source:Araport11) |
| AT5G45240 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G15772 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT1G52320 | kinesin-like protein;(source:Araport11) |
| AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
| AT3G05936 | hypothetical protein;(source:Araport11) |
| AT5G07970 | dentin sialophosphoprotein-like protein;(source:Araport11) |
| AT5G66440 | tRNA-methyltransferase non-catalytic subunit trm6MTase subunit;(source:Araport11) |
| AT5G16740 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G33006 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.0e-261 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G07200 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G02320 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G76460 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G15500 | Ankyrin repeat family protein;(source:Araport11) |
| AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
| AT2G04500 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G72880 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
| AT1G19320 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT5G23750 | Remorin family protein;(source:Araport11) |
| AT1G20735 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G51700 | PIF1 helicase;(source:Araport11) |
| AT5G66560 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT4G29640 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT1G23340 | carboxyl-terminal proteinase, putative (DUF239);(source:Araport11) |
| AT2G24580 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
| AT1G63190 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT5G13070 | MSF1-like family protein;(source:Araport11) |
| AT1G26100 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
| AT5G26810 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G24050 | plant-specific B3-DNA-binding domain protein (DUF313);(source:Araport11) |
| AT5G51140 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G77122 | Uncharacterized protein family UPF0090;(source:Araport11) |
| AT1G51980 | Insulinase (Peptidase family M16) protein;(source:Araport11) |
| AT5G35076 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-45 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
| AT2G21725 | Encodes a defensin-like (DEFL) family protein. |
| AT4G39150 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G01440 | hypothetical protein;(source:Araport11) |
| AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G41170 | F-box family protein;(source:Araport11) |
| AT2G01840 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.6e-34 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G03470 | ELM2 domain-containing protein;(source:Araport11) |
| AT3G57790 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G14690 | transmembrane protein;(source:Araport11) |
| AT3G29773 | pseudogene of nuclease;(source:Araport11) |
| AT5G01800 | saposin B domain-containing protein;(source:Araport11) |
| AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
| AT3G29300 | transmembrane protein;(source:Araport11) |
| AT4G01535 | hypothetical protein;(source:Araport11) |
| AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT2G34340 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G42924 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G01732 | Natural antisense transcript overlaps with AT5G01730;(source:Araport11) |
| AT2G24280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G07322 | other_RNA;(source:Araport11) |
| AT3G63450 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G62410 | MIF4G domain-containing protein;(source:Araport11) |
| AT3G43573 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.7e-27 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G04238 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G55035 | pseudogene of importin alpha isoform 1;(source:Araport11) |
| AT2G34655 | hypothetical protein;(source:Araport11) |
| AT1G56720 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G05475 | RNI-like superfamily protein;(source:Araport11) |
| AT2G25280 | AmmeMemoRadiSam system protein B;(source:Araport11) |
| AT4G19720 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT4G10190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G16190 | hypothetical protein;(source:Araport11) |
| AT3G54000 | TIP41-like protein;(source:Araport11) |
| AT4G31985 | Ribosomal protein L39 family protein;(source:Araport11) |
| AT1G52990 | thioredoxin family protein;(source:Araport11) |
| AT3G24850 | B3 domain protein (DUF313);(source:Araport11) |
| AT5G17340 | Putative membrane lipoprotein;(source:Araport11) |
| AT2G32795 | other_RNA;(source:Araport11) |
| AT3G09950 | hypothetical protein;(source:Araport11) |
| AT3G26934 | hypothetical protein;(source:Araport11) |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
| AT1G18871 | hypothetical protein;(source:Araport11) |
| AT1G23350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G30460 | glycine-rich protein;(source:Araport11) |
| AT3G47965 | hypothetical protein;(source:Araport11) |
| AT1G44770 | elongation factor;(source:Araport11) |
| AT5G02860 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G27300 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT1G74510 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G18596 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G47920 | transcription elongation factor;(source:Araport11) |
| AT4G37080 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G01130 | hypothetical protein (DUF674);(source:Araport11) |
| AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G16190 | Isochorismatase family protein;(source:Araport11) |
| AT1G55090 | carbon-nitrogen hydrolase family protein;(source:Araport11) |
| AT5G17840 | DnaJ/Hsp40 cysteine-rich domain superfamily protein;(source:Araport11) |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT2G20050 | protein phosphatase 2C and cyclic nucleotide-binding/kinase domain-containing protein;(source:Araport11) |
| AT5G03110 | protamine P1 family protein;(source:Araport11) |
| AT4G03360 | Ubiquitin family protein;(source:Araport11) |
| AT5G52450 | MATE efflux family protein;(source:Araport11) |
| AT1G70880 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G48346 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G14860 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
| AT5G59960 | K-stimulated pyrophosphate-energized sodium pump protein;(source:Araport11) |
| AT2G01870 | transmembrane protein;(source:Araport11) |
| AT1G23640 | OBP32pep protein;(source:Araport11) |
| AT3G24065 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT5G27870 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G35605 | pre-tRNA tRNA-Arg (anticodon: CCT);(source:Araport11, TAIR10) |
| AT1G34250 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G30921 | pseudogene of F-box family protein;(source:Araport11) |
| AT2G38660 | Amino acid dehydrogenase family protein;(source:Araport11) |
| AT5G67290 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT1G43610 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G36895 | D-tagatose-1,6-bisphosphate aldolase subunit;(source:Araport11) |
| AT2G42190 | rho GTPase-activating gacO-like protein;(source:Araport11) |
| AT5G05050 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT3G45755 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G09510.1);(source:TAIR10) |
| AT1G68500 | hypothetical protein;(source:Araport11) |
| AT5G28237 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT1G51030 | hypothetical protein;(source:Araport11) |
| AT3G19515 | apoptosis inhibitor;(source:Araport11) |
| AT1G31400 | TRAF-like family protein;(source:Araport11) |
| AT1G62730 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT2G10420 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.7e-82 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
| AT5G03668 | Natural antisense transcript overlaps with AT5G03670;(source:Araport11) |
| AT4G16105 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT4G17580 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT1G19560 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT5G37900 | TRAF-like superfamily protein;(source:Araport11) |
| AT3G20015 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G60430 | antiporter/ drug transporter;(source:Araport11) |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G15190 | hypothetical protein;(source:Araport11) |
| AT1G53800 | muscle M-line assembly protein;(source:Araport11) |
| AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT5G42720 | Glycosyl hydrolase family 17 protein;(source:Araport11) |
| AT4G28290 | hypothetical protein;(source:Araport11) |
| AT1G09500 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
| AT3G46210 | Ribosomal protein S5 domain 2-like superfamily protein;(source:Araport11) |
| AT3G62640 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT1G31380 | TRAF-like family protein;(source:Araport11) |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G34431 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT2G15810 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.5e-12 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT3G44080 | F-box family protein;(source:Araport11) |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G08270 | vacuolar protein sorting-associated protein;(source:Araport11) |
| AT5G50090 | PADRE protein. |
| AT3G29075 | glycine-rich protein;(source:Araport11) |
| AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G78250 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
| AT4G09690 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT3G04500 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G46915 | transcriptional factor B3 family protein;(source:Araport11) |
| AT4G12100 | Cullin family protein;(source:Araport11) |
| AT3G18560 | hypothetical protein;(source:Araport11) |
| AT5G06165 | other_RNA;(source:Araport11) |
| AT1G30945 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G38640 | NagB/RpiA/CoA transferase-like superfamily protein;(source:Araport11) |
| AT4G24070 | carbon-carbon lyase;(source:Araport11) |
| AT3G03500 | TatD related DNase;(source:Araport11) |
| AT2G06822 | Pseudogene of AT2G06822 |
| AT5G35753 | DnaJ heat shock amino-terminal domain protein (DUF3444);(source:Araport11) |
| AT2G36730 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G52100 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G04990 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G31670 | Copper amine oxidase family protein;(source:Araport11) |
| AT2G04480 | hypothetical protein;(source:Araport11) |
| AT2G26030 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G49310 | transmembrane protein;(source:Araport11) |
| AT4G01870 | tolB protein-like protein;(source:Araport11) |
| AT1G18030 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G35080 | ATP binding / aminoacyl-tRNA ligase/ nucleotide binding protein;(source:Araport11) |
| AT2G26680 | FkbM family methyltransferase;(source:Araport11) |
| AT2G21020 | pseudogene of NOD26-like intrinsic protein 3;(source:Araport11) |
| AT1G13760 | hypothetical protein;(source:Araport11) |
| AT5G19165 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-237 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G69730 | Wall-associated kinase family protein;(source:Araport11) |
| AT5G19270 | reverse transcriptase-like protein;(source:Araport11) |
| AT3G53640 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28280 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G23770 | F-box family protein;(source:Araport11) |
| AT3G46350 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT1G44707 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G76240 | DUF241 domain protein (DUF241);(source:Araport11) |
| AT2G27310 | F-box family protein;(source:Araport11) |
| AT3G14480 | glycine/proline-rich protein;(source:Araport11) |
| AT2G05600 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G43830 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
| AT5G63230 | glycosyl hydrolase family protein 17 |
| AT1G60680 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT4G03030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G48140 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G48730 | hypothetical protein;(source:Araport11) |
| AT1G51210 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G39753 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT2G43261 | transmembrane protein;(source:Araport11) |
| AT1G42460 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G07240.1);(source:TAIR10) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT4G30780 | ATP-dependent DNA helicase;(source:Araport11) |
| AT2G04675 | hypothetical protein;(source:Araport11) |
| AT5G57670 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G30520 | heat shock protein;(source:Araport11) |
| AT5G14120 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G37732 | pseudogene of hypothetical protein;(source:Araport11) |
| AT3G22133 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10) |
| AT5G54865 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
| AT5G60250 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G17360 | DNA ligase;(source:Araport11) |
| AT3G24517 | hypothetical protein;(source:Araport11) |
| AT1G31960 | hypothetical protein;(source:Araport11) |
| AT1G52420 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G42850 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G46170 | F-box family protein;(source:Araport11) |
| AT3G19970 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G13470 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G24255.1);(source:TAIR10) |
| AT1G50140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
| AT4G02190 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G17930 | MIF4G domain-containing protein / MA3 domain-containing protein;(source:Araport11) |
| AT4G39360 | hypothetical protein;(source:Araport11) |
| AT1G26200 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT4G25235 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT3G05130 | paramyosin-like protein;(source:Araport11) |
| AT1G71850 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT2G03410 | Mo25 family protein;(source:Araport11) |
| AT3G57580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G49770 | Leucine rich receptor kinase. |
| AT1G55680 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G45638 | other_RNA;(source:Araport11) |
| AT4G11750 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT5G47060 | hypothetical protein (DUF581);(source:Araport11) |
| AT1G16180 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G51120 | zinc finger CCCH domain-containing protein 44;(source:Araport11) |
| AT1G65365 | pseudogene of WALL ASSOCIATED KINASE (WAK)-LIKE 10;(source:Araport11) |
| AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G32430 | Galactosyltransferase family protein;(source:Araport11) |
| AT4G00530 | UvrABC system protein A;(source:Araport11) |
| AT1G80640 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G43255 | O-acyltransferase WSD1-like protein;(source:Araport11) |
| AT5G46874 | Encodes a defensin-like (DEFL) family protein. |
| AT2G19755 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-08 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT3G46570 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G24644 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G50870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G27270 | Quinone reductase family protein;(source:Araport11) |
| AT2G46192 | other_RNA;(source:Araport11) |
| AT1G20310 | syringolide-induced protein;(source:Araport11) |
| AT3G24465 | Encodes a Plant thionin family protein |
| AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
| AT4G33390 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
| AT2G34200 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT3G56820 | RmlC-type cupin;(source:Araport11) |
| AT4G23530 | ROH1, putative (DUF793);(source:Araport11) |
| AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G26460 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G26935 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G02835 | nucleic acid/zinc ion-binding protein;(source:Araport11) |
| AT2G30320 | Pseudouridine synthase family protein;(source:Araport11) |
| AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G29670 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G63835 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-17 P-value blast match to GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)GB:BAA78423 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996361|dbj|BAA78423.1| polyprotein (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT1G19110 | inter-alpha-trypsin inhibitor heavy chain-like protein;(source:Araport11) |
| AT2G29065 | GRAS family transcription factor;(source:Araport11) |
| AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
| AT5G53880 | hypothetical protein;(source:Araport11) |
| AT3G23460 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G58250 | TRAF-like family protein;(source:Araport11) |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT2G04070 | Expression in rosette leaves is activated by high concentration of boron. |
| AT1G48870 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT4G02930 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
| AT5G22280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
| AT1G43883 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.1e-193 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
| AT1G63280 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT5G54950 | Aconitase family protein;(source:Araport11) |
| AT3G55600 | Membrane fusion protein Use1;(source:Araport11) |
| AT1G70160 | zinc finger MYND domain protein;(source:Araport11) |
| AT5G30490 | craniofacial development-like protein;(source:Araport11) |
| AT3G10300 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G13930 | Involved in response to salt stress. Knockout mutants are hypersensitive to salt stress. The mRNA is cell-to-cell mobile. |
| AT5G24318 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G45880 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G46610 | aluminum activated malate transporter family protein;(source:Araport11) |
| AT4G19645 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT5G18130 | transmembrane protein;(source:Araport11) |
| AT1G22080 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT1G43575 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.1e-34 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G17744 | hypothetical protein;(source:Araport11) |
| AT1G28020 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G20240 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT5G03010 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G05350 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G20420 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT5G38700 | cotton fiber protein;(source:Araport11) |
| AT4G15260 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G49000 | transmembrane protein;(source:Araport11) |
| AT2G06860 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
| AT3G59780 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
| AT2G35470 | ribosome maturation factor;(source:Araport11) |
| AT1G63810 | nucleolar protein;(source:Araport11) |
| AT3G04390 | Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding protein;(source:Araport11) |
| AT2G03955 | Encodes a defensin-like (DEFL) family protein. |
| AT5G61370 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G02590 | small multi-drug export protein;(source:Araport11) |
| AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
| AT5G50450 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G12390 | Cornichon family protein;(source:Araport11) |
| AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT4G00955 | wall-associated receptor kinase-like protein;(source:Araport11) |
| AT1G52700 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G13940 | aminopeptidase;(source:Araport11) |
| AT1G69660 | TRAF-like family protein;(source:Araport11) |
| AT3G62840 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT5G37000 | glycosyltransferase family exostosin protein;(source:Araport11) |
| AT5G26080 | proline-rich family protein;(source:Araport11) |
| AT2G22426 | hypothetical protein;(source:Araport11) |
| AT1G05835 | PhD finger protein. |
| AT3G15280 | hypothetical protein;(source:Araport11) |
| AT3G45730 | hypothetical protein;(source:Araport11) |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G26510 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G37870 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G09300 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
| AT5G52500 | transmembrane protein;(source:Araport11) |
| AT3G04970 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT3G10510 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT4G14370 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G40750 | FBD / Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
| AT1G60830 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT2G31700 | transmembrane protein;(source:Araport11) |
| AT5G40382 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
| AT3G16330 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G54550 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G21000 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT2G19610 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G58375 | Methyltransferase-related protein;(source:Araport11) |
| AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
| AT3G60520 | zinc ion-binding protein;(source:Araport11) |
| AT4G13530 | transmembrane protein;(source:Araport11) |
| AT2G29430 | coiled-coil protein (DUF572);(source:Araport11) |
| AT4G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G21220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
| AT5G35416 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-16 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G62865 | hypothetical protein;(source:Araport11) |
| AT2G04300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G55440 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G50370 | Adenylate kinase family protein;(source:Araport11) |
| AT4G32640 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
| AT3G45950 | Pre-mRNA splicing Prp18-interacting factor;(source:Araport11) |
| AT4G00500 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G61950 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT4G07583 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G16610 | hypothetical protein;(source:Araport11) |
| AT1G26330 | DNA binding protein;(source:Araport11) |
| AT1G31166 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.7e-38 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G38020 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT3G05858 | hypothetical protein;(source:Araport11) |
| AT4G11120 | translation elongation factor Ts (EF-Ts);(source:Araport11) |
| AT2G35743 | Pseudogene of AT2G35750; unknown protein |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT2G05980 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.0e-42 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT3G57400 | transmembrane protein;(source:Araport11) |
| AT5G19760 | Encodes a novel mitochondrial carrier capable of transporting both dicarboxylates (such as malate, oxaloacetate, oxoglutarate, and maleate) and tricarboxylates (such as citrate, isocitrate, cis-aconitate, and trans-aconitate). |
| AT2G21040 | C2 domain-containing protein. Possible pseudogene of AT2G20990. |
| AT5G46780 | VQ motif-containing protein;(source:Araport11) |
| AT1G50590 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G62450 | Immunoglobulin E-set superfamily protein;(source:Araport11) |
| AT4G33590 | transmembrane protein;(source:Araport11) |
| AT2G37830 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167. |
| AT1G27285 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G37360 | LOW protein: ammonium transporter 1-like protein;(source:Araport11) |
| AT5G11770 | NADH-ubiquinone oxidoreductase 20 kDa subunit;(source:Araport11) |
| AT5G11700 | ephrin type-B receptor;(source:Araport11) |
| AT3G45470 | IBR domain containing protein;(source:Araport11) |
| AT1G66880 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G11242 | pseudogene of ribosomal protein |
| AT5G60966 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
| AT3G60730 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
| AT2G19100 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.2e-33 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT2G25730 | zinc finger FYVE domain protein;(source:Araport11) |
| AT1G48325 | Expressed protein;(source:Araport11) |
| AT3G26100 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G12870 | transmembrane protein;(source:Araport11) |
| AT2G41150 | plant/protein;(source:Araport11) |
| AT2G04260 | pseudogene of P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT2G07704 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.8e-50 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT2G27670 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
| AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
| AT2G35590 | pseudogene of Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G23100 | GroES-like family protein;(source:Araport11) |
| AT1G57630 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT3G22560 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT3G20180 | Copper transport protein family;(source:Araport11) |
| AT3G28590 | transmembrane protein;(source:Araport11) |
| AT5G58520 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G05932 | Potential natural antisense gene, locus overlaps with AT3G05930 |
| AT3G53940 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT4G17100 | poly(U)-specific endoribonuclease-B protein;(source:Araport11) |
| AT3G05155 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G18090 | 5-3 exonuclease family protein;(source:Araport11) |
| AT5G07810 | SNF2 domain-containing protein / helicase domain-containing protein / HNH endonuclease domain-containing protein;(source:Araport11) |
| AT3G48344 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT2G43110 | U3 containing 90S pre-ribosomal complex subunit;(source:Araport11) |
| AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT5G50805 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
| AT1G70280 | NHL domain-containing protein;(source:Araport11) |
| AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT4G25680 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
| AT2G37160 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G56420 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G13340 | arginine/glutamate-rich 1 protein;(source:Araport11) |
| AT1G55535 | transmembrane protein;(source:Araport11) |
| AT3G58960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G71150 | cyclin-D1-binding protein;(source:Araport11) |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT4G11800 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT4G33625 | vacuole protein;(source:Araport11) |
| AT5G27715 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
| AT1G16500 | filamentous hemagglutinin transporter;(source:Araport11) |
| AT3G18840 | LOW protein: PPR containing-like protein;(source:Araport11) |
| AT5G35601 | pseudogene of aconitase 3;(source:Araport11) |
| AT2G27790 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G11385 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G23880 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.4e-41 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT4G32140 | EamA-like transporter family;(source:Araport11) |
| AT2G16594 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT2G28790 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT3G43652 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.2e-105 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
| AT3G23645 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT2G27930 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G31520 | hypothetical protein;(source:Araport11) |
| AT1G65830 | pre-tRNA tRNA-Ser (anticodon: AGA);(source:Araport11, TAIR10) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT3G54040 | PAR1 protein;(source:Araport11) |
| AT3G32455 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-24 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT5G03795 | Exostosin family protein;(source:Araport11) |
| AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
| AT1G47810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G07728 | Natural antisense transcript overlaps with AT1G07725;(source:Araport11) |
| AT5G06125 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT1G29830 | Magnesium transporter CorA-like family protein;(source:Araport11) |
| AT5G38070 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT2G29020 | Rab5-interacting family protein;(source:Araport11) |
| AT3G14060 | hypothetical protein;(source:Araport11) |
| AT2G03980 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT2G34700 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G36210 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-71 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G33160 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-61 P-value blast match to O80466 /172-336 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G72690 | neurofilament heavy protein;(source:Araport11) |
| AT3G61160 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G05270 | TraB family protein;(source:Araport11) |
| AT1G48330 | SsrA-binding protein;(source:Araport11) |
| AT2G06303 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G29960 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT1G59790 | Cullin family protein;(source:Araport11) |
| AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT2G24410 | SMAD/FHA domain protein;(source:Araport11) |
| AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT3G16660 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G30090 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G04960 | golgin family A protein (DUF1664);(source:Araport11) |
| AT3G05400 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G36550 | haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT5G59230 | transcription factor-like protein;(source:Araport11) |
| AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
| AT5G54820 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G30670 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
| AT2G17695 | outer envelope protein;(source:Araport11) |
| AT2G25565 | C3HC4-type RING finger protein;(source:Araport11) |
| AT2G27980 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT2G24945 | transmembrane protein;(source:Araport11) |
| AT3G28880 | serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit;(source:Araport11) |
| AT1G01310 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT3G62350 | F-box/associated interaction domain protein;(source:Araport11) |
| AT4G37380 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G07600 | Oleosin family protein;(source:Araport11) |
| AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
| AT3G32385 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 4.7e-188 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
| AT5G07420 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G72175 | E3 ubiquitin-protein ligase RNF170-like protein (DUF 1232);(source:Araport11) |
| AT5G04910 | DNA repair REX1-B protein;(source:Araport11) |
| AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G80400 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G07910 | reactive oxygen species modulator-like protein;(source:Araport11) |
| AT5G02025 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT3G56030 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G05940 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
| AT2G44800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G38490 | B3 domain protein (DUF313);(source:Araport11) |
| AT3G22440 | FRIGIDA-like protein;(source:Araport11) |
| AT1G70970 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G80580 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G60000 | transmembrane protein;(source:Araport11) |
| AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
| AT3G20280 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
| AT1G20120 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G70030 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT4G03565 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT3G06840 | hypothetical protein;(source:Araport11) |
| AT1G43886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-165 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT1G76830 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G30935 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT1G55280 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G63060 | ribosome biogenesis NEP1-like protein;(source:Araport11) |
| AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT1G03670 | Ankyrin repeat containing protein |
| AT1G23620 | pseudogene of OBP32pep protein;(source:Araport11) |
| AT2G01370 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT1G07760 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT5G47430 | DWNN domain, a CCHC-type zinc finger;(source:Araport11) |
| AT4G17700 | hypothetical protein;(source:Araport11) |
| AT2G06875 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-46 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT4G36500 | hypothetical protein;(source:Araport11) |
| AT5G57655 | xylose isomerase family protein;(source:Araport11) |
| AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
| AT4G33960 | hypothetical protein;(source:Araport11) |
| AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G29195 | PADRE protein up-regulated after infection by S. sclerotiorum. |
| AT3G59130 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G07945 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to reverse transcriptase, putative;(source:TAIR10) |
| AT3G60340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G35365 | hypothetical protein (DUF1184);(source:Araport11) |
| AT1G76910 | hypothetical protein;(source:Araport11) |
| AT5G55340 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT3G59765 | None;(source:Araport11) |
| AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G66760 | MATE efflux family protein;(source:Araport11) |
| AT5G23575 | Transmembrane CLPTM1 family protein;(source:Araport11) |
| AT3G07920 | Translation initiation factor IF2/IF5;(source:Araport11) |
| AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
| AT1G74530 | transmembrane protein;(source:Araport11) |
| AT5G52355 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
| AT1G67148 | hypothetical protein;(source:Araport11) |
| AT5G67350 | hypothetical protein;(source:Araport11) |
| AT5G55050 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT2G28990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G16560 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G30480 | hypothetical protein;(source:Araport11) |
| AT4G18540 | transmembrane protein;(source:Araport11) |
| AT1G19240 | transmembrane protein;(source:Araport11) |
| AT1G67865 | hypothetical protein;(source:Araport11) |
| AT1G22660 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT3G54550 | DNA-directed RNA polymerase subunit beta-beta protein, putative (DUF506);(source:Araport11) |
| AT5G42070 | hypothetical protein;(source:Araport11) |
| AT5G10580 | plant/protein (Protein of unknown function, DUF599);(source:Araport11) |
| AT2G41650 | hypothetical protein;(source:Araport11) |
| AT5G01860 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
| AT1G65140 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G76250 | transmembrane protein;(source:Araport11) |
| AT5G41900 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
| AT3G27540 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT4G24140 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G40260 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G22791 | F-box family protein;(source:Araport11) |
| AT5G51000 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G16935 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.3e-16 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G16200 | 50S ribosomal protein-like protein;(source:Araport11) |
| AT5G22610 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT1G51810 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G22415 | hypothetical protein;(source:Araport11) |
| AT4G30250 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G58420 | TRAF-like superfamily protein;(source:Araport11) |
| AT4G17975 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT1G69543 | Pseudogene of AT1G74220 |
| AT4G32510 | HCO3- transporter family;(source:Araport11) |
| AT5G58950 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G08055 | Encodes a defensin-like (DEFL) family protein. |
| AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G13910 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT3G47342 | snoRNA;(source:Araport11) |
| AT2G13128 | pseudogene of F-box family protein |
| AT5G62030 | diphthamide synthesis DPH2 family protein;(source:Araport11) |
| AT1G52565 | cytochrome P450 family protein;(source:Araport11) |
| AT4G31190 | pseudogene of SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
| AT2G44510 | CDK inhibitor P21 binding protein;(source:Araport11) |
| AT1G42530 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 4.8e-23 P-value blast match to Q9S9L1 /206-367 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT5G08360 | Stu1, putative (DUF789);(source:Araport11) |
| AT3G18282 | hypothetical protein;(source:Araport11) |
| AT2G29340 | NAD-dependent epimerase/dehydratase family protein;(source:Araport11) |
| AT2G24230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G22690 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
| AT2G19806 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.2e-19 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
| AT2G08986 | hypothetical protein;(source:Araport11) |
| AT1G51402 | hypothetical protein;(source:Araport11) |
| AT3G47830 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT4G07915 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-15 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G67170 | SEC-C motif-containing protein / OTU-like cysteine protease family protein;(source:Araport11) |
| AT5G48420 | hypothetical protein;(source:Araport11) |
| AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G18490 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT1G07550 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G15640 | Rubredoxin-like superfamily protein;(source:Araport11) |
| AT3G45830 | nuclear factor kappa-B-binding-like protein;(source:Araport11) |
| AT5G10290 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
| AT4G02820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G12580 | hypothetical protein;(source:Araport11) |
| AT1G12790 | DNA ligase-like protein;(source:Araport11) |
| AT5G34854 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G04730 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
| AT5G22160 | transmembrane protein;(source:Araport11) |
| AT5G65910 | BSD domain-containing protein;(source:Araport11) |
| AT5G43260 | chaperone protein dnaJ-like protein;(source:Araport11) |
| AT1G47680 | hypothetical protein;(source:Araport11) |
| AT3G63006 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G07400 | forkhead-associated domain-containing protein / FHA domain-containing protein;(source:Araport11) |
| AT4G22580 | Exostosin family protein;(source:Araport11) |
| AT5G45950 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G55240 | Overexpression leads to PEL (Pseudo-Etiolation in Light) phenotype. |
| AT4G16260 | Encodes a putative beta-1,3-endoglucanase that interacts with the 30C02 cyst nematode effector. May play a role in host defense. |
| AT3G11780 | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein;(source:Araport11) |
| AT4G26550 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
| AT5G49525 | transmembrane protein;(source:Araport11) |
| AT4G16970 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G38940 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT3G06830 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT1G32460 | hypothetical protein;(source:Araport11) |
| AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G20410 | RNA-binding ASCH domain protein;(source:Araport11) |
| AT3G21680 | hypothetical protein;(source:Araport11) |
| AT3G22290 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G29070 | Phospholipase A2 family protein;(source:Araport11) |
| AT2G39650 | cruciferin (DUF506);(source:Araport11) |
| AT3G26540 | RGFR3 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR2, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT5G42760 | Leucine carboxyl methyltransferase;(source:Araport11) |
| AT1G68490 | translocase subunit seca;(source:Araport11) |
| AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
| AT3G15420 | Transcription factor TFIIIC, tau55-related protein;(source:Araport11) |
| AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
| AT5G03610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G27900 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-26 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT1G68350 | cotton fiber protein;(source:Araport11) |
| AT3G42180 | Exostosin family protein;(source:Araport11) |
| AT4G06648 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-181 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G28180 | DEAD-box ATP-dependent RNA helicase-like protein;(source:Araport11) |
| AT2G10530 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-42 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT1G78210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G70390 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G50160 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G20360 | TRAF-like family protein;(source:Araport11) |
| AT5G20050 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G23860 | pseudogene of PapD-like superfamily protein;(source:Araport11) |
| AT5G20500 | Glutaredoxin family protein;(source:Araport11) |
| AT3G60700 | hypothetical protein (DUF1163);(source:Araport11) |
| AT5G25520 | SPOC domain / Transcription elongation factor S-II protein;(source:Araport11) |
| AT5G50120 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G66816 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
| AT2G18735 | other_RNA;(source:Araport11) |
| AT1G64820 | MATE efflux family protein;(source:Araport11) |
| AT2G25310 | ER membrane protein complex subunit-like protein (DUF2012);(source:Araport11) |
| AT4G29490 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT2G05765 | snoRNA;(source:Araport11) |
| AT5G53592 | FBD-like domain family protein;(source:Araport11) |
| AT2G13542 | Encodes a defensin-like (DEFL) family protein. |
| AT2G31215 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G39955 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G61715 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G43357 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.3e-50 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G32910 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
| AT2G23040 | hypothetical protein;(source:Araport11) |
| AT5G07790 | hypothetical protein;(source:Araport11) |
| AT2G38380 | Peroxidase superfamily protein;(source:Araport11) |
| AT2G05550 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.6e-37 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G24355 | hypothetical protein;(source:Araport11) |
| AT1G61840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G72960 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
| AT3G29152 | Encodes a Protease inhibitor/seed storage/LTP family protein |
| AT5G01780 | 2-oxoglutarate-dependent dioxygenase family protein;(source:Araport11) |
| AT3G48020 | hypothetical protein;(source:Araport11) |
| AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT5G14410 | hypothetical protein;(source:Araport11) |
| AT5G35340 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT4G24910 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT5G25570 | polyamine-modulated factor 1-binding protein;(source:Araport11) |
| AT5G23170 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G25330 | TRAF-like family protein;(source:Araport11) |
| AT4G31280 | hypothetical protein;(source:Araport11) |
| AT4G32560 | paramyosin-like protein;(source:Araport11) |
| AT1G18550 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G07120 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53635 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G47310 | signal peptidase I;(source:Araport11) |
| AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
| AT3G52320 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G18380 | F-box family protein;(source:Araport11) |
| AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT3G19530 | hypothetical protein;(source:Araport11) |
| AT2G24800 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G50301 | Pseudogene of AT1G49230; zinc finger (C3HC4-type RING finger) family protein |
| AT2G03860 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.0e-62 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G24977 | Pseudogene of AT4G24972; TPD1 (TAPETUM DETERMINANT 1) |
| AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
| AT1G30750 | TPRXL;(source:Araport11) |
| AT3G25700 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G04060 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT5G54700 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G35777 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-67 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G23690 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT1G13500 | hypothetical protein (DUF1262);(source:Araport11) |
| AT1G47780 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G01360 | plant viral-response family protein (DUF716);(source:Araport11) |
| AT3G44090 | F-box family protein;(source:Araport11) |
| AT4G01355 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
| AT2G23690 | PADRE protein. |
| AT4G25510 | hypothetical protein;(source:Araport11) |
| AT1G55100 | transposable_element_gene;(source:Araport11);pseudogene, putative ATP synthase beta subunit;(source:TAIR10) |
| AT5G61750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT2G38520 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.4e-60 P-value blast match to dbj|BAA78427.1| polyprotein (AtRE2-2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G48630 | hypothetical protein;(source:Araport11) |
| AT1G07460 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT3G44717 | Pseudogene of AT5G03495; nucleotide binding protein |
| AT1G67400 | ELMO/CED-12 family protein;(source:Araport11) |
| AT1G19990 | nucleolin;(source:Araport11) |
| AT5G56590 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G23520 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
| AT5G53500 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G58530 | Glutaredoxin family protein;(source:Araport11) |
| AT2G33350 | CCT motif family protein;(source:Araport11) |
| AT5G37872 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.4e-54 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G03550 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G25950 | PITH domain protein (DUF1000);(source:Araport11) |
| AT4G05490 | RNI-like superfamily protein;(source:Araport11) |
| AT1G76120 | Pseudouridine synthase family protein;(source:Araport11) |
| AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G67035 | homeobox Hox-B3-like protein;(source:Araport11) |
| AT1G04540 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G05073 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-300 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G07360 | Amidase family protein;(source:Araport11) |
| AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G50150 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT4G35295 | homoserine kinase, putative / HSK;(source:Araport11) |
| AT5G55800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G09620 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
| AT1G29080 | Papain family cysteine protease;(source:Araport11) |
| AT3G45400 | exostosin family protein;(source:Araport11) |
| AT4G23760 | Cox19-like CHCH family protein;(source:Araport11) |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G53940 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT1G73950 | Transmembrane Fragile-X-F-associated protein;(source:Araport11) |
| AT4G02880 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
| AT4G03140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G68380 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G80970 | XH domain-containing protein;(source:Araport11) |
| AT2G32630 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT2G07811 | pseudogene of mitochondrial protein |
| AT5G27395 | Mitochondrial inner membrane translocase complex, subunit Tim44-related protein;(source:Araport11) |
| AT5G08391 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
| AT3G29330 | zinc finger RNA-binding-like protein;(source:Araport11) |
| AT1G56490 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G29560 | fanconi anemia group E protein FANCE protein;(source:Araport11) |
| AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G22850 | SNARE associated Golgi protein family;(source:Araport11) |
| AT3G56260 | hypothetical protein;(source:Araport11) |
| AT3G16840 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
| AT1G23810 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G73380 | hypothetical protein;(source:Araport11) |
| AT3G47840 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G60080 | 3-5-exoribonuclease family protein;(source:Araport11) |
| AT2G04100 | MATE efflux family protein;(source:Araport11) |
| AT3G17060 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G59450 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G23680 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G47250 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G02010 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT3G21020 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.4e-14 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT1G32160 | beta-casein (DUF760);(source:Araport11) |
| AT5G28285 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT5G25920 | hypothetical protein;(source:Araport11) |
| AT2G03990 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
| AT3G11740 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT4G18810 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G49410 | thiamine-phosphate synthase;(source:Araport11) |
| AT1G15490 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G24260 | prolyl oligopeptidase family protein;(source:Araport11) |
| AT5G57210 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
| AT5G58840 | Subtilase family protein;(source:Araport11) |
| AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT5G20030 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
| AT5G26345 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.9e-43 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT1G62421 | hypothetical protein;(source:Araport11) |
| AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT2G35460 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G16790 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G41860 | transposable_element_gene;(source:Araport11);contains InterPro domain Retrotransposon gag protein;(source:TAIR10) |
| AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
| AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G65810 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G03620 | MATE efflux family protein;(source:Araport11) |
| AT1G14755 | Encodes a defensin-like (DEFL) family protein. |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G20180 | transmembrane protein (DUF677);(source:Araport11) |
| AT5G45530 | transmembrane protein, putative (DUF594);(source:Araport11) |
| AT1G43900 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G09800 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G09160 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT5G37840 | PADRE protein, up-regulated after infection by S. sclerotiorum. |
| AT3G22050 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT5G65440 | transmembrane protein;(source:Araport11) |
| AT1G51870 | protein kinase family protein;(source:Araport11) |
| AT3G19370 | filament-like protein (DUF869);(source:Araport11) |
| AT3G22750 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
| AT3G10760 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G23870 | pseudogene of Terpenoid cyclases family protein;(source:Araport11) |
| AT2G24880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT4G23000 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT3G52510 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G07010 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G32487 | hypothetical protein;(source:Araport11) |
| AT3G17540 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G12520 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G76230 | hypothetical protein;(source:Araport11) |
| AT4G10880 | hypothetical protein;(source:Araport11) |
| AT5G38810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G08870 | pre-tRNA tRNA-Ala (anticodon: TGC);(source:Araport11, TAIR10) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT3G09010 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G24640 | lyase;(source:Araport11) |
| AT2G14200 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-133 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G17060 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G05340 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G48209 | Encodes a Plant thionin family protein |
| AT5G20740 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G55507 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G62760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G53220 | hypothetical protein;(source:Araport11) |
| AT5G46380 | Serine/Threonine-kinase, putative (DUF1296);(source:Araport11) |
| AT1G28070 | ATP-dependent RNA helicase;(source:Araport11) |
| AT1G78030 | hypothetical protein;(source:Araport11) |
| AT1G23220 | Dynein light chain type 1 family protein;(source:Araport11) |
| AT5G14030 | translocon-associated protein beta (TRAPB) family protein;(source:Araport11) |
| AT2G02610 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G30490 | AFG1-like ATPase family protein;(source:Araport11) |
| AT4G08871 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.2e-15 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
| AT5G22430 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G48740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G43880 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G37960 | myosin-M heavy protein;(source:Araport11) |
| AT3G42476 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.8e-19 P-value blast match to gb|AAG52950.1| putative envelope protein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G30050 | transmembrane protein;(source:Araport11) |
| AT3G01820 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G79030 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G27990 | transmembrane protein;(source:Araport11) |
| AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
| AT1G53360 | F-box/associated interaction domain protein;(source:Araport11) |
| AT4G31790 | Tetrapyrrole (Corrin/Porphyrin) Methylase;(source:Araport11) |
| AT1G53040 | tRNA (met) cytidine acetyltransferase, putative (DUF616);(source:Araport11) |
| AT2G22460 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
| AT4G28170 | transmembrane protein;(source:Araport11) |
| AT1G72510 | DUF1677 family protein (DUF1677);(source:Araport11) |
| AT2G27950 | Ring/U-Box superfamily protein;(source:Araport11) |
| AT3G31023 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-152 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G14900 | FRIGIDA-like protein;(source:Araport11) |
| AT5G22040 | ubiquitin carboxyl-terminal hydrolase;(source:Araport11) |
| AT1G22120 | hypothetical protein;(source:Araport11) |
| AT3G44830 | Lecithin:cholesterol acyltransferase family protein;(source:Araport11) |
| AT3G50800 | PADRE protein. |
| AT3G11990 | ECA1 gametogenesis family protein (DUF784);(source:Araport11) |
| AT2G17442 | hypothetical protein;(source:Araport11) |
| AT1G26761 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT1G19500 | hypothetical protein;(source:Araport11) |
| AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G17070 | peptidyl-prolyl cis-trans isomerase;(source:Araport11) |
| AT1G75510 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
| AT4G09745 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
| AT2G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT1G49330 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G17050 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT3G19274 | hypothetical protein;(source:Araport11) |
| AT1G35516 | myb-like transcription factor family protein;(source:Araport11) |
| AT4G13600 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G60520 | pseudogene of Dynamin related protein 4A;(source:Araport11) |
| AT2G47610 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
| AT5G38730 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G51370 | RNI-like superfamily protein;(source:Araport11) |
| AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT1G15890 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
| AT2G24755 | Natural antisense transcript overlaps with AT2G24750 and AT2G24760;(source:Araport11) |
| AT1G20480 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT2G24760 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.9e-16 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT1G67190 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G27790 | Calcium-binding EF hand family protein;(source:Araport11) |
| AT3G08980 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
| AT5G41420 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G23780 | F-box family protein;(source:Araport11) |
| AT5G28520 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G11165 | hypothetical protein;(source:Araport11) |
| AT4G05500 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
| AT3G62620 | Encodes a protein of unknown function. Previously this protein has been annotated computationally as a sucrose-phosphatase-related protein. However, the source of this annotation can not be verified. This annotation (sucrose-phosphatase-related) has been removed. |
| AT1G22250 | hypothetical protein;(source:Araport11) |
| AT2G12462 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
| AT5G45510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT2G26100 | Galactosyltransferase family protein;(source:Araport11) |
| AT3G19480 | Encodes a stromal phosphoglycerate dehydrogenase with a high NAD(H)-specificity that is active in photosynthesizing chloroplasts and draws its substrate 3-PGA directly from the Calvin-Benson-Bassham cycle. |
| AT5G24810 | ABC1 family protein;(source:Araport11) |
| AT1G65950 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
| AT2G24530 | Member of SAGA complex, SPT modulu subunit, interacts with HAG1. |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT3G27250 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40790 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G40800 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G07030 | Alba DNA/RNA-binding protein;(source:Araport11) |
| AT2G17970 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G02530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G32660 | Encodes protein kinase AME3. |
| AT1G07570 | Protein kinase capable of phosphorylating tyrosine, serine, and threonine residues |
| AT5G53540 | Encodes a P-loop NTPase APP1. The disruption of APP1 is accompanied by a reduction in ROS level, a rise in the rate of cell division in the quiescent center (QC) and the promotion of root distal stem cell (DSC) differentiation. |
| AT4G24640 | Encodes AppB protein (AppB1). |
| AT4G18020 | Encodes pseudo-response regulator 2 (APRR2) that interacts with a calcium sensor (CML9). |
| AT5G43780 | sulfate adenylyltransferase, ATP sulfurylase |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT1G52080 | actin binding protein family;(source:Araport11) |
| AT1G06400 | small GTP-binding protein (ara-2).RabGTPase functioning in anterograde trafficking from trans-Golgi network/early endosomal compartments to the plasma membrane as well as in responses to salinity stress. |
| AT3G54840 | Encodes a novel Rab-like GTP-ase that is localized to the peripheral membrane of the endosome. . In its active state interferes with the assembly of GDP-bound ARA7, PUF2, and VPS9a by competitively binding to PUF2 to diminish endosomal transport mediated by canonical RAB5. |
| AT4G19640 | Encodes Ara7. |
| AT1G70490 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT2G30130 | Overexpression/activation tagged allele has epinastic leaves, reduced apical dominance and is sterile. Gene is similar to asymmetric leaves (AS)/lateral organ boundary (LOB) genes which repress KNOX gene expression. |
| AT4G32200 | meiotic asynaptic mutant 2, homologue of ASY1 |
| AT4G11660 | member of Heat Stress Transcription Factor (Hsf) family |
| AT4G16640 | Matrix metalloprotease. |
| AT5G03545 | Expressed in roots in response to phosphate starvation, this response is enhanced by the presence of IAA. Additionally, its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. The mRNA is cell-to-cell mobile. |
| AT4G38250 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
| AT1G01720 | Belongs to a large family of putative transcriptional activators with NAC domain. Transcript level increases in response to wounding and abscisic acid. ATAF1 attentuates ABA signaling and sythesis. Mutants are hyposensitive to ABA. The mRNA is cell-to-cell mobile. |
| AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
| AT1G20823 | Encodes a RING E3 ubiquitin ligase ATL80. Involved in phosphate mobilization and cold stress response in sufficient phosphate growth conditions. The mRNA is cell-to-cell mobile. |
| AT5G65990 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
| AT2G34810 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20830 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). It is involved in plant immunity. Overexpressing plants are more resistant to B. cinerea. |
| AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT4G20840 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT5G44400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT3G13790 | Encodes a protein with invertase activity. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G66810 | Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis. |
| AT2G02160 | Non- tandem CCCH zinc finger protein. |
| AT5G26130 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT4G01610 | Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture. |
| AT1G16380 | member of Putative Na+/H+ antiporter family |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT2G27490 | AT2G27490 encodes dephospho-CoA kinase. The molecular function was shown to phosphorylate the ribosyl moiety forming CoA. |
| AT1G27840 | Encodes a DDB1a interacting protein ATCSA-1 required for UV-B tolerance and genomic integrity. |
| AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
| AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
| AT4G21030 | Encodes a nuclear protein that can bind DNA in a sequence specific manner and is involved in seed coat development and shoot branching. It has been shown to activate transcription of a target gene, AtEXPA9. |
| AT5G66940 | Encodes a nuclear localized DOF-domain binding transcription factor. |
| AT2G05630 | in the Arabidopsis autophagy pathway |
| AT5G66030 | Involved in golgi protein trafficking. AtARL1 binds directly to the GRIP domain of AtGRIP in a GTP-dependent manner. Localized to the golgi apparatus, tyrosine 717 in AtGRIP is crucial for Golgi localization. |
| AT3G62760 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
| AT1G52150 | Member of the class III HD-ZIP protein family. Contains homeodomain and leucine zipper domain. Critical for vascular development and negatively regulates vascular cell differentiation. |
| AT1G69780 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein which is expressed during the seed-to-seedling transition, regulates some of the network nodes, and affects late seedling establishment. Knock-out mutants for athb13 showed increased primary root length as compared with wild type (Col-0) seedlings, suggesting that this transcription factor is a negative regulator of early root growth, possibly repressing cell division and/or cell elongation or the length of time cells elongate. |
| AT1G17780 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT2G16575 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT1G23465 | Mitochondrial ATP-independent protease |
| AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
| AT1G18150 | Encodes mitogen-activated protein kinase 8 (MPK8). MPK8 connects protein phosphorylation, Ca2+, and ROS in the wound-signaling pathway. |
| AT3G63260 | protein kinase, similar to mammal mixed-lineage kinase and Raf protein kinase |
| AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
| AT5G26770 | NEAP2 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
| AT3G47980 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT1G15500 | TLC ATP/ADP transporter;(source:Araport11) |
| AT1G07620 | GTP-binding protein Obg/CgtA;(source:Araport11) |
| AT4G16160 | Homologous to pea OEP16 and barley pPORA (OEP16), a member of Arabidopsis OEP16 family. Two OEP16 genes are closely related to each other and are conserved in all land plants, OEP16-2, also named OEP16-S, and OEP16-1 (renamed OEP16-L) are result of the gene duplication event that occurred prior to divergence of bryophytes and seed plants. Predominantly expressed in seed and is not inducible by cold treatment. atOEP16-S gained an additional exon. The promoter region of atOEP16-S (but not atOEP16-L) contains multiple G-box ABA-responsive elements. The atOEP16-S promoter conferred developmentally regulated seed- and pollen-specific GUS expression in tobacco. |
| AT4G00860 | putative pathogenesis-related protein whose transcript level is induced in response to ozone and pathogenic Pseudomonas strains. |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT1G35537 | Encodes a defensin-like peptide with antifungal activity. |
| AT3G47380 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. |
| AT3G14300 | pectinesterase family protein;(source:Araport11) |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G11570 | Encodes plastid localized protein involved in riboflavin biosynthesis. It dephosphorylates 5-amino-6-ribitylamino- 2,4(1H,3H) pyrimidinedione 5′-phosphate (ARPP) . |
| AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
| AT1G19230 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT2G23310 | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. |
| AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
| AT5G37370 | encodes a putative splicing factor. Over-expression in yeast and Arabidopsis result in increased tolerance to high salt. |
| AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
| AT5G51170 | U6 snRNA phosphodiesterase-like protein;(source:Araport11) |
| AT5G58180 | member of YKT6 Gene Family |
| AT1G19910 | vacuolar H+-pumping ATPase 16 kDa proteolipid (ava-p2) |
| AT4G12490 | Encodes a member of the AZI family of lipid transfer proteins. Contains a PRR domain that appears to be required for localization to the chloroplast. |
| AT4G12510 | Encodes a member of the AZI family of lipid transfer proteins. |
| AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G21340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G06850 | dihydrolipoamide branched chain acyltransferase |
| AT5G20950 | Encodes a beta-glucosidase involved in xyloglucan metabolism. |
| AT1G72210 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT2G41130 | Encodes STC8 (salt tolerant callus 8)/bHLH106 (basic helix-loop-helix transcription factor bHLH106). Knockout lines are more sensitive to NaCl, KCl, LiCl, ABA, and low temperatures than the wild-type. |
| AT2G43140 | bHLH129 is a nuclear localized basic helix loop helix protein. It has been shown to function as a transcriptional repressor. Overexpression of bHLH129 regulates root elongation and ABA response. |
| AT4G00870 | bHLH14 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH17 to negatively regulate jasmonate responses. |
| AT3G57800 | Together with bHLH48 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
| AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
| AT5G28540 | Encodes the luminal binding protein BiP, an ER-localized member of the HSP70 family. BiP is composed of an N-terminal ATP binding domain and a C-terminal domain that binds to hydrophobic patches on improperly/incompletely folded proteins in an ATP-dependent manner. Involved in polar nuclei fusion during proliferation of endosperm nuclei. |
| AT2G39760 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT2G42270 | Similar to yeast Brr2p DEAD/DExH box ATP-dependent RNA helicase. |
| AT3G11480 | The gene encodes a SABATH methyltransferase that methylates both salicylic acid and benzoic acid. It is highly expressed in flowers, induced by biotic and abiotic stress and thought to be involved in direct defense mechanism. |
| AT3G58120 | Encodes a member of the BZIP family of transcription factors. Forms heterodimers with the related protein AtbZIP34. Binds to G-boxes in vitro and is localized to the nucleus in onion epidermal cells. |
| AT5G40880 | Involved in seed germination, seedling/seed development, interacting with PPPDE family protein Desi1. |
| AT5G57580 | Calmodulin-binding protein;(source:Araport11) |
| AT4G25800 | Calmodulin-binding protein;(source:Araport11) |
| AT2G24300 | Calmodulin-binding protein;(source:Araport11) |
| AT1G15220 | Encodes a protein with oxidoreductase activity present in the inner membrane of mitochondria. CCMH is postulated to play a central role in mitochondrial cytochrome c maturation, probably as part of a heme lyase complex that also holds activity of reducing apocytochrome c. CCMH interacts with apocytochrome AtCYTc-a and is shown to be present in a 500 kDa-complex along with CcmFN2. |
| AT1G02150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G07270 | Cell division control, Cdc6;(source:Araport11) |
| AT1G62820 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G33320 | DUF641 domain protein, probable psuedogene. |
| AT2G29720 | Encodes CTF2B. |
| AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G57680 | C-terminal peptidase |
| AT2G33740 | encodes a copper binding protein that forms tetramers in vitro. Gene is expressed in all tissues examined and protein is localized to the chloroplast. The mRNA is cell-to-cell mobile. |
| AT1G59520 | Encodes CW7. |
| AT1G17130 | DUF572 domain protein involved in alternative splicing. |
| AT5G48640 | Cyclin family protein;(source:Araport11) |
| AT5G48630 | Cyclin family protein;(source:Araport11) |
| AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
| AT2G34170 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
| AT3G54600 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT1G56300 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT3G44460 | basic leucine zipper transcription factor (BZIP67), identical to basic leucine zipper transcription factor GI:18656053 from (Arabidopsis thaliana); identical to cDNA basic leucine zipper transcription factor (atbzip67 gene) GI:18656052. Located in the nucleus and expressed during seed maturation in the cotyledons. |
| AT2G17200 | Encodes a ubiquitin receptor protein that specifically associates with PEX2 and PEX12. |
| AT2G41750 | Involved in posttranscriptional modification of tRNA. Can form acp3U20b on a tRNA expressed in yeast cells. The aspartate and tryptophan residues in the DXTW motif of this protein are required for modification activity. Required for the acp3U20a modification of cytosolic tRNA. |
| AT1G47530 | MATE efflux family protein;(source:Araport11) |
| AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
| AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
| AT2G35615 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G13880 | ELM2 domain-containing protein;(source:Araport11) |
| AT2G32580 | transmembrane protein, putative (DUF1068);(source:Araport11) |
| AT1G05070 | transmembrane protein, putative (DUF1068);(source:Araport11) |
| AT3G26820 | Esterase/lipase/thioesterase family protein;(source:Araport11) |
| AT5G58370 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
| AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT2G37640 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G32170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT4G35900 | bZIP protein required for positive regulation of flowering. Mutants are late flowering. FD interacts with FT to promote flowering.Expressed in the shoot apex in floral anlagen, then declines in floral primordia. |
| AT1G60950 | encodes a major leaf ferredoxin |
| AT1G12130 | Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates. |
| AT3G21730 | Dihydroneopterin aldolase;(source:Araport11) |
| AT2G43410 | FPA is a gene that regulates flowering time in Arabidopsis via a pathway that is independent of daylength (the autonomous pathway). Mutations in FPA result in extremely delayed flowering. Double mutants with FCA have reduced fertility and single/double mutants have defects in siRNA mediated chromatin silencing. |
| AT2G36250 | Encodes one of two FtsZ proteins, tubulin-like proteins, in Arabidopsis. It is involved in chloroplast division. |
| AT3G06580 | Encodes a protein with galactose kinase activity. The gene was shown to complement the yeast Agal1 mutant defective in the galactokinase gene GAL1. |
| AT3G06440 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced root hair growth and reduced seed coat mucilage. |
| AT5G62620 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced seed coat mucilage and accelerated leaf senescence. |
| AT3G13040 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT5G06270 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations |
| AT3G11600 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations. |
| AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
| AT4G12790 | GPN GTPase involved in selective nuclear import of RNA polymerase II. |
| AT1G28480 | Encodes GRX480, a member of the glutaredoxin family that regulates protein redox state. GRX480 interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. GRX480 transcription is SA-inducible and requires NPR1. Maybe involved in SA/JA cross-talk. It has also been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT3G62950 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT4G15680 | Encodes a member of the CC-type glutaredoxin (ROXY) family. Operates downstream of cytokinins in a signal transduction pathway that negatively regulates plant primary root growth in response to nitrate. |
| AT1G12230 | Aldolase superfamily protein;(source:Araport11) |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT4G01070 | the glycosyltransferase (UGT72B1) is involved in metabolizing xenobiotica (chloroaniline and chlorophenole). Comparison between wild type and knock-out mutant demonstrates the central role of this gene for metabolizing chloroaniline but significantly less for chlorophenole. The glucosyltransferase preferred UDP-xylose over UDP-glucose indicating its (additional) functioning as a xylosyltransferase in planta |
| AT1G08880 | Encodes HTA5, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10?20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
| AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT4G17460 | Encodes a class II HD-ZIP protein that regulates meristematic activity in different tissues, and that it is necessary for the correct formation of the gynoecium. |
| AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
| AT3G19510 | Encodes a member of the PHD-finger homeodomain protein family. The HAT3.1 homeodomain is highly divergent in sequence even at positions that are almost invariable among homeodomains. HAT3.1 shows a preference for the sequence T(A/G)(A/C)ACCA, different from those bound by other homeodomains. |
| AT5G08720 | Encodes PIN2 PROMOTER BINDING PROTEIN 1 (PPP1), an evolutionary conserved plant-specific DNA binding protein that acts on transcription of PIN genes. Also named as HCF145. Mutations in HCF145 have reduced level of the tricistronic psaA-psaB-rps (small-subunit ribosomal protein)14 mRNA which encodes for the major subunits of the photosystem I (PSI). HCF145 binds to the 5'UTR of PSAA via a novel TMR domain. It functions to stabilize the PSAA transcript. |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT3G03890 | Dimeric β-barrel protein that is structurally related to the putative non-canonical heme oxygenase (HO) and is located in chloroplasts. May function additionally in the tetrapyrrole biosynthetic pathway. |
| AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
| AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT5G02570 | Histone superfamily protein;(source:Araport11) |
| AT2G37470 | Histone superfamily protein;(source:Araport11) |
| AT3G09480 | Histone superfamily protein;(source:Araport11) |
| AT5G10390 | Histone superfamily protein;(source:Araport11) |
| AT1G75600 | Histone superfamily protein;(source:Araport11) |
| AT1G56460 | HIT zinc finger and PAPA-1-like domain-containing protein;(source:Araport11) |
| AT2G17520 | Encodes a endoribonuclease/protein kinase IRE1-like protein that is predicted to form a type I transmembrane protein structure and contain kinase/endoribonuclease domains at their C-terminal halves. The transcript levels for several ER-stress responsive genes, including six protein disulfide isomerases (PDIs), BiP2, and AtbZIP60 are not affected in ire1-2 null mutants. The mRNA is cell-to-cell mobile. |
| AT4G19000 | The C-terminal portion of this protein has homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT3G12130 | KHZ1 is a CCCH zinc-finger and KH domain protein belonging to the VII subfamily. It is expressed throughout the plant. Highly similar to KHZ2. khz1 mutants are late flowering and double mutants with khz2 are even more late flowering. Overexpression leads to increased rates of leaf senescence. |
| AT3G50240 | Encodes a kinesin-related protein. |
| AT2G34480 | Encodes a nuclear localized member of the ribosomal L18ae/LX protein family. Loss of function mutations show reduced transmission through the gametophytes and embryo lethality. |
| AT3G27025 | Encodes a member of the LAZY gene family that is expressed in the shoot apex. |
| AT1G04970 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. Putative BPI/LBP family protein. |
| AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
| AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
| AT1G32080 | Encodes a plant LrgAB/CidAB protein localized to the chloroplast envelope that is involved in chloroplast development, carbon partitioning, ABA/drought response, and leaf senescence. The gene may have evolved from gene fusion of bacterial lrgA and lrgB. |
| AT2G41280 | Encodes a hydrophilic protein similar to Late Embryogenesis Activated (LEA) proteins expressed during embryogenesis, which are thought to be involved in the acquisition of desiccation tolerance. |
| AT2G41260 | Late-embryogenesis-abundant gene. Involved in the acquisition of desiccation tolerance during late phase of embryogenesis. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G16120 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G18360 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G73480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G47630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G20680 | Encodes a mannanase belonging to clade 1 of the GH5 7 phylogenetic tree that exhibits high substrate affinity and catalytic efficiency on mannan substrates with main chains containing both glucose and mannose units such as konjac glucomannan and spruce galactoglucomannan. It is likely a glycoprotein. |
| AT1G23360 | Encodes a 2-phytyl-1,4-naphthoquinone methyltransferase that catalyzes the final step in phylloquinone (vitamin K1) biosynthesis. |
| AT5G24020 | Encodes a Ca2+ dependent ATPase required for correct positioning of the chloroplast division apparatus. Its ATPase activity is stimulated by AtMinE1, a topological specificity factor. |
| AT1G78830 | In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance. |
| AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
| AT1G78930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G62490 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G21150 | mTERF protein involved in mitochondrial development; required for salt tolerance. |
| AT1G61960 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G61970 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G62120 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT5G23930 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT3G58060 | TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.) |
| AT1G63680 | Encodes AtMurE, a homolog of the bacterial MurE that catalyze the ATP-dependent formation of UDP-N-acetylmuramic acid-tripeptide in bacterial peptidoglycan biosynthesis. Localized to plastids. AtMurE is involved in chloroplast biogenesis. |
| AT5G43560 | Encodes MUSE14, a TRAF domain protein. Regulates the turnover of nucleotide-binding domain and leucine-rich repeat-containing (NLR) immune receptors SNC1 and RPS2. Loss of both MUSE13 and MUSE14 leads to enhanced pathogen resistance, NLR accumulation, and autoimmunity. In addition, MUSE13/14 physically interact with ATG6 and appear to regulate ATG6 ubiquitination and thus formation of autophagosomes. |
| AT5G56110 | Encodes a member of the R2R3 MYB transcription factor gene family that is required for anther development by regulation tapetum development, callose dissolution and exine formation. It acts upstream of MS2. |
| AT3G04030 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
| AT3G15950 | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
| AT2G39020 | Although this locus shares considerable sequence similarity with the adjacent NATA1 gene (At2g39030), they appear to encode genes with different functions. NATA1 is involved in the production of N-delta-acetylornithine, but, overexpression of At2g39020 in tobacco does not lead to the formation of this defense compound. The mRNA is cell-to-cell mobile. |
| AT5G19640 | Influences leaf N export via sink-to-source feedback, perhaps via a role in sensing plant internal N-status. Necessary for normal leaf N export under low N. |
| AT4G05220 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G10300 | GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1. |
| AT5G55850 | NOI protein |
| AT1G02080 | Acts as scaffold protein in the CCR4-NOT complex, by interacting with various NOT proteins and CAF1. Essential protein for proper pollen development and germination capacity. |
| AT5G18420 | CCR4-NOT transcription complex subunit;(source:Araport11) |
| AT2G38100 | Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos. |
| AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT1G49670 | molecular function has not been defined. Was shown involved in oxidative stress tolerance. |
| AT4G21710 | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
| AT2G15430 | Non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, encoded by At2g15400, can substitute for At2g15430 in the context of Pol V. |
| AT2G04630 | One of two highly similar proteins that can serve as a non-catalytic subunit of nuclear DNA-dependent RNA polymerases II and V; homologous to budding yeast RPB6 and the E. coli RNA polymerase omega subunit. Probably redundant with At5g51940. |
| AT3G59600 | One of two highly similar proteins that can serve as non-catalytic subunits of Nuclear RNA polymerases II, IV and V; homologous to budding yeast RPB8. Probably redundant with At1g54250. |
| AT3G22900 | Non-catalytic subunit specific to DNA-directed RNA polymerase IV; homologous to budding yeast RPB7 |
| AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
| AT1G21320 | nucleic acid/nucleotide binding protein;(source:Araport11) |
| AT5G60980 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
| AT3G14590 | Ca2+-dependent lipid-binding protein |
| AT1G07615 | GTP-binding protein Obg/CgtA;(source:Araport11) |
| AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G22240 | Ovate family protein;(source:Araport11) |
| AT1G11960 | Calcium channel that is phosphorylated by BIK1 in the presence of PAMPS and required for stomatal immunity. |
| AT1G32090 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT4G35870 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
| AT3G03773 | Encodes one of two isoforms of a co-chaperone of HSP90 that is required for root growth, in particular in the maintenance of the root meristem. It can be phosphorylated in vitro by human and maize CK2. |
| AT5G16680 | PHD protein which cooperates with AIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G61880 | Encodes PAM16L, a paralog of PAM16 (AT3G59280). |
| AT3G48760 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G18940 | clast3-like protein;(source:Araport11) |
| AT3G60820 | Encodes 20S proteasome beta subunit PBF1 (PBF1). |
| AT5G35580 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G18610 | Encodes a receptor-like cytoplasmic kinase that is an immediate downstream component of the chitin receptor CERK1 and contributes to the regulation of chitin-induced immunity. |
| AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G32730 | Encodes a putative c-myb-like transcription factor with three MYB repeats. |
| AT1G19610 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT2G02120 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. Mediates ammonium metabolism by regulatingglutamine synthetase activity. |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
| AT5G47690 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
| AT1G77600 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
| AT4G31880 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
| AT1G80810 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
| AT2G39550 | encodes the beta subunit of geranylgeranyl transferase (GGT-IB), involved in both ABA-mediated and auxin signaling pathways. |
| AT1G43770 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT5G12150 | Encodes a protein with similarity to REN1, a Rho GTPase activating protein.It is cytoplasmic and plasma membrane associated in interphase, but during mitosis localizes to the CDZ/CDS in a POK-dependent manner. |
| AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT5G10410 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G14910 | ANTH domain-containing protein which functions as adaptor protein for clathrin-mediated endocytosis (CME) of the secretory vesicle-associated longintype R-SNARE VAMP72 group. Interacts with the SNARE domain of VAMP72 and clathrin at the plasma membrane. Required for recycling of R-SNARE proteins. |
| AT4G25940 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT5G35200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G25240 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT2G01920 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT1G60890 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
| AT3G22960 | encodes a chloroplast pyruvate kinase alpha subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mRNA is cell-to-cell mobile. |
| AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
| AT3G60670 | PLATZ transcription factor family protein;(source:Araport11) |
| AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G76590 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G62770 | PMEI9 pectin methyleseterase inhibitor. Expressed in many plant tissues. |
| AT4G04470 | 22-kD peroxisomal membrane protein, an integral membrane protein embedded in the lipid bilayer. |
| AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
| AT1G78650 | Similar to DNA polymerase delta (POLD3), which in other organism was shown to be involved in the elongation of DNA replication. |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT1G77800 | PHD finger family protein;(source:Araport11) |
| AT2G07040 | Pollen receptor kinase. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth. |
| AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G18980 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
| AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile. |
| AT1G03600 | PSB27 is a chloroplast lumen localized protein that is involved in adaptation to changes in light intensity. |
| AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G18560 | Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression. |
| AT3G55010 | encoding phosphoribosylformylglycinamidine cyclo-ligase (syn. AIR synthetase)that phosphorylates 5-phosphoribosyl-N-formylglycinamidine (FGAM) to form 5-aminoimidazole ribonucleotide (AIR) |
| AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
| AT5G20850 | Encodes a homolog of yeast RAD51. Its mRNA is most abundant in early flower buds and is expressed at high levels in exponentially growing cells in suspension cultures and is induced in response to gamma radiation. Also involved in defense gene transcription during plant immune responses. |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT1G11650 | Encodes an RNA binding protein with three RNA recognition motifs. The mRNA is cell-to-cell mobile. |
| AT1G10930 | DNA helicase involved in the maintenance of genome stability by modulation of the DNA damage response and suppression of homologous recombination. |
| AT3G46770 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT3G06220 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT1G16590 | putative translesion synthesis polymerase zeta subunit, homologous to Y-family DNA polymerases, contains BRCT domain. Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
| AT3G24240 | RGFR1 is a leucine--rich repeat receptor kinase that, together with RGFR2 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT1G35630 | Protease-associated (PA) RING/U-box zinc finger family protein;(source:Araport11) |
| AT3G13740 | Encodes one of two chloroplast Mini-RNase III-like enzymes in Arabidopsis. Double mutants display imprecise maturation of 23S rRNA and other rRNAs. |
| AT5G18600 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT5G11930 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
| AT3G02920 | Replication protein A, subunit RPA32;(source:Araport11) |
| AT5G61000 | Replication factor-A protein 1-like protein;(source:Araport11) |
| AT4G27090 | Cytoplasmic ribosomal protein.Essential gene as homozygotes are lethal and heterozygotes have various defects in gametophyte development and function. |
| AT1G15250 | cytosolic ribosomal protein gene, part of eL20 family |
| AT2G01250 | Cytosolic ribosomal 60S subunit protein. |
| AT1G23410 | cytosolic ribosomal protein gene, part of eS31 family |
| AT5G56670 | Ribosomal protein S30 family protein;(source:Araport11) |
| AT3G25430 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G32415 | Encodes a PPR protein involved in mitochondrial functioning. Mutants suppress cell wall defects caused by C17 chemical inhibitor. Mutants are defective in cytochrome c maturation and activation of mitochondrial retrograde signalling. |
| AT5G22070 | Putative glycosyltransferase that negatively regulates leaf senescence in a SID2 dependent manner. |
| AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
| AT2G25420 | WD40 domain protein which interacts with ROS1 in the base excision repair pathway through DNA methylation. |
| AT1G58370 | Encodes a protein with xylanase activity. |
| AT1G58430 | Encodes an anther-specific proline-rich protein. |
| AT1G58520 | GDSL-like lipase/acylhydrolase superfamily protein;(source:Araport11) |
| AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
| AT5G09460 | transcription factor bHLH143;(source:Araport11) |
| AT1G32960 | Subtilase family protein;(source:Araport11) |
| AT1G32940 | Subtilase family protein;(source:Araport11) |
| AT5G59810 | Subtilase family protein;(source:Araport11) |
| AT1G22870 | One of two paralogs in Arabidopsis.Loss of both SCYL2B and SCYL2A results in severe growth defects. |
| AT4G12120 | member of KEULE Gene Family |
| AT1G18830 | Together with SEC31B a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT3G63460 | Together with SEC31A a component of the coat protein complex II (COPII) which promotes the formation of transport vesicles from the endoplasmic reticulum (ER). |
| AT1G64350 | seh1-like protein |
| AT3G48900 | Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria. |
| AT1G47710 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT2G34980 | Encodes a putative phosphatidylinositol-glycan synthase subunit C gene. It is involved in the first step of the glycosylphosphatidylinositol (GPI) biosynthetic pathway. |
| AT5G54840 | Monomeric G protein. Expressed in the root quiescent center, flowers, and leaf guard cells and hydathodes. |
| AT1G78880 | Plasma membrane-localized proteins that negatively regulate cellulose synthesis by inhibiting the exocytosis of CESAs. |
| AT1G69220 | Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion. |
| AT3G13672 | SINAT homolog with truncated RING finger and zinc finger domains. |
| AT2G41980 | SINAT1 is an E3 ligase involved in protein ubiquination. Along with MUSE13/14 targets ATG6 ubiquination to regulate autophagosome assembly. |
| AT5G53360 | RING‐finger E3 ubiquitin ligase (SINATT) member that lacks ubiquitin ligase activity due to the absence of the RING domain, functions as a protector protein which stabilizes FREE1. Involved in response to iron deficiency stress. |
| AT3G03970 | At3G03970 encodes the plant KASH protein SINE2; SINE2 interacts with SUN1 and SUN2 and is localized at the nuclear envelope. |
| AT3G06600 | At3G06600 encodes the plant KASH protein SINE3; SINE3 interacts with SUN1 and SUN2 and is localized at the nuclear envelope. |
| AT4G24950 | Encodes the plant KASH protein SINE4; SINE4 interacts with SUN1 and SUN2 and is localized at the nuclear envelope. |
| AT1G77000 | AtSKP2;2 is a homolog of human SKP2, the human F-box protein that recruits E2F1. Contains an F-box motif at the N-terminal region and a C-terminal Leu-rich repeat domain. Forms part of an E3-ubiquitin-ligase SCF (Skp1, cullin, F-box) complex and recruits phosphorylated AtE2Fc, a transcriptional factor that might play a role in cell division and during the transition from skotomorphogenesis to photomorphogenesis. AtSKP2;1 (At1g21410) and AtSKP2;2 (At1g77000) may be duplicated genes. AtSKP2b may also be involved in the degradation of KRP1/ICK1, a CDK inhibitor. |
| AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
| AT2G19830 | SNF7 family protein;(source:Araport11) |
| AT1G17600 | SOC3 is a TIR-NB-leucine-rich repeat (TNL) protein.Mutants suppress loss of chs2 phenotype of auto-activation of immunity. When the TIR domain of SOC3 interacts with CHS2 the binding results in temperature activation of cell death, the suppressors inhibit this interaction. |
| AT3G22760 | CXC domain containing TSO1-like protein 1. The gene is expressed in stamens, pollen mother cells, and immature ovules. Regulates fate transition and cell Divisions in the stomatal lineage. |
| AT1G63210 | SPT6L encodes a putative WG/GW-repeat protein involved in the regulation of apical-basal polarity of embryo |
| AT5G24150 | squalene monooxygenase gene homolog |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT1G73820 | Protein phosphatase which physically interacts with the RRM1 motif of FCA to antagonize FCA binding with COOLAIR, which is critical for PRC2 enrichment and H3K27me3 deposition. |
| AT4G08810 | Calcium binding protein involved in cryptochrome and phytochrome coaction |
| AT1G23090 | Encodes AST91 mRNA for sulfate transporter. |
| AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G09310 | ABA responsive trichome formation regulator. |
| AT4G24130 | ABA responsive SVB family gene. |
| AT5G49600 | ABA responsive SVB family gene. |
| AT1G21460 | Nodulin MtN3 family protein;(source:Araport11) |
| AT3G48740 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT5G50800 | Encodes a member of the SWEET sucrose efflux transporter family proteins, together with RPG1, it is involved in pollen development. Together with SWEET14, it is likely involved in modulating the GA response and is required for proper development of anthers, seeds and seedlings. |
| AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
| AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
| AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G02280 | Flavoenzyme-encoding gene. |
| AT4G23050 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
| AT1G24706 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. Mutations in THO have severe developmental defects and affect the production of several different classes of small RNAs indicating a broader role in small RNA biosynthesis. |
| AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
| AT5G55220 | Contains with HP22 a protein that is related to the bacterial trigger factor chaperone. Plants depleted of either HP22 or HP65b or even both were increasingly delayed in leaf senescence and retained much longer stromal chloroplast constituents than wild-type plants. |
| AT3G01780 | Encodes TPLATE, a cytokinesis protein targeted to the cell plate. Functions in vesicle-trafficking events required for site-specific cell wall modifications during pollen germination and for anchoring of the cell plate to the mother wall at the correct cortical position. |
| AT5G02280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT5G16280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
| AT1G60900 | Putative U2A65 splicing factor which functions in abscisic acid mediated flowering via regulating the precursor messenger RNA splicing of ABI5 and FLC in shoot apex. Regulates flowering time and displays a redundant role in pollen tube growth together with AtU2AF65a. |
| AT2G41160 | ATI3A interacting protein containing a large N-terminal rhomboid-like transmembrane domain and a UBA domain at their C terminus, localized in the ER with a role in plant heat tolerance. UBAC2 proteins may act as both cargo receptors and inducers of an ATI3-mediated selective autophagy pathway, where ATI3 and UBAC2 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT4G02890 | Polyubiquitin gene containing 4 ubiquitin repeats. |
| AT5G16310 | Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1;(source:Araport11) |
| AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT1G22400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT3G22450 | Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. Required for the splicing of two mitochondrial introns. |
| AT1G67250 | Proteasome maturation factor UMP1;(source:Araport11) |
| AT1G61180 | Coiled-coil nucleotide-binding leucine-rich-repeat protein involved in disease resistance. |
| AT3G58730 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
| AT3G45000 | SNF7 family protein;(source:Araport11) |
| AT4G05000 | Vacuolar protein sorting-associated protein VPS28 family protein;(source:Araport11) |
| AT5G09320 | vacuolar protein sorting-associated 9A-like protein;(source:Araport11) |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G29170 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT4G18600 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT4G26640 | member of WRKY Transcription Factor; Group I |
| AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
| AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT5G37300 | Encodes a bifunctional enzyme, wax ester synthase (WS) and diacylglycerol acyltransferase (DGAT). In vitro assay indicated a ratio of 10.9 between its WS and DGAT activities. Both mutant and in vivo expression/analysis in yeast studies indicated a role in wax biosynthesis. |
| AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
| AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
| AT2G46520 | cellular apoptosis susceptibility protein, putative / importin-alpha re-exporter;(source:Araport11) |
| AT1G58380 | Ribosomal protein S5 family protein;(source:Araport11) |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT1G21430 | Flavin-binding monooxygenase family protein;(source:Araport11) |
| AT4G21160 | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
| AT2G30080 | member of Fe(II) transporter isolog family. Gene expression is not regulated by iron, copper, or zinc deficiency or excess. |
| AT3G57700 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G65190 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G57720 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G58350 | Putative serine esterase family protein;(source:Araport11) |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT4G35040 | Basic-region leucine zipper (bZIP19) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
| AT2G16770 | Basic-region leucine zipper (bZIP23) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
| AT5G14220 | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
| AT4G37770 | Encodes an auxin inducible ACC synthase. |
| AT1G12010 | Encodes a protein that appears to have 1-amino-cyclopropane-1-carboxylic acid oxidase activity based on mutant analyses. The mRNA is cell-to-cell mobile. |
| AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
| AT1G48130 | encodes a protein similar to the 1-cysteine (1-Cys) peroxiredoxin family of antioxidants. Expression is limited to seed (aleurone and embryo) and is not induced by ABA or drought. |
| AT2G31360 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression up-regulated by cold temperature. It is involved in the synthesis of the 24:1n-9 and 26:1n-9 components of seed lipids, sphingolipids and the membrane phospholipids phosphatidylserine (PS), and phosphatidylethanolamine (PE). |
| AT5G23020 | methylthioalkymalate synthase-like. Also known as 2-isopropylmalate synthase (IMS2). encodes a methylthioalkylmalate synthase involved in the biosynthesis of aliphatic glucosinolates which accepts all the omega-methylthio-2-oxoalkanoic acids needed to form the known C3 to C8 glucosinolates in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G22110 | Encodes the alpha-3 subunit of 20s proteasome. |
| AT3G14290 | Encodes 20S proteasome subunit PAE2 (PAE2) that has RNase activity. |
| AT1G47250 | Encodes 20S proteasome subunit PAF2 (PAF2). |
| AT2G27020 | Encodes 20S proteasome alpha 7 subunit PAG1. |
| AT1G77440 | Encodes beta subunit of 20s proteosome complex which is involved in protein degradation. |
| AT2G20580 | encoding the RPN subunits of the 26S proteasome The mRNA is cell-to-cell mobile. |
| AT2G26800 | Mutant has increased seed ile, leu and val as well as his and arg. |
| AT2G17370 | Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds. |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT2G26250 | epidermis-specific, encodes KCS10, a putative 3-ketoacyl-CoA synthase. probably involved in the synthesis of long-chain lipids found in the cuticle. |
| AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT4G34250 | Encodes KCS16, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G04220 | Encodes KCS2, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT5G49070 | Encodes KCS21, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G07720 | Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G71160 | Encodes KCS7, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G47290 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT2G26260 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT3G21240 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, 5-OH-ferulic acid and cinnamic acid. At4CL2 was unable to use sinapic acid as substrate. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT2G18250 | At2g18250 encodes pantetheine-phosphate adenylyltransferase catalyzing the formation of dephospho-CoA from pantetheine 4'-phosphate. The enzyme is involved in coenzyme A biosynthesis. |
| AT1G75660 | Encodes a protein with similarity to yeast 5'-3'exonucleases and can functionally complement the yeast mutations. In Arabidopsis XRN3 acts as a suppressor of posttranscriptional gene silencing. Mutants accumulate excised miRNA products suggesting that XRN3 is involved in degradation of these products. |
| AT5G24420 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
| AT5G47700 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
| AT1G29970 | 60S ribosomal protein L18A-1;(source:Araport11) |
| AT5G67030 | Encodes a single copy zeaxanthin epoxidase gene that functions in first step of the biosynthesis of the abiotic stress hormone abscisic acid (ABA). Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
| AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
| AT2G44880 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
| AT2G36270 | Encodes a member of the basic leucine zipper transcription factor family, involved in ABA signalling during seed maturation and germination. The Arabidopsis abscisic acid (ABA)-insensitive abi5 mutants have pleiotropic defects in ABA response, including decreased sensitivity to ABA inhibition of germination and altered expression of some ABA-regulated genes. Comparison of seed and ABA-inducible vegetative gene expression in wild-type and abi5-1 plants indicates that ABI5 regulates a subset of late embryogenesis-abundant genes during both developmental stages. Responsible for reducing cadmium uptake, mediated by interaction with MYB49 . |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT4G11690 | Encodes ABO8, a pentatricopeptide repeat (PPR) protein responsible for the splicing of NAD4 intron 3 in mitochondrial complex I. Abo8 mutants accumulate more reactive oxygen species (ROS) in root tips than the wild type. |
| AT1G66600 | A member of WRKY Transcription Factor; Group III. Involved in the regulation of plant responses to ABA and drought stress. |
| AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
| AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
| AT5G50360 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT5G63350 | ABA‐induced transcription repressor that acts as feedback regulator in ABA signalling. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT3G54770 | Encodes a putative RNA binding protein that is localized in the nucleus and affects ABA-regulated seed germination of Arabidopsis. |
| AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
| AT1G05805 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G31390 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G60600 | Encodes a protein similar to 1,4-dihydroxy-2-naphthoic acid phytyltransferase involved in phylloquinone and plastoquinone biosynthesis. Mutants are pale green and heterotrophic with defects in photosynthetic electron transport. |
| AT3G23560 | Member of the multidrug and toxic compound extrusion (MATE) family, protects roots from inhibitory compounds. |
| AT5G42630 | Encodes a member of the KANADI family of putative transcription factors. Involved in integument formation during ovule development and expressed at the boundary between the inner and outer integuments. It is essential for directing laminar growth of the inner integument.Along with KAN1 and KAN2, KAN4 is involved in proper localization of PIN1 in early embryogenesis. |
| AT1G69260 | ABI five binding protein;(source:Araport11) |
| AT3G29575 | ABI five binding protein 3;(source:Araport11) |
| AT5G17640 | Expression of this gene is induced by abscisic acid and salt stress. |
| AT5G42030 | ABL interactor-like protein 4;(source:Araport11) |
| AT2G45190 | Encodes a member of the YABBY family of transcriptional regulators that is involved in abaxial cell type specification in leaves and fruits. YAB1 acts in a non-cell autonomous fashion within the meristem to affect phyllotactic patterning. The non-autonomous effect on the central region of the meristem is mediated through the activity if Lateral Suppressor (LAS). |
| AT1G62340 | Subtilisin-like serine protease required for epidermal surface formation in embryos and juvenile plants |
| AT5G14850 | Encodes a putative mannosyltransferase homolog to human PIG-B and yeast GPI10, both of which are involved in the biosynthesis of glycosylphosphatidylinositol (GPI) anchors. Disruption of the gene affects COBRA-LIKE10 localization, a GPI-anchored protein (GPI-AP) important for pollen tube growth and guidance. |
| AT2G36080 | Encodes a plant-specific B3 DNA-binding domain transcription factor. Has transcription repressor activity. |
| AT4G14400 | encodes a novel protein with putative ankyrin and transmembrane regions. It is a member of one of the largest uncharacterized gene families in higher plants. The gene is involved in resistance to Pseudomonas syringae. |
| AT3G19720 | Encodes a novel chloroplast division protein. Mutants of exhibit defects in chloroplast constriction, have enlarged, dumbbell-shaped chloroplasts. The ARC5 gene product shares similarity with the dynamin family of GTPases, which mediate endocytosis, mitochondrial division, and other organellar fission and fusion events in eukaryotes. Phylogenetic analysis showed that ARC5 is related to a group of dynamin-like proteins unique to plants. A GFP-ARC5 fusion protein localizes to a ring at the chloroplast division site. Chloroplast import and protease protection assays indicate that the ARC5 ring is positioned on the outer surface of the chloroplast. Facilitates separation of the two daughter chloroplasts. |
| AT1G75010 | Encodes ARC3 (Accumulation and Replication of Chloroplast 3), a chloroplast division factor functioning in the initiation of chloroplast division. ARC3 is a chimera of the prokaryotic FtsZ and part of the eukaryotic phosphatidylinositol-4-phosphate 5-kinase (PIP5K). Located on the outer surface of the chloroplast in a ring-like structure at the early stage of chloroplast division. The arc3 mutant has a small number of abnormally large chloroplasts in the cell. |
| AT1G64810 | Encodes a chloroplast localized RNA binding protein that is involved in group II intron splicing. Splicing defects can account for the loss of photosynthetic complexes in apo1 mutants. |
| AT2G31810 | ACT domain-containing small subunit of acetolactate synthase protein;(source:Araport11) |
| AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
| AT1G36160 | Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile. |
| AT2G26400 | Encodes a protein predicted to belong to the acireductone dioxygenase (ARD/ARD?)family. |
| AT4G35830 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. This enzyme can also specifically bind to the 5' UTR of CSD2 in vitro. |
| AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
| AT5G65890 | Member of ACT domain containing protein family. ACT domains are amino acid binding domains. Shows strongest expression in flowers and siliques. |
| AT2G03730 | Member of a small family of ACT domain containing proteins. ACT domains are thought to be involved in amino acid binding. |
| AT3G01990 | Member of a small family of ACT domain containing proteins in Arabidopsis. ACT domains are involved in amino acid binding. |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT5G09810 | Member of Actin gene family.Mutants are defective in germination and root growth. The mRNA is cell-to-cell mobile. |
| AT2G42090 | actin related gene or pseudogene, based on sequence divergence and lack of expression |
| AT5G59880 | Encodes actin depolymerizing factor 3 (ADF3). |
| AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
| AT4G34970 | A member of actin polymerizing factors (ADFs)family, ADF9 primarily functions as an actin bundling protein. |
| AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT2G01330 | nucleotide binding protein;(source:Araport11) |
| AT3G33520 | Encodes ACTIN-RELATED PROTEIN6 (ARP6), a putative component of a chromatin-remodeling complex. Required for both histone acetylation and methylation of the FLC chromatin in Arabidopsis. Along with PIE1 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). Incorporation of this variant histone into chromatin mediates the ambient temperature response. Located at specific regions of the nuclear periphery. Expression throughout plants shown by in-situ and immunolocalization methods. Mutants show defects in fertility, leaf, flower and inflorescence development and shorter flowering times. ARP6 also is involved in globally controlling developmental responses to ambient temperature through incorporation of variant histone H2A.Z into chromatin. |
| AT2G33385 | actin-related protein C2B;(source:Araport11) |
| AT1G65890 | acyl activating enzyme 12;(source:Araport11) |
| AT5G16370 | acyl activating enzyme 5;(source:Araport11) |
| AT1G30520 | Encodes a chloroplast O-succinylbenzoyl-CoA ligase. Involved in phylloquinone biosynthesis. Knock mutant is seedling lethal. |
| AT5G23050 | acyl-activating enzyme 17;(source:Araport11) |
| AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
| AT4G27780 | Encodes acyl-CoA-binding protein with ankyrin repeats The mRNA is cell-to-cell mobile. |
| AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
| AT5G65110 | Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis. |
| AT3G51840 | Encodes a short-chain acyl-CoA oxidase, which catalyzes the first step of peroxisomal fatty acid beta-oxidation during early, post-germinative growth in oilseed species. Null mutants virtually lack short-chain acyl-CoA and are resistant to 2,4-dichlorophenoxybutyric acid, which is converted to the herbicide and auxin analogue 2,4-dichlorophenoxyacetic acid by beta-oxidation. Despite the almost complete loss of short-chain activity, lipid catabolism and seedling growth and establishment was unaltered in the acx4 mutant. However, double mutants in acx3acx4 (acx3 encodes medium chain acyl CoA oxidase) were not viable and arrested during embryogenesis. |
| AT1G06310 | Encodes a putative acyl-CoA oxidase. However, no transcripts have been detected for this gene and no altered phenotypes have been detected in plants mutant for this gene. This suggests that ACX6 does not significantly contribute to seedling beta-oxidation of fatty acids or indole-3-butyric acid in vivo. |
| AT1G06090 | Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation. |
| AT2G19790 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
| AT1G10730 | Clathrin adaptor complexes medium subunit family protein;(source:Araport11) |
| AT2G47420 | Encodes a putative rRNA dimethyltransferase. |
| AT5G48300 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS1 is the major small subunit isoform present in all plant tissues tested. The mRNA is cell-to-cell mobile. |
| AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
| AT3G49860 | A member of ARF-like GTPase family. A thaliana has 21 members, in two subfamilies, ARF and ARF-like (ARL) GTPases. Possible pseudogene because it lacks an N-terminal part that is conserved among the other ARL8 proteins. |
| AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
| AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
| AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
| AT2G03060 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL30 is expressed in pollen.It forms heterodimers with other MICK family members. |
| AT2G26320 | AGAMOUS-like 33;(source:Araport11) |
| AT2G26880 | AGAMOUS-like 41;(source:Araport11) |
| AT2G14210 | MADS box gene, transcription factor |
| AT4G02235 | AGAMOUS-like 51;(source:Araport11) |
| AT5G60440 | AGL62 encodes a Type I MADS domain protein that likely functions as a transcription factor. It is expressed AGL62 is expressed exclusively in the endosperm. AGL62 supresses suppresses cellularization during the syncytial phase of endosperm development. |
| AT1G77950 | Cooperates with the histone mark reader EBS to modulate seed germination under high temperature. |
| AT5G51860 | Encodes a MADS-box transcription factor involved in floral transition. |
| AT5G38620 | MADS-box transcription factor family protein;(source:Araport11) |
| AT3G30260 | Agamous-like transcription factor. A target of SPL10, AGL79 knockdowns show defects in leaf shape, shoot branching, and flowering time. |
| AT5G60910 | MADS box gene negatively regulated by APETALA1 |
| AT5G49490 | AGAMOUS-like 83;(source:Araport11) |
| AT5G49420 | MADS-box transcription factor family protein;(source:Araport11) |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT1G60880 | Root Specific |
| AT3G12690 | Encodes a putative serine/threonine kinase It is expressed specifically in pollen and appears to function redundantly with AGC1.7 to regulate polarized growth of pollen tubes. |
| AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
| AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
| AT2G17580 | Encodes a bacterial-type poly(A) polymerase, AGS1. |
| AT5G65510 | Encodes one of three PLETHORA transcription factors required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT4G39660 | alanine:glyoxylate aminotransferase 2 homolog (AGT2). The mRNA is cell-to-cell mobile. |
| AT2G38400 | alanine:glyoxylate aminotransferase 2 homolog (AGT3) mRNA, |
| AT4G01800 | Encodes the ATPase subunit of the chloroplast Sec translocation machinery which plays an essential role in chloroplast biogenesis and the regulation of photosynthesis, the absence of which triggers a retrograde signal, eventually leading to a reprogramming of chloroplast and mitochondrial gene expression. |
| AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
| AT3G66658 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT1G23800 | Encodes a mitochondrial aldehyde dehydrogenase; nuclear gene for mitochondrial product. |
| AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
| AT1G54100 | Aldehyde dehydrogenase |
| AT5G20960 | Encodes aldehyde oxidase AA01. |
| AT1G04580 | Encodes aldehyde oxidase AAO4 preferentially expressed in developing seeds. |
| AT2G37790 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT2G37760 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including aliphatic and aromatic aldehydes and steroids. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
| AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
| AT3G11200 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
| AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
| AT1G22650 | Plant neutral invertase family protein;(source:Araport11) |
| AT4G20070 | The gene encoding Arabidopsis thaliana Allantoate Amidohydrolase (AtAAH)which catalyzes the allantoate deiminase reaction (EC 3.5.3.9)is expressed in all parts of the plant being consistent with a function in purine turnover in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT4G04955 | Encodes an allantoinase which is involved in allantoin degradation and assimilation. Gene expression was induced when allantoin was added to the medium. The insertion mutant, ataln m2-1, did not grow well on the MS medium where allantoin, instead of ammonium nitrate, was supplied. |
| AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
| AT1G64740 | alpha-tubulin expressed primarily in stamens and mature pollen |
| AT5G22770 | AP-2 complex subunit alpha-1. Part of endomembrane trafficking system. |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT1G76130 | alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase, putative, strong similarity to alpha-amylase GI:7532799 from (Malus x domestica);contains Pfam profile PF00128: Alpha amylase, catalytic domain. Predicted to be secreted based on SignalP analysis. |
| AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT3G56310 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT3G29320 | Encodes a plastidic alpha-glucan phosphorylase. In vitro, the enzyme has a preference for maltooligosaccharides, such as maltoheptaose. The mRNA is cell-to-cell mobile. |
| AT5G26120 | alpha-L-arabinofuranosidase 2;(source:Araport11) |
| AT3G21160 | Encodes an alpha-mannosidase I enzyme responsible for N-glycan maturation. |
| AT2G25940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. |
| AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT1G68370 | DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins. |
| AT5G10940 | ASG2 is farnesylated protein and this post-translational modification impacts its subcellular localization. It is the homolog of the human anti-obesity factor WDTC1 and is involved in the negative regulation of fatty acid biosynthesis. The non-farnesylated form displays a nucleo-cytosolic subcellular localization. The farnesylated form displays a cytosolic subcellular localization. Interaction with At4g05420 (DDB1a) was shown using BiFC approach. |
| AT2G44980 | SNF2 domain-containing protein / helicase domain-containing protein;(source:Araport11) |
| AT1G07180 | Internal NAD(P)H dehydrogenase in mitochondria. The predicted protein sequence has high homology with other designated NAD(P)H DHs from microorganisms; the capacity for matrix NAD(P)H oxidation via the rotenone-insensitive pathway is significantly reduced in the Atndi1 mutant plant line; the in vitro translation product of AtNDI1 is imported into isolated mitochondria and located on the inside of the inner membrane. |
| AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
| AT3G22360 | encodes an alternative oxidase whose expression is limited to flowers and floral buds. |
| AT1G32350 | alternative oxidase 1D;(source:Araport11) |
| AT1G25480 | Encodes a phosphorylation-dependent anion channel that can mediate malate release from the vacuole and is required for stomatal closure in response to abscisic acid. |
| AT3G18440 | Belongs to the aluminum-activated malate transporter family. Encodes a vacuolar malate channel. Expressed in all parts of plants. Almost exclusively expressed in mesophyll cells of leaves. The mRNA is cell-to-cell mobile. |
| AT3G21430 | DNA binding protein;(source:Araport11) |
| AT4G14940 | atao1 gene of Arabidopsis thaliana encodes an extracellular copper amine oxidase expressed during early stages of vascular tissue development. |
| AT1G58360 | Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root. |
| AT1G77380 | Amino acid permease which transports basic amino acids. |
| AT1G44100 | amino acid permease 5 |
| AT5G49630 | Is a high affinity amino acid transporter capable of transporting aspartate and tryptophan. May be involved in the amino acid uptake from xylem. |
| AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
| AT4G33090 | encodes an aminopeptidase, a ortholog of mouse microsomal AP (EC 3.4.11.2). |
| AT4G36760 | Arabidopsis aminopeptidase P1 The mRNA is cell-to-cell mobile. |
| AT1G59820 | Encodes a phospholipid translocase. Involved in secretory vesicle formation from trans-Golgi in peripheral columella cells at the root tip. Mutants have short primary roots and grow slower. The mRNA is cell-to-cell mobile. |
| AT1G72700 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT4G13510 | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile. |
| AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
| AT3G24300 | Encodes a plasma membrane localized ammonium transporter. |
| AT4G28700 | ammonium transporter 1;(source:Araport11) |
| AT2G38290 | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
| AT3G48150 | anaphase-promoting complex or cyclosome subunit |
| AT3G05870 | Subunit of the anaphase promoting complex, a ubiquitin ligase complex that regulates progression through the cell cycle. |
| AT1G01510 | Encodes a homolog of human CtBP. Mutant has longer and thicker leaves than wild type. Involved in controlling polar cell expansion in the leaf width direction. It has been shown to localize to cytosolic stress granules and is involved in their formation. |
| AT5G28640 | Encodes a protein with similarity to mammalian transcriptional coactivator that is involved in cell proliferation during leaf and flower development. Loss of function mutations have narrow, pointed leaves and narrow floral organs. AN3 interacts with members of the growth regulating factor (GRF) family of transcription factors. |
| AT5G02620 | Encodes a member of the ankyrin repeat protein. Localized in the endoplasmic reticulum. |
| AT1G35720 | Encodes a member of the annexin gene family, a diverse, multigene family of calcium-dependent, membrane-binding proteins. The protein was determined to have peroxidase activity. This activity is thought to be dependent on the presence of post-translational modifications (most likely phosphorylation). The protein was shown to be present as a mixture of monomer and homodimer. The homodimerization seems to be dependent on the presence of Ca2+ or H2O2. The dimerization was prevented by the addition of DTT, β-mercaptoethanol and TCEP. Annat1 mRNA is expressed in flowers, roots,leaves and stems and is most abundant in stems. mRNA levels are increased in response to oxidative stress. Developmental expression patterns suggest a role in Golgi-mediated polysaccharide secretion. It is a Ca 2+-permeable transporter providing a molecular link between reactive oxygen species and cytosolic Ca 2+ in plants. The mRNA is cell-to-cell mobile. |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G28395 | related to lipid transfer proteins |
| AT5G61160 | anthocyanin 5-aromatic acyltransferase 1;(source:Araport11) |
| AT2G29690 | Encode a functional anthranilate synthase protein. Expressed at a constitutive basal level. Expression was not induced by wounding nor bacterial pathogen infiltration. Involved in aromatic amino acid biosynthesis. |
| AT5G05730 | ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots. |
| AT1G60070 | Gamma subunit 1 of AP-1 adaptor protein complex. |
| AT1G72570 | Integrase-type DNA-binding superfamily protein;(source:Araport11) |
| AT4G13040 | Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation. |
| AT3G54340 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies petal and stamen identities. Associates with PISTILLATA. |
| AT2G31440 | Encodes a gamma-secretase subunit. Associates with other subunits in intracellular membrane compartments. |
| AT3G03860 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
| AT5G01310 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
| AT2G14750 | Encodes adenosine-5'-phosphosulfate kinase. Provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. Essential for pollen viability. The mRNA is cell-to-cell mobile. |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT2G41460 | Apurinic endonuclease-redox protein. It functions as an apurinic/apyrimidinic class II endonuclease, and is involved in DNA repair. |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT3G57510 | Encodes ADPG1, a polygalacturonase protein involved in silique and anther dihiscence. Loss of function mutations have reduced seed set, indehiscent fruit and reduced pollen shedding. Required for release of cell wall-derived PR elicitors. |
| AT2G29525 | Inositol phosphorylceramide synthase |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT1G77360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G33920 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G66080 | Type 2C protein phosphatase located in the plasma membrane. Functions in heat shock response memory mantainance. |
| AT2G28130 | NSE5 subunit of the SMC5/6 complex. |
| AT1G49220 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G17245 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G28040 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09110 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G40250 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G27940 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47560 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G61550 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G10150 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G35910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G06490 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G47610 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G51930 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44578 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G44581 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G05910 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42000 | AtMT4a is a member of Type 4 metallothionein (MT) genes. It is involved in the early develoment of the embryo and in the accumulation of metal ions especially Zn in the seeds. |
| AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
| AT5G06130 | Encodes an OR(orange)-like protein that interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
| AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT2G40360 | Encodes BOP1, an ortholog of Block of cell proliferation (BOP) protein. A T-DNA null allele of the BOP1 gene is lethal, and a 50% decrease in transcript accumulation is sufficient to cause severe developmental defects linked to defective cell division. |
| AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G30680 | Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B. |
| AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
| AT5G64310 | Encodes arabinogalactan-protein (AGP1). The mRNA is cell-to-cell mobile. |
| AT3G01700 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
| AT3G13520 | Encodes a GPI-anchored arabinogalactan (AG) peptide with a short 'classical' backbone of 10 amino acids, seven of which are conserved among the 4 other Arabidopsis AG peptides. These peptides may be involved in cell signaling. |
| AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
| AT1G55330 | Encodes a putative arabinogalactan-protein (AGP21). |
| AT5G40730 | Encodes an arabinogalactan-protein (AGP24). |
| AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
| AT4G40090 | arabinogalactan protein 3;(source:Araport11) |
| AT1G35230 | Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile. |
| AT4G16130 | Arabinokinase. |
| AT5G61980 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD1 belongs to the class 1, together with AGD2, AGD3 and AGD4. Not expressed in hypocotyls and cotyledons. |
| AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
| AT1G59980 | ARG1-like 2;(source:Araport11) |
| AT4G08900 | Encodes an arginase, likely to be involved in polyamine biosynthesis in pollen. |
| AT2G16500 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT4G29510 | Has arginine N-methyltransferase activity. Modifies AtMBD7. |
| AT5G05700 | Encodes an arginyl-tRNA:protein transferase (ATE1), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. Mutants of ATE1 also display delayed leaf senescence and altered responses to pathogens. |
| AT1G31290 | ARGONAUTE 3;(source:Araport11) |
| AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
| AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
| AT5G21150 | AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT1G16060 | Encodes ADAP, an AP2-domain protein that interacts with ARIA. ADAP is a positive regulator of the ABA response and is also involved in regulating seedling growth. |
| AT4G34370 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G31760 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
| AT5G08730 | IBR domain-containing protein;(source:Araport11) |
| AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G19330 | Encodes an armadillo repeat protein involved in the abscisic acid response. The protein interacts with a transcription factor, ABF2, which controls ABA-dependent gene expression via the G-box-type ABA-responsive elements. |
| AT4G34940 | Armadillo repeat protein. One of a family of four in Arabidopsis. Located in the nucleus and cytoplasm of pollen vegetative cells, and in the cytoplasm of egg cells. Involved in the signaling network controlling tip growth and actin organization in the pollen tube. |
| AT4G36030 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
| AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT5G22630 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
| AT2G20340 | Encodes an aromatic aldehyde synthase (AtAAS), which catalyzes the in vitro conversion of phenylalanine and 3,4-dihydroxy-L-phenylalanine to phenylacetaldehyde and dopaldehyde, respectively. The mRNA is cell-to-cell mobile. |
| AT3G11900 | encodes an amino acid transporter that transports aromatic and neutral amino acids, IAA, and 2,4-D. Expressed in all tissues with highest abundance in flowers and cauline leaves. a member of a small gene family in Arabidopsis and represents a new class of amino acid transporters. |
| AT2G16220 | Stress induced gene. Mutants show increased sensitivity to arsenate. |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT4G32320 | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
| AT1G65770 | Encodes AMR1 (Ascorbic acid Mannose Pathway Regulator 1). Coordinately and negatively regulates the mannose/L-galactose ascorbic acid biosynthetic pathway in response to developmental and environmental cues. |
| AT2G19640 | ASH1-related protein 2;(source:Araport11) |
| AT1G76710 | SET domain group 26;(source:Araport11) |
| AT3G16150 | Encodes an asparaginase that catalyzes the degradation of L-asparagine to L-aspartic acid and ammonia. The mRNA is cell-to-cell mobile. |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT5G19550 | Nitrogen metabolism. Major cytosolic isoenzyme controlling aspartate biosynthesis in the light. The mRNA is cell-to-cell mobile. |
| AT5G11520 | Encodes the chloroplastic isozyme of aspartate aminotransferase. Involved in aspartate biosynthesis and nitrogen metabolism. mRNA is expressed in senescing leaves. |
| AT3G02020 | encodes a monofunctional aspartate kinase |
| AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
| AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
| AT5G66870 | Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination. |
| AT1G16530 | ASYMMETRIC LEAVES 2-like 9;(source:Araport11) |
| AT1G67370 | Meiotic asynaptic mutant 1 (ASY1). ASY1 protein is initially distributed as numerous foci throughout the chromatin. During early G2, the foci are juxtaposed to the nascent chromosome axes to form a continuous axis associated signal. |
| AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
| AT2G17410 | AT Rich domain protein. |
| AT1G63480 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
| AT4G22770 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
| AT1G14490 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
| AT5G51590 | Member of the 29 AT-hook family TFs involved in the development of root xylem. |
| AT1G63470 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
| AT1G20900 | Encodes an AT hook domain containing protein that acts redundantly with SOB3 to modulate hypocotyl growth inhibition in response to light. |
| AT4G32830 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. It specifically phosphorylates Ser10 of histone H3 and colocalizes with phosphorylated histone H3 during mitosis. |
| AT2G25880 | Encodes a member of a family of Ser/Thr kinases whose activities peak during cell division. Transcripts are abundant in tissues rich in dividing cells like roots and flowers but are low or absent in fully expanded leaves and stems. In interphase cells, the protein is predominantly nuclear. During mitosis, the protein associates with plant-specific cytoskeletal structures (preprophase band, phragmoplast, nascent cell plate) that are necessary for cytokinesis as well as with the microtubule spindle. |
| AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
| AT3G06590 | Encodes RITF1, a bHLH transcription factor that regulates the transcription of several genes involved in the detoxification of reactive oxygen species generated by salt stress. |
| AT4G00355 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. |
| AT4G09550 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT5G49460 | One of the two genes encoding subunit B of the cytosolic enzyme ATP Citrate Lyase (ACL) |
| AT1G58080 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT1G09795 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
| AT3G22890 | encodes ATP sulfurylase, the first enzyme in the sulfate assimilation pathway of Arabidopsis. It may also participate in selenium metabolism. The mRNA is cell-to-cell mobile. |
| AT3G47730 | member of ATH subfamily |
| AT3G47770 | ABC2 homolog 5;(source:Araport11) |
| AT3G47780 | member of ATH subfamily The mRNA is cell-to-cell mobile. |
| AT3G47790 | ABC2 homolog 7;(source:Araport11) |
| AT2G36910 | Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR1.Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AT3G28860. PGP1 mediates cellular efflux of IAA and interacts with PIN genes that may confer an accelerated vectoral component to PGP-mediated transport. The non-polar localization of PGP1 at root and shoot apices, where IAA gradient-driven transport is impaired, may be required to confer directionality to auxin transport in those tissues. The mRNA is cell-to-cell mobile. |
| AT1G28010 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT3G28380 | P-glycoprotein 17;(source:Araport11) |
| AT3G28860 | Encodes a member of the ATP-binding cassette (ABC) transporter family that is involved in auxin transport and is involved in postembryonic organ separation. Also known as AtMDR11 and PGP19. Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Acts upstream of phyA in regulating hypocotyl elongation and gravitropic response. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AtPGP1. |
| AT3G62150 | Encodes a facultative transporter controlling auxin concentrations in plant cells. |
| AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
| AT5G46540 | P-glycoprotein 7;(source:Araport11) |
| AT3G59140 | member of MRP subfamily |
| AT1G30410 | member of MRP subfamily |
| AT2G07680 | Encodes ABCC13/MRP11, a member of the multidrug resistance associated protein MRP/ABCC subfamily. Its expression is induced by gibberellic acid and downregulated by naphthalene acetic acid, abscisic acid, and zeatin. |
| AT3G62700 | member of MRP subfamily |
| AT3G13080 | encodes an ATP-dependent MRP-like ABC transporter able to transport glutathione-conjugates as well as chlorophyll catabolites. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
| AT1G04120 | encodes a high-affinity inositol hexakisphosphate transporter that plays a role in guard cell signaling and phytate storage. It is a member of MRP subfamily / ABC transporter subfamily C. |
| AT3G21250 | member of MRP subfamily |
| AT4G39850 | Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. |
| AT4G19210 | member of RLI subfamily The mRNA is cell-to-cell mobile. |
| AT4G30300 | member of NAP subfamily |
| AT5G60790 | Member of GCN subfamily; essential for translation inhibition under cold stress through interacting with GCN2 to phosphorylate eukaryotic translation initiation factor 2. GCN1 regulated gens are involved in flower development, seed dormancy and seed development, response to osmotic stress, amino acid biosynthesis, photosynthesis, cell wall organization, protein transport and localization, lipid biosynthesis, transcription, macroautophagy, proteolysis and cell death. |
| AT1G64550 | Encodes a member of GCN subfamily. Predicted to be involved in stress-associated protein translation control. The mutant is affected in MAMP ((microbe-associated molecular patterns)-induced stomatal closure, but not other MAMP-induced responses in the leaves. Arabidopsis has five ABCF proteins, which are all closely related by sequence to yeast GCN20. None of these five are individually required for GCN2 kinase activity. |
| AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G21090 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G55100 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin. |
| AT2G37360 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
| AT3G25620 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
| AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G13220 | Encodes a ATP-binding cassette transporter G26 (ABCG26) involved in tapetal cell and pollen development. Required for male fertility and pollen exine formation. |
| AT3G52310 | ABC transporter G family member 27;(source:Araport11) |
| AT4G15230 | pleiotropic drug resistance 2;(source:Araport11) |
| AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
| AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
| AT1G15520 | ABC transporter family involved in ABA transport and resistance to lead. Localizes to plasma membrane. Upregulated by lead. Expressed in leaves, flowers, stomata and roots. |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT2G13610 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G13580 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). Phloem-expressed and plasma membrane-localized jasmonate transporter which together with JAT4 and GLR3.3 involved in regulating long-distance translocation of JA, which is important for driving the loading, translocation of JA in the phloem pathway by a self-propagation mode, contributing to wound-induced systemic response/resistance. |
| AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
| AT5G14100 | Member of NAP subfamily. Putative component of chloroplast ECF/ABC-Transporter involved in metal homeostasis. |
| AT1G19800 | Encodes a permease-like protein involved in lipid transfer from the ER to the chloroplast, more specifically, transfer of phosphatidate across the chloroplast inner membrane. Mutant leaves accumulate trigalactosyldiacylglycerol, triacylglycerol and phosphatidate. Chloroplast lipids are altered in their fatty acid composition and as a consequence the development of chloroplasts in the mutants are impacted. The mutant seeds has a higher abortion rate. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT5G02270 | member of NAP subfamily |
| AT5G44316 | Stabilizer of iron transporter SufD superfamily protein;(source:Araport11) |
| AT1G09430 | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity. |
| AT4G14680 | Encodes one of three A. thaliana ATP-sulfurylases. APS is the first enzyme of sulfate assimilation that catalyzes the formation of adenosine-5'-phosphosulfate from ATP and sulfate. |
| AT5G61810 | Encodes the predominant of three APC isoforms in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
| AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
| AT4G18980 | Encodes a nuclear-targeted protein AtS40-3 that modulates senescence associated gene expression. |
| AT4G29670 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. Shows high activity towards the chloroplast 2-Cys peroxiredoxin A, and poor activity towards the chloroplast NADP-malate dehydrogenase. |
| AT5G61440 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. The mRNA is cell-to-cell mobile. |
| AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
| AT3G63380 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
| AT4G29900 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT3G21180 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
| AT1G27770 | Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor. |
| AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
| AT1G54210 | Autophagy protein. |
| AT3G13970 | Autophagy protein. |
| AT5G50230 | autophagy-related (ATG) gene |
| AT3G19190 | Encodes autophagy-related 2 (ATG2). The mRNA is cell-to-cell mobile. |
| AT4G04620 | Autophagy protein. |
| AT3G06420 | Autophagy protein. |
| AT2G31260 | Involved in autophagy, the process of vacuolar bulk degradation of cytoplasmic components. Mutant shows accelerated bolting and senescence. |
| AT5G66930 | meiotically up-regulated protein;(source:Araport11) |
| AT4G30790 | Encodes autophagy-related 2 (ATG11) |
| AT5G49980 | auxin F-box protein 5;(source:Araport11) |
| AT5G43700 | Auxin inducible protein similar to transcription factors. |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT1G04250 | Transcription regulator acting as repressor of auxin-inducible gene expression. Auxin-inducible AUX/IAA gene. Short-lived nuclear protein with four conserved domains. Domain III has homology to beta alpha alpha dimerization and DNA binding domains. Involved in auxin signaling and is a positive modulator of natural leaf senescence. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. |
| AT1G77850 | Encodes a transcriptional regulator that directly binds to the promoter of MYB108 and plays a crucial role in anther dehiscence, pollen wall pattern formation, tapetum development, and auxin signal transduction in anthers. It is post-transcriptionally regulated by miR160 and regulates early auxin response genes. |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT4G23980 | Encodes auxin response factor 9 (ARF9). The mRNA is cell-to-cell mobile. |
| AT3G26810 | Auxin F box protein, the dominant auxin receptor in roots. |
| AT1G12820 | Auxin receptor involved in primary and lateral root growth inhibition in response to nitrate. Target of miR393. Induced by nitrate in primary roots. |
| AT1G22220 | F-box family protein;(source:Araport11) |
| AT4G12550 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein that is related to a large family of proteins that consist of a proline-rich or glycine-rich N-terminus and a hydrophobic, possibly membrane spanning C-terminus. |
| AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
| AT5G39720 | avirulence induced protein 2 like protein;(source:Araport11) |
| AT1G33960 | Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
| AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
| AT3G21880 | Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570). |
| AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G25440 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
| AT1G60250 | B-box zinc finger family protein;(source:Araport11) |
| AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
| AT3G21890 | B-box type zinc finger family protein;(source:Araport11) |
| AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT2G47890 | Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T |
| AT3G23750 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G69990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G17840 | CAAX protease self-immunity protein;(source:Araport11) |
| AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
| AT4G15370 | Encodes an oxidosqualene cyclase that primarily produces the tetracyclic triterpene baruol in vitro and when expressed in yeast. It can also make 22 other minor triterpenoid products with varying numbers of rings. |
| AT3G12500 | encodes a basic chitinase involved in ethylene/jasmonic acid mediated signalling pathway during systemic acquired resistance based on expression analyses. |
| AT4G29100 | Member of basic helix loop helix protein family. Expressed primarily in vascular system. Overexpression causes ABA sensitivity. Together with PFA1 and PFA2 governs the competence of pericycle cells to initiate lateral root primordium formation. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT2G31210 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH010 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
| AT1G51070 | bHLH115 is a basic helix loop helix protein of the IVc subgroup that plays a role in iron homeostasis. It interacts with related family members and targets PYE and other genes involved in response to Fe. |
| AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G51960 | bZIP transcription factor induced by salt stress and promoted salt tolerance. Localized to the cytoplasm and nucleus under control conditions and targeted preferentially to the nucleus under salt stress |
| AT3G54620 | bZIP transcription factor-like protein mRNA |
| AT5G24800 | Encodes bZIP protein BZO2H2. |
| AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
| AT3G30530 | basic leucine-zipper 42;(source:Araport11) |
| AT3G49760 | basic leucine-zipper 5;(source:Araport11) |
| AT1G06070 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT4G38910 | Encodes a basic pentacysteine protein that is localized to the nucleus and specifically binds in vitro to GA dinucleotide repeats. |
| AT2G01930 | BASIC PENTACYSTEINE1 (BPC1) is a regulator of the homeotic Arabidopsis thaliana gene SEEDSTICK (STK), which controls ovule identity. BPC1 induces conformational changes by cooperative binding to purine-rich elements present in the STK regulatory sequence. STK is upregulated in bpc1 mutant.Along with BPC2, BPC1 binds to the promoter of and represses GALS1 thereby reducing beta 1,4- galactan accumulation. |
| AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
| AT5G01280 | Encodes a microtubule-associated protein. |
| AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT1G32150 | Encodes a G group bZIP transcription factor family member that can bind cis elements with an ACGT core, such as G-box, Hex, C-box and As-1. The protein is localized in the nucleus and can homodimerize and can heterodimerize with other G group members. |
| AT3G60080 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G10815 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G26400 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G13430 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G19950 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT5G07220 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT3G60920 | beige/BEACH domain protein;(source:Araport11) |
| AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
| AT4G36870 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw1/saw2 may act redundantly to repress BP in leaves. Regulates together with BLH4 demethylesterification of homogalacturonan in seed mucilage. |
| AT1G75410 | BEL1-like homeodomain 3 (BLH3) |
| AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
| AT2G27990 | Encodes a BEL1-like homeobox gene that functions together with PNY in meristem maintenance by regulating the allocation process during vegetative and reproductive development. Both gene products are required for the competence of the SAM to respond properly to floral inductive signals. |
| AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT1G69010 | Encodes BES1-INTERACTING MYC-LIKE 2 (BIM2), a PAR1 (PHYTOCHROME RAPIDLY REGULATED 1)-interacting protein that positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT5G08130 | Encodes a basic helix-loop-helix (bHLH) family protein BIM1 (BES1-INTERACTING MYC-LIKE 1), involved in brassinosteroid signaling. It synergistically interacts with BES1 to bind to E box sequences (CANNTG). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT4G18890 | BES1/BZR1 homolog 3;(source:Araport11) |
| AT1G58180 | beta carbonic anhydrase 6;(source:Araport11) |
| AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
| AT2G32810 | putative beta-galactosidase |
| AT1G45191 | beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1 |
| AT4G27830 | Encodes a beta-glucosidase that may be responsible for acyl-glucose-dependent anthocyanin glucosyltransferase activity in Arabidopsis. In vitro efforts to demonstrate AAGT activity for BGLU10 have been unsuccessful but experiments with mutants in this gene suggest at least an indirect involvement in anthocyanin formation. |
| AT1G02850 | beta glucosidase 11;(source:Araport11) |
| AT5G42260 | beta glucosidase 12;(source:Araport11) |
| AT3G60130 | beta glucosidase 16;(source:Araport11) |
| AT2G44480 | beta glucosidase 17;(source:Araport11) |
| AT5G16580 | beta glucosidase 2;(source:Araport11) |
| AT5G28510 | beta glucosidase 24;(source:Araport11) |
| AT2G44460 | Beta-glucosidase, major myrosinase which initiates sulfur reallocation by hydrolyzing particular GL species, conferring sulfur deficiency tolerance, especially during early development. |
| AT2G44470 | beta glucosidase 29;(source:Araport11) |
| AT1G51470 | Encodes a myrosinase. |
| AT1G61820 | beta glucosidase 46;(source:Araport11) |
| AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
| AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
| AT5G55700 | In vitro assay indicates no beta-amylase activity of BAM4. However mutation in BAM4 impairs starch breakdown. BAM4 may play a regulatory role. |
| AT1G78950 | Terpenoid cyclases family protein;(source:Araport11) |
| AT5G52570 | Converts β-carotene to zeaxanthin via cryptoxanthin. |
| AT5G64570 | Encodes a beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
| AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
| AT4G26140 | putative beta-galactosidase |
| AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
| AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
| AT1G72990 | beta-galactosidase 17;(source:Araport11) |
| AT4G36360 | putative beta-galactosidase (BGAL3 gene) |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT1G45130 | beta-galactosidase 5;(source:Araport11) |
| AT1G61810 | beta-glucosidase 45;(source:Araport11) |
| AT5G39990 | Encodes GlcAT14A, a beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan. The protein was localized to the Golgi apparatus when transiently expressed in Nicotiana benthamiana. Plays a role in cell elongation during seedling growth. |
| AT1G65590 | Encodes a protein with beta-hexosaminidase activity. Located on the plasma membrane. |
| AT4G25700 | Converts beta-carotene to zeaxanthin via cryptoxanthin. |
| AT5G49360 | Encodes a bifunctional {beta}-D-xylosidase/{alpha}-L-arabinofuranosidase required for pectic arabinan modification. Located in the extracellular matrix. Gene is expressed specifically in tissues undergoing secondary wall thickening. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G11190 | Encodes a bifunctional nuclease that acts on both RNA and DNA involved in nucleic acid degradation to facilitate nucleotide and phosphate recovery during senescence. It has mismatch-specific endonuclease activity with wide recognition of single base mismatches as well as the ability to cleave indel types of mismatches (heteroduplexes with loops). |
| AT1G19660 | Wound-responsive family protein;(source:Araport11) |
| AT5G12050 | rho GTPase-activating protein;(source:Araport11) |
| AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
| AT1G69160 | suppressor;(source:Araport11) |
| AT1G13670 | hypothetical protein;(source:Araport11) |
| AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
| AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
| AT5G15530 | biotin carboxyl carrier protein isoform 2 (BCCP2) mRNA, |
| AT1G64150 | Encodes an integral thylakoid membrane protein that is required for normal operation of oxygen-evolving complex (as evidenced by oxygen evolution rates) and for manganese incorporation. PAM71 belongs to a small gene family in Arabidopsis comprising five members. PAM71 is well conserved in the green lineage and shares homology with putative Ca2+/H+ exchangers from yeast (Saccharomyces cerevisiae) (GDT1) and human (Homo sapiens) (TMEM165). |
| AT2G41370 | Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP2 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP2 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP3 expression is restricted to pedicel axils by BP and PNY; promotes KNAT6 (At1g23380) expression. |
| AT4G14480 | Encodes a putative Ser/Thr protein kinase, BLUS1 (BLUE LIGHT SIGNALING1). BLUS1 functions as a phototropin substrate and primary regulator of stomatal control to enhance photosynthetic CO2 assimilation under natural light conditions. |
| AT5G20230 | Encodes a Al-stress-induced gene. Along with TCF, it promotes lignin biosynthesis in response to cold stress. The mRNA is cell-to-cell mobile. |
| AT5G53400 | Encodes BOBBER1 (BOB1), a non-canonical small heat shock protein required for both development and thermotolerance. BOB1 is cytoplasmic at basal temperatures but forms heat shock granules containing canonical small heat shock proteins at high temperatures. The mRNA is cell-to-cell mobile. |
| AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT3G61190 | Encodes a protein with a C2 domain that binds to BON1 in yeast two hybrid analyses. Its ability to bind to phospholipids is enhanced by calcium ions. Involved in maintaining cell homeostasis. |
| AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
| AT1G08860 | Encodes a copine-like protein, which is a member of a newly identified class of calcium-dependent, phospholipid binding proteins that are present in a wide range of organisms. Overexpression of this gene suppresses bon1-1 phenotypes. Double mutant analyses with bon1-1 suggest that BON1 and BON3 have overlapping functions in maintaining cellular homeostasis and inhibiting cell death. |
| AT2G39660 | Encodes a plasma membrane-localized ser/thr protein kinase that is a crucial component of host response signaling required to activate the resistance responses to Botrytis and A. brassicicola infection. It is likely a negative regulator of salicylic acid accumulation and basal defense against virulent bacterial pathogens. Together with ER plays opposing roles in leaf morphogenesis and inflorescence architecture. Required to maintain appropriate auxin response during leaf margin morphogenesis. Interacts with ER-family proteins and directly phosphorylates ER. |
| AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
| AT1G49840 | glutamyl-tRNA (Gln) amidotransferase subunit A (DUF620);(source:Araport11) |
| AT1G67950 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
| AT3G18550 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Role in flowering control. |
| AT1G55510 | branched-chain alpha-keto acid decarboxylase E1 beta |
| AT1G10060 | encodes a mitochondrial branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT1G10070 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. Involved in cell wall development. |
| AT3G49680 | Encodes a chloroplast branched-chain amino acid aminotransferase. Complements the yeast leu/iso-leu/val auxotrophy mutant. |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT3G54030 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
| AT1G80210 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
| AT3G06820 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
| AT5G20540 | Belongs to five-member BRX gene family. Arabidopsis BRX genes share high levels of similarity among each others, with several conserved domains. The most distinct is BRX domain - highly conserved in all BRX genes among distantly related species. This protein-protein interaction domain is required and sufficient for BRX activity. |
| AT5G42750 | Encodes a plasma-membrane associated phosphoprotein that interacts directly with the kinase domain of BRI1 through the evolutionarily conserved C-terminal BIM motif binding to the C-lobe of the BRI1 kinase domain. It interferes with the interaction between BRI1 with its signalling partner, the plasma membrane localised LRR-receptor kinase BAK1 by inhibiting the transphosphorylation to keep BRI1 at a basal level of activity. It is phosphorylated by BRI1 at Ser270 & Ser274 and at tyrosine site Tyr211 and dissociates from plasma membrane to end up in the cytosol after phosphorylation. Its loss-of-function mutant shows higher sensitivity to BR treatment. |
| AT4G30610 | Encodes a secreted glycosylated serine carboxypeptidase with broad substrate preference that is involved in brassinosteroid signalling via BRI1. It is proteolytically processed in vivo by a separate as yet unidentified protease. |
| AT4G03080 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT1G08420 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT2G27210 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
| AT2G45400 | involved in the regulation of brassinosteroid metabolic pathway |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT1G19350 | Encodes brassinosteroid (BR) signalling protein that accumulates in the nucleus as dephosphorylated form in response to BRs. Is phosphorylated by the BIN2 GSK3 kinase. It synergistically interacts with BIM1 to bind to E box sequences (CANNTG). The protein contains a nuclear localization signal (NLS), followed by a highly conserved amino-terminal domain (N) shared by all family members, a BIN2 phosphorylation domain (P), a PEST motif, involved in protein degradation in the absence of BR, and a carboxyl-terminal domain. BES1 can interact with the ELF6 and REF6 Jumonji N/C-domain containing proteins and may direct them to modify histone methylation upstream of some brassinosteroid responsive-genes. Works with BRAVO to regulate QC division in the root. AT1G19350.3(BES1-L) is the long isoform of BES1. It contains an additive N-terminal NLS compared with the canonical BES1-S. This recently evolved isoform is expressed specifically in the Arabidopsis lineage |
| AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
| AT5G65090 | Encodes a protein involved in root hair morphogenesis and tip growth. Required for restricting both the size of the root-hair initiation site and the width of the root hairs during the transition to tip growth, but, apparently, is not required for normal subsequent tip growth. |
| AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT3G18290 | Encodes BRUTUS (BTS), a putative E3 ligase protein with metal ion binding and DNA binding domains, which negatively regulates the response to iron deficiency. The mRNA is cell-to-cell mobile. |
| AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT3G43700 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT3G19590 | Encodes a protein that may have a role in the spindle assembly checkpoint. |
| AT3G47650 | DnaJ/Hsp40 cysteine-rich domain superfamily protein;(source:Araport11) |
| AT5G18930 | S-adenosylmethionine decarboxylase family member. |
| AT3G48250 | Encodes a pentatricopeptide repeat protein implicated in splicing of intron 1 of mitochondrial nad7 transcripts. |
| AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
| AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT4G39070 | Encodes BZS1, a brassinosteroids-regulated BZR1 target (BRBT) gene. BZS1 is a putative zinc finger transcription factor. Expression of BZS1 was increased under BR-deficient condition and repressed by BR. Transgenic Arabidopsis plants overexpressing BZS1 showed a hypersensitivity to the BR biosynthetic inhibitor brassinazole (BRZ). In contrast, transgenic plants expressing reduced level of BZS1 had longer hypocotyls than wild type when grown on BRZ. |
| AT5G51990 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF4). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to drought stress and abscisic acid treatment, but not to low temperature. |
| AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT4G21670 | encodes a a novel transcriptional repressor harboring two double-stranded RNA-binding domains and a region homologous to the catalytic domain of RNA polymerase II C-terminal domain phosphatases found in yeast and in animals that regulate gene transcription. Protein exhibits innate phosphatase activity in vitro. Mutants exhibit hyperresponsiveness to ABA, cold, and NaCl. |
| AT1G73580 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT4G18160 | Encodes AtTPK3 (KCO6), a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK3 is found in the thylakoid stromal lamellae. May form homomeric ion channels in vivo. It modulates the partitioning of the proton motive force (pmf) between the delta psi and delta pH in chloroplasts in vivo at physiological light intensities. Vacuolar K+-conducting TPC1 and TPK1/TPK3 channels act in concert to provide for Ca2+- and voltageinduced electrical excitability to the central organelle of plant cells. |
| AT4G17470 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
| AT1G52827 | Cysteine-rich protein that confers cadmium tolerance to yeast. Homologs are also found in rice, Brassica rapa and pine. |
| AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
| AT4G01420 | Encodes calcineurin B-like protein 5 (CBL5). Overexpression confers tolerance to drought and salt stress. |
| AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
| AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
| AT4G32820 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
| AT5G17860 | Cation/Ca2+ exchanger family member. Double mutants with CCX4 show delayed greening and defects in ROS response. |
| AT4G22120 | Calcium-permeable stretch activated cation channel. |
| AT5G23060 | Encodes a chloroplast-localized protein that modulates cytoplasmic Ca2+ concentration and is crucial for proper stomatal regulation in response to elevations of external Ca2+. Phosphorylation of this protein is dependent on calcium. |
| AT4G38810 | SnRK2-Interacting Calcium Sensor. Encodes two different isoforms that can both inhibit SnRK2. The longer form (AT4G38810.2) is calcium dependant, the other is not. |
| AT2G41860 | member of Calcium Dependent Protein Kinase |
| AT2G38910 | member of Calcium Dependent Protein Kinase |
| AT2G35890 | member of Calcium Dependent Protein Kinase |
| AT4G04700 | member of Calcium Dependent Protein Kinase |
| AT1G50700 | Member of Calcium Dependent Protein Kinase. Mediates Strigolactone-Induced Stomatal Closure |
| AT5G19360 | member of Calcium Dependent Protein Kinase |
| AT1G68200 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
| AT2G13680 | Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen. |
| AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
| AT5G21274 | Encodes a calmodulin isoform. Expressed in leaves. |
| AT3G51920 | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT1G66400 | Encodes a calmodulin-like protein. Regulates nitric oxide levels and transition to flowering. |
| AT5G64220 | CAMTA2 proteins bind to the AtALMT1 promoter at in vitro. The gene itself is Al inducible, and AtALMT1 expression is partially repressed in camta2 mutant. The mRNA is cell-to-cell mobile. |
| AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
| AT5G12480 | calmodulin-domain protein kinase CDPK isoform 7 (CPK7) |
| AT3G20410 | calmodulin-domain protein kinase CDPK isoform 9 (CPK9) |
| AT3G22930 | Encodes a calmodulin-like protein. |
| AT5G23580 | Member of a unique family of enzymes containing a single polypeptide chain with a kinase domain at the amino terminus and a putative calcium-binding EF hands structure at the carboxyl terminus; recombinant protein is fully active and induced by Ca2+ |
| AT5G61790 | calnexin 1;(source:Araport11) |
| AT1G08450 | Encodes one of three Arabidopsis calreticulins. In CRT-deficient mouse fibroblasts, this protein restores ER Ca2+ levels. Non-receptor component required for EFR-mediated immunity. Mutants show de-repressed anthocyanin accumulation in the presence of elf18, and EFR accumulation and signalling. |
| AT3G56690 | encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined. |
| AT5G26920 | Encodes a calmodulin-binding protein CBP60g (calmodulin binding protein 60-like.g). The calmodulin-binding domain is located near the N-terminus; calmodulin binding is dependent on Ca(2+). Inducible by both bacterial pathogen and MAMP (microbe-associated molecular pattern) treatments. Bacterial growth is enhanced in cbp60g mutants. cbp60g mutants also show defects in salicylic acid (SA) accumulation and SA signaling. |
| AT1G78955 | Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system. |
| AT5G18520 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. The mRNA is cell-to-cell mobile. |
| AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
| AT3G01500 | Encodes a putative beta-carbonic anhydrase betaCA1. Together with betaCA4 (At1g70410) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. Activated by OXS2 under the treatment of salt. |
| AT5G62180 | Carboxyesterase that binds stringolactones. |
| AT5G01270 | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. |
| AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
| AT1G80000 | CASC3/Barentsz eIF4AIII binding protein;(source:Araport11) |
| AT5G67380 | Casein kinase II (CK2) catalytic subunit (alpha 1). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis. |
| AT4G28540 | Member of CKL gene family (CKL-C group). |
| AT4G17640 | Encodes casein kinase II beta (regulatory) subunit. |
| AT4G14670 | This locus was originally annotated as encoding ClpB2 (also referred to as Hsp92.7), which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. However, according to Lee et al. (2007, Plant Journal, 49:115-127), there is no evidence for expression of an appropriate-sized mRNA from this locus. Re-annotation of the genome indicates that this locus potentially encodes a 68.8-kDa protein, containing only the N-terminal two thirds of the originally predicted open reading frame. This locus contains a 626-bp deletion in WS ecotype compared with the Col ecotype, which eliminates residues 1-86 of the predicted protein. |
| AT5G44550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G03700 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G06390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G16300 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT2G36330 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G34600 | CAF2 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF1 it is required for formation of the casparian band. |
| AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
| AT1G73875 | Deadenylase. |
| AT5G11350 | Deadenylase. |
| AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
| AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
| AT1G54115 | Involved in cation (Na and K) homeostasis. |
| AT3G51860 | cation exchanger 3;(source:Araport11) |
| AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
| AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
| AT3G14070 | Involved in cation (K, Na and Mn) homeostasis and transport |
| AT5G17850 | CCX2 is a putative cation/Ca2+ exchange protein. It is located in the endoplasmic reticulum. It plays a role in salt induced calcium signaling. Loss of function results in decreased cytosolic and increased ER Ca2+ concentrations. |
| AT3G44920 | member of Putative Na+/H+ antiporter family |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT1G79400 | member of Putative Na+/H+ antiporter family |
| AT1G05580 | member of Putative Na+/H+ antiporter family |
| AT5G37060 | member of Putative Na+/H+ antiporter family |
| AT5G58460 | member of Putative Na+/H+ antiporter family |
| AT5G01690 | member of Putative Na+/H+ antiporter family |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT1G08135 | cation/H+ exchanger 6B;(source:Araport11) |
| AT1G06970 | member of Putative Na+/H+ antiporter family |
| AT5G04770 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. Expressed in sink tissues. Induced during infestation of roots by the plant parasitic root-knot nematode, Meloidogyne incognita. Localized in the plasma membrane. |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT3G17510 | Encodes a CBL-interacting protein kinase. Specifically interacts with ECT1 and ECT2. |
| AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
| AT5G01810 | Encodes a CBL-interacting serine/threonine protein kinase, also has similarities to SOS2 kinase. |
| AT1G29230 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.20), which has also been reported as a member of the CBL-interacting protein kinases (CIPK18). |
| AT5G45810 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.5), which has also been reported as a member of the CBL-interacting protein kinases (CIPK19). |
| AT5G07070 | Encodes CBL-interacting protein kinase 2 (CIPK2). |
| AT2G38490 | member of AtCIPKs |
| AT5G25110 | salt- and anoxia-induced member of AtCIPK family. |
| AT4G14580 | CBL-interacting protein kinase |
| AT5G10930 | Encodes CBL-interacting protein kinase 5 (CIPK5). |
| AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile. |
| AT4G24400 | Encodes a CBL (calcineurin B-like calcium sensor proteins) -interacting serine/threonine protein kinase. Regulates the low-affinity phase of the primary nitrate response. The mRNA is cell-to-cell mobile. |
| AT5G10860 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT1G27820 | Deadenylase. |
| AT5G10960 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G02800 | Encodes CDL1, a homolog of CDG1. CDL1 positively regulates brassinosteroid signaling and plant growth. |
| AT3G50530 | CDPK-related kinase |
| AT2G41140 | Encodes CDPK-related kinase 1 (CRK1). |
| AT3G22650 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT3G53230 | CDC48 is induced upon oilseed rape mosaic tobamovirus infection and appears to be involved in controlling virus movement. |
| AT1G47960 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. This protein may inhibit their activity. |
| AT3G13784 | cell wall invertase 5;(source:Araport11) |
| AT1G21250 | Encodes a cell wall-associated kinase that interacts with AtGRP3 and may function as a signaling receptor of extracellular matrix component such as oligogalacturonides. The mRNA is cell-to-cell mobile. |
| AT5G44030 | Encodes a cellulose synthase involved in secondary cell wall biosynthesis. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. The mRNA is cell-to-cell mobile. |
| AT4G38190 | encodes a gene similar to cellulose synthase |
| AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT4G24000 | encodes a protein similar to cellulose synthase |
| AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
| AT1G24070 | encodes a gene similar to cellulose synthase |
| AT1G23480 | encodes a gene similar to cellulose synthase |
| AT2G32620 | encodes a gene similar to cellulose synthase |
| AT2G32530 | encodes a gene similar to cellulose synthase |
| AT2G32540 | encodes a gene similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT3G03050 | encodes a cellulose synthase like protein. mutations initiate root hairs that rupture at their tip soon after initiation. is required for the synthesis of a noncellulosic wall polysaccharide. |
| AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
| AT4G31590 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
| AT1G06830 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. CEPD1 is a non secreted polypeptide that is highly similar to CEPD2 which is another member of a novel family related to glutaredoxins. It is induced by nitrogen starvation. It acts downstream of the CEP1 peptide in systemic N-demand signalling .The RNA is expressed in the phloem of cotelydon and leaf vasculature but the peptide is graft transmissible, traveling from the shoot to the root. |
| AT2G30370 | Encodes a small, potentially secreted protein that acts as an inhibitor of stomatal production though likely not through direct interaction with the TMM receptor. It is homologous to known stomatal regulators EPF1 and EPF2. Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT3G11830 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT3G03960 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
| AT3G62080 | Encodes a charged multi-vesicular body protein (CHMP7) homolog, that is an ESCRT-III-related protein and functions in the endosomal sorting pathway in humans. The Brassica homolog has been shown to be involved in plant growth and leaf senescence. |
| AT3G60680 | DUF641 family protein (DUF641);(source:Araport11) |
| AT2G43570 | chitinase;(source:Araport11) |
| AT3G27170 | member of Anion channel protein family The mRNA is cell-to-cell mobile. |
| AT5G33280 | Voltage-gated chloride channel family protein;(source:Araport11) |
| AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
| AT4G17090 | Encodes a beta-amylase targeted to the chloroplast. Transgenic BMY8 RNAi lines fail to accumulate maltose during cold shock suggesting that maltose accumulation coincides with BMY8 expression. Apart from maltose, the sugar content of the RNAi lines were similar to wildtype (glucose and sucrose unaffected).BAM3 activity declines 2 and 4 days after start of cold stress despite an increase in transcript levels. BAM3 activity has a lower temperature optimum than BAM1 (PMID:25293962). |
| AT5G49910 | Stromal heat shock protein involved in protein import into chloroplast. The mRNA is cell-to-cell mobile. |
| AT1G08640 | Encodes a choloroplast membrane protein CJD1 (Chloroplast J-like Domain 1). Predicted to contain a transit peptide, three transmembrane domains and an N-terminal J-like domain. Influences fatty acid composition of chloroplast lipids. |
| AT1G35680 | Encodes a chloroplast ribosomal protein L21 that is required for chloroplast development and embryogenesis. The mRNA is cell-to-cell mobile. |
| AT3G53460 | Encodes a nuclear gene with a consensus RNA-binding domain that is localized to the chloroplast. |
| AT3G52380 | Encodes a chloroplast RNA-binding protein that stabilizes chloroplast RNAs as evidenced by analyses of transcript accumulation in null mutants. Essential for seedling development (albino, strongly retarded growth even on sucrose-containing medium). |
| AT1G67840 | Encodes a chloroplast sensor kinase (CSK) that shares common ancestors with cyanobacterial histidine sensor kinases. CSK is synthesised in the cytosol and imported into the chloroplast as a protein precusor. CSK is autophosphorylated and required for control of transcription of chloroplast genes by the redox state of an electron carrier connecting photosystems I and II. |
| AT2G25625 | Histone deacetylase-like protein;(source:Araport11). Induced by senescence and abiotic stresses. |
| AT1G10500 | Involved in chloroplast Fe-S cluster assembly. Located in the chloroplast stroma. Expressed preferentially in green tissues. |
| AT5G39520 | Plastid localized transmembrane protein involved in ABA mediated leaf senescence and stomatal movement. |
| AT2G37770 | Encodes an NADPH-dependent aldo-keto reductase that can act on a wide variety of substrates in vitro including saturated and unsaturated aldehydes, steroids, and sugars. GFP-tagged AKR4C9 localizes to the chloroplast where it may play a role in detoxifying reactive carbonyl compounds that threaten to impair the photosynthetic process. Transcript levels for this gene are up-regulated in response to cold, salt, and drought stress. |
| AT1G76080 | Encodes a thioredoxin like protein. Localizes to the chloroplast and is redistributed to the chloroplast envelope under heat stress. It is involved in non host resistance and thermotolerance. |
| AT5G52100 | Is essential for chloroplast NAD(P)H dehydrogenase activity, which is involved in electron transfer between PSII and PSI. Likely functions in biogenesis or stabilization of the NAD(P)H dehydrogenase complex. The mRNA is cell-to-cell mobile. |
| AT2G45350 | Encodes a member of a PCMP (plant combinatorial and modular protein) family (PCMP-E subfamily) with 11 pentatricopeptide (PPR) repeats. The protein is involved in RNA editing of the initiation codon of ndhD in the chloroplast. |
| AT4G21445 | CRR9 gene encodes a novel stromal protein without any known functional domains or motifs. It is highly conserved in cyanobacteria and land plants but not in green algae. |
| AT1G59720 | Pentatricopeptide Repeat Protein containing the DYW motif. Required for editing of multiple plastid transcripts. Endonuclease activity. |
| AT5G63950 | chromatin remodeling 24;(source:Araport11) |
| AT1G05490 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
| AT3G42670 | Encodes a nuclear localized SNF domain containing protein involved in RNA silencing. Mutants were identified in a screen for defects in the spread of RNA silencing. CLSY1 may affect production of dsRNA from the locus to be silenced. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY2-4 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
| AT5G44800 | Interacts with transcription factors involved in floral meristem identity and affects the expression of key floral regulators. Affects H3K27me3 and H3K4me3 levels at a subset of loci in the genome. |
| AT3G24340 | Involved in gene silencing. Locus-specific regulator of 24nt-siRNA expression, works together with CLSY1-3 as the master regulators of essentially all Pol-IV-dependent 24nt-siRNAs. |
| AT2G13370 | Chromatin-remodeling factor; has large number of MAPK docking sites (D-sites). |
| AT3G06400 | Encodes a SWI2/SNF2 chromatin remodeling protein belonging to the ISWI family. Involved in nuclear proliferation during megagametogenesis and cell expansion in the sporophyte. Constitutively expressed. RNAi induced loss of function in megagametogenesis results in female sterility.35S:RNAi plants have reduced stature. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density. |
| AT1G80740 | ecotype Kl-0 chromomethylase (CMT1). A plant line expressing an RNAi construct directed against DMT4 has reduced agrobacterium-mediated tumor formation. |
| AT1G04730 | Necessary for sister chromatid cohesion. Acts in synergy with ETG1. |
| AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
| AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
| AT1G15950 | Encodes a cinnamoyl CoA reductase. Involved in lignin biosynthesis. The mRNA is cell-to-cell mobile. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G37970 | cinnamyl alcohol dehydrogenase 6;(source:Araport11) |
| AT1G72680 | cinnamyl-alcohol dehydrogenase;(source:Araport11) |
| AT2G23410 | Encodes cis-prenyltransferase involved in dolichol biosynthesis. |
| AT5G58770 | AtCPT7 synthesizes medium-chain polyprenols of approximately 55 carbons in length. The enzyme utlizes geranylgeranyl pyrophosphate (GGPP) and isopentenyl pyrophosphate (IPP) as substrates. The enzymatic product accumulates into plastdial membranes (DOI:10.1105/tpc.16.00796). |
| AT3G58740 | Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds. |
| AT3G58750 | Encodes a peroxisomal citrate synthase that is expressed throughout seedling and shoot development. |
| AT3G51890 | Clathrin light chain protein;(source:Araport11) |
| AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
| AT4G38060 | hypothetical protein;(source:Araport11) |
| AT2G27250 | One of the three CLAVATA genes controlling the size of the shoot apical meristem (SAM) in Arabidopsis. Belongs to a large gene family called CLE for CLAVATA3/ESR-related. Encodes a stem cell-specific protein CLV3 presumed to be a precursor of a secreted peptide hormone. The deduced ORF encodes a 96-amino acid protein with an 18-amino acid N-terminal signal peptide. The functional form of CLV3 (MCLV3) was first reported to be a posttranscriptionally modified 12-amino acid peptide, in which two of the three prolines were modified to hydroxyproline (Ito et al., Science 2006, 313:842; Kondo et al., Science 2006, 313:845). Ohyama et al. (2009) later reported that the active mature CLV3 is a 13-amino-acid arabinosylated glycopeptide (Nature Chemical Biology, 5:578). CLV3 binds the ectodomain of the CLAVATA1 (CLV1) receptor-kinase. Regulates shoot and floral meristem development. Required for CLAVATA1 receptor-like kinase assembly into a signaling complex that includes KAPP and a Rho-related protein. It restricts its own domain of expression, the central zone (CZ) of the shoot apical meristem (SAM), by preventing differentiation of peripheral zone cells, which surround the CZ, into CZ cells and restricts overall SAM size by a separate, long-range effect on cell division rate. CLE domain of CLV3 is sufficient for function. Results obtained from whole seedlings challenge the concept that the immune receptor FLS2 perceives the meristematic regulatory peptide CLV3p in mesophyll, seedlings, and SAM cells and that CLV3p contributes to SAM immunity against bacterial infection (PMID:22923673). |
| AT1G73165 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
| AT1G69320 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G63245 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
| AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT4G18510 | CLE2, putative ligand, member of large gene family homologous to Clavata3 |
| AT1G69970 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
| AT2G31081 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT4G13195 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation. |
| AT2G31083 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G26600 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT5G23880 | Encodes a protein similar to the 100kD subunit of cleavage and polyadenylation specificity factor (CPSF), the factor responsible for the recognition of the AAUAAA motif during mRNA polyadenylation. The protein interacts with a portion of a nuclear poly(A) polymerase. It is likely to be a part of the mRNA 3'end formation apparatus. |
| AT3G44340 | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
| AT1G49970 | Encodes a ClpP-related sequence. Though similar to ClpP proteins, this does not contains the highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). |
| AT4G17040 | HON5 (At4g17040) encodes the ClpR4 subunit of the chloroplast-localized Clp protease complex. hon mutations disturb plastid protein homeostasis, thereby activating plastid signaling and inducing stress acclimatization. |
| AT5G53350 | CLP protease regulatory subunit CLPX mRNA, nuclear gene |
| AT5G39930 | Encodes a protein with similarity to the CLP1 polyadenylation factor. |
| AT4G10100 | molybdenum cofactor synthesis family protein, similar to Molybdenum cofactor synthesis protein 2 small subunit (Molybdopterin- synthase small subunit) (MOCS2A) (MOCO1-A) (Swiss-Prot:O96033) (Homo sapiens); contains TIGRFAM TIGR01682: molybdopterin converting factor, subunit 1; sir loss-of-function mutants are resistant to sirtinol, a modulator of auxin signaling. |
| AT3G29810 | During the course of seed coat epidermal cell differentiation, COBRA-LIKE 2 plays a role in cellulose deposition into mucilage secretory cells of Arabidopsis seeds. COBRA-LIKE 2 affects mucilage solubility and cellulosic ray formation. |
| AT3G16860 | COBRA-like protein 8 precursor;(source:Araport11) |
| AT1G13030 | Encodes a plant coilin, a protein that in other organisms is a major structural scaffolding protein necessary for Cajal body formation, composition and activity. It has been shown to bind both U1 and U1 snRNAs in vitro. |
| AT2G42530 | Encodes COR15B, a protein that protects chloroplast membranes during freezing. |
| AT1G29395 | Integral membrane protein in the inner envelope of chloroplasts. Provide freezing tolerance. Expression is induced by short-term cold-treatment, water deprivation, and abscisic acid treatment. involved in response to salt tolerance |
| AT5G42900 | Acts with COR28 as a key regulator in the COP1-HY5 regulatory hub by regulating HY5 activity to ensure proper skotomorphogenic growth in the dark and photomorphogenic development in the light. |
| AT2G41990 | late embryogenesis abundant protein;(source:Araport11) |
| AT2G34560 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
| AT5G16300 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT1G31780 | Encodes a component of the oligomeric Golgi (COG) complex. Found in pollen golgi apparatus. Loss of function results in defects in pollen tube growth resulting in lack of transmission through the pollen. |
| AT2G31280 | Encodes a LHW-like protein with 80% amino acid identity to LHW. |
| AT5G15850 | Homologous to the flowering-time gene CONSTANS. |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT3G07650 | This gene belongs to the CO (CONSTANS) gene family. This gene family is divided in three subgroups: groups III, to which COL9 belongs, is characterised by one B-box (supposed to regulate protein-protein interactions) and a second diverged zinc finger. COL9 downregulates expression of CO (CONSTANS) as well as FT and SOC1 which are known regulatory targets of CO. The mRNA is cell-to-cell mobile. |
| AT3G26940 | Receptor-like cytoplasmic kinase, RLCKVII subfamily. Overexpression causes abnormal differential and elongation growth after organ differentiation. |
| AT2G32950 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile. |
| AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
| AT1G61620 | Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile. |
| AT4G27430 | Positive regulator of light-regulated genes. Novel nuclear protein which requires light for its high level expression. The mRNA is cell-to-cell mobile. |
| AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
| AT5G42350 | Encodes CFK1 (COP9 INTERACTING F-BOX KELCH 1), a CSN (COP9 signalosome)-interacting F-box protein. CFK1 is a component of a functional ubiquitin ligase complex. CFK1 promotes hypocotyl elongation by increasing cell size. |
| AT5G42360 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
| AT4G12290 | Copper amine oxidase. Induced by ABA and involved in stomatal closure. |
| AT2G42490 | Peroxisome-localized copper amine oxidase involved in lateral root formation. |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT5G59040 | encodes a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast |
| AT1G08830 | Encodes a cytosolic copper/zinc superoxide dismutase CSD1 that can detoxify superoxide radicals. Its expression is affected by miR398-directed mRNA cleavage. Regulated by biotic and abiotic stress. Activation of CSD1 in the cytoplasm involves both a CCS-dependent and -independent pathway. |
| AT4G23600 | Encodes cystine lyase which is expected to be involved in amino acid metabolism, providing the plant with cysteine and the generation of precursors of ethylene biosynthesis. mRNA levels are elevated in response to wounding. |
| AT4G13370 | Member of a novel, plant specific family of microtubule associated proteins. |
| AT1G05470 | Encodes an inositol polyphosphate 5' phosphatase (5PTase) that is required for the proper recruitment of cells into developing vascular tissue in leaves and cotyledons. It is most similar to Type I 5PTases that are known to cleave a phosphate from IP3 or IP4. cvp2 mutants have elevated levels of IP3 and are hypersensitive to ABA in seed germination assays. |
| AT1G69180 | Putative transcription factor with zinc finger and helix-loop-helix domains, the later similar to HMG boxes. Involved in specifying abaxial cell fate in the carpel. Four putative LFY binding sites (CCANTG) and two potential binding sites for MADS box proteins known as CArG boxes (CC(A/T)6GG) were found in the region spanning 3.8 Kb upstream of the CRC coding region. CRC targets YABBY genes such as YUC4 in gynoecium development. |
| AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
| AT3G01370 | Encodes a protein containing a CRM domain that is involved in group I and group II intron splicing. |
| AT4G39040 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
| AT3G28630 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
| AT4G01710 | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
| AT5G12170 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. The mRNA is cell-to-cell mobile. |
| AT4G28520 | Encodes a 12S seed storage protein that is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT4G34530 | Encodes a transcription factor CIB1 (cryptochrome-interacting basic-helix-loop-helix). CIB1 interacts with CRY2 (cryptochrome 2) in a blue light-specific manner in yeast and Arabidopsis cells, and it acts together with additional CIB1-related proteins to promote CRY2-dependent floral initiation. CIB1 positively regulates FT expression. |
| AT1G32790 | RNA-binding protein, putative, similar to RNA-binding protein GB:CAB40027 GI:4539439 from (Arabidopsis thaliana).Member of a family of PAB2 binding domain proteins. |
| AT2G26280 | smr (Small MutS Related) domain-containing protein |
| AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
| AT1G30820 | Cytidine triphosphate synthase. |
| AT4G02120 | Cytidine triphosphate synthase. |
| AT4G20320 | Cytidine triphosphate synthase. |
| AT2G34890 | Cytidine triphosphate synthase. |
| AT1G02980 | encodes an Arabidopsis cullin |
| AT5G53950 | Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2. Together with CUC3-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates the axillary meristem initiation, directly binding to the DA1 promoter. |
| AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
| AT2G32010 | Encodes an inositol polyphosphate 5?-phosphatase (5PTase). Mediating phosphoinositide signaling. Involved in establishment of foliar vein patterns. |
| AT4G35220 | Cyclase family protein;(source:Araport11) |
| AT1G44542 | Cyclase family protein;(source:Araport11) |
| AT2G46450 | Member of Cyclic nucleotide gated channel family.Positive regulator of resistance against avirulent fungal pathogen.Suppresses the phenotype conferred by cpr22 in a dosage-dependent manner. |
| AT2G28260 | member of Cyclic nucleotide gated channel family |
| AT3G48010 | member of Cyclic nucleotide gated channel family |
| AT1G44110 | Cyclin A1;(source:Araport11) |
| AT1G16330 | core cell cycle genes |
| AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
| AT3G63120 | cyclin p1;(source:Araport11) |
| AT3G21870 | cyclin p2;(source:Araport11) |
| AT2G45080 | cyclin p3;(source:Araport11) |
| AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT1G47210 | cyclin-dependent protein kinase 3;(source:Araport11) |
| AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
| AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
| AT4G33060 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT4G34960 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT2G47320 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT3G66654 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
| AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
| AT5G50260 | Encodes a papain-like cysteine protease involved in tapetal programmed cell death and pollen development.CEP1 is expressed specifically in the tapetum from stages 5 to 11 of anther development. The CEP1 protein first appears as a proenzyme in precursor protease vesicles, and is then transported to the vacuole and transformed into the mature enzyme before rupture of the vacuole. CEP1 was also released to the tapetal cell wall during late stage 6 and stage 7. After the tapetal cell wall degenerated, the CEP1 enzyme entered the callose wall from the degenerated tapetal cell wall and was probably involved in degeneration of the callose wall. |
| AT3G48340 | KDEL-tailed cysteine endopeptidase. Mutants generated via RNAi show decreased lateral root growth. |
| AT4G11310 | cysteine proteinase precursor-like protein |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT4G23180 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile. |
| AT4G23190 | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) |
| AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
| AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23240 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23270 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G23290 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11460 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04500 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT3G45860 | Encodes a cysteine-rich receptor-like protein kinase. Involved in programmed cell death and defense response to pathogen. |
| AT4G04570 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G05340 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT4G33660 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT2G33520 | cysteine-rich/transmembrane domain protein A;(source:Araport11) |
| AT2G31170 | Encodes the cysteinyl t-RNA synthetase SYCO ARATH (SYCO), which is expressed and required in the central cell but not in the antipodals. SYCO, localized to the mitochondria, is necessary for mitochondrial cristae integrity. Mutation of this gene affects the lifespan of adjacent accessory cells. |
| AT2G19570 | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. |
| AT2G45150 | cytidinediphosphate diacylglycerol synthase 4;(source:Araport11) |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT1G22840 | Encodes cytochrome c. Contains two site II (TGGGCC/T) elements, which interact with a TCP-domain transcription factor, and a downstream internal telomeric repeat, and are required for expression of the Cytc-1 gene. Promoter directs preferential expression in root and shoot meristems and in anthers. Double mutants with CYTC-2 accumulate starch during the day, have delayed growth and development and reduced GA and DELLA proteins linking cellular metabolism and GA homeostasis. |
| AT2G17330 | putative obtusifoliol 14-alpha demethylase. Expressed pseudogene. |
| AT2G24180 | Encodes a cytochrome P450 monooxygenase that converts indole-3-acetonitrile to indole-3-aldehyde / indole-3-carboxylic acid and cyanide. The mRNA is cell-to-cell mobile. |
| AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
| AT1G16410 | member of CYP79F The mRNA is cell-to-cell mobile. |
| AT1G65670 | a member of the cytochrome P450 gene family. molecular function unknown. |
| AT4G15345 | cytochrome P450 pseudogene |
| AT4G15396 | cytochrome P450, family 702, subfamily A, polypeptide 6;(source:Araport11) |
| AT4G15398 | cytochrome P450 pseudogene |
| AT3G30290 | a member of cytochrome P450 gene family |
| AT2G44890 | member of CYP704A |
| AT3G20083 | pseudogene of cytochrome P450;(source:Araport11) |
| AT3G20110 | member of CYP705A |
| AT3G20940 | a member of A-type cytochrome P450 |
| AT5G47990 | Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses. |
| AT4G12300 | member of CYP706A |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT2G29090 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. This gene predominantly accumulates in dry seeds and is up-regulated immediately following imbibition. CYP707A2 appears to play a major role in the rapid decrease in ABA levels during early seed imbibition. |
| AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
| AT1G78490 | member of CYP708A family. The mRNA is cell-to-cell mobile. |
| AT2G46960 | member of CYP709B |
| AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
| AT2G30750 | Putative cytochrome P450; together with CYP71A13 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
| AT2G30770 | Putative cytochrome P450; together with CYP71A12 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
| AT5G24950 | putative cytochrome P450 |
| AT3G48280 | putative cytochrome P450 |
| AT5G57260 | putative cytochrome P450 |
| AT5G25180 | putative cytochrome P450 |
| AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G26230 | putative cytochrome P450 |
| AT3G26290 | putative cytochrome P450 |
| AT1G13070 | putative cytochrome P450 |
| AT1G13100 | putative cytochrome P450 |
| AT3G26220 | cytochrome P450 monooxygenase |
| AT3G26295 | putative cytochrome P450. |
| AT3G26280 | cytochrome P450 monooxygenase |
| AT5G35715 | encodes a protein with cytochrome P450 domain |
| AT2G02580 | member of CYP71B |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
| AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G36110 | Encodes a member of the CYP716A subfamily of cytochrome P450 monooxygenases with triterpene oxidizing activity catalyzing C-28 hydroxylation of alpha-amyrin, beta-amyrin, and lupeol, producing uvaol, erythrodiol, and betulin, respectively. Additionally, it shows carboxylation activity for the C-28 position of alpha- and beta-amyrin. |
| AT3G14610 | putative cytochrome P450 |
| AT3G14620 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
| AT3G14630 | putative cytochrome P450 |
| AT1G75130 | member of CYP721A |
| AT1G19630 | cytochrome P450, family 722, subfamily A, polypeptide 1;(source:Araport11) |
| AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
| AT2G45570 | member of CYP76C |
| AT1G33720 | cytochrome P450, family 76, subfamily C, polypeptide 6;(source:Araport11) |
| AT3G60955 | a cytochrome P450 pseudogene. overlaps with a real gene on the other strand. |
| AT3G52970 | member of CYP76G |
| AT3G10570 | member of CYP77A |
| AT5G04630 | member of CYP77A |
| AT1G11600 | member of CYP77B |
| AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
| AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
| AT1G79370 | member of CYP79C |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT4G37330 | member of CYP81D |
| AT4G37320 | member of CYP81D |
| AT4G37400 | member of CYP81F |
| AT4G31950 | member of CYP82C |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
| AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
| AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT1G12740 | encodes a protein with cytochrome P450 domain |
| AT4G37430 | Encodes a member of the CYP81F cytochrome P450 monooxygenase subfamily. |
| AT5G06900 | member of CYP93D |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT3G01900 | member of CYP94B |
| AT3G48520 | CYP94B3 is a jasmonoyl-isoleucine-12-hydroxylase that catalyzes the formation of 12-OH-JA-Ile from JA-Ile. By reducing the levels of this the biologically active phytohormone, CYP94B3 attenuates the jasmonic acid signaling cascade. CYP94B3 transcript levels rise in response to wounding. |
| AT2G23180 | member of CYP96A |
| AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
| AT1G65340 | member of CYP96A |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
| AT1G31800 | Encodes a protein with β-ring carotenoid hydroxylase activity. The mRNA is cell-to-cell mobile. |
| AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
| AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT1G75450 | This gene used to be called AtCKX6. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
| AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT4G23750 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Monopteros target gene. CRF proteins relocalize to the nucleus in response to cytokinin. |
| AT1G49120 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G50915 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G57620 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
| AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
| AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
| AT3G12620 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G06580 | Encodes a protein with glycolate dehydrogenase activity, which was shown to complement various subunits of the E. coli glycolate oxidase complex. It has not been ruled out that the enzyme might be involved in other catalytic activities in vivo. |
| AT3G24420 | DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism. |
| AT5G55910 | Member of AGC VIIIa Kinase family. D6PK is a protein kinase involved that plays a role in polar auxin transport. Most likely acts redundantly with the related proteins: D6PKL1,D6PKL2,and D6PKL3. PIN1 is a target of D6PK phosphorylation. D6PK is associated with sterol enriched membrane rafts and may be involved in regulation of the switch from basal to planar polarity during root hair initiation. Involved in pulse-induced phototropism but also for time-dependent second positive phototropism. Works with PIN3 in the same genetic pathway of hypocotyl phototropism under all light conditions. Involved in the generation of auxin asymmetrical distribution induced by phototropic stimulation. |
| AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
| AT5G66620 | DA1-related protein 6;(source:Araport11) |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT2G30550 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
| AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G58760 | Encodes a DDB1a interacting protein DDB2 required for UV-B tolerance and genomic integrity. |
| AT4G21100 | One of two closely related genes similar to a damaged DNA binding protein originally described in mammals. May form a complex with DET1 to regulate photomorphogenesis. Loss of function mutations are lethal. The DDB1b protein binds with a number of DWD-containing proteins and may form part of a CUL4-based E3 ubiquitin ligase. |
| AT3G20550 | Encodes a nuclear localized FHA (forhkead) domain containing protein.Mutant plants have shortened roots, delayed flowering time, altered floral organ number, defective floral organs and reduced fertility.Ddl mutants also show reduced levels of pri-miRNAs as well as mature miRNAs suggesting involvement in biogenesis of miRNAs. DDL does not affect transcription of miRNAs directly but may act through other proteins such as DCL. |
| AT3G42170 | transposase-like gene with conserved domains from the family of hAT transposases that includes hobo from Drosophila melanogaster, Activator (Ac) from maize, and Tam3 from snapdragon but lacks several amino acids known to be essential for Ac transposition5. The DAYSLEEPER gene lacks 8 bp duplications and TIRs (a common feature of transcriptionally silent hAT transposases), however, DAYSLEEPER expression was detected, and several expressed sequence tags are available. The expression seems to be under the control of factors determining the circadian rhythm. DAYSLEEPER was isolated as a factor binding to a motif (Kubox1) present in the upstream region of the Arabidopsis DNA repair gene Ku70. Mutant plants lacking DAYSLEEPER or strongly overexpressing this gene do not develop in a normal manner. |
| AT5G22760 | PHD finger family protein;(source:Araport11) |
| AT5G12400 | PHD-finger and DNA binding domain-containing protein;(source:Araport11) |
| AT1G67780 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT1G18950 | DDT domain superfamily;(source:Araport11) |
| AT5G25580 | hypothetical protein;(source:Araport11) |
| AT5G08630 | DDT domain-containing protein;(source:Araport11) |
| AT4G10180 | Encodes a nuclear-localized protein that acts as a repressor of photomorphogenesis and may be involved in chromatin remodeling. The mRNA is cell-to-cell mobile. |
| AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
| AT3G01540 | RNA HELICASE DRH1 |
| AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
| AT5G13570 | Encodes DCP2 with mRNA decapping activity. DCP2 forms a mRNA decapping complex with DCP1 (At1g08370) and VCS (VARICOSE) (At3g13300). Recombinant DCP2 is enzymatically active in vitro, generating from capped mRNAs m7GDP, and 5?-phosphorylated mRNAs. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP1. |
| AT1G26110 | Encodes Decapping 5, required for mRNA decapping, P-body formation and translational repression during postembryonic development. |
| AT1G72490 | DRO1 is a member of the IGT gene family and has a unknown function . It is expressed in roots and involved in leaf root architecture, specifically the orientation of lateral root angles. Involved in determining lateral root branch angle. |
| AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
| AT2G44810 | Mutant has defects in anther dehiscence, pollen maturation, and flower opening. The DAD1 protein is a chloroplastic phospholipase A1 that catalyzes the initial step of jasmonic acid biosynthesis. |
| AT4G18750 | Encodes a pentatricopeptide (PPR) protein involved in leaf and root development. dot4 mutants have an aberrant midgap venation pattern in juvenile leaves and cotyledons. |
| AT5G15410 | 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens. CNGC2 could be the key step mediating bulk Ca2+ influx into leaf cells after unloading from the vascular and have no direct roles in the leaf development and HR. |
| AT3G48720 | Encodes a hydroxycinnamoyl-CoA: v-hydroxy fatty acid transferase involved in cutin synthesis. Mutants are almost devoid of ferulic acid. |
| AT3G27925 | Encodes a DegP protease; nuclear gene encoding chloroplast-targeted protease that can degrade two lumenal proteins, plastocyanin and OE33, suggesting a role as a general-purpose protease in the thylakoid lumen. Involved in the degradation of D1 protein of PS II, hence participating in the repair of PS II damages caused by photoinhibition. The mRNA is cell-to-cell mobile. |
| AT5G36950 | Encodes a putative DegP protease. |
| AT3G16540 | Encodes a putative DegP protease. |
| AT1G28320 | Mutants in this gene are defective in the processing of pre-glyoxysomal malate dehydrogenase (pre-gMDH) to gMDH. |
| AT1G65630 | Encodes a putative DegP protease. |
| AT3G03380 | Encodes a putative DegP protease. The mRNA is cell-to-cell mobile. |
| AT2G38340 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT1G21910 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT3G50980 | dehydrin xero 1;(source:Araport11) |
| AT1G19550 | Glutathione S-transferase family protein;(source:Araport11) |
| AT3G12930 | Encodes a novel conserved chloroplast protein that interacts with components of the PEP complex. Mutants show delayed greening and reduced photosynthetic capcity. |
| AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
| AT1G06080 | Encodes a protein homologous to delta 9 acyl-lipid desaturases of cyanobacteria and acyl-CoA desaturases of yeast and mammals. expression down-regulated by cold temperature. It is involved in the desaturation of VLCFAs to make monounsaturated VLCFAs. |
| AT1G65520 | encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
| AT4G34060 | Encodes a protein with 5-meC and thymine-DNA glycosylase activity with a preference for CpG and CpHpG sequences. Involved in maintaining methylation marks. Many targets of DML3 are senescence-associated genes (SAGs). |
| AT1G11500 | DUF1218 family member. |
| AT2G04040 | AtDTX1 (At2g04040) has been identified as a detoxifying efflux carrier for plant-derived antibiotics and other toxic compounds, including Cd2+. Expression in rosette leaves is activated by high concentration of boron.Mistakenly referred to as At2g04070 in PMID:11739388. |
| AT3G23550 | MATE efflux family protein;(source:Araport11) |
| AT5G52050 | MATE efflux family protein;(source:Araport11) |
| AT4G25640 | Encodes a multidrug and toxin efflux family transporter. Involved in flavonoid metabolism, affecting Root growth, seed development and germination, and pollen development, release and viability. |
| AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
| AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
| AT5G64280 | dicarboxylate transporter 2.2;(source:Araport11) |
| AT1G01040 | Encodes a Dicer homolog. Dicer is a RNA helicase involved in microRNA processing. Mutations in this locus can result in embryo lethality. Embryo shape at seed maturity is globular-elongate. Other mutants convert the floral meristems to an indeterminate state, others yet show defects in ovule development. mRNA is expressed in all shoot tissues. DCL1 is able to produce miRNAs and siRNAs. The mRNA is cell-to-cell mobile. |
| AT1G51360 | Involved in defense against fungal pathogens and located in cytosol. |
| AT1G14130 | DAO1 is an IAA oxidase expressed in many different plant parts. it is a member of a family of dioxygenase and 2OG Fe(II) oxygenase domain and DAO domain containing proteins. It appears to be the major IAA oxidase in planta and major contributor to IAA degradation. |
| AT1G64160 | Encodes a dirigent protein involved in the synthesis of (-)pinoresinol. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT1G30825 | Involved in trichome maturation. mutant displays enlarged trichomes |
| AT5G58900 | R-R-type MYB protein |
| AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
| AT3G14990 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. The mRNA is cell-to-cell mobile. |
| AT1G53280 | Encodes a homolog of animal DJ-1 superfamily protein. In the A. thaliana genome, three genes encoding close homologs of human DJ-1 were identified AT3G14990 (DJ1A), AT1G53280 (DJ1B) and AT4G34020 (DJ1C). Among the three homologs, DJ1C is essential for chloroplast development and viability. It exhibits glyoxalase activity towards glyoxal and methylglyoxal. |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G00940 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
| AT3G17830 | Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
| AT1G66730 | Encodes a novel plant specific DNA ligase that is involved in seed germination and DNA repair. |
| AT4G21080 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
| AT4G36040 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT1G48140 | Encodes a subunit of the dolichol phosphate mannase synthase (DPMS) complex that may serve as membrane anchors for the catalytic core, DPMS1, or provide catalytic assistance. It is localized in the ER and mediates isoprenyl-linked glycan biogenesis. |
| AT1G03300 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT5G23800 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype |
| AT2G46840 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype. Overexpression increases plant organ size, possibly by influencing the expression of the cell wall formation and auxin transporter genes that regulate cell size. |
| AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
| AT4G12010 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. Co-regulates with WRKY19 basal levels of immunity to root-knot nematodes. |
| AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
| AT2G33830 | Negative regulator of local and systemic acquired resistance; target of FLD for activation of SAR. |
| AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
| AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
| AT5G05410 | Encodes a transcription factor that specifically binds to DRE/CRT cis elements (responsive to drought and low-temperature stress). Belongs to the DREB subfamily A-2 of ERF/AP2 transcription factor family (DREB2A). There are eight members in this subfamily including DREB2B. The protein contains one AP2 domain. Overexpression of transcriptional activation domain of DREB2A resulted in significant drought stress tolerance but only slight freezing tolerance in transgenic Arabidopsis plants. Microarray and RNA gel blot analyses revealed that DREB2A regulates expression of many water stress?inducible genes. The mRNA is cell-to-cell mobile. |
| AT5G67190 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT2G23340 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
| AT1G27461 | Nuclear localized protein involved in osmotic stress tolerance. |
| AT1G80710 | Encodes a WD-40 repeat family protein containing a DWD (DDB1 binding WD-40) motif. Mutant analysis demonstrates that DRS1 promotes tolerance to drought stress, possibly mediated by ABA, and suggests involvement of DDB1- Cul4?mediated protein degradation in drought response. |
| AT2G31470 | Encodes a F-Box protein DOR (Drought tolerance Repressor) functionally as an inhibitory factor for abscisic acid-induced stomatal closure under drought stress. |
| AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
| AT5G54450 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G54560 | hypothetical protein (DUF295);(source:Araport11) |
| AT4G13680 | hypothetical protein (DUF295);(source:Araport11) |
| AT5G52940 | DUF295 domain protein. |
| AT1G80240 | DUF642 gene |
| AT3G21520 | Encodes a protein is directly or indirectly involved in membrane fission during breakdown of the ER and the tonoplast during leaf senescence and in membrane fusion during vacuole biogenesis in roots. The mRNA is cell-to-cell mobile. |
| AT5G27370 | inactive Serine/Threonine-kinase, putative (DUF679);(source:Araport11) |
| AT4G28485 | The structure of this gene is mis-annotated in TAIR10. Please refer to PMID:20712629 and the Comment field on the TAIR locus page for revised annotation. |
| AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
| AT2G17180 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT1G63030 | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (DDF2). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. Overexpression of this gene results in the reduction of gibberellic acid biosynthesis. This gene is expressed in all tissues examined, but most abundantly expressed in rosette leaves and stems. Overexpression of DDF1, a putative paralog of this gene, also reduces gibberellic acid biosynthesis and makes the plants more tolerant to high-salinity levels. |
| AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
| AT1G60510 | pseudogene of Dynamin related protein 4C;(source:Araport11) |
| AT3G61760 | DYNAMIN-like 1B;(source:Araport11) |
| AT4G21330 | Encodes a bHLH transcription factor strongly expressed in the tapetum from late anther stage 5 to early stage 6, and at a lower level in meiocytes. dyt1 mutant exhibits abnormal anther morphology beginning at anther stage 4. DYT1 acts downstream of SPL/NZZ and EMS1/EXS , and regulates the expression of downstream genes like AMS, MS1 and other tapetum preferential genes for pollen development, primarily via TDF1. |
| AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT3G16800 | EGR3 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress, EGR3 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
| AT5G19180 | Encodes a subunit of a RUB-activating enzyme analogous to the E1 ubiquitin-activating enzyme. ECR1 functions as a heterodimer with AXR1 to activate RUB, a ubiquitin-related protein. |
| AT5G62640 | nuclear targeted protein involved in flowering time regulation that affects flowering time independent of FLC |
| AT1G77300 | Encodes a protein with histone lysine N-methyltransferase activity required specifically for the trimethylation of H3-K4 in FLC chromatin (and not in H3-K36 dimethylation). Acts as an inhibitor of flowering specifically involved in the autonomous promotion pathway. EFS also regulates the expression of genes involved in carotenoid biosynthesis and nitrogen assimilation.Modification of histone methylation at the CRTISO locus reduces transcript levels 90%. The increased shoot branching seen in some EFS mutants is likely due to the carotenoid biosynthesis defect having an effect on stringolactones.Required for ovule, embryo sac, anther and pollen development. |
| AT4G14690 | Encodes an early light-induced protein. ELIPs are thought not to be directly involved in the synthesis and assembly of specific photosynthetic complexes, but rather affect the biogenesis of all chlorophyll-binding complexes. A study (PMID 17553115) has shown that the chlorophyll synthesis pathway was downregulated as a result of constitutive ELIP2 expression, leading to decreased chlorophyll availability for the assembly of pigment-binding proteins for photosynthesis. |
| AT5G53870 | early nodulin-like protein 1;(source:Araport11) |
| AT2G25060 | early nodulin-like protein 14;(source:Araport11) |
| AT4G12880 | early nodulin-like protein 19;(source:Araport11) |
| AT1G64640 | early nodulin-like protein 8;(source:Araport11) |
| AT1G08930 | encodes a putative sucrose transporter whose gene expression is induced by dehydration and cold. The mRNA is cell-to-cell mobile. |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
| AT5G20480 | Encodes a predicted leucine-rich repeat receptor kinase (LRR-RLK). Functions as the receptor for bacterial PAMP (pathogen associated molecular patterns) EF-Tu. |
| AT3G18980 | EIN2 targeting protein1;(source:Araport11) |
| AT5G25350 | Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA. Part of the SCF complex, it is located in the nucleus and is involved in the ethylene-response pathway. |
| AT2G43400 | Encodes a unique electron-transfer flavoprotein:ubiquinone oxidoreductase that is localized to the mitochondrion. Mutants are more sensitive to sugar starvation when plants are kept in the dark for long periods. |
| AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
| AT5G09990 | elicitor peptide 5 precursor;(source:Araport11) |
| AT2G22000 | elicitor peptide 6 precursor;(source:Araport11) |
| AT4G37980 | NADPH-dependent cinnamaldehyde and hexenal reductase involved in the production of green leaf volitile compounds. |
| AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
| AT4G10090 | elongator protein 6;(source:Araport11) |
| AT5G22800 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT2G45330 | RNA 2-phosphotransferase, Tpt1 / KptA family;(source:Araport11) |
| AT3G48930 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT1G49400 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT1G79350 | Encodes the Arabidopsis thaliana orthologue of metazoan Strawberry notch, a highly conserved co-activator of the developmental regulator Notch. It mediates stress-induced chromatin memory by modulating nucleosome occupancy by interacting with chromatin remodeling proteins of the ISWI and SWI/SNF classes. |
| AT1G48850 | Flavoenzyme-encoding gene essential for embryo development. |
| AT2G26830 | Encodes a member of a small family of choline/ethanolamine kinases that is localized to the plasma membrane. Homozygous loss of function alleles are embryo lethal. Overexpression results in altered phospholipid levels suggesting a critical role in phospholipid biosynthesis. |
| AT5G17710 | Chloroplast GrpE protein involved in chloroplastic response to heat stress and the correct oligomerization of the photosynthesis-related LHCII complex. |
| AT1G56200 | Encodes a chloroplast localized protein that is essential for chloroplast development. |
| AT5G21140 | Encodes a nuclear localized, structural subunit of the SMC 5/6 complex and a non- SMC element. Loss of function results in abnormal cell division and embryo lethality. Analysis of partially rescued lines indicates a role in double strand break DNA repair. Similar phenotype to NSE3 which it also interacts with. Maintains cell viability together with NSE3 during early embryogenesis. |
| AT5G37510 | Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte. The mRNA is cell-to-cell mobile. |
| AT5G27720 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT1G58210 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It colocalizes with filamentous actin and is localized to the plasma membrane. |
| AT3G61780 | embryo defective 1703;(source:Araport11) |
| AT1G76060 | CIAF1 mitochondrial protein required for assembly of the 1000-kD complex I holoenzyme. |
| AT5G08170 | porphyromonas-type peptidyl-arginine deiminase family protein;(source:Araport11) |
| AT4G28210 | embryo defective 1923;(source:Araport11) |
| AT3G05680 | Encodes a splicing/methylation factor that is a homologue to the mammalian VIRILIZER, is member of a core set of mRNA m6A writer proteins and is required for N6-adenosine methylation of mRNA. Analysis of transcriptional profiles of the vir-1 mutant suggests that VIR is likely involved in regulation of gene expression, but the function of VIR is rather general than specific and knock-down of VIR does not affect overall splicing rates. |
| AT1G48175 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT5G16715 | protein EMBRYO DEFECTIVE 2247;(source:Araport11) |
| AT4G21130 | similar to man and yeast U3-55K genes, involved in processing of pre-ribosomal RNA. |
| AT1G30610 | Pentatricopeptide repeat protein .Mutations in this locus result in embryo lethality due to defects in chloroplast development. Embryo shape at seed maturity is globular. |
| AT2G18020 | Ribosomal protein L2 family;(source:Araport11) |
| AT1G08840 | Encodes a homolog of human and yeast DNA2. Mutants have increased sensitivity to DNA damage stress. |
| AT3G48470 | embryo defective 2423;(source:Araport11) |
| AT5G18570 | Encodes AtObgC, a plant ortholog of bacterial Obg. AtObgC is a chloroplast-targeting GTPase essential for early embryogenesis. Mutations in this locus result in embryo lethality. The protein is dually localized in the stroma and the inner envelope membrane and is involved in thylakoid membrane biogenesis and functions primarily in plastid ribosome biogenesis during chloroplast development. |
| AT5G02250 | Encodes a exoribonuclease involved in rRNA processing in mitochondria and chloroplasts.Loss of function mutations are pale green and require supplementation with sucrose for germination and early development. Plants are pale green due to defects in chloroplast biogenesis. |
| AT5G06240 | embryo defective 2735;(source:Araport11) |
| AT3G12670 | Cytidine triphosphate synthase; essential for CTP supply in developing embryos. |
| AT5G39680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT4G29860 | Encodes a WD repeat protein with seven WD repeat motifs, predicted to function in protein-protein interaction. Mutations caused defects in both embryo and seedling development. |
| AT2G38770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G02660 | Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial;(source:Araport11) |
| AT2G31060 | elongation factor family protein;(source:Araport11) |
| AT2G32590 | condensin complex subunit;(source:Araport11) |
| AT5G24670 | A protein coding gene with unknown function. The 5?UTR of this gene overlaps with a RNA coding gene TER2. TER2 (GenBank accession no. HQ401285) encodes a putative template sequence corresponding to 1.5 copies of the Arabidopsis telomere repeat (PNAS 2011, 108:73-78). Natural epiallele in Nok-1, transmission of the epiallele over generations depends only on the selfreinforcing loop between CHROMOMETHYLASE 3 and KRYPTONITE, involving DNA methylated in the CHG context and histone H3 lysine 9 methylation. |
| AT5G13010 | Encodes a nuclear localized DEAH-box containing protein that is involved in miRNA biogenesis. Loss of function mutants are embryo lethal. Gene silencing experiments demonstrated its role in the localization of DCL-1 and HYL1 to the nuclear D-body. In silenced lines, miRNA production is suppressed and plants have developmental abnormalities and are hypersensitive to fungal pathogens. |
| AT5G11890 | harpin-induced protein;(source:Araport11) |
| AT5G51200 | Originally identified as EDS4, enhanced disease sensitive phenotype and subsequently cloned and identified as NUCLEOPORIN205. Affects circadian clock and downstream genes including those involved in defense response. |
| AT5G58250 | Involved in tetrapyrrole biosynthesis. May function as a scaffold protein to stabilize CHL27. |
| AT5G64580 | Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
| AT5G40160 | Encodes ankyrin repeat protein EMB506. Mutations in this locus result in embryo lethality. |
| AT2G03050 | A locus involved in embryogenesis. Mutations in this locus result in embryo lethality. |
| AT5G27270 | P-type PPR chloroplast localized protein required for group II intron splicing in chloroplasts. |
| AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
| AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G18080 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G10000 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G00140 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G37890 | Involved in shoot regenaration from root explants. |
| AT3G03650 | Exostosin family protein;(source:Araport11) |
| AT3G56990 | embryo sac development arrest 7;(source:Araport11) |
| AT4G34200 | Encodes a 3-phosphoglycerate dehydrogenase that is essential for embryo and pollen development. |
| AT1G10745 | Encodes a Maternally expressed gene (MEG) family protein |
| AT1G10717 | Encodes a Maternally expressed gene (MEG) family protein |
| AT5G11530 | Involved in regulating reproductive development |
| AT1G18260 | Encodes an Arabidopsis homolog of the yeast Hrd3/mammlian Sel1L protein. Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT1G02310 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G01930 | Encodes a endo-beta-mannanase involved in seed germination. |
| AT2G21600 | Key player of retrieval of ER membrane proteins The mRNA is cell-to-cell mobile. |
| AT3G07100 | Encodes SEC24a/ERMO2. Required for endoplasmic reticulum (ER) morphology. Has epistatic interactions with AT1G55350, AT3G59420, and AT3G10525. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
| AT3G25040 | Encodes ERD2b. a homolog of the yeast endoplasmic reticulum retention receptor ERD2. Mutations in ERD2b compromise EFR but not FLS2 signaling. The mRNA is cell-to-cell mobile. |
| AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
| AT2G01850 | EXGT-A3 has homology to xyloglucan endotransglucosylases/hydrolases (XTHs). Mutants in this gene show a lesion mimic phenotype associated with leaf maturation and a reduction in the number of tertiary veins. Individual tracheary elements in the mutants are shorter, but phloem transport activity is not severely affected. EXGT-A3 plays a role in xyloglucan degradation in the differentiating tracheary elements of rosette leaves. The mRNA is cell-to-cell mobile. |
| AT1G08720 | enhanced disease resistance 1 (EDR1) confers resistance to powdery mildew disease caused by the fungus Erysiphe cichoracearum The mRNA is cell-to-cell mobile. |
| AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
| AT5G22090 | EAR1 is a negative regulator of ABA signaling that enhances the activity of all six clade A PP2Cs (ABI1, ABI2, HAB1, HAB2, AHG1, AHG3) by interacting with and releasing the N-terminal autoinhibition of these proteins. EAR1 indirectly affects OST1 activity through enhancing ABI1 activity. The EAR1 141-287 fragment is sufficient for the functioning of EAR1 in ABA responses; the 131-248 region harbors an intrinsically disordered region and only 249-278 can form a predicted regular structure. EAR1 is located in the ER, nuclei, and cytoplasm; ABA signaling promotes the translocation of EAR1 from the ER and/or cytoplasm to the nucleus. Mutations showed that it functions in seed germination, primary root growth, and drought tolerance. |
| AT3G15140 | ERI (At3g15140) encodes a protein of 337 amino acids of the ribonuclease H-like superfamily. The protein contains both DEDDh and SAP domains.The first exon contains a TCT-microsatellite structure (starting 226 bp after ATG) that, based on sequence complementarity, is a miR5021-cleavage target site. ERI is predicted to function as an siRNA exonuclease. Overexpression leads to increased post transcriptional gene silencing and reduced numbers of 21mers. Macroscopically, the growth rate is increased in overexpressors leading to increased biomass. |
| AT5G10810 | enhancer of rudimentary homolog ATER |
| AT4G16210 | enoyl-CoA hydratase/isomerase A;(source:Araport11) |
| AT2G32440 | ent-kaurenoic acid hydroxylase (KAO2) |
| AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
| AT3G13898 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT1G54040 | Epithiospecifier protein, interacts with WRKY53. Involved in pathogen resistance and leaf senescence. |
| AT4G05520 | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290). |
| AT1G30630 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT2G34840 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT4G05130 | equilibrative nucleoside transporter 4;(source:Araport11) |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
| AT1G28360 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ERF12). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. Regulates floral development. |
| AT2G35700 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Thought to be involved in secondary cell wall metabolism. |
| AT1G49880 | Encodes Erv1, a component of the mitochondrial intermembrane space assembly machinery involved in the import pathway of the small intermembrane space proteins. It contains a Cys-X-Cys shuttle disulfide and oxidizes thioredoxin in vitro. Flavoenzyme-encoding gene. |
| AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile. |
| AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
| AT1G31660 | Encodes a protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and male and female gametophyte development. |
| AT4G29960 | EBS7 encodes a plant specific, endoplasmic reticulum localized protein that is involved in endoplasmic reticulum-associated degradation (ERAD). It interacts with the ERAD component AtHRD1a and may regulate HRD1a stability. Identified in a screen for supressors of a mutation in bri1 that causes bri1 to be retained in the ER. Loss of EBS7 function restores BR sensitivity in the bri1-9 mutant allele. |
| AT5G25190 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT5G09410 | calmodulin-binding protein, similar to another ethylene-upregulated calmodulin-binding protein ER1 GI:11612392 from (Nicotiana tabacum) |
| AT1G66340 | Similar to prokaryote sensory transduction proteins. Contains a histidine kinase and a response regulator domain. Homodimer. Membrane component. Binds ethylene. Mutations affect ethylene binding and metabolism of other plant hormones such as auxin, cytokinins, ABA and gibberellic acid. Ethylene receptor. Has histidine kinase activity. Is regulated by RTE1. Mutations in ETR1 block ethylene stimulation of flavonol synthesis. |
| AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
| AT3G23240 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3. |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT5G51190 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture and the response to cold stress. |
| AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G32800 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G43410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Expression of ERF96 is induced by pathogens, JA and ethylene and over expression leads to increased resistance to resistance to necrotrophic pathogens. It is a nuclear localized, transcriptional activator that binds to GCC elements that is involved in positive regulation of ABA responses. |
| AT1G50640 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-3). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT5G47230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-5). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
| AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT3G60490 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT1G13950 | Encodes eukaryotic translation initiation factor 5A (EIF-5A).In mammalian cells it functions as a shuttle protein that translocates mRNA from the nucleus to cytoplasmic ribosomes. Overexpression results in an increase in both primary and secondary xylem formation. In RNAi suppressed lines, xylem formation is reduced. |
| AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
| AT5G47880 | Encodes a eukaryotic release factor 1 homolog. Cosuppression of the gene's expression results affects cell elongation of the inflorescence stem, specifically the internodes, and radial cell division. Expression of the protein is primarily observed in the vascular system and in actively growing and elongating zones. |
| AT2G39990 | translation initiation factor eIF2 p47 subunit homolog |
| AT3G60240 | protein synthesis initiation factor 4G (EIF4G). A mutation in this gene (cum2-1) results in decreased accumulation of CMV coat protein in upper, uninoculated leaves. Likely affects cell-to-cell movement of the virus, also affects TCV multiplication. |
| AT5G57870 | Encodes a putative eukaryotic translation initiation factor The mRNA is cell-to-cell mobile. |
| AT1G79270 | evolutionarily conserved C-terminal region 8;(source:Araport11) |
| AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
| AT4G17680 | Encodes an S-ribonuclease binding protein specifically involved in plant tolerance to NaHCO3. |
| AT1G27510 | Encodes one of the two plastid proteins EXECUTER (EX1, AT4G33630) and EX2 (AT1G27510). Mediates singlet oxygen induced programmed cell death. |
| AT4G33630 | Encodes one of the two plastid proteins EXECUTER (EX1, AT4G33630) and EX2 (AT1G27510). Mediates singlet oxygen induced programmed cell death. |
| AT5G49830 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT1G10180 | LOW protein: exocyst complex component-like protein;(source:Araport11) |
| AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT1G72470 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G14090 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G28650 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G09440 | EXORDIUM like 4;(source:Araport11) |
| AT1G54490 | Involved in the ethylene response. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. Endogenous suppressor of posttranscriptional gene silencing. The mRNA is cell-to-cell mobile. |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G26770 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G55500 | expansin-like protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G39700 | putative expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT1G65680 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT4G28250 | putative beta-expansin/allergen protein. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT3G60570 | member of BETA-EXPANSINS. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT3G45970 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) The mRNA is cell-to-cell mobile. |
| AT4G17030 | Encodes EXLB1 (expansin-like B1), a member of the expansin family. |
| AT1G23720 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G26250 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT4G08370 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT4G08380 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT5G19810 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT1G70990 | Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility. |
| AT2G23460 | encodes a novel G-alpha protein that shares similarity to plant, yeast, and animal G-alpha proteins at the C-terminus. It contains an N-terminus that is as large as the C-terminus, is a member of a small family, and is expressed in all tissues examined, including roots, leaves, stems, flowers, and fruits. |
| AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
| AT1G75930 | member of Lipase proteins |
| AT2G35320 | homologue of the animal Eyes Absent genes. encodes a tyrosine-specific phosphatase. the protein sequence lacks the cys-containing signature of the classical tyrosine phosphatases. belongs to the aspartate-based phosphatases. The enzyme activity is strictly metal-dependent. |
| AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
| AT1G44080 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT1G65760 | ascorbic acid mannose pathway regulator (DUF295);(source:Araport11) |
| AT2G14290 | LL-diaminopimelate protein (DUF295);(source:Araport11) |
| AT3G22345 | F-box/kelch-repeat protein;(source:Araport11) |
| AT4G14165 | F-box family protein-like protein;(source:Araport11) |
| AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
| AT4G22165 | F-box protein (DUF295);(source:Araport11) |
| AT5G25290 | F-box protein (DUF295);(source:Araport11) |
| AT5G25300 | F-box protein;(source:Araport11) |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT1G35530 | Encodes FANCM, a highly conserved helicase that functions as a major factor limiting meiotic crossover formation. It is not directly involved in the repair of DNA lesions but suppresses spontaneous somatic homologous recombination via a RecQ helicase (At-RECQ4A)-independent pathway. |
| AT4G14970 | Encodes a protein that is required for meiotic homologous recombination and acts in parallel to both MUTS HOMOLOG 4 (AtMSH4), known for its role in promoting interfering cross-overs (COs) and MMS AND UV SENSITIVE 81 (AtMUS81), known for its role in the formation of non-interfering COs. |
| AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT5G19260 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT1G10240 | FAR1-related sequence 11;(source:Araport11) |
| AT4G33360 | Encodes an NAD+-dependent dehydrogenase that oxidizes farnesol more efficiently than other prenyl alcohol substrates. |
| AT5G63530 | Farnesylated protein that binds metals. |
| AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
| AT5G55730 | Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development. |
| AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G06390 | FASCICLIN-like arabinogalactan protein 17 precursor;(source:Araport11) |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT4G31370 | fasciclin-like arabinogalactan-protein, putative (FLA5) |
| AT2G45470 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT2G29980 | Endoplasmic reticulum enzyme responsible for the synthesis of 18:3 fatty acids from phospholipids. Uses cytochrome b5 as electron donor. |
| AT3G15850 | Chloroplastic enzyme responsible for the synthesis of 16:1 fatty acids from galactolipids and sulpholipids. Uses ferredoxin as electron donor. The mRNA is cell-to-cell mobile. |
| AT4G30950 | Chloroplastic enzyme responsible for the synthesis of 16:2 and 18:2 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation resulted in reduced level of unsaturated fatty acids leading to susceptibility to photoinhibition. |
| AT3G11170 | Chloroplastic enzyme responsible for the synthesis of 16:3 and 18:3 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene expression is induced by wounding in shoot and root. The wound-response in shoot is independent of jasmonic acid mediated pathway whereas the root response is mediated by jasmonic acid. The mRNA is cell-to-cell mobile. |
| AT4G20870 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
| AT3G44540 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
| AT3G56700 | Encodes a fatty-acyl-CoA reductase that is expressed in response to wounding. |
| AT1G08510 | Encodes an acyl-acyl carrier protein thioesterase. Hydrolyzes primarily saturated acyl-ACPs with chain lengths that vary between 8 and 18 carbons. Involved in saturated fatty acid synthesis. Nuclear-encoded, plastid-targeted globular protein that is functional as dimer. |
| AT3G63170 | Encodes a plastid stroma localized fatty acid binding protein involved in fatty acid metabolism. |
| AT2G26310 | Encodes a plastid stroma localized fatty acid binding protein. |
| AT4G13985 | FBD-associated F-box protein;(source:Araport11) |
| AT1G57790 | F-box family protein;(source:Araport11) |
| AT5G11460 | FCS like zinc finger 10 is induced during energy starvation through SnRK1 signaling. Mutants accumulate more SnRK1alpha1 which results in the inhibition of seedling growth under favorable growth conditions. Increased SnRK1 activity in the mutant also results in the downregulation of TOR signaling (DOI:10.1111/tpj.13854). |
| AT5G51100 | Fe superoxide dismutase whose mRNA levels are increased in response to exposure to UV-B. |
| AT5G23310 | Fe superoxide dismutase |
| AT2G35620 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.Mucilage is easily detached from fei2 mutants seeds, and forms a capsule that is >50% smaller relative to wild-type. |
| AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
| AT2G27510 | ferredoxin 3;(source:Araport11) |
| AT4G14890 | 2Fe-2S ferredoxin-like superfamily protein;(source:Araport11) |
| AT1G32550 | Encodes FdC2, a ferredoxin protein capable of alternative electron partitioning. FdC1 level increases in conditions of acceptor limitation at PSI. |
| AT5G08410 | ferredoxin/thioredoxin reductase subunit A (variable subunit) 2;(source:Araport11) |
| AT3G08040 | Encodes a member of the MATE (multidrug and toxin efflux family), expressed in roots but not shoots. Mutants accumulate excess iron, manganese and zinc, and express root Fe(III) chelatase activity even under iron sufficiency conditions. FRD3 is likely to function in root xylem loading of an iron chelator or other factor necessary for efficient iron uptake out of the xylem or apoplastic space and into leaf cells. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT5G50160 | Encodes a ferric chelate reductase that is expressed in shoots and flowers. |
| AT4G36220 | encodes ferulate 5-hydroxylase (F5H). Involved in lignin biosynthesis. |
| AT1G26870 | NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
| AT4G22240 | Involved in photoprotection of photosystem II. The RVSI and twin-positive motifs in the transit peptide are necessary for efficient leucoplast import of prFB. |
| AT3G23400 | Encodes FIBRILLIN 4 (FIB4). The fibrillins are a large family of chloroplast proteins that have been linked with stress tolerance and disease resistance. FIBRILLIN 4 is required for plastoglobule development and stress resistance.Iinvolved in plastoquinone transport. |
| AT5G19940 | Enables plants to cope with moderate light stress and affects cadmium tolerance. |
| AT1G04650 | FLIP is a member of a conserved gene family with wide distribution across taxa. In Arabidopsis, it forms a complex with FIGL1 regulates meiotic crossover formation via RAD51 and DMC1. |
| AT4G26700 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
| AT4G25340 | Encodes a member of the FKBP-type immunophilin family that functions as a histone chaparone. Binds to 18S rDNA and represses its expression. The N-terminal nucleoplasmin domain interacts with H2A/H2B and H3/H4 histone oligomers, individually, as well as simultaneously, suggesting two different binding sites for H2A/H2B and H3/H4. |
| AT5G48580 | Endoplasmic reticulum (ER) localized immunophilin protein which possesses PPIase activity. Positively regulates plant immunity in response to Phytophthora infection. Host target of PcAvr3a12 during early P. capsici infection. Involved in ER stress sensing and is required for ER stress-mediated plant immunity. |
| AT5G64350 | Encodes FK506-binding protein 12 (FKBP12 or FKP12). FKP12 overexpression dramatically enhances rapamycin sensitivity, whereas rapamycin inhibition is relieved in transgenic plants deficient in FKP12. |
| AT3G25220 | immunophilin (FKBP15-1) |
| AT1G79790 | Encodes a chloroplast-localized FMN hydrolase that whose phosphatase activity is FMN-specific. |
| AT1G68050 | Encodes FKF1, a flavin-binding kelch repeat F box protein, is clock-controlled, regulates transition to flowering. Forms a complex with GI on the CO promoter to regulate CO expression. |
| AT1G62570 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
| AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
| AT5G28470 | Encodes a member of the nitrate/peptide NTR/PTR family of transporters is required for accumulation and transport of pollen-specific flavonol 3-O-sophorosides, characterized by a glycosidic β-1,2-linkage, to the pollen surface of Arabidopsis. |
| AT5G63590 | flavonol synthase 3;(source:Araport11) |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT2G30120 | protein FLC EXPRESSOR;(source:Araport11) |
| AT3G01560 | proline-rich receptor-like kinase, putative (DUF1421);(source:Araport11) |
| AT1G43800 | Δ9 stearoyl-ACP desaturase which together with FAB2, AAD1, and AAD5 redundantly participates in oil storage during the maturation phase. |
| AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT2G42280 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G04610 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT1G65480 | FT, together with LFY, promotes flowering and is antagonistic with its homologous gene, TERMINAL FLOWER1 (TFL1). Together with TSF, it plays an antagonistic role to TFL1 in the determination of inflorescence meristem identity. FT is expressed in leaves and is induced by long day treatment. Either the FT mRNA or protein is translocated to the shoot apex where it induces its own expression. Recent data suggests that FT protein acts as a long-range signal. FT is a target of CO and acts upstream of SOC1. |
| AT5G24860 | encodes a small protein of 12.6 kDa that regulates flowering and is involved in gibberellin signalling pathway. It is expressed in apical meristems immediately after the photoperiodic induction of flowering. Genetic interactions with flowering time and floral organ identity genes suggest that this gene may be involved in modulating the competence to flower. There are two other genes similar to FPF1, FLP1 (At4g31380) and FLP2 (no locus name yet, on BAC F8F16 on chr 4). This is so far a plant-specific gene and is only found in long-day mustard, arabidopsis, and rice. |
| AT5G27830 | Folate receptor family protein;(source:Araport11).Expression correlates with increase in bound folate in planta. |
| AT5G53390 | Encodes a member of the bifunctional wax ester synthase/diacylglycerol acyltransferase gene family, WSD11, which is expressed in elongating petals and localized to the plasma membrane. |
| AT3G63300 | Encodes a pleckstrin homology domain- and DUF828-containing protein. Mutants have defects in leaf vascular pattering, with vascular bundles that fail to meet distally in both the cotyledons and leaves. Necessary to the formation of the closed leaf vascular pattern characteristic of dicot leaves in response to auxin. Redundant with FKD2. FKD1 may influence PIN1 localization in an auxin dependent manner. proposed to be a key component of the auxin canalization pathway. FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G47440 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G14780 | Encodes a NAD-dependent formate dehydrogenase. |
| AT4G15200 | Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes. |
| AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT3G25500 | Poly-L-proline-containing (PLP) protein that form part of the signal-transduction cascade that leads to rearrangement of the actin cytoskeleton. AFH1 is a nonprocessive formin that moves from the barbered end to the side of an actin filament after the nucleation event. |
| AT3G14270 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
| AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
| AT2G28110 | Homolog to AT5G22940, a member of glycosyltransferase family 47 that is involved in secondary cell wall biosynthesis. It exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. Protein has a domain that shares significant similarity with the pfam03016 domain. It is expressed specifically in developing vessels and fiber cells, and FRA8 is targeted to Golgi. Mutants have irregular xylem formation, reduced cellulose levels and plants are smaller than normal siblings. |
| AT3G59480 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
| AT3G54090 | Encodes a fructokinase-like protein (AT3G54090/FLN1, AT1G69200/FLN2), a member of the pfkB-carbohydrate kinase family. FLN1 and FLN2 are potential plastidial thioredoxin z (TRX z) targets. Mutants display mutant chloroplast development, general plant growth and development defects and defects in PEP-dependent transcription. |
| AT1G07110 | Encodes the bifunctional enzyme fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase. |
| AT5G03690 | Aldolase superfamily protein;(source:Araport11) |
| AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
| AT2G29080 | encodes an FtsH protease that is localized to the mitochondrion |
| AT3G47060 | encodes an FtsH protease that is localized to the chloroplast |
| AT1G06430 | encodes a FtsH protease that is localized to the chloroplast |
| AT1G71990 | This gene encodes a Lewis-type alpha 1,4-fucosyltransferase |
| AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
| AT5G50950 | Encodes a fumarase enzyme initially shown to be in the mitochondria through proteomic studies but later shown to be present in the cytosol using an RFP fluorescent protein tag. It appears to be important for the accumulation of fumarate from malate in leaves in the light, and helps to promote nitrogen assimilation under high nitrogen conditions. It does not appear to be necessary for lipid metabolism and seedling growth. Inhibition of fumarate accumulation results in an overall shift in the cold response of leaves, with a complete inhibition of cold acclimation of photosynthesis. |
| AT1G02090 | encodes a phosphoprotein that is a subunit of the COP9 signalosome. Mutants exhibit constitutive photomorphogenic phenotype. |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT2G26300 | Encodes an alpha subunit of a heterotrimeric GTP-binding protein. The active GTP-bound form of GPA1 binds to the GTG1 and GTG2 abscisic acid (ABA) receptors and appears to affect their GTPase and GTP-binding activity, and hence, ABA binding abilities. GPA1 is a positive regulator in ABA-mediated inhibition of stomatal opening. Plants with recessive mutant alleles have complex phenotypes including: reduced brassinolide response, reduced cell divisions, round leaves, short hypocotyls. It is likely to be involved in the signaling events that trigger unfolded protein response-associated cell death. GPA1 is also involved in sugar signaling. The mRNA is cell-to-cell mobile. |
| AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
| AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
| AT4G17330 | gene of unknown function expressed in seedlings, flower buds and stems |
| AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
| AT4G02780 | Catalyzes the conversion of geranylgeranyl pyrophosphate (GGPP) to copalyl pyrophosphate (CPP) of gibberellin biosynthesis |
| AT2G18490 | GAZ is a nuclear localized transcriptional activator that is regulated (decreased) by GA and ABA levels. GAZ is expressed in the root stele and may function non-cell autonomously to effect hormone mediated control of ground tissue maturation. |
| AT1G74670 | Gibberellin-regulated family protein;(source:Araport11) |
| AT2G33570 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
| AT5G30500 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
| AT1G09350 | Predicted to encode a galactinol synthase |
| AT1G60470 | Predicted to encode a galactinol synthase. |
| AT5G23790 | Predicted to encode a galactinol synthase. |
| AT5G19580 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT5G15470 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT2G46480 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G38270 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT1G54690 | Encodes HTA3, a histone H2A protein. H2AX is a meiosis-specific isoform of histone H2A. Upon DSB formation, rapid accumulation of phosphorylated H2AX (γ-H2AX) occurs around the break site. H2AX foci accumulate in early G2. Immunolocalization studies in spread preparations of wild-type meiocytes at G2/early leptotene revealed the accumulation of numerous rather diffuse γ-H2AX foci throughout the chromatin. However, their accumulation is not contemporaneous with that of AtSPO11-1. At 3 h post-S, no γ-H2AX foci are detected. During the 3- to 5-h window when AtSPO11-1 foci rapidly disappear, there is an equally swift accumulation of γ-H2AX to a maximum of >50 diffuse foci. The level of γH2AX then remains constant for a further 13 h before undergoing a gradual decrease to 10?20 foci in the 18- to 24-h post-S period. By 30 h the foci have disappeared from the chromatin. |
| AT4G32940 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteinases that is expressed in vegetative organs and is upregulated in association with various types of cell death and under stressed conditions. They are essential in processing seed storage proteins and for mediating the susceptible response of toxin-induced cell death. |
| AT1G78670 | gamma-glutamyl hydrolase 3;(source:Araport11) |
| AT4G30530 | Encodes a gamma-glutamyl peptidase, outside the GGT family, that can hydrolyze gamma-glutamyl peptide bonds. The mRNA is cell-to-cell mobile. |
| AT4G30550 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT5G24280 | Encodes GMI1, a structural-maintenance-of-chromosomes-hinge domain-containing protein. Involved in somatic homologous recombination. |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
| AT2G45050 | Encodes a member of the GATA factor family of zinc finger transcription factors. A positive regulator of photomorphogenesis. |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
| AT4G32890 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G42640 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
| AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G73790 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT5G28840 | Encodes a protein with GDP-D-mannose 3',5'-epimerase activity. The enzyme is involved in ascorbate biosynthesis. It catalyzes the conversion of GDP-D-mannose to GDP-L-galactose. |
| AT5G40990 | Component of plant resistance. Contains lipase signature motif and GDSL domain. Directly interferes with the fungal infection process by acting on fungal cell walls through its action as a antimicrobial compound. Critical component for both local and systemic resistance responses in the incompatible interaction with Alternaria brassicicola in the ethylene-dependent pathway. |
| AT2G25650 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT2G36340 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
| AT2G03800 | encodes a D-aminoacyl-tRNA deacylase. Involved in detoxification of D-aminoacyl-tRNA. Mutants also show ethanol-hypersensitive phenotype. |
| AT5G13200 | Encodes a protein with unknown function that is involved in hormone mediated regulation of seed germination/dormancy. |
| AT1G54380 | Encodes GEMIN2, a spliceosomal small nuclear ribonucleoprotein assembly factor conserved from yeast to humans. GEMIN2 is a key component of a posttranscriptional regulatory mechanism that ensures the appropriate acclimation of plants to daily and seasonal changes in temperature conditions. It controls the alternative splicing of several circadian clock genes and attenuates the effects of temperature on the circadian period. |
| AT4G09000 | Encodes a 14-3-3 gene, designated GRF1 chi (for general regulatory factor1-G-box factor 14-3-3 homolog isoform chi). The major native forms of 14-3-3s are homo- and hetero-dimers, the biological functions of which are to interact physically with specific client proteins and thereby effect a change in the client. As a result, 14-3-3s are involved in a vast array of processes such as the response to stress, cell-cycle control, and apoptosis, serving as adapters, activators, and repressors. There are currently 133 full-length sequences available. |
| AT1G34760 | Encodes a 14-3-3 protein. Binds H+-ATPase in response to blue light. |
| AT1G26480 | 14-3-3 protein GF14iota (grf12) |
| AT1G78300 | G-box binding factor GF14 omega encoding a 14-3-3 protein The mRNA is cell-to-cell mobile. |
| AT2G42590 | 14-3-3 gene. Binds calcium and displays induced structural changes. |
| AT2G31400 | Encodes a a chloroplast-localized pentatricopeptide-repeat protein involved in regulation of nuclear gene expression. |
| AT3G32040 | Chloroplast localized GFDP synthase. |
| AT2G23800 | encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
| AT1G18970 | Encodes a germin-like protein with possible oxalate oxidase activity (based on GenBank record). |
| AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT1G02400 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins but not C20 gibberellins. |
| AT1G50960 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. DDF1 binds to GA2OX7 and regulates its expression in response to salt stress. |
| AT1G15550 | Involved in later steps of the gibberellic acid biosynthetic pathway. Activated by AGAMOUS in a cal-1, ap1-1 background. Deletion of 208 bp from -1016 to -809 (Δ-808) resulted in loss of GA-negative feedback (this sequence, which contains a 43-bp sequence GNFEI, was shown to be sufficient for GA-negative feedback). |
| AT2G47790 | Encodes GIGANTUS1 (GTS1), a member of Transducin/WD40 protein superfamily. Controls seed germination, growth and biomass accumulation. |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT2G37585 | Encodes GlcAT14C. Has glucuronosyltransferase activity adding glucuronic acid residues to beta-1,3- and beta-1,6-linked galactans. |
| AT1G30540 | Actin-like ATPase superfamily protein;(source:Araport11) |
| AT5G45600 | The GSA41 human homolog is expressed in nuclei and binds NuMA, a component of the nuclear matrix in interphase nuclei. It negatively regulates flowering by controlling the H4 acetylation levels in the FLC and FT chromatin. |
| AT4G38880 | GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2 |
| AT2G41760 | Controls the expression of specific defence-response genes, activates the synthesis pathway for the phytoalexin camalexin and influences basal resistance to Pseudomonas syringae pv tomato (Pst). |
| AT5G65630 | This gene is predicted to encode a bromodomain-containing protein. Plant lines expressing RNAi constructs targeted against GTE7 show some resistance to agrobacterium-mediated root transformation. |
| AT1G48520 | Encodes Glu-tRNA(Gln) amidotransferase subunit B (from Genbank record AF239836). |
| AT4G04970 | encodes a gene similar to callose synthase The mRNA is cell-to-cell mobile. |
| AT2G31960 | encodes a protein similar to callose synthase |
| AT3G14570 | encodes a protein similar to callose synthase |
| AT4G03550 | Encodes a callose synthase that is required for wound and papillary callose formation in response to fungal pathogens Erysiphe and Blumeria. Mutants are resistant to P. parasitica and exhibit an exaggerated PR1 response.Contributes to PAMP-induced basal defense. The mRNA is cell-to-cell mobile. |
| AT3G27160 | GHS1 encodes plastid ribosomal protein S21 The mRNA is cell-to-cell mobile. |
| AT3G27300 | glucose-6-phosphate dehydrogenase 5;(source:Araport11) |
| AT1G61800 | glucose6-Phosphate/phosphate transporter 2. Expression is upregulated in the shoot of cax1/cax3 mutant. The mRNA is cell-to-cell mobile. |
| AT5G25980 | Myrosinase (thioglucoside glucohydrolase) gene involved in glucosinoloate metabolism. The mRNA is cell-to-cell mobile. |
| AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
| AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT5G34940 | The protein is predicted (WoLF PSORT program) to be membrane-associated. |
| AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
| AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT1G65960 | glutamate decarboxylase (GAD2) The mRNA is cell-to-cell mobile. |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT5G48410 | member of Putative ligand-gated ion channel subunit family |
| AT2G24720 | member of Putative ligand-gated ion channel subunit family |
| AT2G24710 | member of Putative ligand-gated ion channel subunit family |
| AT5G11210 | member of Putative ligand-gated ion channel subunit family |
| AT2G29120 | member of Putative ligand-gated ion channel subunit family |
| AT2G29100 | member of Putative ligand-gated ion channel subunit family |
| AT1G42540 | member of Putative ligand-gated ion channel subunit family |
| AT5G04140 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression in leaves is induced by light and sucrose. Proposed to be involved in photorespiration and nitrogen assimilation. The mRNA is cell-to-cell mobile. |
| AT2G41220 | Encodes a gene whose sequence is similar to ferredoxin dependent glutamate synthase (Fd-GOGAT). Expression is most abundant in root. The mRNA is cell-to-cell mobile. |
| AT5G64050 | Glutamate-tRNA ligase. Targeted to mitochondria and chloroplast. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT3G48730 | glutamate-1-semialdehyde 2,1-aminomutase 2;(source:Araport11) |
| AT5G57685 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT2G24762 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
| AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
| AT5G37600 | encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
| AT3G17820 | encodes a cytosolic glutamine synthetase, the enzyme has low affinity with substrate ammonium The mRNA is cell-to-cell mobile. |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT5G40370 | Glutaredoxin family protein;(source:Araport11) |
| AT4G28730 | Encodes a glutaredoxin GrxC5. GrxC5 exists as two forms when expressed in Escherichia coli. The monomeric apoprotein possesses deglutathionylation activity mediating the recycling of plastidial methionine sulfoxide reductase B1 and peroxiredoxin IIE, whereas the dimeric holoprotein incorporates a [2Fe-2S] cluster. |
| AT2G31570 | glutathione peroxidase GPx |
| AT4G31870 | Encodes glutathione peroxidase. Role in the degradation of H2O2 to water using glutathione as electron donor. |
| AT4G02520 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
| AT2G29490 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G69920 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78370 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G17170 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). It is involved in the detoxification of the environmental pollutant 2,4,6-trinitrotoluene. Arabidopsis plants over-expressing At1g17170 were more resistant to TNT, removed more TNT from sterile and soil-based media, and had reduced levels of glutathione when grown in the presence of TNT. |
| AT2G29460 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). Role in the degradation of H2O2 to water using glutathione as electron donor |
| AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G02390 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. It functions in vitro as a maleylacetoacetate isomerase and is likely to be involved in tyrosine catabolism. |
| AT1G42970 | Encodes chloroplast localized glyceraldehyde-3-phosphate dehydrogenase that can use both NADH and NADPH to reduce 1,3-diphosphate glycerate. It forms A2B2 heterotetramers with GapA forms of the GADPH enzyme. These complexes are active in the light under reducing conditions, but show reduced NADPH-dependent activity in response to oxidized thioredoxins and increased NAD(H)/NADP(H) ratios due to the formation of inactive A8B8 hexadecamers. The mRNA is cell-to-cell mobile. |
| AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
| AT1G06520 | sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile. |
| AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
| AT3G11430 | sn-glycerol-3-phosphate 2-O-acyltransferas, involved in the biosynthesis of suberin polyester. |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT5G41080 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT5G43300 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
| AT2G05440 | GLYCINE RICH PROTEIN 9;(source:Araport11) |
| AT5G07510 | encodes a glycine-rich protein that is expressed in low abundance in stems and leaves, and very low abundance in flowers. |
| AT5G07520 | encodes a glycine-rich protein that is expressed only in flowers during a specific developmental stage (flower stage 12). |
| AT5G07550 | member of Oleosin-like protein family |
| AT5G07560 | Lipid-binding oleosins, glycine-rich protein. |
| AT2G05380 | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT3G20470 | encodes a glycine-rich protein that is expressed more abundantly in immature seed pods than in stems and leaves. Expression is not detected in roots or flowers. |
| AT3G14420 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. The mRNA is cell-to-cell mobile. |
| AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
| AT2G33470 | glycolipid transfer protein 1;(source:Araport11) |
| AT3G21260 | Glycolipid transfer protein (GLTP) family protein;(source:Araport11) |
| AT4G09740 | glycosyl hydrolase 9B14;(source:Araport11) |
| AT4G23560 | glycosyl hydrolase 9B15;(source:Araport11) |
| AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
| AT4G39010 | Cellulase involved in cell wall modification during valve dehiscence. |
| AT1G48930 | glycosyl hydrolase 9C1;(source:Araport11) |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
| AT1G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G08670 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT1G08280 | Encodes a glycosyltransferase (GT) GALT29A, which belongs to the Carbohydrate Active Enzyme family GT29. GALT29A co-expresses with other arabinogalactan GTs, GALT31A and GLCAT14A. The recombinant GALT29A expressed in Nicotiana benthamiana demonstrated a galactosyltransferase activity, transferring galactose from UDP-galactose to a mixture of various oligosaccharides derived from arabinogalactan proteins. |
| AT1G67290 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
| AT2G43430 | Encodes a predicted mitochondrial glyoxalase GLX2-1. Studies using recombinant protein show that GLX2-1 contains a dinuclear metal binding site, but does not have glyoxalase 2 activity. Required for abiotic stress but not for normal plant growth. |
| AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
| AT1G53580 | Mononuclear Fe(II)-containing member of the b-lactamase fold superfamily. ETHE1 is homodimeric in solution, exhibits low-level esterase activity, and specifically binds a single Fe(II) atom in the active site. |
| AT1G15380 | Glyoxalase which affects ABA?JA crosstalk. |
| AT1G80160 | Vicinal oxygen chelate (VOC) superfamily member. |
| AT1G17650 | Glyoxylate reductase located in chloroplasts. |
| AT5G14950 | Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans. |
| AT1G07290 | Encodes a GDP-mannose transporter. |
| AT1G76340 | Encodes a nucleotide-sugar transporter. It is is likely the primary Golgi GDP-L-galactose transporter, and provides GDP-L-galactose for RG-II biosynthesis. Knockout lines are lethal. RNAi suppressor lines were used for analysis. GDP-L-Galactose transport was affected. This process was required for pectic RG-II biosynthesis. |
| AT5G19980 | Encodes a Golgi-localized nucleotide-sugar transporter. |
| AT2G45200 | Encodes a member of the GOS1 (Golgi SNARE) gene family. |
| AT2G19950 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC1 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (558-715 aa) portion of the protein. |
| AT2G46180 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein. |
| AT1G79830 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC5 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (139 aa) portion of the protein. The C-terminal portion of the protein can also specifically interact with two members of the Rab family of GTPases (RabH1b and RabH1c). |
| AT3G02242 | root meristem growth factor-like protein;(source:Araport11) |
| AT4G27630 | Encodes a GPCR-type G protein receptor with nine predicted transmembrane domains. The protein binds abscisic acid (ABA) and is predicted to function as an ABA receptor. It has GTP-binding and GTPase activity and binds to ABA more effectively in the presence of GDP. GTG2 binds to GPA1, the alpha subunit of the heterotrimeric G protein. GPA1 (in its GTP-bound state) affects the GTP binding and GTPase activity of GTG2 and may act to down-regulate GTG2 binding to ABA. GTG2 is widely expressed throughout the plant and appears to be involved in the regulation of several ABA-dependent responses including seed germination, plant development, and promotion of stomatal closure. GTG2 transcript levels do not appear to change in response to ABA or abiotic stresses. |
| AT2G26890 | GRV2 has sequence similarity to the C. elegans protein RME-8 which is involved in endocytosis. grv2 mutants result in a reduction in gravitropic response in hypocotyls and shoots but do not affect root gravitropism. The mutants are defective in amyloplast sedimentation. |
| AT5G13370 | IBA - specific acyl acid amido synthetase which conjugates glutamine to IBA. It is involved in generating inactive and/or storage forms of IBA in the seedling, root, and silique. May play a role in auxin homeostasis by modulating the levels of IBA for peroxisomal conversion to IAA. |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT4G00850 | Arabidopsis thaliana GRF1-interacting factor 3 (GIF3) mRNA |
| AT1G53130 | Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space. |
| AT4G37740 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower |
| AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
| AT5G53660 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT4G24150 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in shoot and flower. |
| AT5G13190 | Encodes a plasma membrane localized LITAF domain protein that interacts with LSD1 and acts as a negative regulation of hypersensitive cell death. |
| AT1G33240 | Encodes a plant transcriptional activator that contains two separate, but similar, trihelix DNA-binding domains, similar to GT-2. Gene is expressed in all aerial parts of the plant, with higher level of expression in siliques. At-GTL2 was thought to be a duplicated copy of this gene but is likely to be a cloning artefact, the result of a chimeric clone. Regulates ploidy-dependent cell growth in trichome. |
| AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
| AT4G34460 | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. It seems to be involved in the calcium-mediated response to extracellular ATP. |
| AT5G64300 | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile. |
| AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT3G57550 | guanylate kinase |
| AT2G38840 | Guanylate-binding family protein;(source:Araport11) |
| AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
| AT5G57350 | member of Plasma membrane H+-ATPase family |
| AT3G47950 | mutant has Slight reduction in root and shoot growth; Exaggerated defects in salt stress; Plasma Membrane H+ ATPase |
| AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
| AT3G42640 | H[+]-ATPase 8;(source:Araport11) |
| AT1G80660 | H[+]-ATPase 9;(source:Araport11) |
| AT3G10520 | Encodes a class 2 non-symbiotic hemoglobin. Over-expression of AHb2 in seeds led to a 40% increase in the total fatty acid content of developing and mature seeds in three subsequent generations. This was mainly due to an increase in the poly-unsaturated C18:2 (omega-6) linoleic and C18:3 (omega-3) alpha-linolenic acids. |
| AT5G65710 | Encodes a protein controlling the separation step of floral organ abscission.Necessary for pathogen-triggered leaf abscission. |
| AT5G56250 | hapless 8;(source:Araport11) |
| AT1G09450 | Encodes a protein kinase that phosphorylates histone H3 at Thr3 and Thr11 and plays a role in mitotic cell division. |
| AT5G10010 | myosin-H heavy protein;(source:Araport11) |
| AT5G02500 | Encodes a member of heat shock protein 70 family. Hsc70-1 negatively regulates the expression of Hsp101 through HsfA1d, HsfA1e and HsfA2. During non-HS condition, Hsc70-1 attenuates the activity of HsfAs and finally affects the expression of HsfA2 and Hsp101 genes. hsc70-1 mutant showed thermotolerance phenotype due to higher expression of Hsp101 and other HS inducible genes. |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT4G15802 | Encodes a protein with similarity to heat shock factor binding proteins. Involved in negative regulation of heat shock response. Becomes nuclear localized upon heat treatment. |
| AT5G56030 | A member of heat shock protein 90 (HSP90) gene family. Expressed in all tissues and abundant in root apical meristem, pollen and tapetum. Expression is NOT heat-induced but induced by IAA and NaCl. Interacts with HsfA1d in the cytosol and the nucleus and negatively regulates HsfA1d. Did not bind to AtHsfA4c. The mRNA is cell-to-cell mobile. |
| AT5G56000 | HEAT SHOCK PROTEIN 81.4;(source:Araport11) |
| AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT3G22830 | member of Heat Stress Transcription Factor (Hsf) family |
| AT1G67970 | member of Heat Stress Transcription Factor (Hsf) family |
| AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
| AT1G32330 | Member of Heat Stress Transcription Factor (Hsf) family. Negatively regulated by HSP90.2. |
| AT3G02990 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
| AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
| AT5G17450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G22990 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G28660 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT2G35730 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT3G48970 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G03380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT5G27690 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G30473 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT4G37270 | Encodes a P1B-type ATPases that is localized to the chloroplast envelope and is involved in the transport of Cu into chloroplasts. It is essential for growth under high light conditions. |
| AT4G30110 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
| AT2G19110 | Encodes a protein with similarity to Zn ATPase. Can rescue Zn deficiency in yeast and Cd resistance, suggesting a role in Zn and Cd transport. The mRNA is cell-to-cell mobile. |
| AT5G09750 | Encodes a bHLH transcription factor that is involved in transmitting tract and stigma development. |
| AT2G30800 | Has RNA or DNA helicase activity and expressed specifically in tapetum and vascular tissue. First identified member of a new group of the mle helicase group of the DEAH family. |
| AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
| AT2G16060 | Encodes a class 1 nonsymbiotic hemoglobin induced by low oxygen levels with very high oxygen affinity. It is not likely to be a hemoglobin transporter because of its extremely high affinity for oxygen. Overexpression impairs cold stress-induced nitric oxide (NO) production. |
| AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
| AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
| AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
| AT3G45060 | member of High affinity nitrate transporter family |
| AT5G14570 | Encodes ATNRT2.7, a nitrate transporter that controls nitrate content in seeds. Expression is detected in reproductive organs and peaks in seeds. Localized to the vacuolar membrane. |
| AT2G21045 | Arsenate reductase. Contributes to QTL for arsenate tolerance. Col is resistant and Kas-1 represents sensitive strain. |
| AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
| AT1G48620 | This gene is predicted to encodes a histone H1/H5 family member. A plant line expressing an RNAi construct targeted against HON5 shows a reduced level of agrobacterium-mediated root transformation. |
| AT3G15150 | Encodes a SUMO E3 ligase that regulates endocycle onset and meristem maintenance. |
| AT1G60995 | ER localized protein involved in regulation of sterol metabolism. Regulates the accumulation of HMGR1 and HMGR2. HISE1 shares 50% amino acid sequence similarity (50% positive substitution) with the mouse ER membrane protein membralin (NP_001346561.1; PMID:31712757) |
| AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
| AT3G24430 | Encodes chloroplast protein HCF101 (high chlorophyll fluorescence 101). Serves as a chloroplast scaffold protein that specifically assembles [4Fe-4S] clusters and transfers them to the chloroplast membrane and soluble target proteins. |
| AT2G30470 | HSI2 is a member of the ABI3 family of B3 domain proteins and functions as an active repressor of the Spo minimal promoter through the EAR motif. It contains a plant-specific B3 DNA-binding domain. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50?M ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. HSI2 is also an epigenetic repressor as it also contains functional plant homeodomain-like (PHD-L) and zinc-finger Cys- and Trp-containing (CW) domains associated with epigenetic regulation. The PHD-L domain of HSI2 is connected to promoting trimethylation of Lys-27 on histone 3 (H3K27me3), while the CW domain can bind directly to H3K4me3. Through these domains, HSI2 represses the seed maturation program during seed germination by repressing transcription of the core LAFL (LEC1, ABI3, FUS3, and LEC2) seed developmental transcriptional regulators. In developing A. thaliana embryos, HSI2 suppresses expression of a large number of genes, many identified as targets of FUS3. However, the absence of HSI2 had no effect on transcript levels of the LAFL regulators and the levels of measured metabolites and phytohormones (ABA, auxin, and JA derivatives) in developing Arabidopsis embryos. HSI2 likely fine-tunes seed maturation by repressing genes involved in early embryogenesis that are not required later for seed maturation and desiccation. |
| AT5G59220 | Encodes a member of the PP2C family (Clade A protein phosphatases type 2C). Functions as a negative regulator of osmotic stress and ABA signaling. |
| AT1G07430 | Encodes a member of the group A protein phosphatase 2C (PP2C) family that is responsible for negatively regulating seed dormancy. |
| AT2G29380 | highly ABA-induced PP2C protein 3;(source:Araport11) |
| AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
| AT4G14910 | Encodes a protein that is predicted to act as a imidazoleglycerol-phosphate dehydratase involved in histidine biosynthesis |
| AT1G27320 | Encodes a histidine kinases, a cytokinin receptor that controls cytokinin-mediated leaf longevity through a specific phosphorylation of the response regulator, ARR2. The mRNA is cell-to-cell mobile. |
| AT5G10720 | member of Histidine Kinase |
| AT1G61270 | Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
| AT1G31160 | Encodes a member of the histidine triad nucleotide-binding family of proteins, but its activity has not been determined. |
| AT4G16566 | Encodes a protein that has an unexpected bifunctional capability in vitro. The purified enzyme has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) and ADP-sulfurylase activity (E.C. 2.7.7.5). The latter is activated at low pH. The enzyme can exert it phosphorylase activity on a range of related substrates in vitro, but it acts best with APS (adenosine 5'-phsophosulfate). This protein appears to function as a homodimer. |
| AT3G21510 | Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
| AT1G06760 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
| AT3G27360 | Histone superfamily protein;(source:Araport11) |
| AT1G67220 | histone acetyltransferase of the CBP family 2;(source:Araport11) |
| AT3G54610 | Encodes a histone acetyltransferase that plays a role in the determination of the embryonic root-shoot axis. It is also required to regulate the floral meristem activity by modulating the extent of expression of WUS and AG. In addition, it is involved in stem cuticular wax accumulation by modulating CER3 expression via H3K9/14 acetylation. In other eukaryotes, this protein is recruited to specific promoters by DNA binding transcription factors and is thought to promote transcription by acetylating the N-terminal tail of histone H3. The enzyme has indeed been shown to catalyse primarily the acetylation of H3 histone with only traces of H4 and H2A/B being acetylated. Non-acetylated H3 peptide or an H3 peptide that had been previously acetylated on K9 both serve as excellent substrates for HAG1-catalyzed acetylation. However, prior acetylation of H3 lysine 14 blocks radioactive acetylation of the peptide by HAG1. HAG1 is specific for histone H3 lysine 14. |
| AT5G56740 | Encodes an enzyme with histone acetyltransferase activity. Histone H4 is the primary substrate for the enzyme. Prior acetylation of lysine 12 of histone H4 reduces radioactive acetylation by HAG2. HAG2 acetylates histone H4 lysine 12. |
| AT5G22880 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases. |
| AT3G18520 | Encodes a protein with similarity to histone deacetylases. The histone deacetylase domain of HDA15 (HDA15HD) assembles as tetrameric forms with each monomer composed of 12 alpha-helices and 9 beta-sheets (DOI: 10.1104/pp.20.00604).Plants expressing RNAi directed against this gene show a moderate resistance to agrobacterium-mediated root transformation. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
| AT5G61060 | Encodes a member of the histone deacetylase family. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. |
| AT3G44680 | Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD. |
| AT5G35600 | Encodes a histone deacetylase that is crucial for female gametophyte development and embryogenesis. |
| AT4G27230 | Encodes HTA2, a histone H2A protein. |
| AT1G55250 | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
| AT2G44150 | Encodes a protein-lysine N-methyltransferase. Located in ER. |
| AT3G61890 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Loss of function mutant has abnormally shaped leaves and stems. |
| AT5G15150 | homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem. |
| AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
| AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
| AT4G32980 | Encodes transcription factor involved in photomorphogenesis. Regulates gibberellin biosynthesis. Activated by AGAMOUS in a cal-1, ap1-1 background. Expressed at low levels in developing stamens. Increased levels of ATH1 severely delay flowering in the C24 accession. Most remarkably, ectopically expressed ATH1 hardly had an effect on flowering time in the Col-0 and Ler accessions. ATH1 physically interacts with STM, BP and KNAT6 and enhances the shoot apical meristem defect of some of these genes suggesting a role in SAM maintenance. It acts to integrate light and hormone signaling to regulate internode elongation. Nuclear localization is dependent upon interaction with STM. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
| AT3G01220 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. Expressed during seed germination in the micropylar endosperm and in the root cap, and increases ABA sensitivity and seed dormancy when mutated. The mRNA is cell-to-cell mobile. |
| AT2G02540 | Zinc finger homeobox protein. Expressed in vascular tissue. In a yeast one hybrid system was not able to transactivate a reporter gene. |
| AT2G18550 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT4G24660 | homeobox protein 22;(source:Araport11) |
| AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
| AT5G65410 | Encodes ZFHD2, a member of the zinc finger homeodomain transcriptional factor family.Gain of function of ATHB25 (35S and UBQ10 proomoters) and double loss of function of ATHB25 and ATHB22 increases and decreases, respectively, seed longevity. This phenotype is maternal and related to seed coat alterations. Gain of function increases expression of GA3OX2 and GA4 and GA1 levels. Together with REM7 induces the expression of genes controlling shoot stem characteristics by ectopic expression in roots. |
| AT3G50890 | homeobox protein 28;(source:Araport11) |
| AT1G14440 | homeobox protein 31;(source:Araport11) |
| AT3G28920 | homeobox protein 34;(source:Araport11) |
| AT4G36740 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT2G22430 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein that is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis. |
| AT2G33880 | Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling. |
| AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
| AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
| AT3G60390 | Encodes homeobox protein HAT3. |
| AT1G17920 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with HDG11, it is involved in trichome branching. |
| AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT3G03260 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT3G22740 | homocysteine S-methyltransferase (HMT3) |
| AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
| AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
| AT4G29820 | Encodes a homolog of the protein CFI-25, a polyadenylation factor subunit. |
| AT1G56110 | NOP56-like protein |
| AT2G22450 | riboflavin biosynthesis protein;(source:Araport11) |
| AT5G64520 | Encodes a protein of the XRCC2 family involved in DNA repair. atxrcc2-1 Mutants are sensitive to MitomycinC but do not show fertility defects. |
| AT5G57450 | Involved in homologous recombination and recombinational repair, mutants are sterile, hypersensitive to DNA crosslinking agents, show aberrant meiosis with extensive chromosome fragmentation |
| AT5G41370 | Encodes XPB1, a DNA repair protein and transcription factor. Arabidopsis thaliana has duplicated XPB gene (AtXPB1 and AtXPB2, with high similarity to each other). XPB proteins are involved in both DNA repair and transcription, they are component of the transcription factor IIH (TFIIH) and are responsible for DNA helicase activity during nucleotide (nt) excision repair (NER). Complementation assays in yeast rad25 mutant strains suggest the involvement of AtXPB2 in DNA repair. Although both genes are expressed in a constitutive manner during the plant life cycle, Northern blot analyses suggest that light modulates the expression level of both XPB copies. The mRNA is cell-to-cell mobile. |
| AT3G56440 | yeast autophagy 18 D-like protein;(source:Araport11) |
| AT1G03380 | yeast autophagy 18 G-like protein;(source:Araport11) |
| AT1G65040 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
| AT4G31750 | Encodes HopW1-1-Interacting protein 2 (WIN2). Interacts with the P. syringae effector HopW1-1. WIN2 has protein phosphatase activity. Modulates plant defenses against bacteria. Three WIN proteins are identified so far (WIN1: AT1G80600; WIN2: AT4G31750; WIN3: AT5G13320). |
| AT1G25550 | Member of HHO/HRS GARP type transcriptional repressor family. Involved in Pi uptake and Pi starvation signaling. Transcriptional repressors that functions with other NIGT genes as an important hub in the nutrient signaling network associated with the acquisition and use of nitrogen and phosphorus. |
| AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
| AT5G10630 | Transcripts of this gene are alternatively spliced to encode either HBS1, a decoding factor translational GTPase, or SKI7, a component of the cytosolic RNA exosome. |
| AT5G08230 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT2G48160 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
| AT1G17560 | Encodes HUELLENLOS (HLL), a mitochondrial ribosome protein, similar to L14 ribosomal protein of eubacteria. HLL is essential for normal ovule development. |
| AT1G75700 | HVA22-like protein G;(source:Araport11) |
| AT1G19950 | HVA22-like protein H (ATHVA22H);(source:Araport11) |
| AT4G15440 | Encodes a hydroperoxide lyase. Also a member of the CYP74B cytochrome p450 family. In the ecotype Columbia (Col) the gene contains a 10-nucleotide deletion in its first exon that causes it to code for a truncated protein that results in a non-functional hydroperoxide lyase. |
| AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
| AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
| AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
| AT5G25265 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT2G25260 | Hyp O-arabinosyltransferase-like protein;(source:Araport11) |
| AT4G32120 | Encodes a hydroxyproline O-galactosyltransferase. |
| AT1G12550 | Encodes a hydroxypyruvate reductase that reduces HP to glycerate and shows even more activity with glyoxylate, a more upstream intermediate of the photorespiratory cycle. It is likely targeted to the chloroplast where it could provide a compensatory bypass for the reduction of HP and glyoxylate within this compartment. Together with HPPR2 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G72770 | mutant has ABA hypersensitive inhibition of seed germination; Protein Phosphatase 2C; regulates the activation of the Snf1-related kinase OST1 by abscisic acid. The mRNA is cell-to-cell mobile. |
| AT1G64960 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G67700 | multidrug resistance protein;(source:Araport11) |
| AT5G49230 | Identified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction. |
| AT5G62740 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
| AT3G21760 | Encodes HYR1, a UDP glycosyltransferase (UGT). HYR1 glucosylates hypostatin, an inhibitor of cell expansion in vivo to form a bioactive glucoside. |
| AT3G01100 | unknown protein, has cDNAs and ESTs associated to it |
| AT4G26670 | Member of PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Role in protein import into chloroplasts. |
| AT1G71750 | Encodes a protein with hypoxanthine-guanine-phosphoribosyltransferase activity. Unlike some related enzymes, it does not appear to act on xanthine in vitro. The enzyme catalyzes reactions occurring in both directions, but appears to prefer acting on guanine, followed by hypoxanthine, in vitro. The enzyme is likely to function in purine salvage pathways and appears to be important for seed germination. |
| AT5G66985 | hypothetical protein;(source:Araport11) |
| AT3G27770 | plant/protein;(source:Araport11) |
| AT1G33055 | hypothetical protein;(source:Araport11) |
| AT3G27220 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G03270 | HRU1 is a hypoxia induced universal stress protein. It exists as two splice variants with AT3G03270.2 , which contains a putative dimerization domain, the predominant transcript found under anoxia. It is induced by RAP2.12. Subcellular localization is dynamic; under anoxia the localization of HRU1 shifts from cytoplasm to the plasma membrane. |
| AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
| AT3G02875 | Hydrolyzes amino acid conjugates of the plant growth regulator indole-3-acetic acid (IAA), including IAA-Leu and IAA-Phe. Uses Mg and Co ions as cofactors. |
| AT5G54680 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G37560 | Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM. |
| AT3G06810 | Encodes a protein with similarity to acyl-CoA dehydrogenases. Mutations in IBR3 render plants resistant to indole-3-butryic acid, a putative storage form of the biologically active auxin IAA (indole-3-acetic acid). IBR3 is hypothesized to carry out the second step in a β-oxidation-like process of IBA metabolism in Arabidopsis. Though its subcellular location has not been determined, IBR3 has a peroxisomal targeting sequence and two other putative IBA metabolic enzymes (IBR1 and IBR10) can be found in this organelle. No specific enzymatic activity has been documented for IBR3, but double mutant analyses with CHY1 argue against a role for IBR3 in general fatty acid β-oxidation. The mRNA is cell-to-cell mobile. |
| AT2G43060 | ILI1 binding bHLH 1;(source:Araport11) |
| AT1G64790 | ILITHYIA (ILA) is a HEAT repeat protein involved in plant immunity. The gene is also involved in systemic acquired resistance induced by P. syringae expressing avrRps4. Loss-of-function mutants of ILA caused pleiotropic defects in the mutant plants. The mutant plants are smaller in size and the leaves are serrated and yellow to light green in color. Required for bacterium-triggered stomatal closure. |
| AT1G33900 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
| AT3G23900 | Physically interacts with, and promotes canonical splicing of, transcripts encoding defense signaling proteins, including the key negative regulator of pattern recognition receptor signaling complexes, CALCIUM-DEPENDENT PROTEIN KINASE 28 (CPK28). Upon immune activation by Plant Elicitor Peptides (Peps), IRR is dephosphorylated, disrupting interaction with CPK28 transcripts and resulting in accumulation of an alternative splice variant encoding a truncated CPK28 protein with impaired kinase activity and diminished function as a negative regulator. |
| AT5G49310 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT5G03070 | Putative importin alpha isoform. When overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT1G54840 | Encodes an atypical member of the sHSP20 family that is involved in histone demethylation. Loss of function mutations show increased methylation. IMD2 co-localizes to the nucleus with, and physically interacts with, IMD1, a protein involved in RNA directed DNA methylation. IMD2 contains an alpha crystallin domain , that is required for its function. |
| AT5G65040 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
| AT3G13810 | indeterminate(ID)-domain 11;(source:Araport11) |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT1G55110 | indeterminate(ID)-domain 7;(source:Araport11) |
| AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
| AT1G80390 | Member of a multigene family of Auxin responsive genes. |
| AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT2G01200 | Belongs to auxin inducible gene family. |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
| AT4G14430 | Encodes a peroxisomal delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation. This enzyme might also be involved in the conversion of indole-3-butyric acid to indole-3-acetic acid via a beta-oxidation-like pathway. |
| AT1G04100 | Auxin induced gene, IAA10 (IAA10). |
| AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
| AT5G64667 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT5G48820 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
| AT2G46470 | inner membrane protein OXA1-like protein;(source:Araport11) |
| AT1G23420 | Essential for formation and asymmetric growth of the ovule outer integument. Member of the YABBY protein family of putative transcription factors that contain apparent Cys(2)-Cys(2) zinc-finger domains and regions of similarity to the high mobility group (HMG) transcription factors. INO may be required for polarity determination in the central part of the ovule. |
| AT2G43980 | inositol 1,3,4-trisphosphate 5/6-kinase 4;(source:Araport11) |
| AT1G30220 | Inositol transporter presenting conserved extracellular loop domains homologs of plexins/semaphorin/integrin (PSI) domains from animal type I receptors. |
| AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
| AT2G31830 | Encodes a 5-inositol-polyphosphate phosphatase, that, in vitro, shows some activity against Ins(1,4,5)P3 and PI(3,4,5)P3, but even higher activity against PI(4,5)P2 |
| AT1G17140 | Encodes a ROP/RAC effector, designated interactor of constitutive active ROPs 1 (ICR1), that interacts with GTP-bound ROPs. ICR1 is a scaffold mediating formation of protein complexes that are required for cell polarity. ICR1 is comprised of coiled-coil domains and forms complexes with itself and the exocyst vesicle-tethering complex subunit SEC3. |
| AT1G48280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family. |
| AT3G49380 | Member of IQ67 (CaM binding) domain containing family. |
| AT5G07240 | Member of IQ67 (CaM binding) domain containing family. |
| AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G14380 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT1G18840 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT5G03570 | Encodes FPN2, a tonoplast localized nickel transport protein. FPN2 is one of the Arabidopsis orthologs (AT2G38460/IREG1/FPN1 and AT5G03570/IREG2/FPN2) the iron efflux transporter ferroportin (FPN) identified in animals. |
| AT4G19540 | Encodes a iron-suflur protein required for NADH dehydrogenase. |
| AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
| AT1G27600 | Encodes a member of the GT43 family glycosyltransferases involved in glucuronoxylan biosynthesis: AT2G37090 (IRX9) and AT1G27600 (IRX9-L or I9H, IRX9 homolog); AT4G36890 (IRX14) and AT5G67230 (IRX14-L or I14H, IRX14 homolog). They form two functionally non-redundant groups essential for the normal elongation of glucuronoxylan backbone. I9H functions redundantly with IRX9, I14H is redundant with IRX14. IRX9 or I9H do not complement IRX14, IRX14 or I14H do not complement IRX9. |
| AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
| AT4G09020 | Encodes an isoamylase-like protein. Mutant studies show that the gene is strongly involved in starch breakdown. A GUS-protein fusion product was shown to localize to the surface of chloroplastic structures reminiscent of starch granules. In the mutants, the chloroplastic α-amylase AMY3 is upregulated. The mRNA is cell-to-cell mobile. |
| AT2G17130 | Encodes a regulatory subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. |
| AT5G03290 | Encodes a catalytic subunit of the mitochondrially-localized NAD+- dependent isocitrate dehydrogenase. The mRNA is cell-to-cell mobile. |
| AT3G21720 | Encodes a glyoxylate cycle enzyme isocitrate lyase (ICL) involved in salt tolerance. |
| AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
| AT3G02780 | Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that it functions in the mevalonate, but not the MEP biosynthetic pathway. |
| AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT2G43090 | One of three genes encoding the small subunit of isopropylmalate isomerase, a heterodimer consisting of a large and a small subunit. A function in both leucine biosynthesis and the first cycle of Met chain elongation has been demonstrated for this subunit. The mRNA is cell-to-cell mobile. |
| AT3G45300 | Encodes isovaleryl-coenzyme a dehydrogenase. Mutants have increases in 12 seed free amino acids, accumulation of seed homomethionine and 3-isovaleroyloxypropyl-glucosinolate, with a concomitant decrease in seed 3-benzoyloxypropyl-glucosinolate. The mRNA is cell-to-cell mobile. |
| AT1G34220 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT2G14830 | Ist1p;(source:Araport11) |
| AT3G16450 | Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
| AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
| AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
| AT5G05600 | Encodes a protein with similarity to flavonol synthases that is involved in the detoxifcation polycyclic aromatic hydrocarbons.One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
| AT5G10650 | JUL1 encode a RING-type E3 ubiquitin ligase that is involved in JA responses. It ubiquitinates the JAV1 jasmonic acid response repressor which is then degraded by the proteosome. Participates in ABA-mediated microtubule depolymerization, stomatal closure, and tolerance response to drought stress. |
| AT2G26490 | JGB contains seven WD40 repeats and is highly conserved in flowering plants. Overexpression inhibits pollen germination. suggesting JGB is a negative regulator of pollen germination |
| AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
| AT1G30810 | JMJ18 encodes a novel JmjC domain- containing histone H3K4 demethylase. PHD finger-containing protein. |
| AT1G31120 | potassium transporter |
| AT2G35060 | potassium transporter |
| AT1G32240 | Encodes a member of the KANADI family of putative transcription factors. Together with KAN1, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN1 and KAN4 appears to regulate the proper localization of PIN1 in early embryogenesis. |
| AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT4G37470 | HTL belonging to the alpha/beta fold hydrolase superfamily. Mutant and over-expression studies indicates its involvement in seedling de-etiolation process. Involved in the perception of karrikins. Interacts with MAX2. Important for cotyledon expansion. |
| AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
| AT4G01575 | Encodes a putative Kazal-type serine proteinase inhibitor that is highly expressed in seeds, mature roots and flowers. |
| AT3G52890 | KCBP-interacting protein kinase interacts specifically with the tail region of KCBP |
| AT5G03770 | Encodes a putative KDO (3-deoxy-D-manno-octulosonate) transferase |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT1G12360 | encodes a Sec1 protein and expressed throughout the plant. physically interacts with Syntaxin1 and is required for cytokinesis. |
| AT4G14950 | KMS1 encode a endoplasmic reticulum protein involved in the early secretory pathway. |
| AT4G32250 | Encodes a component of the TOC machinery that phosphorylates import receptors, supports pre-protein import, and contributes to efficient chloroplast biogenesis. |
| AT4G27180 | kinesin heavy chain subunit |
| AT5G54670 | Encodes a truncated KatC polypeptide (KatC(207-754)), which includes the carboxyl-terminal region of KatC. This was expressed in Escherichia coli and was shown to possess microtubule-stimulated ATPase activity. |
| AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT1G27500 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G03730 | Member of a family of proteins containing an F-box domain at the N-terminal region and three kelch repeats at the C-terminal region. Involved in BR signaling. Co-suppressed KIB1,2,3,4 lines have a dwarf phenotype and resemble BR receptor mutants. |
| AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
| AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
| AT1G70510 | A member of class I knotted1-like homeobox gene family (together with KNAT1). Similar to the knotted1 (kn1) homeobox gene of maize. KNAT2 acts synergistically with cytokinins and antagonistically with ethylene based on ectopic expression studies in different mutant backgrounds and hormone treatments. In addition, KNAT2 is negatively regulated by AS and YABBY genes. KNAT2 is strongly expressed in the shoot apex of seedlings, while in mature plants the gene is primarily expressed in flowers and inflorescence stems. |
| AT5G25220 | A member of class II knotted1-like homeobox gene family (together with KNAT4 and KNAT5). Expressed in: hypocotyl-root boundary, anther-filament junction in flowers, ovule-funiculus and peduncle-silique boundaries, petioles and root. Light-regulated expression with differential response to red/far-red light. KNAT3 promoter activity showed cell-type specific pattern along longitudinal root axis, restricted mainly to the differentiation zone of the root, namely in the cortex and pericycle. Not detected in lateral root primordia |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT1G23380 | homeodomain transcription factor KNAT6, belonging to class I of KN transcription factor family (which also includes KNAT1 and KNAT2). Expression is increased in as and bop1 leaf mutants. |
| AT5G14010 | Encodes KNUCKLES (KNU), a C2H2-type zinc finger protein with a conserved transcriptional repression motif. Mediates the repression of WUS in floral meristem determinacy control. |
| AT3G08550 | mutant is Dwarfed and shows defects in cell elongation; Cellulose deficient; Plasma Membrane Protein |
| AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT1G73260 | Encodes a trypsin inhibitor involved in modulating programmed cell death in plant-pathogen interactions. |
| AT1G60370 | KUK F-box domain protein. Natural variants are associated with GWAS trait for root meristem and cell length. Polymorphisms in the coding sequence are the major causes of KUK allele? dependent natural variation in root development. |
| AT5G56470 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT2G46760 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
| AT3G10050 | first enzyme in the biosynthetic pathway of isoleucine |
| AT4G02420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G55830 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT3G08870 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT4G28350 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
| AT5G03260 | LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G29130 | Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency. |
| AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
| AT3G45130 | lanosterol synthase 1;(source:Araport11) |
| AT1G18850 | PCP2 encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1. |
| AT2G03740 | Late embryogenesis abundant protein. Associates with and stabilizes membranes as part of cryoprotective response. |
| AT1G01470 | Encodes late-embryogenesis abundant protein whose mRNA levels are induced in response to wounding and light stress. Might be involved in protection against desiccation. |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT1G52690 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT5G63090 | Involved in lateral organ development |
| AT3G58190 | This gene contains two auxin-responsive element (AuxRE). Required for triggering cell reprogramming during callus formation. |
| AT2G39230 | Encodes a pentatricopeptide protein (LOJ) that is specifically expressed in lateral organ junctions. |
| AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
| AT5G44870 | Encodes LAZ5, a TIR-class NB-LRR R protein of unknown pathogen specificity with sequence similarity to RPS4, an R protein conferring resistance to Pseudomonas syringae expressing the effector AvrRPS4. Overexpression of LAZ5 results in hypersensitive cell death (plants did not survive to set seeds). |
| AT2G47780 | Encodes a small rubber particle protein homolog. Plays dual roles as positive factors for tissue growth and development and in drought stress responses. |
| AT3G22990 | Armadillo-repeat containing protein. Involved in leaf and flower development. Located in nucleus. Broadly expressed throughout vegetative and floral tissues. LFR is functionally associated with AS2 to mediate leaf development. |
| AT1G27340 | Encodes a putative F-box protein that is involved in the regulation of leaf morphology. |
| AT1G18390 | Serine/Threonine kinase family catalytic domain protein;(source:Araport11) |
| AT1G25390 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G61850 | Encodes transcriptional regulator that promotes the transition to flowering.Involved in floral meristem development. LFY is involved in the regulation of AP3 expression, and appears to bring the F-box protein UFO to the AP3 promoter. Amino acids 46-120 define a protein domain that mediates self-interaction. |
| AT5G51410 | LUC7 N terminus domain-containing protein;(source:Araport11) |
| AT3G14460 | Leucine rich repeat protein that also contains an adenylate cyclase catalytic core motif. Capable of converting ATP to cAMP in vitro. Mutants show increased susceptibility to fungal pathogens. |
| AT4G18670 | Leucine rich extensin protein involved in cell wall biogenesis and organization. Interacts with several members of the RALF family of ligand peptides. |
| AT2G15880 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT4G00830 | Encodes a heterogeneous nuclear ribonucleoprotein (hnRNP-Q) that is involved in the plant innate immune response and may function as a suppressor of cell-autonomous immunity. |
| AT1G03070 | Bax inhibitor-1 family protein;(source:Araport11) |
| AT4G10340 | photosystem II encoding the light-harvesting chlorophyll a/b binding protein CP26 of the antenna system of the photosynthetic apparatus The mRNA is cell-to-cell mobile. |
| AT2G31160 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT3G23290 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT5G58500 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT5G28490 | Encodes a nuclear protein that mediates light regulation of seedling development in a phytochrome-dependent manner. |
| AT2G34430 | Photosystem II type I chlorophyll a/b-binding protein The mRNA is cell-to-cell mobile. |
| AT1G43130 | like COV 2;(source:Araport11) |
| AT3G18220 | Phosphatidic acid phosphatase (PAP2) family protein;(source:Araport11) |
| AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT5G66450 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon2) and LPPepsilon1, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
| AT3G51590 | Encodes a member of the lipid transfer protein family. Proteins of this family are generally small (~9 kD), basic, expressed abundantly and contain eight Cys residues. The proteins can bind fatty acids and acylCoA esters and can transfer several different phospholipids. They are localized to the cell wall. The LTP12 promoter is active exclusively in the tapetum during the uninucleate microspore and bicellular pollen stages. Predicted to be a member of PR-14 pathogenesis-related protein family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G51600 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G17240 | lipoamide dehydrogenase precursor |
| AT1G55020 | lipoxygenase, a defense gene conferring resistance Xanthomonas campestris The mRNA is cell-to-cell mobile. |
| AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile. |
| AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT1G68790 | Member of small gene family in Arabidopsis containing 4 members (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
| AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
| AT3G52770 | ZPR3 is a small-leucine zipper containing protein that is involved in the establishment of leaf polarity. |
| AT2G36307 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT2G24260 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT4G30980 | Encodes a basic helix-loop-helix (bHLH) protein that regulates root hair and sperm cell development. One of the three Arabidopsis homologs of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) gene: At2g24260 (AtLRL1), At4g30980 (AtLRL2), and At5g58010 (AtLRL3). |
| AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
| AT2G28500 | LOB domain-containing protein 11;(source:Araport11) |
| AT2G45420 | LOB domain-containing protein 18;(source:Araport11) |
| AT3G03760 | LOB domain-containing protein 20;(source:Araport11) |
| AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
| AT5G06080 | LOB domain-containing protein 33;(source:Araport11) |
| AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
| AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
| AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
| AT5G26860 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. The mRNA is cell-to-cell mobile. |
| AT3G05780 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT2G35990 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT5G11950 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At2G37210. |
| AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
| AT5G23670 | Encodes the LCB2 subunit of serine palmitoyltransferase, an enzyme involved in sphingosine biosynthesis. The protein is localized to the endoplasmic reticulum. |
| AT1G02340 | Encodes a light-inducible, nuclear bHLH protein involved in phytochrome signaling. Mutants exhibit a long-hypocotyl phenotype only under far-red light but not under red light and are defective in other phytochrome A-related responses. Mutants also show blue light response defects. HFR1 interacts with COP1, co-localizes to the nuclear specks and is ubiquinated by COP1. |
| AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
| AT2G47240 | Encodes an acyl-CoA synthetase that acts on long-chain and very-long-chain fatty acids, involved in cuticular wax and cutin biosynthesis The mRNA is cell-to-cell mobile. |
| AT4G23850 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT5G27600 | Encode peroxisomal long-chain acyl-CoA synthetase. Activates fatty acids for further metabolism. Interacts with PEX5. |
| AT1G55540 | Nuclear pore complex protein;(source:Araport11) |
| AT2G30575 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
| AT1G50120 | Encodes a Golgi-localized protein which regulates pollen tube growth. Required for TGN formation and Golgi structure maintenance. |
| AT4G14850 | Encodes a pentatricopeptide (PPR) protein that binds single-stranded RNA. The N-terminal portion of the protein can localize to the mitochondria. Mutations in this gene make plants less sensitive to inhibitors of the MEP and MVA pathways of isoprenoid biosynthesis and increase the activity of HMG CoA reductase. |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT5G51545 | Encodes LPA2 (low psii accumulation2), an intrinsic thylakoid membrane protein required for efficient assembly of Photosystem II. |
| AT3G50970 | Belongs to the dehydrin protein family, which contains highly conserved stretches of 7-17 residues that are repetitively scattered in their sequences, the K-, S-, Y- and lysine rich segments. LTI29 and LTI30 double overexpressors confer freeze tolerance. Located in membranes. mRNA upregulated by water deprivation and abscisic acid. The mRNA is cell-to-cell mobile. |
| AT4G19038 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G11760 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G43505 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28405 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G25265 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G06985 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
| AT3G61182 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G20993 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G42242 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G47077 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30064 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G54225 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT4G35760 | Encodes a bimodular enzyme comprising an integral domain homologous to the catalytic subunit of mammalian vitamin K epoxide reductase (VKORC1, EC 1.1.4.1) that is fused to a soluble thioredoxin-like moiety. Using yeast microsomes as a recombinant system, it was shown that the VKORC1 domain of At4g35760 functions as a stringent naphthoquinone reductase, and that its reduced Trx-like partner can serve as its electron donor. Located in plastid. Required for the assembly of photosystem II. Can catalyze disulfide bond formation in vitro. |
| AT4G02560 | Encodes a nuclear localized protein with similarity to transcriptional regulators. Recessive mutants are late flowering. Expression of LFY is reduced in LD mutants. LD has been reported to exhibit prion like behavior in yeast but it remains to be determined if such activity exists during normal plant development. |
| AT1G78970 | Lupeol synthase. Converts oxidosqualene to multiple triterpene alcohols and a triterpene diols. This conversion proceeds through the formation of a 17β-dammarenyl cation. |
| AT1G78960 | Encodes a multifunctional 2-3-oxidosqualene (OS)-triterpene cyclase that can cyclize OS into lupeol, alpha- and beta-amyrin. |
| AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
| AT5G40780 | Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. |
| AT1G24400 | High-affinity transporter for neutral and acidic amino acids, expressed in tapetum tissue of anthers. Transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
| AT1G14030 | Encodes a lysine methyltransferase whose main soluble physiological substrates are chloroplastic fructose 1,6-bisphosphate aldolases, FBA1, FBA2, and FBA3. Lysines near the C-terminal end of the target proteins are trimethylated. |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
| AT2G33580 | Encodes a putative LysM-containing receptor-like kinase. LYK5 is a major chitin receptor and forms a chitin-induced complex with related kinase CERK1. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
| AT3G57650 | Encodes an endoplasmic reticulum localized protein with lysophosphatidyl acyltransferase activity. |
| AT1G12640 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. |
| AT3G11710 | lysyl-tRNA synthetase 1;(source:Araport11) |
| AT5G50850 | Transketolase family protein;(source:Araport11) |
| AT4G15570 | Similar to yeast Sen1 (splicing endonuclease 1)helicase protein. Involved in female gametophyte development. The mRNA is cell-to-cell mobile. |
| AT4G28580 | Transmembrane magnesium transporter that induces Mg transport from tapetum cell to locule. One of nine family members. Functions in pollen development. |
| AT2G03620 | Transmembrane magnesium transporter. One of nine family members. |
| AT4G25080 | Encodes a protein with methyltransferase activity responsible for the methylation of magnesium protoporphyrin IX. Mutants defective in this gene are affected in chlorophyll biosynthesis and show a reduction in the accumulation of a number of major thylakoid-associated proteins including components of PSI (LHCI), PSII (LHCII, D1, CP43) and the cytochrome b6f complex (Cytf). By contrast, no significant changes were detected for the proteins of the stroma and the chloroplast envelope. |
| AT1G03840 | MGP is a nuclear-localized putative transcription factor with three zinc finger domains. MGP can interact with three proteins implicated in root patterning: SCR, SHR, and JKD in Y2H assays, and these interactions depend on the first zinc finger in MGP. MGP appears to be a direct transcriptional target of SHR and SCR, based on promoter binding assays, though it is not expressed in the QC, based on in situ hybridizations. |
| AT2G25010 | Encodes a nuclear localized aminotransferase like protein containing a plant mobile domain. MAIL1 is expressed in the root, SAM, leaves, flowers and embryo. Loss of function mutations display defects in root and shoot growth. In the root, primary root growth terminates early. In the shoot, leaf development is delayed, and lateral organs are smaller than normal. MAIL1 appears to affect meristem cell division and cell fate. Biochemical analysis of the mutants also demonstrates silencing defects. Based on epistasis analysis, this MAIN1 acts in a different pathway than DNA methylation, and siRNA and in the same pathway as MAIL1 and PP7L. |
| AT2G04865 | Encodes a nuclear localized aminotransferase-like protein containing a plant mobile domain. The mRNA is cell-to-cell mobile. |
| AT1G17930 | Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing. |
| AT5G07020 | Encodes an integral thylakoid membrane protein that interacts with PSII core complexes and contributes to the maintenance of PSII homeostasis upon exposure to photoinhibitory light conditions by participating in the protection and stabilization of PSII under photoinhibitory stress. |
| AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G47520 | Encodes a protein with NAD-dependent malate dehydrogenase activity, located in chloroplasts. The mRNA is cell-to-cell mobile. |
| AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
| AT4G20900 | Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein. |
| AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
| AT1G73670 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
| AT3G18040 | Encodes a protein with similarity to MAP kinases (MAPK9).Expressed preferentially in guard cells and appears to be involved in reactive oxygen species mediated ABA signaling. |
| AT3G21220 | Encodes a mitogen-activated kinase kinase, dual specific protein kinase that is expressed in vegetative tissues and floral buds. Involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK4. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggesting a role for both proteins in mediating floral organ abscission.MKK5 is part of a positive feedback loop that regulates HAE expression in floral receptacles. |
| AT3G06230 | member of MAP Kinase Kinase |
| AT4G08500 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. Mediates cold, salt, cadmium and wounding stress signalling. Phosphorylates MEK1. |
| AT4G08470 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002, 7(7):301. |
| AT2G41970 | Encodes MRI, a plasma membrane-localized member of the RLCK-VIII subfamily. Preferentially expressed in both pollen tubes and root hairs. mri-knockout mutants display spontaneous pollen tube and root-hair bursting. |
| AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
| AT2G02955 | maternal effect embryo arrest 12;(source:Araport11) |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34090 | maternal effect embryo arrest 18;(source:Araport11) |
| AT2G34570 | PIN domain-like family protein;(source:Araport11) |
| AT2G34870 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT2G34880 | JMJ15 is a novel H3K4 demethylase that regulates genes involved in flowering and response to stress. It is also a maternally expressed, imprinted gene. |
| AT4G00060 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT4G14080 | Involved in the formation of the pollen wall. DYT1 and bHLH089 specifically recognize the TCATGTGC box to activate expression. |
| AT4G04040 | Encodes a pyrophosphate-dependent phosphofructokinase B subunit (PFPbeta2). |
| AT4G13345 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G02240 | F-box family protein;(source:Araport11) |
| AT1G25310 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
| AT3G19350 | Encodes a the C-terminal domain of poly(A) binding proteins. MPC is imprinted such that only the maternal allele is expressed in the endosperm. MPC is silenced by the action of MET1 and its expression is promoted by DEM. |
| AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
| AT1G78610 | mechanosensitive channel of small conductance-like 6;(source:Araport11) |
| AT3G01435 | Expressed protein;(source:Araport11) |
| AT5G19480 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT3G63210 | encodes a novel zinc-finger protein with a proline-rich N-terminus, identical to senescence-associated protein SAG102 |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39020 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT5G39030 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT4G32450 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G37140 | Amember of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. MCT1 expression is increased in the presence of ABA and RNAi suppression showed increased germination rates in the presence of ABA. |
| AT4G18120 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML3 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML3 is the transcript with highest frequency of alternative splicing. Expression was detected during early embryo development (heart and torpedo stage); no accumulation was detected in vegetative and floral apices, as revealed by in situ hybridization. |
| AT5G61960 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML1 is a member of two sister clades of mei2-like gene family, AML1 through AML5 and belongs to the clade named ALM14. AML1 is expressed during early embryo development, particularly along embryonic axis at torpedo stage, in shoot apex (weaker expression) and in the organogenic regions of floral apices. |
| AT1G60460 | Encodes a structural homolog of the archaeal topo VIB subunit that forms a complex with the two Arabidopsis thaliana SPO11 orthologs required for meiotic DSB formation (SPO11-1 and SPO11-2) and is essential for meiotic DSB formation. |
| AT4G27860 | vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT4G22270 | Encodes a plasma membrane protein involved in the positive regulation of organ size development. Overexpression results in organ size enlargement. |
| AT3G01050 | membrane-anchored ubiquitin-fold protein 1 precursor;(source:Araport11) |
| AT5G15460 | membrane-anchored ubiquitin-fold protein 2;(source:Araport11) |
| AT1G64080 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT2G37380 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT4G14965 | membrane-associated progesterone binding protein 4;(source:Araport11) |
| AT5G50440 | Member of Membrin Gene Family. Encodes a Golgi-localized SNARE protein MEMB12. MEMB12 is a target of miR393b-mediated gene silencing during Pseudomonas syringae pv. Tomato infection. Loss of function of MEMB12 leads to increased exocytosis of an antimicrobial pathogenesis-related protein, PR1. |
| AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
| AT4G28590 | Encodes a dual-targeted nuclear/plastidial phytochrome signaling component required for PEP assembly. It controls PhAPG expression primarily from the nucleus by interacting with phytochromes and promoting their localization to photobodies for the degradation of the transcriptional regulators PIF1 and PIF3. RCB-dependent PIF degradation in the nucleus signals the plastids for PEP assembly and PhAPG expression. |
| AT4G25110 | Encodes a type I metacaspase. Two Arabidopsis metacaspases, AT1G02170 (MC1) and AT4G25110 (MC2) antagonistically control programmed cell death in Arabidopsis. MC1 is a positive regulator of cell death and requires conserved caspase-like putative catalytic residues for its function. MC2 negatively regulates cell death. This function is independent of the putative catalytic residues. A third type I Arabidopsis metacaspase is MC3 (AT5g64240). |
| AT1G79340 | Encodes MCP2d, the predominant and constitutively expressed member of type II metacaspases (MCPs). MCP2d plays a positive regulatory role in biotic and abiotic stress-induced programmed cell death (PCD). Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. The mRNA is cell-to-cell mobile. |
| AT1G16420 | Encodes a metacaspase (cysteine-type endopeptidase) that is involved in promoting programmed cell death in response to hydrogen peroxide (H2O2), UV light, and methyl viologen (MV). Transcript levels rise in response to UV-C, H2O2, and MV. In vitro assays demonstrate that this enzyme has a preference for cleaving after an arginine residue, and it has a pH optimum of 8.0. |
| AT3G09390 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage |
| AT2G45240 | Encodes a cytoplasmic MAP1 like methionine aminopeptidase which is involved in removing the N-terminal methionine from proteins. Induced mutants using RNAi technology which knocks out both MAP1 and MAP2 like genes show abnormal development. |
| AT4G37040 | encodes a methionine aminopeptidase |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT1G33990 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
| AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
| AT4G16690 | Encodes a protein shown to have carboxylesterase activity, methyl IAA esterase activity, and methyl jasmonate esterase activity in vitro. This protein does not act on MeSA, MeGA4, or MEGA9 in vitro. Although MES16 is similar to MES17, a MeIAA hydrolase, two mes16 mutant lines (SALK_151578) and (SALK_139756) do not show altered sensitivity to MeIAA in root growth assays. MES16 transcripts appear to be more than 10-fold less abundant than those of MES17 in roots. |
| AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
| AT1G15340 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
| AT5G52230 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G23010 | Encodes a methylthioalkylmalate synthase, catalyzes the condensation reactions of the first two rounds of methionine chain elongation in the biosynthesis of methionine-derived glucosinolates. The mRNA is cell-to-cell mobile. |
| AT1G18500 | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). The mRNA is cell-to-cell mobile. |
| AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
| AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
| AT1G66795 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC |
| AT3G18217 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC. Pri-mRNA coordinates for MIR157c (converted to TAIR10 based on PMID19304749): Chr3: 6244826-6243830 (reverse), length: 997 bp; exon coordinates: exon 1: 6244826 to 6244347, exon 2: 6244115 to 6243830; mature miRNA and miRNA* are located on exon 1. |
| AT2G47585 | Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA. The miR164a pri-mRNA also encodes a regulatory peptide miPEP164a (AT2G47584) that regulates accumulation of its own miRNA. |
| AT5G27807 | Encodes a microRNA that targets several genes containing NAC domains including NAC1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCG. Early extra petal mutant (eep1). Pri-mRNA coordinates for MIR164c (converted to TAIR10 based on PMID19304749): Chr5: 9852483-9853314 (forward), length: 832 bp; exon coordinates: exon 1: 9852483-9853314; mature miRNA and miRNA* are located on exon 1. |
| AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
| AT3G22886 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. Essential for fertility of both ovules and anthers. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAAGCUGCCAGCAUGAUCUA. Pri-mRNA coordinates for MIR167a (converted to TAIR10 based on PMID19304749): Chr3: 8108021-8108622 (forward), length: 602 bp; exon coordinates: exon 1: 8108021 to 8108622; mature miRNA and miRNA* are located on exon 1. |
| AT3G63375 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUA |
| AT3G04765 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAAGCUGCCAGCAUGAUCUUG |
| AT1G31173 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUGG |
| AT5G66045 | Encodes a microRNA that targets several SCL family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAUUGAGCCGUGUCAAUAUC |
| AT3G23125 | Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC |
| AT5G58465 | Encodes a microRNA that targets the TAS3 family of tasiRNA-generating transcripts. Cleavage of TAS3 transcripts by miR390 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AAGCUCAGGAGGGAUAGCGCC |
| AT1G76135 | Encodes a microRNA that targets one member of the F-box family. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGCAUUCUGUCCACCUCC. It targets F-box protein AT1g27340. It is involved in the regulation of leaf morphology. |
| AT1G69792 | Encodes a microRNA that targets both APS and AST family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CUGAAGUGUUUGGGGGAACUC. Predicted targets are ATP sulfurylases. |
| AT1G69797 | Encodes a microRNA that targets both APS and AST family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: CUGAAGUGUUUGGGGGGACUC. Predicted targets are ATP sulfurylases. |
| AT5G62162 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAGUUGCCCUG |
| AT1G32582 | Encodes a microRNA of unknown function that is predicted to target PPR family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAUGAGAGUAUUAUAAGUCAC |
| AT2G47015 | Encodes a microRNA that targets both a Laccase and Plantacyanin-like family member. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AUGCACUGCCUCUUCCCUGGC |
| AT3G18895 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAATGTGATGATGAACTGACC |
| AT1G12294 | Encodes a microRNA that targets several CC-NBS-LRR family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUUUCCUACUCCGCCCAUAC |
| AT4G24415 | Encodes a microRNA that targets AGL16. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCAUUUGUGAGAAGGGA |
| AT1G78478 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAGACCGAUGUCAACAAACAAG |
| AT4G23387 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CGGCUCUGAUACCAAUUGAUG |
| AT4G13493 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UAAGAUCCGGACUACAACAAAG |
| AT3G53016 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUCGGUUCGCGAUCCACAAG |
| AT4G14504 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AAGAUAAGCGCCUUAGUUCUGA |
| AT1G23060 | hypothetical protein;(source:Araport11) |
| AT5G44610 | Encodes a protein with seven repeated VEEKK motifs. RNAi and overexpression experiments suggest that the gene is not involved in cell division but might be consequential for cell shape of epidermal and cortical cells. The protein encoded by this gene binds to cortical microtubules and inhibits tubulin polymerization. Associates to the plasma membrane and interacts with calmodulin and phosphatidylinositol phosphates, indicating an involvement in cellular signal transduction. Expression is enhanced by abiotic and hormonal factors. Induced during senescence.Interacts with Ca2+/calmodulin complex, phosphatidylinositol phosphates, and free Ca2+. |
| AT1G24764 | Member of the MAP70 protein family. |
| AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
| AT1G67120 | Represents a homolog of the yeast MDN gene, which encodes a non-ribosomal protein involved in the maturation and assembly of the 60S ribosomal subunit. In Arabidopsis, it is essential for female gametogenesis progression. |
| AT5G57170 | Chemokine-like MDL protein; modulates flowering time and innate immunity. |
| AT3G51660 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
| AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
| AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT1G44900 | Encodes MCM2 (MINICHROMOSOME MAINTENANCE 2), a protein essential to embryo development. Overexpression results in altered root meristem function. |
| AT2G16440 | Regulates DNA replication via interaction with BICE1 and MCM7. |
| AT1G26800 | MPSR1 is cytoplasmic E3 ligase that senses misfolded proteins independently of chaperones and targets those proteins for degradation via the 26S proteasome. Involved in the regulation of the homeostasis of sensor NLR immune receptors. |
| AT2G04540 | Encodes a mitochondrial beta-ketoacyl-ACP synthase. |
| AT1G09575 | Mitochondrial calcium channel. |
| AT1G57610 | calcium uniporter (DUF607);(source:Araport11) |
| AT3G12770 | Encodes a pentatricopeptide repeat protein (PPR) protein involved in mitochondrial mRNA editing. |
| AT5G08305 | E+-type pentatricopeptide repeat protein involved in C to U editing in mitochondria and chloroplasts. |
| AT4G04750 | Putative mitochondrial F1F0-ATPase. |
| AT4G05450 | mitochondrial ferredoxin 1;(source:Araport11) |
| AT4G01400 | Pentatricopeptide Repeat Protein involved in splicing of nad4, nad 5, nad 1 and nad2 introns which affects biogenesis of the respiratory complex I. |
| AT1G07030 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G48030 | Encodes a mitochondrial lipoamide dehydrogenase whose expression is induced by light. |
| AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
| AT3G09040 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G06710 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G42130 | Encodes a protein belonging to the mitochondrial carrier family and similar to animal mitoferrin but likely NOT to be located in the mitochondria, but rather in chloroplasts. It is likely to be involved in transporting iron into the chloroplast. |
| AT1G10210 | Encodes ATMPK1. Kinase is activated by wounding. |
| AT5G40440 | Encodes a mitogen-activated protein kinase kinase. Activates MPK8 and is a target of MPKKK20. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
| AT1G51660 | Encodes a mitogen-activated map kinase kinase (there are nine in Arabidopsis) involved in innate immunity. This protein activates MPK3/MPK6 and early-defense genes redundantly with MKK5. In plants with both MKK5 and MKK4 levels reduced by RNAi plants, floral organs do not abscise suggestion a role for both proteins in mediating floral organ abscission. The mRNA is cell-to-cell mobile. |
| AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
| AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
| AT5G55090 | member of MEKK subfamily |
| AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT1G05100 | member of MEKK subfamily. Negatively regulated by RGLG1 and RGLG2; involved in drought stress tolerance. |
| AT5G67080 | member of MEKK subfamily |
| AT4G36950 | member of MEKK subfamily |
| AT3G07980 | MAP3K epsilon protein kinase 2 is functionally redundant with MAP3Ke1. Required for pollen development but not essential. |
| AT3G13530 | MAP3K epsilon protein kinase 1 is functionally redundant with MAP3Ke2. Required for pollen development but not essential. map3ke1;map3ke2 double-mutant pollen grains develop plasma membrane irregularities following pollen mitosis I. Localized primarily in the plasma membrane. Expressed in leaf trichomes, root columella cells and developing ovules. |
| AT5G11300 | mitotic-like cyclin, core cell cycle gene that is expressed only in roots (RT_PCR), portions with mitotic activity only (whole mount in situ). |
| AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT2G01530 | MLP-like protein 329;(source:Araport11) |
| AT1G70660 | MMZ2/UEV1B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1A can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. However, a combination of MMZ2/UEV1B and UBC13A do not do a good job of rescuing an mms2 ubc13 double mutant in yeast. MMZ2/UEV1B transcripts are found in most plant organs, but not in the pollen or in seedlings 6 hours or 2 days post-germination. The transcript levels do not appear to be stress-inducible. The mRNA is cell-to-cell mobile. |
| AT1G54030 | Encodes a vacuolar protein. Mutation causes organizational defects in the endoplasmic reticulum and aberrant protein trafficking in the plant secretory pathway. The mRNA is cell-to-cell mobile. |
| AT4G02150 | Encodes IMPORTIN ALPHA 3. Mutant plants act as suppressors of snc1 response and salicylic acid accumulation. Located in the nucleus. Involved in protein import. Protein interacts with Agrobacterium proteins VirD2 and VirE2. Is not individually essential for Agrobacterium-mediated root transformation, but when overexpressed can rescue the impa-4 decreased transformation susceptibility phenotype. |
| AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT2G25680 | Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. |
| AT1G80310 | MOT2 encodes a molybdate transporter which locates to the vacuolar membrane. Loss-of-function (knock out) mutants show elevated molydate levels in rosette leaves and in fully senescent leaves, but decreased MoO4 levels in seeds. Under conditions of molybdate deficiency leaves from mot2::tDNA mutants show strongly reduced nitrate reductase activity. The mot2 gene is slightly expressed in young and mature leaves, but strongly in senescing leaves. This observation points to a function of MOT2 in molybdate transfer from leaves to seeds during plant senescence. |
| AT2G28390 | SAND family protein;(source:Araport11) |
| AT3G52880 | Encodes a peroxisomal monodehydroascorbate reductase, involved in the ascorbate-glutathione cycle which removes toxic H2O2 |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
| AT3G50870 | Encodes a GATA transcriptional regulator required to position the proembryo boundary in the early embryo. Regulates shoot apical meristem and flower development. |
| AT1G19850 | Encodes a transcription factor (IAA24) mediating embryo axis formation and vascular development. Similar to AUXIN RESPONSIVE FACTOR 1 (ARF1) shown to bind to auxin responsive elements (AREs), and to the maize transcriptional activator VIVIPAROUS 1( VP1). In situ hybridization shows expression in provascular tissue of embryos, the emerging shoot primordia, then is restricted to provascular tissue, and in the root central vascular cylinder. |
| AT1G36370 | Encodes a nuclear localised protein MSA1 (MORE SULPHUR ACCUMULATION1). Epigenetically regulates sulphur homeostasis. Has sequence similarity to SHM (serine hydroxymethyltransferase) but lacks SHM activity in vitro. |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT3G54870 | Armadillo-repeat containing kinesin-related protein. Plays a role during transition to root-hair tip growth.Mutants have short, branched root hairs and an excess of endoplasmic microtubles. Phenotype suggests ARK1 plays a role in modulating microtubule depolymerization during root hair tip growth.An HKT2.4 (CS76404) - ARK1 variant causes root hair branching. |
| AT2G03720 | Involved in root hair development |
| AT4G02720 | Encodes an ortholog of NKAP (NF-kB activating protein), that interacts with splicing and ribosome biogenesis proteins, colocalizes with the 45S rDNA at the nucleolar organizer regions (NORs) and negatively regulates 45S rDNA expression. |
| AT2G33340 | Encodes MAC3B, a U-box proteins with homology to the yeast and human E3 ubiquitin ligase Prp19. Associated with the MOS4-Associated Complex (MAC). Involved in plant innate immunity. Regulator of flowering time. |
| AT1G37113 | hypothetical protein;(source:Araport11) |
| AT4G37295 | Encodes an 86 AA polypeptide sequence that produces an 11 AA secreted, bioactive peptide. It is induced by BD16. The peptide is bound by the RLK7 receptor kinase and inhibits the formation of lateral root founder cells. Homolog of prePIP1. |
| AT1G28280 | VQ motif-containing protein;(source:Araport11) |
| AT5G10490 | A member of MscS-like gene family, structurally very similar to MSL3, comprising of an N-terminal chloroplast transit peptide, five trans-membrane helices and a C-terminal cytoplasmic domain. Mutant plants showed abnormalities in the size and shape of plastids. MSL2-GFP was localized to discrete foci on the plastid envelope and co-localize with the plastid division protein AtMinE. |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
| AT1G28240 | strawberry notch protein (DUF616);(source:Araport11) |
| AT1G51340 | Encodes a root citrate transporter which together with the root malate transporter ALMT1 are the primary mechanism of aluminum tolerance. |
| AT3G06860 | Encodes a multifunctional protein. Involved in peroxisomal fatty acid beta oxidation. Loss-of-function mutant lacks hydroxyacyl-CoA dehydrogenase activity and have reduced levels of long-chain enoyl-CoA hydratase activity. The mutant has fewer but larger peroxisomes. The mRNA is cell-to-cell mobile. |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
| AT1G22610 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
| AT3G04605 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT3G05850 | Encodes a member of a domesticated transposable element gene family MUSTANG. Members of this family are derived from transposable elements genes but gained function in plant fitness and flower development. Known members include: AT3G04605 (MUG1), AT2G30640 (MUG2), AT1G06740 (MUG3), AT5G16505 (MUG4), AT3G06940 (MUG5), AT5G48965 (MUG6), AT3G05850 (MUG7) and AT5G34853 (MUG8). |
| AT4G02070 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. |
| AT3G09230 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT2G25230 | Encodes a putative transcription factor (MYB100). |
| AT2G32460 | Member of the R2R3 factor gene family. |
| AT1G63910 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT2G26950 | Member of the R2R3 factor gene family. |
| AT1G69560 | Encodes LOF2 (LATERAL ORGAN FUSION2), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF1 (At1g26780). |
| AT3G02940 | Encodes a putative transcription factor (MYB107). |
| AT3G06490 | Encodes a MYB transcription factor involved in regulating anther dehiscence as well as regulating cell death, and cuticle-related Botrytis immunity. |
| AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
| AT5G49330 | Member of the R2R3 factor gene family. Together with MYB11 and MYB111 redundantly regulates flavonol biosynthesis. |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT1G26780 | Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560). |
| AT1G74080 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB122). |
| AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
| AT2G31180 | Member of the R2R3 factor gene family. |
| AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
| AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
| AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
| AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
| AT1G66230 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT5G40430 | Encodes a putative transcription factor (MYB22). |
| AT5G40330 | Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1. |
| AT5G61420 | Encodes a nuclear localized member of the MYB transcription factor family. Involved in positive regulation of aliphatic glucosinolate biosynthesis.Expression is induced by touch, wounding and glucose. |
| AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
| AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
| AT3G24310 | snapdragon myb protein 305 homolog (myb) |
| AT1G74650 | Member of the R2R3 factor gene family. |
| AT4G34990 | Member of the R2R3 factor gene family. |
| AT5G06100 | Encodes a member of the myb family of transcription factors (MYB33), contains Pfam profile: PF00249 myb DNA-binding domain. Double mutants with MYB65 are male sterile- anthers are small, pollen development is defective. Spatial expression appears to be under the control of miR159, contains a target site for this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. When the target site is mutated, expression is detected in leaves, roots, anther filament, pistil. The expression of a translational fusion is specific to anther locules in contrast to constructs lacking the miR159 target site. Phenotype is conditional and can be restored by lower temperature or higher light intensity. |
| AT5G60890 | Myb-like transcription factor that modulates expression of ASA1, a key point of control in the tryptophan pathway; mutant has deregulated expression of ASA1 in dominant allele. Loss of function allele suggests ATR1 also functions at a control point for regulating indole glucosinolate homeostasis. |
| AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
| AT3G09370 | C-myb-like transcription factor (MYB3R3) mRNA. It is a target of CDK phosphorylation and blocks cell division in response to DNA damage. |
| AT3G48920 | Member of the R2R3 factor gene family. |
| AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
| AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
| AT3G46130 | Encodes a putative transcription factor (MYB48) that functions to regulate flavonol biosynthesis primarily in cotyledons. |
| AT5G54230 | MYB49 transcription factor. Binds to and promotes expression of genes involved in cadmium accumulation. Interacts with ABI5 which acts as a repressor preventing MYB49 induced expression of target genes. |
| AT3G18100 | Member of the R2R3 transcription factor gene family. |
| AT4G01680 | Encodes a putative transcription factor (MYB55). |
| AT4G09460 | Encodes myb6 DNA-binding protein. The mRNA is cell-to-cell mobile. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
| AT1G79180 | Member of the R2R3 factor gene family. |
| AT5G11050 | Member of R2R3-MYB transcription factor gene family. |
| AT3G11440 | Member of the R2R3-MYB gene family. Similar to GA-induced Barley myb gene. May be induced during germination in response to GA. Double mutants with MYB33 are male sterile, showing defects in pollen development and anther development. Contains a binding site for miRNA159 and may be spatially regulated by this micro RNA. A highly conserved RNA secondary structure abuts the miR159 binding site which facilitates its regulation by miR159. The male sterile phenotype of the MYB33/MYB65 double mutant is light and temperature sensitive. Fertility can be restored with increased light intensity and lower temperatures. |
| AT5G14750 | Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC). |
| AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
| AT2G23290 | Member of the R2R3 factor gene family. |
| AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
| AT5G49620 | Member of the R2R3 factor gene family. |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT5G26660 | myb domain protein 86;(source:Araport11) |
| AT1G66390 | Production of anthocyanin pigment 2 protein (PAP2). |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT5G62320 | Encodes a putative transcription factor (MYB99). |
| AT5G67300 | Member of the R2R3 factor MYB gene family involved in mediating plant responses to a variety of abiotic stimiuli. The mRNA is cell-to-cell mobile. |
| AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
| AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
| AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. The mRNA is cell-to-cell mobile. |
| AT2G46810 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
| AT1G14520 | Encodes MIOX1. Belongs to myo-inositol oxygenase gene family. |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
| AT3G19960 | member of Myosin-like proteins |
| AT1G08800 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT1G04160 | Encodes a member of the type XI myosin protein family involved in root hair elongation. |
| AT2G31900 | Encodes an novel myosin isoform. |
| AT3G10550 | Has 3'-phosphatase activity against both phosphatidylinositol-3,5-bisphosphate (PtdIns3,5P2) and Phosphatidylinositol-3-phosphate (PtdIns3P). The in vitro activity was higher with PtdIns3,5P2 than with PtdIns3P. |
| AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
| AT1G52040 | Encodes myrosinase-binding protein expressed in flowers. |
| AT3G16440 | myrosinase-binding protein-like protein (AtMLP-300B) mRNA, |
| AT5G14180 | Myzus persicae-induced lipase 1;(source:Araport11) |
| AT2G22910 | N-acetyl-l-glutamate synthase 1;(source:Araport11) |
| AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
| AT2G39030 | Encodes a protein that acts as an ornithine N-delta-acetyltransferase, leading to the formation of N-delta-actetylornithine. This compound is likely used in plant defense and levels of it are increased in Arabidopsis plants in response to MeJA and ABA. The mRNA is cell-to-cell mobile. |
| AT2G19620 | Plays a role in dehydration stress response. |
| AT4G17830 | NAOD encodes a functional acetylornithine deacetylase. Silenced lines plants flower early but have reduced fertility (siliques do not develop) as well as reduced ornithine levels.NAOD mediates a linear pathway for ornithine biosynthesis. |
| AT4G04880 | Encodes an N6-mAMP deaminase (ADAL, renamed MAPDA) that catabolizes N6-mAMP derived from turnover of m6A-modified RNA to inosine monophosphate in vivo by hydrolytically removing the aminomethyl group. |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT5G27150 | Encodes a vacuolar sodium/proton antiporter involved in salt tolerance, ion homeostasis, and leaf development. The mRNA is cell-to-cell mobile. |
| AT1G14660 | member of putative Na+/H+ antiporter (AtNHX) family. Functions as a plasma membrane Li+/H+ antiporter. Involved in Li+ efflux and detoxification. |
| AT1G12260 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT1G33060 | NAC 014;(source:Araport11) |
| AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
| AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
| AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
| AT1G32770 | Encodes SND1, a NAC Domain transcription factor involved in secondary wall biosynthesis in fibers. Expressed specifically in interfascicular fibers and xylary fibers in stems. Expressed in the procambium of stem inflorescences and root. May act as a negative regulator of secondary wall thickening in xylary fibers. Acts redundantly with NST1 to control development of secondary walls in siliques. |
| AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
| AT1G61110 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
| AT1G02220 | NAC domain transcription factor which functions as a negative regulator of the TDIF-PXY module and fine-tunes TDIF signaling in vascular development. Controls the balance of xylem formation and cambial cell divisions. |
| AT3G29035 | Encodes a protein with transcription factor activity. Note: this protein (AT3G29035) on occasion has also been referred to as AtNAC3, not to be confused with the AtNAC3 found at locus AT3G15500. The mRNA is cell-to-cell mobile. |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT2G33480 | NAC domain containing protein 41;(source:Araport11) |
| AT2G43000 | Encodes a NAC transcription factor induced by hydrogen peroxide (H2O2). Involved in senescence. Over expression of the gene strongly delays senescence and enhances tolerance to various abiotic stresses. |
| AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
| AT1G02250 | Encodes a member of the NAC family of transcription factors. ANAC005 contains sequences specifying both nuclear and plasma membrane targeting. Overexpression results in increased xylem differentiation suggesting ANAC005 promotes xylem formation. |
| AT3G10480 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. It binds the NAC-binding site, the Mitochondrial Dysfunction Motif. |
| AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
| AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
| AT3G17730 | NAC domain containing protein 57;(source:Araport11) |
| AT4G01520 | NAC domain containing protein 67;(source:Araport11) |
| AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
| AT4G28500 | NAC domain containing protein 73;(source:Araport11) |
| AT4G28530 | Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue. |
| AT4G36160 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT5G07680 | NAC domain containing protein 80;(source:Araport11) |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT5G14000 | NAC domain containing protein 84;(source:Araport11) |
| AT5G14490 | NAC domain containing protein 85;(source:Araport11) |
| AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
| AT5G41090 | NAC domain containing protein 95;(source:Araport11) |
| AT5G46590 | Transcription factor required for the initiation of cell division during wound healing. Redundantly involved with ANAC071 in the process of "cambialization". |
| AT5G50820 | NAC domain containing protein 97;(source:Araport11) |
| AT5G56620 | NAC domain containing protein 99;(source:Araport11) |
| AT5G62380 | Encodes a NAC-domain transcription factor involved in xylem formation. Induces transdifferentiation of various cells into metaxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids. |
| AT5G07710 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT5G46830 | Calcium-binding transcription factor involved in salt stress signaling. |
| AT1G21640 | Encodes a protein with NAD kinase activity. The protein was also shown to bind calmodulin. |
| AT1G04280 | Encodes a mitochondrial CaM/Ca2+-dependent NAD+ kinase. |
| AT4G05020 | Miitochondrial alternative NADH dehydrogenase. |
| AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
| AT4G09350 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G53460 | NADH-dependent glutamate synthase The mRNA is cell-to-cell mobile. |
| AT2G19900 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME1 is expressed in response to developmental and cell-specific signals. The enzyme is active in vitro and appears to function as a homohexamer or homooctamer. It is believed to be a cytosolic protein. |
| AT4G35460 | NADPH-dependent thioredoxin reductase 1 (NTR1. Similar to E.coli NTR and has conserved NADPH binding domains. |
| AT1G16520 | NAI1 interacting protein, involved in ER body and vesicle formation. |
| AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
| AT1G18800 | Double nrp1-1 nrp2-1 mutants show arrest of cell cycle progression at G2/M and disordered cellular organization occurred in root tips. Localize in the nucleus and can form homomeric and heteromeric protein complexes with NRP1. Bind histones Histone2A and Histone2B and associate with chromatin in vivo. Plant mutated in both NRP1 and NRP2 genes show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. NRP genes act synergistically with NAP1 genes in promoting somatic homologous recombination. |
| AT3G17850 | Protein kinase which together with IRE3 plays an important role in controlling root skewing and maintaining the microtubule network. |
| AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
| AT2G35960 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression is not altered in response to cucumber mosaic virus or spermine. |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
| AT2G17730 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
| AT3G22790 | Encodes a member of the NET superfamily of proteins that potentially couples different membranes to the actin cytoskeleton in plant cells. It binds filamentous actin and is localized to the plasma membrane and plasmodesmata. |
| AT1G09720 | Member of NET domain family of actin binding proteins. Paralog of At3g22790 (NET2A). |
| AT2G22560 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT5G58980 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT1G10170 | Encodes AtNFXL1, a homologue of the putative human transcription repressor NF-X1. Functions as a negative regulator of the trichothecene phytotoxin-induced defense response. |
| AT1G51390 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU4 than to NFU1,2, and 3. Targeted to the mitochondrion. The mRNA is cell-to-cell mobile. |
| AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
| AT2G46870 | Member of the RAV family of DNA binding proteins. Contains B3 domain. Recognizes 5'-CACCTG-'3 motif. |
| AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT5G04950 | Encodes a nicotianamide synthase. |
| AT5G56080 | Encodes a protein with nicotianamine synthase activity. Its transcript levels rise in roots in response to zinc deficiency and rise in leaves in response to elevated levels of zinc. |
| AT2G23420 | nicotinate phosphoribosyltransferase 2;(source:Araport11) |
| AT1G42470 | Patched family protein;(source:Araport11) |
| AT4G38350 | Patched family protein;(source:Araport11) |
| AT5G49940 | Encodes a protein containing the NFU domain and functions as a molecular scaffold for iron-sulfur cluster assembly and delivery. Homologous to the cyanobacterial CNFU protein and is targeted to the chloroplast. |
| AT3G12320 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK4 in having affects on biomass accumulation and phototrophism. |
| AT5G06980 | Member of a small gene family. Appears to be clock regulated.Somewhat redundant with LNK1/2 though more like LNK3 in having affects on biomass accumulation and phototrophism. |
| AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
| AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
| AT1G20640 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT1G76350 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT1G64530 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT3G59580 | Plant regulator RWP-RK family protein;(source:Araport11) |
| AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
| AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
| AT1G78390 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
| AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G08100 | Encodes a high-affinity nitrate transporter. |
| AT5G60780 | member of High affinity nitrate transporter family |
| AT5G60770 | member of High affinity nitrate transporter family |
| AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
| AT1G62580 | Encodes a flavin monooxygenase that binds NO, has a higher affinity for NO than for O(2) and can generate cGMP from GTP in vitro in an NO-dependent manner. |
| AT3G44310 | Mutants are resistant to indole-3-acetonitrile (IAN). NIT1 catalyzes the terminal activation step in indole-acetic acid biosynthesis. Predominantly expressed isoform of nitrilase isoenzyme family. Aggregation of NIT1 in cells directly abutting wound sites is one of the earliest events associated with wound and herbicide-induced cell death. The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. It is also involved in the conversion of IAN to IAM (indole-3-acetamide) and other non-auxin-related metabolic processes. The mRNA is cell-to-cell mobile. |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT5G22300 | encodes a nitrilase isomer. The purified enzyme shows a strong substrate specificity for beta-cyano-L-alanine, a intermediate product of the cyanide detoxification pathway. The mRNA is cell-to-cell mobile. |
| AT3G16390 | Encodes a nitrile-specifier protein NSP3. NSP3 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
| AT5G48180 | Encodes a nitrile-specifier protein NSP5. NSP5 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT3G54360 | Encodes a catalase chaperon that is essential for catalase activity. Required for multiple stress responses. |
| AT3G57670 | Encodes a a C2H2/C2HC zinc finger transcription factor specifically expressed in the transmitting tract and involved in transmitting tract development and pollen tube growth.Acts redundantly with WIP4 and WIP5 to determine distal cell fate in the root. MP binds to regulatory elements within the NTT locus and likely regulates its expression. |
| AT1G08300 | no vein-like protein;(source:Araport11) |
| AT4G18910 | Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
| AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
| AT4G03090 | AtNDX negatively regulates ABI4 expression during ABA signaling. |
| AT2G37010 | member of NAP subfamily |
| AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT3G03530 | PHOSPHOESTERASE FAMILY PROTEIN, NPC4 is significantly induced upon phosphate starvation and plays an important role in the supply of inorganic phosphate and diacylglycerol from membrane-phospholipids during phosphate deprivation.Has a preference for glycosylinositolphosphorylceramide (GIPC) as a substrate. |
| AT4G13250 | Encodes a chlorophyll b reductase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
| AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
| AT1G65420 | Chloroplast localized YCF20-like gene involved in nonphotochemical quenching. Has overlapping functions with npq6. |
| AT2G03820 | Encodes a protein involved in the nuclear export of the 60S ribosomal subunit and formation of the secondary cell wall. |
| AT4G11910 | Acts antagonistically with SGR1 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT3G17440 | member of NPSN Gene Family |
| AT3G63000 | NPL4-like protein 1;(source:Araport11) |
| AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile. |
| AT5G67385 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
| AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
| AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
| AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
| AT1G68570 | NPF3.1 is a membrane localized GA transporter that is expressed in the root endodermis. |
| AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G27040 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G72120 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
| AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
| AT1G32450 | Transmembrane nitrate transporter. Involved in xylem transport of nitrate from root to shoot. Induced in response to high and low concentrations of nitrate. Not involved in nitrate uptake. Expressed in root pericycle cells under the control of MYB59. Also functions as a proton-coupled H+/K+ antiporter for K+ loading into the xylem. |
| AT3G54140 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source |
| AT5G01180 | Encodes a dipeptide transporter expressed in pollen and ovules during early seed development. GFP-tagged PTR5 localizes to the plasma membrane. |
| AT3G25560 | NSP-interacting kinase 2;(source:Araport11) |
| AT1G03530 | nuclear assembly factor 1;(source:Araport11) |
| AT2G19400 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G06670 | nuclear DEIH-box helicase (NIH) encoding a putative RNA and/or DNA helicase homologous to a group of nucleic acid helicases from the DEAD/H family with nuclear DEIH-box helicase (NIH) distinct N- and C-terminal regions that differ from animal DEIH proteins The mRNA is cell-to-cell mobile. |
| AT2G34720 | nuclear factor Y, subunit A4;(source:Araport11) |
| AT1G54160 | Encodes a member of the CCAAT-binding transcription factor (CBF-B/NF-YA) family. Expression is upregulated in response to ABA and drought. This regulation appears to be mediated by MIR169A which is downregulated in response to drought. NFYA5 is a target of MIR169A. Loss of function mutations are hypersensitive to drought. |
| AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
| AT5G08190 | nuclear factor Y, subunit B12;(source:Araport11) |
| AT5G47670 | Encodes LEC1-Like (L1L), closely related to LEC1 (Leafy Cotyledon1). Functions as a regulator of embryo development. |
| AT2G37060 | nuclear factor Y, subunit B8;(source:Araport11) |
| AT5G50480 | nuclear factor Y, subunit C6;(source:Araport11) |
| AT5G27910 | nuclear factor Y, subunit C8;(source:Araport11) |
| AT1G30010 | Analysis of the RNA profiles of wild-type and mutant plants establishes a role for nMAT1 in the trans-splicing of nad1 intron 1 and in the cis-splicing of nad2 intron 1 and nad4 intron 2. |
| AT5G63320 | Encodes NPX1 (Nuclear Protein X1), a nuclear factor regulating abscisic acid responses. |
| AT1G29940 | Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A). |
| AT1G06790 | Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III. |
| AT5G60040 | Encodes a subunit of RNA polymerase III (aka RNA polymerase C). |
| AT1G63020 | Encodes one of two alternative largest subunits of a putative plant-specific RNA polymerase IV (aka RNA polymerase D). Required for posttranscriptional gene silencing. |
| AT5G03555 | Encodes PLUTO (plastidic nucleobase transporter), a member of the Nucleobase:Cation-Symporter1 protein family, capable of transporting purine and pyrimidine nucleobases. |
| AT4G31240 | protein kinase C-like zinc finger protein;(source:Araport11) |
| AT5G63310 | Maintains intracellular dNTP levels except ATP. Plays a role in response to oxidative stress and UV. Involved in phytochrome-mediated light signaling. Participates in auxin-regulated processes, partly through the modulation of auxin transport. H-bonding with His-197 inside the nucleotide-binding pocket is critical for NDPK2 functioning. |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT2G19480 | This gene is predicted to encode a nucleosome assembly protein. Plant lines expressing an RNAi construct directed against this gene show a reduction in agrobacterium-mediated root transformation. The mRNA is cell-to-cell mobile. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
| AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT1G80300 | Encodes an ATP/ADP transporter. The mRNA is cell-to-cell mobile. |
| AT4G25434 | nudix hydrolase homolog 10;(source:Araport11) |
| AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
| AT5G47650 | Encodes an ADP-ribose pyrophosphatase that confers enhanced tolerance to oxidative stress. |
| AT5G19470 | nudix hydrolase homolog 24;(source:Araport11) |
| AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
| AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT3G55370 | Encodes a nuclear localized Dof domain containing transcription factor expressed primarily in roots. Responsive to salicylic acid. Transgenic overexpressors have yellow leaves and short, defective roots. |
| AT5G53450 | OBP3-responsive protein 1;(source:Araport11) |
| AT2G04570 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
| AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
| AT5G01170 | hypothetical protein (DUF740);(source:Araport11) |
| AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
| AT4G25140 | Encodes oleosin1, a protein found in oil bodies, involved in seed lipid accumulation. Suppression of OLEO1 (and OLEO2) resulted in an aberrant phenotype of embryo cells that contain unusually large oilbodies that are not normally observed in seeds. Changes in the size of oilbodies caused disruption of storage organelles, altering accumulation of lipids and proteins and causing delay in germination. Functions in freezing tolerance of seeds. |
| AT5G51210 | Encodes oleosin3, a protein found in oil bodies, involved in seed lipid accumulation. |
| AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
| AT5G55930 | oligopeptide transporter |
| AT4G10770 | oligopeptide transporter |
| AT5G53510 | oligopeptide transporter |
| AT1G17370 | Encodes an RNA?binding protein involved in stress granule formation. Regulated by a transposable element small RNA. |
| AT1G51560 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
| AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
| AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
| AT2G15820 | Encodes a protein that promotes splicing of type II introns. otp51 mutants fail to splice intron 2 of plastid ycf3 transcripts, a factor required for the assembly of Photosystem I. Therefore, homozygous otp51 mutants have profound photosynthetic defects and can only survive in sucrose-supplemented in vitro cultures under low light conditions. OTP51 may also be involved in splicing several other transcripts and precursor forms of the trnL, trnG, trnI, and trnA transcripts also accumulate in otp51 mutants. Although OTP51 shares some homology with DNA endonucleases, it lacks key catalytic residues suggesting that it does not participate in DNA cleavage. |
| AT1G64310 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
| AT5G59200 | Encodes a chloroplast RNA editing factor. |
| AT2G02980 | Encodes a chloroplast RNA editing factor. |
| AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
| AT3G20660 | organic cation/carnitine transporter4;(source:Araport11) |
| AT2G35720 | Encodes OWL1, a J-domain protein involved in perception of very low light fluences. |
| AT1G26840 | Origin Recognition Complex subunit 6. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. It acts downstream of BRP4, and is, at least in part, involved in the BRP4-mediated mitotic cell-cycle progression. |
| AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
| AT5G16180 | Promotes the splicing of chloroplast group II introns. Splices atpF introns. |
| AT5G35080 | Encodes a protein involved in the endoplasmic reticulum-associated degradation of glycoproteins. |
| AT4G08180 | OSBP(oxysterol binding protein)-related protein 1C;(source:Araport11) |
| AT4G22540 | OSBP(oxysterol binding protein)-related protein 2A;(source:Araport11) |
| AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
| AT5G57240 | OSBP(oxysterol binding protein)-related protein 4C;(source:Araport11) |
| AT5G19620 | AtOEP80 is paralog to the chloroplastic protein translocation channel Toc75. Mutations in this locus result in embryo lethality. |
| AT5G01840 | Encodes a member of the plant specific ovate protein family. Members of this family have been shown to bind to KNOX and BELL- like TALE class homeodomain proteins. This interaction may mediate relocalization of the TALE homeodomain from the nucleus to the cytoplasm. Functions as a transcriptional repressor that suppresses cell elongation. May also directly affect microtubule organization via interactions with TON2. |
| AT1G79960 | ovate family protein 14;(source:Araport11) |
| AT2G36050 | ovate family protein 15;(source:Araport11) |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT3G52540 | ovate family protein 18;(source:Araport11) |
| AT4G18830 | Member of the ovate protein family.Interacts with BLH1 and KNAT3. Regulates the subcellular localization of BLH1.I May also directly affect microtubule organization via interactions with TON2. |
| AT3G52525 | ovate family protein 6;(source:Araport11) |
| AT2G18500 | ovate family protein 7;(source:Araport11) |
| AT1G10570 | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. sYFP:OTS2 protein accumulates in nuclei in a punctate pattern. Double mutant analysis with ULP1D/OTS1 indicates that these genes are involved in salt stress responses and flowering time regulation. |
| AT3G55400 | methionyl-tRNA synthetase / methionine-tRNA ligase / MetRS (cpMetRS);(source:Araport11) |
| AT5G49030 | tRNA synthetase class I (I, L, M and V) family protein;(source:Araport11) |
| AT2G25840 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
| AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
| AT1G25350 | glutamine-tRNA ligase, putative / glutaminyl-tRNA synthetase, putative / GlnRS;(source:Araport11) |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT1G21900 | Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER. |
| AT4G30210 | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. The mRNA is cell-to-cell mobile. |
| AT2G43080 | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline),the collagen model peptide (Pro-Pro-Gly)10 and other proline rich peptides. |
| AT1G60440 | The gene AT1G60440 encodes pantothenate kinase 1. Its molecular function was shown to phosphorylate pantothenate to form 4?-phosphopantothenate. |
| AT3G19180 | Encodes a chloroplast division factor located in the plastid inner envelope with its N-terminus exposed to the stroma. PARC6 influences FtsZ assembly and is required for recruitment of PDV1 during chloroplast division. |
| AT4G17410 | PQT3 is a nuclear localized E3 ligase involved in negative regulation of stress tolerance.PRMT4b is a substrate of PQT3. |
| AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
| AT2G02710 | Encodes a putative blue light receptor protein. |
| AT5G10480 | Protein tyrosine phosphatase-like involved in cell division and differentiation. Interacts with CDKA;1 only in its phosphorylated form, preventing dephosphorylation. Overexpression slowed down cell division in suspension cell cultures at the G2-to-M transition and early mitosis and inhibited Arabidopsis seedling growth. Localized in the cytoplasm of dividing cells but moved into the nucleus upon cell differentiation. Based on complementation of yeast mutant PAS2 has acyl-CoA dehydratase activity. It interacts with CER10, a component of the microsomal fatty acid elongase complex, suggesting a role in synthesis of VLCFAs (very long chain fatty acids). |
| AT2G39220 | Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus. |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT1G75040 | Thaumatin-like protein involved in response to pathogens. mRNA level of the PR-5 gene (At1g75040)is significantly changed after cutting the inflorescence stem indicating the existence of a network of signal transducing pathways as other stress-regulated genes (At5g01410, At3g17800, At1g29930)do not response to the treatment. The mRNA is cell-to-cell mobile. |
| AT3G57260 | beta 1,3-glucanase |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
| AT4G17660 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G07070 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G01020 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G77510 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner. |
| AT3G54960 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). Neither AtIRE1-2 nor AtbZIP60 appear to be required for this response. |
| AT1G04980 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
| AT5G22130 | member of Glycosyltransferase Family- 50 |
| AT4G14713 | PPD1 (and its paralog, PPD2) encode plant-specific putative DNA-binding proteins. PPD1 and PPD2 are not found in grasses. Overexpression of PPD reduces lamina size by promoting the early arrest of dispersed meristematic cells DMC proliferation during leaf and silique development. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. The curvature of a deltappd leaf reflects the difference between excess growth of the lamina and a limitation to the extension capacity of its perimeter. |
| AT3G09410 | Pectinacetylesterase family protein;(source:Araport11) |
| AT1G09550 | Pectinacetylesterase family protein;(source:Araport11) |
| AT2G46930 | Encodes a pectin acetylesterase that removes cell wall acetate associated with pectin formation in Arabidopsis leaves. |
| AT4G19410 | Pectinacetylesterase family protein;(source:Araport11) |
| AT4G19420 | Pectinacetylesterase family protein;(source:Araport11) |
| AT1G53840 | encodes a pectin methylesterase |
| AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
| AT1G53830 | encodes a pectin methylesterase |
| AT3G29090 | Encodes an atypical pectin methylesterase that does not require salt for its activity and has a blockwise mode of pectin demethylesterification. |
| AT3G49220 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT1G48020 | Pectin methylesterase inhibitor AtPMEI1. Inactivates AtPPME1 in vitro. Localized to pollen tube cell tip. |
| AT2G31430 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G53370 | pectin methylesterase PCR fragment F;(source:Araport11) |
| AT2G21610 | pectinesterase 11;(source:Araport11) |
| AT3G58390 | Represses the RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. Impairs NSD likely by sequestering the HBS1 components of the NSD complex. |
| AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
| AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
| AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
| AT1G06580 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G03380 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G73080 | Encodes a leucine-rich repeat receptor kinase. Functions as a receptor for AtPep1 to amplify innate immunity response to pathogen attacks. The mRNA is cell-to-cell mobile. |
| AT1G17750 | Encodes PEPR2, a plasma membrane leucine-rich repeat receptor kinase functioning as a receptor for the Pep1 and Pep2 peptides. Pep1 and Pep2 are amino acids that induce the transcription of defense-related genes. |
| AT3G57190 | Encodes a chloroplast stroma-localized ribosomal peptide chain release factor that is involved in the light- and stress-dependent regulation of stability of 3' processed petB transcripts to adjust cytochrome b(6) levels. It appears to bind to the 3'-UTR of petB RNA, protecting it from 3'-5' exonucleolytic attack. At-prfB3 arose from a gene duplication of At-prfB1. |
| AT1G15390 | encodes a peptide deformylase-like protein. Removes N-formyl groups, a prerequisite for the action of methionine aminopeptidase during protein synthesis. Targeted to mitochondria. Requires Zn for catalysis. |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT5G07470 | ubiquitous enzyme that repairs oxidatively damaged proteins |
| AT1G68640 | Encodes bZIP-transcription factor. Mutant plants have extra floral organs. PAN is essential for AG activation in early flowers of short-day-grown plants. Binds directly to 5'-AAGAAT-3'regulatory sequence in AG promoter. |
| AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G15440 | Encodes a nucleolar protein that is a ribosome biogenesis co-factor. Mutants display aberrant RNA processing and female gametophyte development. |
| AT5G23940 | Encodes PERMEABLE LEAVES3 (PEL3), a putative acyl-transferase. Mutation in this locus results in altered trichome phenotype (trcichomes become tangled during leaf expansion). Additional phenotype includes altered cuticle layer. |
| AT1G05250 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT2G41480 | Encodes a cationic cell-wall-bound peroxidase homolog that is involved in the lignification of cell walls. Regulated by COG1, involved in seed longevity. |
| AT3G32980 | Peroxidase superfamily protein;(source:Araport11) |
| AT4G11290 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT4G33420 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
| AT5G66390 | Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT3G49120 | Class III peroxidase Perx34. Expressed in roots, leaves and stems. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT3G47430 | member of the peroxin11 (PEX11) gene family, located on the peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
| AT3G61070 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
| AT3G21865 | Interacts with PEX4 in a yeast two-hybrid. The PEX4 and PEX22 pair may be important during the remodeling of peroxisome matrix contents as glyoxysomes transition to leaf peroxisomes. |
| AT3G18160 | Peroxin 3-1;(source:Araport11) |
| AT3G04460 | RING finger protein involved in peroxisome biogenesis. Also involved in peroxisomal import of nitric oxide synthase. Has been demonstrated to have E3 ubiquitin ligase activity. |
| AT3G06050 | Encodes a mitochondrial matrix localized peroxiredoxin involved in redox homeostasis. Knockout mutants have reduced root growth under certain oxidative stress conditions. |
| AT2G33150 | Encodes an organellar (peroxisome, glyoxysome) 3-ketoacyl-CoA thiolase, involved in fatty acid b-oxidation during germination and subsequent seedling growth. Mutants have defects in glyoxysomal fatty acid beta-oxidation. EC2.3.1.16 thiolase. |
| AT1G06530 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR2. Involved in mitochondrial morphogenesis. |
| AT2G39970 | Encodes peroxisomal membrane protein 38 (PMP38). Mutation in this protein results in enlargement of peroxisomes. Delivers NAD+ for optimal fatty acid degradation during storage oil mobilization. |
| AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT5G14520 | Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression. |
| AT5G03680 | Recessive mutations are defective in organ initiation and orientation in the second whorl. This gene encodes a trihelix transcription factor whose expression is limited to margins of floral and vegetative organs. Overexpression and double mutant analyses suggest that this gene is involved in limiting lateral growth of organs. |
| AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
| AT1G30490 | Dominant PHV mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Has overlapping functions with PHABULOSA, REVOLUTA and CORONA/ATHB15 in patterning the apical portion of the embryo. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. |
| AT5G35210 | Encodes a chloroplast envelope-bound plant homeodomain (PHD) transcription factor with transmembrane domains that functions in multiple retrograde signal pathways. The proteolytic cleavage of PTM occurs in response to retrograde signals and amino-terminal PTM accumulates in the nucleus, where it activates ABI4 transcription in a PHD-dependent manner associated with histone modifications. |
| AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
| AT4G39230 | encodes a protein whose sequence is similar to phenylcoumaran benzylic ether reductase (PCBER), which catalyzes NADPH-dependent reduction of 8-5' linked lignans such as dehydrodiconiferyl alcohol to give isodihydrodehydrodiconiferyl alcohol. |
| AT5G13800 | Encodes a pheophytinase that is involved in chlorophyll breakdown. Its transcript levels increase during senescence and pph-1 mutants have a stay-green phenotype. |
| AT5G61480 | Encodes PXY, a receptor-like kinase essential for maintaining polarity during plant vascular-tissue development. |
| AT4G19840 | encodes a phloem lectin, similar to phloem lectin in cucumber and celery. Gene is expressed in the phloem, predominantly in the companion cells. The mRNA is cell-to-cell mobile. |
| AT3G61060 | phloem protein 2-A13;(source:Araport11) |
| AT5G52120 | phloem protein 2-A14;(source:Araport11) |
| AT5G45070 | phloem protein 2-A8;(source:Araport11) |
| AT2G02230 | phloem protein 2-B1;(source:Araport11) |
| AT1G56250 | Encodes an F-box protein that can functionally replace VirF, regulating levels of the VirE2 and VIP1 proteins via a VBF-containing SCF complex. It is thought to be involved in DNA integration and T-DNA degradation. |
| AT3G23430 | Encodes a protein with the mainly hydrophilic N-terminal and the C-terminal containing 6 potential membrane-spanning domains. The mutant is deficient in the transfer of phosphate from root epidermal and cortical cells to the xylem. Its expression is repressed by phosphate (Pi) in shoots, and transiently induced by phosphite (Phi) in roots and shoots. PHO is expressed in developing ovules and plays a role in the transfer of Ph from maternal tissues to filial tissues. |
| AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT5G43360 | Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT2G32830 | Encodes Pht1;5, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT3G54700 | Encodes Pht1;7, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
| AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT1G35140 | EXL1 is involved in the C-starvation response. Phenotypic changes of an exl1 loss of function mutant became evident only under corresponding experimental conditions. For example, the mutant showed diminished biomass production in a short-day/low light growth regime, impaired survival during extended night, and impaired survival of anoxia stress. |
| AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
| AT3G09560 | The PAH1 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
| AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
| AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
| AT3G58830 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase that localizes to chloroplasts in above ground plant parts and mitochondria in root tips and root hairs and is involved in the synthesis of plastidial Phosphatidylglycerol (PG). This enzyme is responsible for the second step of PG synthesis. Mutants show reduced root growth. |
| AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT4G01190 | Type I phosphatidylinositol-4-phosphate 5-kinase, subfamily A. Preferentially phosphorylates PtdIns4P. Expressed in flowers and inflorescence stems. |
| AT1G77740 | Encodes PIP5K2, a phosphatidylinositol-4-phosphate 5-kinase (PtdIns(4)P 5-kinase 2; or PIP5K2 that is involved in regulating lateral root formation and root gravity response. The mRNA is cell-to-cell mobile. |
| AT3G47220 | Encodes a plasma membrane-localized phosphoinositide-specific phospholipase C with a role in thermotolerance. |
| AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
| AT5G57190 | Encodes the minor form of the two non-mitochondrail phosphatidylserine decarboxylase. The gene expression level is very low. Located at the tonoplast. |
| AT1G15110 | PSS1 encodes a base-exchange-type Phosphatidylserine (PS) synthase. Mutant analysis revealed its role in pollen maturation. |
| AT4G37870 | Encodes a phosphoenolpyruvate carboxykinase that localizes to the cytosol. |
| AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
| AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
| AT1G08650 | Encodes a phosphoenolpyruvate carboxylase kinase that is expressed at highest levels in leaves. Expression is induced by light. The mRNA is cell-to-cell mobile. |
| AT1G12680 | phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11) |
| AT1G17710 | Encodes a phosphoethanolamine/phosphocholine phosphatase. It is likely to be involved in the liberation of inorganic phosphate from intracellular sources. Expression is upregulated in the shoot of cax1/cax3 mutant. |
| AT2G22480 | Phosphofructokinase isoform; target of plastidic thioredoxin-f-dependent redox regulation. |
| AT4G24450 | phosphoglucan, water dikinase;(source:Araport11) |
| AT1G23190 | Encodes a cytosolic phosphoglucomutase (PGM). Two Arabidopsis PGM proteins (AT1G70730/PGM2 and AT1G23190/PGM3) have high sequence similarities and redundant functions. Mature plants possessing a single cPGM allele had a major reduction in cPGM activity. Whereas pgm2 and pgm3 single mutants are undistinguishable from the wild type, loss of both PGM2 and PGM3 severely impairs male and female gametophyte development. The mRNA is cell-to-cell mobile. |
| AT1G79550 | Encodes cytosolic phosphoglycerate kinase (PGK3). Expression studies in PGK mutants showed that PGK1 and PGK3 were down-regulated in pgk3.2 and pgk1.1, respectively. These results indicate that the down-regulation of photosynthetic activity could be a plant strategy when glycolysis is impaired to achieve metabolic adjustment and optimize growth. |
| AT3G12780 | PGK1 was localized exclusively in the chloroplasts of photosynthetic tissues and is the photosynthetic isoform. The pgk1.1 knock-down mutant displayed reduced growth, lower photosynthetic capacity and starch content. Expression studies in PGK mutants showed that PGK1 and PGK3 were down-regulated in pgk3.2 and pgk1.1, respectively. These results indicate that the down-regulation of photosynthetic activity could be a plant strategy when glycolysis is impaired to achieve metabolic adjustment and optimize growth (DOI:10.1104/pp.17.01227).Functions redundantly with AT1G56190 in the chloroplast in the biosynthesis of thylakoid membrane galactolipids. Double mutants are photosynthetically incompetent, plants are albino and seedling lethal |
| AT2G26560 | Encodes a lipid acyl hydrolase with wide substrate specificity that accumulates upon infection by fungal and bacterial pathogens. Protein is localized in the cytoplasm in healthy leaves, and in membranes in infected cells. Plays a role in cell death and differentially affects the accumulation of oxylipins. Contributes to resistance to virus. |
| AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT1G13680 | Encodes a phospholipase C-like protein that serves as a convergence point for fumonisin B1 and extracellular ATP signalling, and functions in Arabidopsis stress response to fumonisin B1. |
| AT1G52570 | member of C2-PLD subfamily |
| AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
| AT1G55180 | member of C2-PLD. subfamily Represents a phospholipase D (PLD) gene with four exons, hence it is a member of the alpha class. Its amino acid sequence is quite different from other PLDs, therefore it might possess unique structural and/or catalytic properties. |
| AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
| AT3G16785 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Does not appear to be involved in root hair patterning. Not induced upon Pi starvation. |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
| AT5G13640 | arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT) |
| AT2G45790 | Encodes a cytoplasmic phosphomannomutase, involved in ascorbate biosynthesis |
| AT2G42910 | Phosphoribosyltransferase family protein;(source:Araport11) |
| AT2G44530 | Phosphoribosyltransferase family protein;(source:Araport11) |
| AT1G10700 | Encodes a P-independent phosphoribosyl pyrophosphate (PRPP) synthase. |
| AT1G29410 | Encodes phosphoribosylanthranilate isomerase which catalyzes the third step in tryptophan biosynthesis. |
| AT1G32060 | phosphoribulokinase;(source:Araport11) |
| AT2G32260 | phosphorylcholine cytidylyltransferase;(source:Araport11) |
| AT4G35630 | Encodes a phosphoserine aminotransferase which is involved in serine biosynthesis in the chloroplast which operates via the phosphorylated pathway. The mRNA is cell-to-cell mobile. |
| AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
| AT3G12810 | Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile. |
| AT3G13670 | MUT9-like protein kinase. Contributes to phosphorylation of photoexcited CRY2. Interaction with CRY2 occurs via the non catalytic PPKC domain.MLK4 phosphorylates the conserved H2A serine 95 residue. Synthetic mutants that cannot phosphorylate H2AS95 fail to complement the late flowering phenotype suggesting that MLK4 promotes long day flowering via phosphorylation.MLK4 is required for H2A295 phosphorylation of GI. |
| AT3G47390 | Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant. |
| AT1G25520 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT2G39470 | PsbP-like protein 2;(source:Araport11) |
| AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
| AT2G30170 | Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens. |
| AT2G05100 | Lhcb2.1 protein encoding a subunit of the light harvesting complex II. Member of a gene family with high degree of sequence similarity. Initially LHCB2.3 was considered as a separate gene but appears to be an allele of LHCB2.1. |
| AT3G27690 | Encodes Lhcb2.4. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. The mRNA is cell-to-cell mobile. |
| AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
| AT3G21055 | Encodes photosystem II 5 kD protein subunit PSII-T. This is a nuclear-encoded gene (PsbTn) which also has a plastid-encoded paralog (PsbTc). |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT4G32070 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G29000 | MYB-CC family member. PHL1 acts redundantly with PHR1 to regulate responses to Pi starvation. |
| AT3G24120 | MYB-CC protein involved in regulation of response to phosphate starvation. |
| AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
| AT4G14330 | Orphan kinesin with processive motility on single microtubules. |
| AT2G26710 | Encodes a member of the cytochrome p450 family that serves as a control point between multiple photoreceptor systems and brassinosteroid signal transduction. Involved in brassinolide metabolism. Mediates response to a variety of light signals including hypocotyl elongation and cotyledon expansion. |
| AT1G68890 | Homologous to the four eubacterial men genes involved in menanoquinone biosynthesis. Studies of mutants defective in this gene demonstrated its involvement in phylloquinone biosynthesis in Arabidopsis. The mRNA is cell-to-cell mobile. |
| AT2G01490 | Encodes a phytanoyl-CoA 2-hydroxylase (PAHX). The mRNA is cell-to-cell mobile. |
| AT5G48150 | Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. |
| AT1G25540 | Encodes a nuclear protein that acts in a phyB pathway (but downstream of phyB) and induces flowering in response to suboptimal light conditions. PFT1 promotes flowering in CO dependent and independent pathways and integrates several environmental stimuli, such as light quality and JA-dependent defenses. Mutants are hypo-responsive to far-red and hyper-responsive to red light and flower late under long day conditions. Also shown to be a Mediator subunit regulating jasmonate-dependent defense. |
| AT1G09530 | Transcription factor interacting with photoreceptors phyA and phyB. Forms a ternary complex in vitro with G-box element of the promoters of LHY, CCA1. Acts as a negative regulator of phyB signalling. It degrades rapidly after irradiation of dark grown seedlings in a process controlled by phytochromes. Does not play a significant role in controlling light input and function of the circadian clockwork. Binds to G- and E-boxes, but not to other ACEs. Binds to anthocyanin biosynthetic genes in a light- and HY5-independent fashion. PIF3 function as a transcriptional activator can be functionally and mechanistically separated from its role in repression of PhyB mediated processes. |
| AT3G62090 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
| AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT3G46640 | Encodes a myb family transcription factor with a single Myb DNA-binding domain (type SHAQKYF) that is unique to plants and is essential for circadian rhythms, specifically for transcriptional regulation within the circadian clock. LUX is required for normal rhythmic expression of multiple clock outputs in both constant light and darkness. It is coregulated with TOC1 and seems to be repressed by CCA1 and LHY by direct binding of these proteins to the evening element in the LUX promoter. The mRNA is cell-to-cell mobile. |
| AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
| AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
| AT1G06570 | Mutation of the PDS1 locus disrupts the activity of p-hydroxyphenylpyruvate dioxygenase (HPPDase), the first committed step in the synthesis of both plastoquinone and tocopherols in plants. |
| AT1G13590 | Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus. |
| AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
| AT5G65870 | Probable phytosulfokines 5 precursor, coding for a unique plant peptide growth factor. |
| AT5G53890 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation. |
| AT1G54570 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT3G26840 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
| AT2G48060 | Similar to mechanically sensitive ion channel identified in mouse. Mutants display root helical growth phenotype in agar media suggesting a role in mechanoperception at the root cap. |
| AT1G66520 | formyltransferase;(source:Araport11) |
| AT1G05750 | Encodes a pentatricopeptide repeat protein required for editing of rpoA and clpP chloroplast transcripts. |
| AT2G01190 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT1G68450 | VQ motif-containing protein;(source:Araport11) |
| AT2G01140 | Aldolase superfamily protein;(source:Araport11) |
| AT1G73590 | Encodes an auxin efflux carrier involved in shoot and root development. It is involved in the maintenance of embryonic auxin gradients. Loss of function severely affects organ initiation, pin1 mutants are characterised by an inflorescence meristem that does not initiate any flowers, resulting in the formation of a naked inflorescence stem. PIN1 is involved in the determination of leaf shape by actively promoting development of leaf margin serrations. In roots, the protein mainly resides at the basal end of the vascular cells, but weak signals can be detected in the epidermis and the cortex. Expression levels and polarity of this auxin efflux carrier change during primordium development suggesting that cycles of auxin build-up and depletion accompany, and may direct, different stages of primordium development. PIN1 action on plant development does not strictly require function of PGP1 and PGP19 proteins. |
| AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
| AT1G20925 | Member of family of proteins that are similar to PIN auxin transporter. |
| AT1G76520 | Auxin efflux carrier family protein;(source:Araport11) |
| AT1G76530 | Auxin efflux carrier family protein;(source:Araport11) |
| AT5G65980 | Auxin efflux carrier family protein;(source:Araport11) |
| AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
| AT2G26700 | Member of AGC VIIIa Kinase gene family. Encodes PID2, a homolog of PID. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT5G18410 | distorted trichomes and exhibits a diffuse actin cytoskeleton |
| AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
| AT1G14870 | PCR2 encodes a membrane protein involved in zinc transport and detoxification. |
| AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT3G18660 | Plants expressing an RNAi construct specifically targeting PGSIP1 was shown to have a dramatically reduced amount of starch. Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT1G54940 | Encodes a xylan glucuronosyltransferase. |
| AT1G08990 | plant glycogenin-like starch initiation protein 5;(source:Araport11) |
| AT3G22590 | Encodes PLANT HOMOLOGOUS TO PARAFIBROMIN (PHP), a homolog of human Paf1 Complex (Paf1C) subunit Parafibromin. Human Parafibromin assists in mediating output from the Wnt signaling pathway, and dysfunction of the encoding gene HRPT2 conditions specific cancer-related disease phenotypes. PHP resides in a ~670-kDa protein complex in nuclear extracts, and physically interacts with other known Paf1C-related proteins in vivo. Loss of PHP specifically conditioned accelerated phase transition from vegetative growth to flowering and resulted in misregulation of a very limited subset of genes that included the flowering repressor FLOWERING LOCUS C (FLC). Member of PAF-C complex. |
| AT4G35470 | Encodes PIRL4, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
| AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
| AT3G54850 | Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro. Regulator of flowering time. |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
| AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G23140 | PUB4 encodes a functional ubiquitin-protein ligase. The gene is expressed in most plant tissues and the protein localizes to the nucleus. PUB4 has been recovered as a second site suppressor from several different genetic screens and from these, it has been inferred to have roles in regulating root development, pollen tapetum development and ROS induced chloroplast degredation. |
| AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G18340 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress. E3 ligase which acts as a regulator in the heat response signaling pathway. Over-expressing AtPUB48 could induce the expression of the heat-related genes (HSP101, HSP70, HSP25.3, HSFA2, and ZAT12). Enhances plant resistance to heat stress during seed germination and seedling growth. |
| AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
| AT3G07360 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
| AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
| AT3G54110 | Member of Uncoupling protein PUMP2 family. Encodes a mitochondrial uncoupling protein AtUCP1 involved in maintain the redox poise of the mitochondrial electron transport chain to facilitate photosynthetic metabolism. Disruption of UCP1 results in a photosynthetic phenotype. Specifically there is a restriction in photorespiration with a decrease in the rate of oxidation of photorespiratory glycine in the mitochondrion. This change leads to an associated reduced photosynthetic carbon assimilation rate. The mRNA is cell-to-cell mobile. |
| AT3G29380 | Encodes a TFIIB-related protein expressed in the reproductive organs and seeds. Loss-of-function specifically affects the development of the syncytial endosperm. It is not required for RNA polymerase IV or V activities. |
| AT2G02850 | Encodes plantacyanin one of blue copper proteins. Involved in anther development and pollination. Expressed in the transmitting tract of the pistil. |
| AT4G00430 | a member of the plasma membrane intrinsic protein subfamily PIP1. involved redundantly with PIP1;1/2/3/5 in hydraulics and carbon fixation, regulates the expression of related genes that affect plant growth and development. |
| AT3G54820 | plasma membrane intrinsic protein 2;(source:Araport11) |
| AT4G35100 | a member of the plasma membrane intrinsic protein PIP. functions as aquaporin. Salt-stress-inducible MIP |
| AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
| AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT2G01660 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT1G19880 | Encodes a regulator of chromatin condensation 1 (RCC1) family protein; confers plasticity of rosette diameter in response to changes in N availability. |
| AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
| AT3G62590 | PLIP3 is a glycerolipid A1 lipase with substrate specificity for phosphatidylglycerol. Expression is induced by ABA. |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT5G20610 | Encodes a member of a plant specific C2 domain containing gene family. Along with PMI, it appears to be involved in chloroplast and nuclear relocation in response to light. |
| AT2G33450 | Ribosomal L28 family;(source:Araport11) |
| AT1G64510 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
| AT3G15190 | chloroplast 30S ribosomal protein S20;(source:Araport11) |
| AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT5G16150 | Encodes a putative plastidic glucose transporter. |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT2G22170 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT5G65158 | Lipase/lipooxygenase, PLAT/LH2 family protein;(source:Araport11) |
| AT5G51600 | Mutant has defective roots. Essential for giant cell ontogenesis. Role in organizing the mitotic microtubule array during both early and late mitosis in all plant organs. |
| AT1G51190 | Encodes a member of the AINTEGUMENTA-like (AIL) subclass of the AP2/EREBP family of transcription factors and is essential for quiescent center (QC) specification and stem cell activity. It is a key effector for establishment of the stem cell niche during embryonic pattern formation. It is transcribed in response to auxin accumulation and is dependent on auxin response transcription factors. |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT5G17480 | pollen calcium-binding protein 1;(source:Araport11) |
| AT2G16505 | Encodes a Maternally expressed gene (MEG) family protein. Expressed in pollen and involved in pollen-stigma interaction. |
| AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT1G22760 | Putative poly(A) binding protein May there fore function in posttranscriptional regulation, including mRNA turnover and translational initiation. Expression detected only in floral organs. |
| AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
| AT1G71770 | Encodes a Class I polyA-binding protein. Expressed in floral organs. Binds polyA sepharose in vitro. |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT5G13700 | Encodes a protein with polyamine oxidase activity. The mRNA of this gene is only expressed in very low amounts in the organs where it was detected (light-grown plants). |
| AT2G43020 | Encodes a polyamine oxidase. |
| AT3G59050 | Encodes a polyamine oxidase. |
| AT1G65840 | encodes a peroxisomal polyamine oxidase, involved in the back-conversion polyamine degradation pathway. Among the five polyamine oxidases in the Arabidopsis genome, PAO4 is the major isoform in root peroxisomes. The mRNA is cell-to-cell mobile. |
| AT1G31830 | Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein. |
| AT1G70370 | Polygalacturonase involved in cell wall modification. |
| AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
| AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
| AT1G72590 | Encodes a polyphenol reductase. |
| AT2G16530 | Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal |
| AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
| AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
| AT4G39920 | Microtubule-folding cofactor, produces assembly-competent alpha-/beta-tubulin heterodimers. |
| AT2G31370 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
| AT4G18290 | Encodes KAT2, a member of the Shaker family potassium ion (K+) channel. Critical to stomatal opening induced by blue light. Critical to circadian rhythm of stomatal opening. Involved in plant development in response to high light intensity. Under high light intensity, the mutant plant produced less biomass compared to the wild type. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT2G30070 | Encodes a high affinity potassium transporter. |
| AT5G14880 | Potassium transporter family protein;(source:Araport11) |
| AT5G58600 | Belongs to a large family of plant-specific genes of unknown function. Involved in resistance to the powdery mildew species Erysiphe cichoracearum and Erysiphe orontii, but not to the unrelated pathogens Pseudomonas syringae or Peronospora parasitica. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G21210 | Encodes a PPDK regulatory protein that has both protein kinase and protein phosphatase activities towards PPDK (pyruvate orthophosphate dikinase). |
| AT5G51700 | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
| AT1G44910 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
| AT1G49800 | Homolog of PIP1. |
| AT5G23290 | prefoldin 5;(source:Araport11) |
| AT5G05987 | prenylated RAB acceptor 1.A2;(source:Araport11) |
| AT1G17700 | prenylated RAB acceptor 1.F1;(source:Araport11) |
| AT2G27820 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
| AT3G19170 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers |
| AT2G28610 | Encodes a homeodomain containing protein that regulates lateral axis-dependent development of Arabidopsis flowers and is required for cell proliferation. It is expressed in a restricted number of L1 cells at the lateral regions of flower primordia, floral organ primordia, and young leaf primordia. |
| AT5G09520 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT3G21295 | Pro-Trp-Pro-Trp repeat protein. |
| AT1G56650 | Encodes a putative MYB domain containing transcription factor involved in anthocyanin metabolism and radical scavenging. Essential for the sucrose-mediated expression of the dihydroflavonol reductase gene. Auxin and ethylene responsiveness of PAP1 transcription is lost in myb12 mutants. Interacts with JAZ proteins to regulate anthocyanin accumulation. |
| AT4G29350 | Encodes profilin2, a low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Expressed in vegetative organs. The first intron of PRF2 enhances gene expression. The mRNA is cell-to-cell mobile. |
| AT2G19770 | Encodes profilin 5, originally named profilin 4 (PRO4/PFN4). Low-molecular weight, actin monomer-binding protein that regulates the organization of actin cytoskeleton. Pollen-specific plant profilin present predominantly in mature pollen and growing pollen tubes. |
| AT1G29850 | Encodes a protein that by its interaction with HAM acetyltransferases plays an important role during DNA damage responses induced by UV-B radiation and participates in programmed cell death programs. |
| AT1G07370 | Encodes putative proliferating cell nuclear antigen involved in cell cycle regulation. May be sumoylated. |
| AT2G28625 | Encodes a cytoplasmic protein that genetically interacts with AtRZF1, a RING-type subunit of the E3 ubiquitin ligase family, to mediate proline accumulation in response to abiotic stress. |
| AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots. |
| AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT2G21140 | Proline-rich protein expressed in expanding leaves, stems, flowers, and siliques. |
| AT4G38770 | Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant. |
| AT5G02190 | encodes an aspartic protease, has an important role in determining cell fate during embryonic development and in reproduction processes. The loss-of-function mutation of PCS1 causes degeneration of both male and female gametophytes and excessive cell death of developing embryos during torpedo stage. |
| AT5G35590 | Encodes 20S proteasome subunit PAA1 (PAA1). |
| AT3G12270 | protein arginine methyltransferase 3;(source:Araport11) |
| AT5G49020 | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
| AT3G06930 | Encodes an type I protein arginine methyltransferase. PRMT4b can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
| AT3G20020 | protein arginine methyltransferase 6;(source:Araport11) |
| AT1G55480 | Encodes a member of a novel plant protein family containing a PDZ, a K-box, and a TPR motif. mRNA but not protein levels decrease after wounding. ZKT is phosphorylated at Thr and Ser residues after wounding. The mRNA is cell-to-cell mobile. |
| AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
| AT5G53920 | Protein methyltransferase. One target is PRPL11 which it methylates on Lys 109. |
| AT3G25800 | one of three genes encoding the protein phosphatase 2A regulatory subunit |
| AT2G42500 | Encodes one of the isoforms of the catalytic subunit of protein phosphatase 2A: AT1G59830/PP2A-1, AT1G10430/PP2A-2, At2g42500/PP2A-3, At3g58500/PP2A-4 [Plant Molecular Biology (1993) 21:475-485 and (1994) 26:523-528; Note that in more recent publications, there is mixed use of gene names for PP2A-3 and PP2A-4 - some refer to At2g42500 as PP2A-3 and some as PP2A-4]. ACR4 phosphorylates the PROTEIN PHOSPHATASE 2A-3 (PP2A-3) catalytic subunit of the PP2A phosphatase holoenzyme and PP2A dephosphorylates ACR4. |
| AT5G36250 | Encodes a myristoylated 2C-type protein phosphatase that interacts with the catalytic subunit of SnRK1. The mRNA is cell-to-cell mobile. |
| AT3G11410 | Encodes protein phosphatase 2C. Negative regulator of ABA signalling. Expressed in seeds during germination. mRNA up-regulated by drought and ABA. |
| AT3G51390 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
| AT1G68820 | Putative C3HC4 zinc-finger ubiquitin E3 ligase, negative regulator in ABA and drought stress response. May act as a positive role in regulating the high temperature by mediating the degradation of unknown target proteins. |
| AT1G18470 | Putative C3HC4 zinc-finger ubiquitin E3 ligase that is induced by ABA and plays a positive role in ABA signaling. |
| AT3G48330 | Encodes protein-L-isoaspartate methyltransferase. Important for maintaining viability as the seed ages. Involved in germination. |
| AT2G16650 | Encodes a proteinaceous RNase P that supports RNase P activity in vivo in both organelles and the nucleus. It is also involved in the maturation of small nucleolar RNA (snoRNA) and mRNA. |
| AT5G02310 | Encodes PROTEOLYSIS6 (PRT6), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Another component of the N-end rule pathway is arginyl-tRNA:protein arginyltransferase (ATE). Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. The mRNA is cell-to-cell mobile. |
| AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
| AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
| AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
| AT2G05620 | Involved in electron flow in Photosystem I. Essential for photoprotection. |
| AT3G25840 | Spliceosome-associated kinase involved in alternative splicing. May influence alternative splicing patterns by phosphorylating a subset of splicing regulators. |
| AT4G28750 | mutant has Decreased effective quantum yield of photosystem II; Pale green plants; Reduced growth rate; Subunit E of Photosystem I |
| AT3G56650 | thylakoid lumenal protein (Mog1/PsbP/DUF1795-like photosystem II reaction center PsbP family protein);(source:Araport11) |
| AT1G49350 | PsiMP Glycosylase (PUMY) that hydrolyzes PsiMP to uracil and ribose-5-phosphate. Acts together with PUMY in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. Acts together with the a pseudouridine kinase PUKI in the peroxisome to prevent toxic pseudouridine monophosphate accumulation. |
| AT3G19420 | Encodes a phosphatase with low in vitro tyrosine phosphatase activity that is capable of dephosphorylating in vitro the 3'phosphate group of PI3P, PI(3,4)P2, and PI(3,5)P2 and may be an effector of lipid signaling. The mRNA is cell-to-cell mobile. |
| AT2G47060 | Encodes Pto-interacting 1-4 (PTI1-4), a member of the PTI1-like serine/threonine protein kinases that share strong sequence identity to the tomato PTI1 kinase. |
| AT1G35850 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G21620 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G09610 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G01410 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT3G16810 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G09830 | glycinamide ribonucleotide synthetase (GAR synthetase) that catalyzes the conversion of phosphoribosyl amine to phosphoribosyl glycineamide |
| AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
| AT1G75470 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT3G07130 | Encodes PAP15, a purple acid phosphatase with phytase activity. Expression of PAP15 is developmentally and temporally regulated, with strong expression at the early stages of seedling growth and pollen germination. The expression is also organ/tissue-specific, with strongest expression in the vasculature, pollen grains, and roots. Recombinant PAP protein exhibits broad substrate specificity with moderate phytase activity. PAP15 likely mobilizes phosphorus reserves in plants, particularly during seed and pollen germination. |
| AT3G10150 | purple acid phosphatase 16;(source:Araport11) |
| AT3G17790 | Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT5G34850 | Encodes a root-secreted purple acid phosphatase precursor involved in extracellular phosphate-scavenging. |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT5G63140 | purple acid phosphatase 29;(source:Araport11) |
| AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
| AT2G01880 | PEP complex component. |
| AT2G01890 | Encodes a purple acid phosphatase (PAP) belonging to the low molecular weight plant PAP group. |
| AT1G77720 | Encodes a predicted protein kinase based on sequence similarity. |
| AT3G17410 | Positively regulates ABA-mediated physiological responses via phosphorylation on RCAR3/ RCAR11. |
| AT1G01690 | Encodes a novel plant-specific protein that is involved in meiotic double strand break formation. |
| AT2G36570 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G01890 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT1G73000 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT4G01026 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of ABI1 and ABI2. |
| AT4G17870 | Encodes a member of the PYR (pyrabactin resistance )/PYL(PYR1-like)/RCAR (regulatory components of ABA receptor) family proteins with 14 members. PYR/PYL/RCAR family proteins function as abscisic acid sensors. Mediate ABA-dependent regulation of protein phosphatase 2Cs ABI1 and ABI2. |
| AT3G16050 | Encodes a protein with pyridoxal phosphate synthase activity whose transcripts were detected mostly in roots and accumulate during senescence. The protein was found in very low abundance, which prevented a specific localisation. |
| AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
| AT5G23300 | dihydroorotate dehydrogenase, catalyses fourth step of pyrimidine biosynthesis |
| AT5G09650 | Encodes a protein with inorganic pyrophosphatase activity. |
| AT4G33070 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT1G01090 | pyruvate dehydrogenase E1 alpha subunit |
| AT1G30120 | Encodes a putative plastid pyruvate dehydrogenase E1 beta subunit that is distinct from the mitochondrial pyruvate dehydrogenase E1 beta subunit. |
| AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
| AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
| AT2G01350 | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT5G50210 | Encodes an Fe-S binding protein with quinolinate synthase (QS) activity and cysteine desulfurase activator activity. The QS activity was demonstrated by functional complementation of corresponding E. coli mutants and complementation of embryo-lethal phenotypes of the QS homozygous null allele in Arabidopsis. The SufE domain of the protein also stimulates the cysteine desulfurase activity of CpNifS (AT1G08490) in vitro. This protein binds a (4Fe-Su)2+ cluster in its NadA domain and is localized in the chloroplast. |
| AT1G49890 | Together with QWRF1 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT2G20815 | QWRF motif protein (DUF566);(source:Araport11) |
| AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
| AT3G12070 | RAB geranylgeranyl transferase beta subunit 2;(source:Araport11) |
| AT4G17530 | AtRabD2c encodes a Rab GTPase, which plays important roles in pollen development, germination and tube elongation. |
| AT3G53610 | GTPase AtRAB8 (atrab8). AtRAB8s associate with the endomembrane system and modulate tubulovesicular trafficking between compartments of the biosynthetic and endocytic pathways. Together with RAB8A and 8D interacts with several RTNLB proteins and participates in A. tumefaciens and P. syringae infection processes. |
| AT5G03520 | GTPase that colocalizes with golgi and plasma membranes. |
| AT4G18800 | Encodes RabA1d, a member of the RabA subfamily of small Rab GTPases. |
| AT5G60860 | RAB GTPase homolog A1F;(source:Araport11) |
| AT2G33870 | RAB GTPase homolog A1H;(source:Araport11) |
| AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
| AT1G01200 | RAB GTPase homolog A3;(source:Araport11) |
| AT4G39990 | Rab GTPase that selectively marks cell wall-containing TGN compartments. Involved in protein trafficking to membranes during tip growth. |
| AT3G09900 | RAB GTPase homolog E1E;(source:Araport11) |
| AT3G16100 | RAB GTPase homolog G3C;(source:Araport11) |
| AT4G39890 | RAB GTPase homolog H1C;(source:Araport11) |
| AT5G06070 | Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus. |
| AT1G19510 | RAD-like 5;(source:Araport11) |
| AT1G75250 | RAD-like 6;(source:Araport11) |
| AT5G50340 | DNA repair protein RadA-like protein;(source:Araport11) |
| AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
| AT5G47870 | cobalt ion-binding protein;(source:Araport11) |
| AT5G27920 | Encodes a nuclear F-box protein that can directly interact with the C2H2‐type zinc finger transcription factor STOP1 and promote its ubiquitination and degradation. STOP1 is crucial for aluminum (Al) resistance. |
| AT4G01265 | Pseudogene of AT4G01265; raffinose synthase family protein |
| AT2G20660 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT2G34825 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G05490 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT3G23805 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
| AT1G28270 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF4 and RALF19 act redundantly in the pollen tube to regulate pollen tube growth. |
| AT1G60815 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT1G61563 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT5G19320 | Encodes RAN GTPase activating protein 2. The protein is localized to the nuclear envelope during interphase. |
| AT3G05880 | Induced by low temperatures, dehydration and salt stress and ABA. Encodes a small (54 amino acids), highly hydrophobic protein that bears two potential transmembrane domains. |
| AT1G02130 | Belongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation. |
| AT5G55080 | A member of RAN GTPase gene family. |
| AT5G48330 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G55510 | Encodes a regulator of floral determinacy in that interacts with both nucleolar and nucleoplasmic proteins. |
| AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT1G71390 | receptor like protein 11;(source:Araport11) |
| AT1G71400 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. The mRNA is cell-to-cell mobile. |
| AT2G15080 | receptor like protein 19;(source:Araport11) |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT2G32680 | NLP20 LRR receptor protein involved in PAMP mediated immunity. |
| AT3G05370 | receptor like protein 31;(source:Araport11) |
| AT3G05650 | receptor like protein 32;(source:Araport11) |
| AT3G23010 | receptor like protein 36;(source:Araport11) |
| AT3G24982 | receptor like protein 40;(source:Araport11) |
| AT4G13880 | receptor like protein 48;(source:Araport11) |
| AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
| AT4G13920 | receptor like protein 50;(source:Araport11) |
| AT5G49290 | receptor like protein 56;(source:Araport11) |
| AT2G18890 | RLCK VI_A class kinase which activity is regulated by Rho-of-plants (ROP) GTPases. Controls seedling and plant growth in parallel with gibberrellin. |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT1G29750 | Receptor-like serine/threonine kinase (RKF1). The putative extracellular domain of the RKF1 protein contains 13 tandem repeats of leucine-rich sequences. Expressed in early flower primordial, stamen, and pollen grains. |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT1G69270 | RPK1 is a leucine-rich receptor-like kinase located in the plasma membrane which is upregulated by abscisic acid, dehydration, high salt, low temperature, but not by other plant hormones. RPK1 knock-out and antisense plants show an ABA-insensitive phenotype. RPK1 plays a role in ABA-controlled cell proliferation and is a regulator of the ABA signal transduction pathway. Overexpression of the LRR domain has a dominant negative effect on RPK1. Mutations in RPK1 uncouple cotyledon anlagen and primordia by modulating epidermal cell shape and polarity. |
| AT4G00340 | Encodes a receptor-like protein kinase that is expressed in roots. |
| AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
| AT4G16950 | Contains a putative nucleotide binding site and leucine-rich repeats. Similar to the plant resistance genes N and L6, and to the toll and interleukin-1 receptors. Confers resistance to Peronospora parasitica.Redundant function together with SIKIC1 and 3 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
| AT1G58602 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
| AT2G47700 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
| AT1G01320 | Encodes REDUCED CHLOROPLAST COVERAGE 1 (REC1) a protein with similarity to the FLOURY locus in maize. Located in the nucleus and cytosol. Contributes to establishing the size of the chloroplast compartment. |
| AT4G28080 | Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment. |
| AT4G11040 | Encodes a nuclear localized protein with sequence similarity to PP2C phosphatases that is involved in seed dormancy. Loss of function mutations have reduced seed dormancy but does not act through ABA or DOG1 pathways. Lacks several conserved key residues and does not possess any appreciable phosphatase activity in in vitro assays. QTL allele with a nonsynonymous amino acid change confers seed dormancy phenotype. |
| AT5G09680 | Encodes RLF (Reduced Lateral root Formation). Involved in lateral root formation. Contains a cytochrome b5-like heme/steroid binding domain. Localized in the cytosol. |
| AT3G61730 | Encodes a nuclear localized F-box protein that is involved in tapetal layer degeneration and pollen development. Interacts with ASK1 and that interaction is mediated by the F-box domain. |
| AT3G15820 | Functions as phosphatidylcholine:diacylglycerol cholinephosphotransferase, a major reaction for the transfer of 18:1 into phosphatidylcholine for desaturation and also for the reverse transfer of 18:2 and 18:3 into the triacylglycerols synthesis pathway |
| AT1G25260 | Involved in male gamete development. Trans-acting factor in the assembly of the pre-60S particle. |
| AT1G19360 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT2G34410 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT5G40450 | Encodes a member of a plant gene family, APK_ORTHOMCL5144,of unknown function. RBB1 is localized to the cytosol and involved in vacuolar biogenesis and organization. RBB1 mutants have increased number of vacuolar bulbs and fewer trans-vacuolar strands. |
| AT3G17170 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
| AT3G26090 | Encodes AtRGS1, a putative membrane receptor for D-glucose. Also functions as a regulator of G-protein signaling. Has GTPase-accelerating activity. Regulates the activity of AtGPA1. Lines over-expressing the gene are more tolerant to dehydration and root elongation. These phenotypes are dependent on ABA. Nuclear localization of the protein is dependent on ABA. RGS1 endocytosis is induced by JA which promotes its dissociation from GPA1. |
| AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
| AT2G20140 | Encodes one of the two RPT2 (26S proteasome subunit RPT2) paralogs: RPT2a (At4g29040) and RPT2b (At2g20140). RPT2b can not complement the rpt2a mutant phenotype. rpt2a rpt2b double mutants are embryo lethal. |
| AT4G38630 | Regulatory particle non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
| AT3G05530 | Encodes RPT5a (Regulatory Particle 5a), one of the six AAA-ATPases of the proteasome regulatory particle. Essential for gametophyte development. In Arabidopsis, the RPT5 subunit is encoded by two highly homologous genes, RPT5a and RPT5b. RPT5a and RPT5b show accession-dependent functional redundancy. In Wassilewskija (Ws) accession: mutant alleles of RPT5a displayed 50% pollen lethality, indicating that RPT5a is essential for male gametophyte development. In the Columbia (Col) accession, a rpt5a mutant allele did not display such a phenotype because the RPT5b Col allele complements the rpt5a defect in the male gametophyte, whereas the RPT5b Ws allele does not. Double rpt5a rpt5b mutants in Col background showed a complete male and female gametophyte lethal phenotype. The mRNA is cell-to-cell mobile. |
| AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
| AT3G14230 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
| AT1G78080 | Encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family (RAP2.4). The protein contains one AP2 domain. Role in mediating light and ethylene signaling. The mRNA is cell-to-cell mobile. |
| AT1G22190 | The gene encodes a putative transcription factor belongings to the abiotic stress-associated DREB A-6 clade. The mRNA is cell-to-cell mobile. |
| AT1G43160 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family (RAP2.6). The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT4G06746 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.9). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1 and RAP2.10. |
| AT3G61260 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. Negatively regulates the cell-to-cell movement of TuMV via competition with PCaP1 for binding actin filaments. |
| AT3G57540 | Remorin family protein;(source:Araport11) |
| AT5G22010 | Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing. |
| AT5G02030 | Mutant has additional lateral organs and phyllotaxy defect. Encodes a homeodomain transcription factor. Has sequence similarity to the Arabidopsis ovule development regulator Bell1. Binds directly to the AGAMOUS cis-regulatory element. Its localization to the nucleus is dependent on the coexpression of either STM or BP. |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
| AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
| AT4G31610 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. Expressed specifically in reproductive meristems. |
| AT5G67630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G62270 | BOR2 is involved in efficient borate crosslinking of rhamnogalacturonan II in cell walls under boron limitation. |
| AT1G15460 | Encodes a efflux-type boron transporter. Over-expression improved plant growth under B toxic conditions. |
| AT1G74810 | HCO3- transporter family;(source:Araport11) |
| AT3G57710 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
| AT4G16990 | disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT5G22330 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G54640 | Isolated from T-DNA insertion line, the rat5 mutant is deficient in T-DNA integration. Encodes histone2A protein. |
| AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT5G45260 | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2. |
| AT5G07390 | respiratory burst oxidase homolog A;(source:Araport11) |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
| AT3G16857 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
| AT1G67710 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Affects ABA-JA crosstalk. |
| AT2G27070 | member of Response Regulator: B- Type |
| AT3G04280 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family. ARR22 is more similar to the receiver domains of hybrid kinases than other response regulators. It acts as a phosphohistidine phosphatase when tested with phospho-AHP5 in vitro suggesting that it might be involved in a two-component phosphorelay. Expression of ARR22 transcripts appears to be localized to the chalaza and to be induced by wounding. Ectopic expression of ARR in other parts of the plant leads to reduced cytokinin-related responses and impaired root, shoot, and flower development. Overexpression of wild-type ARR22 in an arr22 mutant background causes variable defects in plant growth and fertility. But, in the same ar22 background, over-expression of versions of ARR22 that should act as dominant-negative or constitutively active proteins, based on mutations to the conserved Asp residue, do not show any phenotypic abnormalities, raising the possibility that these may not act as canonical response regulators. |
| AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
| AT3G49570 | response to low sulfur 3;(source:Araport11) |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
| AT2G33380 | Encodes a calcium binding protein whose mRNA is induced upon treatment with NaCl, ABA and in response to desiccation. mRNA expression under drought conditions is apparent particularly in leaves and flowers. Isoform of caleosin with a role as a peroxygenase involved in oxylipin metabolism during biotic and abiotic stress. Involved in the production of 2-hydroxy-octadecatrienoic acid. The peroxygenase has a narrow substrate specificity thus acting as a fatty acid hydroperoxide reductase in vivo. |
| AT4G27410 | Encodes a NAC transcription factor induced in response to desiccation. It is localized to the nucleus and acts as a transcriptional activator in ABA-mediated dehydration response. |
| AT5G59820 | Encodes a zinc finger protein involved in high light and cold acclimation. Overexpression of this putative transcription factor increases the expression level of 9 cold-responsive genes and represses the expression level of 15 cold-responsive genes, including CBF genes. Also, lines overexpressing this gene exhibits a small but reproducible increase in freeze tolerance. Because of the repression of the CBF genes by the overexpression of this gene, the authors speculate that this gene may be involved in negative regulatory circuit of the CBF pathway. The mRNA is cell-to-cell mobile. |
| AT5G48310 | Protein of unknown function that may be involved in stress response. Strongly expressed in vascular tissues.Mutants are ABA- insensitive. |
| AT1G77570 | Winged helix-turn-helix transcription repressor DNA-binding. Expressed in pollen and mutants show enlarged pollen grain nucleoli. |
| AT1G49770 | Encodes a member of the basic helix loop helix family of transcription factors. Loss of RGE1 function causes shriveled seeds that contain small embryos. The cuticle in the embryos does not develop normally, possible due to the adeherence of the endosperm to the developing embryo. RGE1 is expressed in the endosperm surrounding region which directly surrounds the developing embryo, however it exerts its effect non autonomously- in the developing embryo. Mutant seedlings are extremely sensitive to desiccation due to the abnormal cuticle. Together with ICE1, ZOU determines primary seed dormancy depth independently of their joint role in endosperm development. |
| AT5G13610 | Encodes a mitochondria-localized protein involved in ABI4-mediated mitochondrial retrograde signalling. |
| AT3G08630 | alphavirus core family protein (DUF3411);(source:Araport11) |
| AT3G56140 | DUF399 family protein, putative (DUF399 and DUF3411);(source:Araport11) |
| AT5G58000 | Reticulon family protein;(source:Araport11) |
| AT2G15280 | Reticulon family protein;(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
| AT3G61560 | Reticulon family protein;(source:Araport11) |
| AT5G52660 | Encodes RVE6, a homolog of the circadian rhythm regulator RVE8. rve4 rve6 rve8 triple mutants display an extremely long circadian period, with delayed and reduced expression of evening-phased clock genes. |
| AT2G26670 | Encodes a plastid heme oxygenase necessary for phytochrome chromophore biosynthesis and for coupling the expression of some nuclear genes to the functional state of the chloroplast. |
| AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
| AT5G50750 | RGP4 is a reversibly glycosylated polypeptide. Analyses using tagged RGP4 suggest that it is present in the cytosol and in association with the Golgi apparatus. Recombinant RGP4 does not have UDP-arabinose mutase activity based on an in vitro assay even though the related RGP1, RGP2, and RGP3 proteins do have activity in the same assay. RGP4 can form complexes with RGP1 and RGP2. RGP4 is expressed during seed development. |
| AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile. |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
| AT1G06190 | Encodes a novel ribonucleic acid-binding protein that interacts with the endonuclease RNase E and supports its function in processing plastid ribonucleic acids. |
| AT3G51300 | Encodes a pollen-specific Rop GTPase, member of the Rho family of small GTP binding proteins that interacts with RIC3 and RIC4 to control tip growth in pollen tubes. These three proteins promote the proper targeting of exocytic vesicles in the pollen tube tip. ROP1 activity is regulated by the REN1 GTPase activator protein. |
| AT3G58460 | RHOMBOID-like protein 15;(source:Araport11) |
| AT3G53780 | RHOMBOID-like protein 4;(source:Araport11) |
| AT2G02990 | Encodes a member of the ribonuclease T2 family that responds to inorganic phosphate starvation, and inhibits production of anthocyanin. Also involved in wound-induced signaling independent of jasmonic acid. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
| AT2G39780 | Encodes the main endoribonuclease activity in plant cells and localizes to the endoplasmic reticulum (ER), ER-derived structures, and vacuoles. It is essential for normal ribosomal RNA recycling. The mRNA is cell-to-cell mobile. |
| AT2G21790 | encodes large subunit of ribonucleotide reductase involved in the production of deoxyribonucleoside triphosphates (dNTPs) for DNA replication and repair |
| AT2G01290 | Cytosolic ribose-5-phosphate isomerase. Knockout mutation causes chloroplast dysfunction, late flowering and premature cell death. |
| AT3G05590 | Encodes cytoplasmic ribosomal protein L18. |
| AT2G37600 | cytosolic ribosomal protein gene, part of eL36 familyl |
| AT5G41520 | The gene belongs to the three-member Arabidopsis gene family encoding the eukaryote-specific protein S10e of the small cytoplasmic ribosomal subunit. |
| AT5G23740 | Encodes a putative ribosomal protein S11 (RPS11-beta). |
| AT4G00100 | Encodes a cytoplasmic ribosomal protein S13 homologue involved in early leaf development The mRNA is cell-to-cell mobile. |
| AT3G46040 | Regulated by TCP20. The mRNA is cell-to-cell mobile. |
| AT1G79850 | nuclear-encoded 30S chloroplast ribosomal protein S17 |
| AT4G31700 | Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis. |
| AT3G07750 | 3-5-exoribonuclease family protein;(source:Araport11) |
| AT5G38720 | RRP7 shares limited sequence similarity to human and yeast RRP7. In Arabidopsis RRP7 functions in 18S ribosomal RNA maturation. |
| AT3G63190 | The gene encodes a chloroplast ribosome recycling factor homologue. Analysis of mutants revealed its role in the chloroplast development and eary stages of embryo development. |
| AT1G03770 | Encodes a nuclear localized protein with similarity to animal polycomb repressive core complex1 (PRC1) core component RING.Appears to function redundantly with ATRING1a, a close paralog. Both interact physically with CLF and LHP1 and appear to function together to repress class I KNOX gene expression. |
| AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
| AT3G01650 | Encodes RGLG1 (RING domain ligase 1), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. ABA inhibits myristoylation and induces shuttling of the RGLG1 to promote nuclear degradation of PP2CA. |
| AT5G14420 | Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. |
| AT3G43750 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, are key regulators of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
| AT3G45570 | RING/U-box protein with C6HC-type zinc finger domain-containing protein;(source:Araport11) |
| AT2G21420 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, key regulator of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
| AT2G26135 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT2G26130 | Encodes a RING-type zinc finger ubiquitin ligase involved in seed longevity.Gain of function (35S promoter) increases, and loss of function decreases, seed longevity. |
| AT4G03510 | RMA1 encodes a novel 28 kDa protein with a RING finger motif and a C-terminal membrane-anchoring domain that is involved in the secretory pathway. Has E3 ubiquitin ligase activity. |
| AT5G22920 | Encodes a protein with sequence similarity to RING, zinc finger proteins. Loss of function mutations show reduced (15%) stomatal aperture under non stress conditions. |
| AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
| AT1G15100 | Encodes a putative RING-H2 finger protein RHA2a. |
| AT3G11770 | RICE1 is a 23kDa protein with 3?- 5? exoribonuclease activity. It is expressed ubiquitously and localized to the cytoplasm. When RICE1 and its paralog RICE2 are knocked down, miRNA levels are decreased. RICE1 interacts with AGO1 and AGO10. It may affect miRNA accumulation by clearing RISC by degrading 5? products of AGO cleavage. |
| AT1G72530 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
| AT2G42520 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G45810 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT5G57980 | NRPB5-like protein of unknown function; homologous to budding yeast RPB5 |
| AT1G12700 | Encodes RNA PROCESSING FACTOR 1 (RPF1), a pentatricopeptide repeat (PPR) protein of the P-class containing canonical PPR-repeats. RPF1 is required for the 5?-end processing of the nad4 mRNA in mitochondria. Ler and other accessions impaired in processing of the nad4 mRNA 5′-end, contain a single nucleotide polymorphism (SNP) 807 nucleotides downstream of the predicted translation start codon (G807A). The resulting premature translation termination codon abolishes the function of the RPF1 gene in Ler. Required for the formation of nad4L-atp4 transcripts with -318 5′ termini. |
| AT4G13850 | Encodes a glycine-rich RNA-binding protein. Gene expression is induced by cold. |
| AT3G13224 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
| AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
| AT1G60200 | RBM25 is an alternative splicing factor involved in mediation of abiotic stress response and ABA response. Its expression is modulated by a variety of stressors and it in turn appears to affect the ratio of splice variants of stress responsive genes such as HAB1.2/HAB1.1. |
| AT5G54900 | RNA-binding protein 45A;(source:Araport11) |
| AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
| AT3G15000 | Encodes RIP1 (RNA-editing factor interacting protein 1). Involved in chloroplast and mitochondrial RNA editing. The mRNA is cell-to-cell mobile. |
| AT4G00660 | RNAhelicase-like 8;(source:Araport11) |
| AT4G15417 | RNAse II-like 1;(source:Araport11) |
| AT1G80650 | RNAse THREE-like protein 1;(source:Araport11) |
| AT1G16440 | Member of AGC VIIIa Kinase gene family. Invovled in the maintenance of (p)ppGpp level to accustom plastidial gene expression to darkness. |
| AT1G30850 | root hair specific 4;(source:Araport11) |
| AT1G13620 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT2G04025 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT5G51451 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
| AT2G30520 | Encodes a phototropin-interacting NRL protein that is an early signaling component in the phototrophic response and is essential for the phototropin-mediated chloroplast accumulation response but is not involved in the chloroplast avoidance response or stomatal opening. |
| AT5G49820 | root UVB sensitive protein (Protein of unknown function, DUF647);(source:Araport11) |
| AT2G26290 | root-specific kinase 1;(source:Araport11) |
| AT5G19560 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT1G79860 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth Growth. |
| AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G00460 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
| AT5G02010 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Required for periodic formation of secondary cell wall pits. |
| AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
| AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT2G37080 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT1G27380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Protein most similar to RIC4 (family subgroup V). Gene is expressed in all tissues examined. |
| AT3G56070 | rotamase cyclophilin 2 (ROC2) exhibiting peptidyl-prolyl cis-trans isomerase activity involved in signal transduction. |
| AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
| AT5G58710 | Encodes cyclophilin ROC7. The mRNA is cell-to-cell mobile. |
| AT3G53232 | ROTUNDIFOLIA like 1;(source:Araport11) |
| AT3G14362 | ROTUNDIFOLIA like 10;(source:Araport11) |
| AT4G13395 | ROTUNDIFOLIA like 12;(source:Araport11) |
| AT3G23635 | ROTUNDIFOLIA like 13;(source:Araport11) |
| AT1G13245 | ROTUNDIFOLIA like 17;(source:Araport11) |
| AT2G29125 | ROTUNDIFOLIA like 2;(source:Araport11) |
| AT1G07490 | ROTUNDIFOLIA like 3;(source:Araport11) |
| AT5G59510 | ROTUNDIFOLIA like 5;(source:Araport11) |
| AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
| AT2G36985 | Encodes ROTUNDIFOLIA4, a member of the seed plant-specific family of small peptides, RTFL (ROT FOUR LIKE), characterised by the presence of a 29-amino acid domain: RTF. Expressed in shoot apices, young leaves and flowers. Involved in controlling polarity-dependent cell proliferation. |
| AT5G08020 | Encodes a homolog of Replication Protein A. rpa70b mutants are hypersensitive to UV-B radiation and MMS treatments suggesting a role for this protein in DNA damage repair. The mRNA is cell-to-cell mobile. |
| AT1G12210 | RFL1 has high sequence similarity to the adjacent disease resistance (R) gene RPS5. |
| AT4G31580 | Encodes a Serine/arginine-rich (SR) protein RSZp22. SR proteins are splicing regulators that share a modular structure consisting of one or two N-terminal RNA recognition motif domains and a C-terminal RS-rich domain. RSZp22 is located in the nucleolus. It is a nucleocytoplasmic shuttling protein and an interacting partner to the Arabidopsis U1-70K. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT1G19900 | RUBY encodes a secreted galactose oxidase involved in cell wall modification. |
| AT2G35800 | Encodes a predicted calcium-dependent S-adenosyl methionine carrier. |
| AT3G23810 | S-adenosyl-l-homocysteine (SAH) hydrolase 2;(source:Araport11) |
| AT3G02470 | Encodes a S-adenosylmethionine decarboxylase involved in polyamine biosynthesis. |
| AT3G25570 | S-adenosylmethionine decarboxylase family member. |
| AT4G01850 | S-adenosylmethionine synthetase 2;(source:Araport11) |
| AT1G49820 | encodes 5-methylthioribose kinase, involved in methionine cycle The mRNA is cell-to-cell mobile. |
| AT4G09800 | encodes a ribosomal protein S18C, a constituent of the small subunit of the ribosomal complex |
| AT3G58865 | Member of Sadhu non-coding retrotransposon family |
| AT5G22450 | SAGA complex subunit. Regulates gene expression by affecting histone H3 acetylation. |
| AT2G01640 | ribosome biogenesis protein;(source:Araport11) |
| AT3G25910 | C2H2-type zinc finger protein involved in salt tolerance. Induced by salt stress. |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
| AT3G07700 | ABC1K7 is a member of an atypical protein kinase family that is induced by salt stress. Loss of function mutations affect the metabolic profile of chloroplast lipids. It appears to function along with ABC1K8 in mediating lipid membrane changes in response to stress. |
| AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
| AT1G27760 | Encodes a protein with similarity to human interferon-related developmental regulator (IFRD)that is involved in salt tolerance. Loss of function mutations are hypersensitive to salt stress and have reduced fertility. SAT32 is found in the cytoplasm but appears to translocate to the nucleus when plants are subject to salt stress. |
| AT1G19330 | Evening-expressed key component of Sin3-HDAC complex, which bind directly to the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and PSEUDO-RESPONSE REGULATOR 9 (PRR9) promoters and catalyze histone 3 (H3) deacetylation at the cognate regions to repress expression, allowing the declining phase of their expression at dusk. |
| AT1G73805 | Encodes SAR Deficient 1 (SARD1), a key regulator for ICS1 (Isochorismate Synthase 1) induction and salicylic acid (SA) synthesis. |
| AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
| AT3G18380 | DNA-BINDING TRANSCRIPTION FACTOR 2;(source:Araport11) |
| AT1G55310 | Encodes a SR spliceosome protein that is localized to nuclear specks, interacts with SR45 and the U1-70K protein of the U1 snRNP, has sequence similar to human SC35 protein. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
| AT1G21450 | Encodes a scarecrow-like protein (SCL1). Member of GRAS gene family. The mRNA is cell-to-cell mobile. |
| AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
| AT1G63100 | Transcription factor belonging to the GRAS family which controls the mitotic cell cycle and division plane orientation. |
| AT3G12900 | S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil. |
| AT5G11860 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). |
| AT3G23727 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G05335 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G65113 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G10767 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G14785 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G32714 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT5G45875 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G60987 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT3G62440 | Encodes an F-box protein which is predominantly expressed in flower tissues and interacts with ASK19 protein. Mutations in this gene suggest it acts as a negative regulator of endothecial secondary wall thickening in anthers. |
| AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
| AT1G02010 | member of KEULE Gene Family |
| AT1G61250 | Encodes a putative secretory carrier membrane protein (SC3). The mRNA is cell-to-cell mobile. |
| AT2G20840 | Secretory carrier membrane protein (SCAMP) family protein;(source:Araport11) |
| AT1G55740 | seed imbibition 1;(source:Araport11) |
| AT3G57520 | SIP2 encodes a raffinose-specific alpha-galactosidase that catalyzes the breakdown of raffinose into alpha-galatose and sucrose. This enzyme may function in unloading raffinose from the phloem as part of sink metabolism. Although it was originally predicted to act as a raffinose synthase (RS), that activity was not observed for recombinant SIP2. |
| AT4G18520 | Encodes a PPR (pentatricopeptide repeat) protein PDM1/SEL1. Involved in RNA editing and splicing of plastid genes. |
| AT3G10420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G14030 | selenium-binding protein 1;(source:Araport11) |
| AT4G14040 | selenium-binding protein 2;(source:Araport11) |
| AT3G23800 | selenium-binding protein 3;(source:Araport11) |
| AT3G47300 | SELT-like protein precursor;(source:Araport11) |
| AT1G66580 | senescence associated gene 24;(source:Araport11) |
| AT5G14930 | encodes an acyl hydrolase involved in senescence . |
| AT2G29350 | Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis. |
| AT4G02380 | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
| AT5G13170 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
| AT3G14067 | Encodes a protein with similarity to serine protease, subtilisin, that is upregulated during senescence and expressed in the arial portions of the plant.Loss of function mutations have increased branch number but normal silique length and seed set and therefore have increased fertility. |
| AT1G17020 | Encodes a novel member of the Fe(II)/ascorbate oxidase gene family; senescence-related gene. |
| AT3G06510 | Encodes a protein with beta-glucosidase and galactosyltransferase activity, mutants show increased sensitivity to freezing. Though it is classified as a family I glycosyl hydrolase, it has no hydrolase activity in vitro. |
| AT5G43940 | Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility. |
| AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
| AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
| AT2G22970 | serine carboxypeptidase-like 11;(source:Araport11) |
| AT2G22980 | serine carboxypeptidase-like 13;(source:Araport11) |
| AT3G12220 | serine carboxypeptidase-like 16;(source:Araport11) |
| AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
| AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
| AT2G24000 | serine carboxypeptidase-like 22;(source:Araport11) |
| AT3G02110 | serine carboxypeptidase-like 25;(source:Araport11) |
| AT2G35780 | serine carboxypeptidase-like 26;(source:Araport11) |
| AT3G07990 | serine carboxypeptidase-like 27;(source:Araport11) |
| AT1G11080 | serine carboxypeptidase-like 31;(source:Araport11) |
| AT5G23210 | serine carboxypeptidase-like 34;(source:Araport11) |
| AT5G08260 | serine carboxypeptidase-like 35;(source:Araport11) |
| AT3G63470 | serine carboxypeptidase-like 40;(source:Araport11) |
| AT1G28110 | serine carboxypeptidase-like 45;(source:Araport11) |
| AT5G22980 | serine carboxypeptidase-like 47;(source:Araport11) |
| AT3G45010 | serine carboxypeptidase-like 48;(source:Araport11) |
| AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
| AT3G10450 | serine carboxypeptidase-like 7;(source:Araport11) |
| AT3G48780 | Encodes one of the two LCB2 subunits (LCB2a and LCB2b) of serine palmitoyltransferase, an enzyme involved in sphingolipid biosynthesis. LCB2a and LCB2b are functional redundant. Double mutants are gametophytic lethal. The mRNA is cell-to-cell mobile. |
| AT1G07350 | Encodes a serine/arginine rich-like protein, SR45a. Involved in the regulation of stress-responsive alternative splicing. |
| AT5G01820 | Encodes a CBL-interacting serine/threonine protein kinase. |
| AT5G08160 | Encodes a serine/threonine protein kinase. |
| AT2G17700 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
| AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
| AT1G11870 | Seryl-tRNA synthetase targeted to chloroplasts and mitochondria. Its inactivation causes developmental arrest of chloroplasts and mitochondria in Nicotiana benthamiana. |
| AT5G53430 | Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
| AT4G30860 | Encodes a member of the trxG protein family. Contains a SET domain which is known to be involved in modification of histone tails by methylation. Interacts physically with AMS, but the implications of this interaction are unknown.Overexpression results in plieotrophic developmental defects. |
| AT4G27910 | Encodes a SET domain containing protein, putative H3K4 methyltransferase. Involved in bolting/flowering time together with ATX1 and ATX3. |
| AT3G03750 | SET domain protein 20;(source:Araport11) |
| AT1G43850 | Encodes a transcriptional co-regulator of AGAMOUS, that functions with LEUNIG to repress AG in the outer floral whorls. |
| AT5G62090 | Encodes a protein that functions with LUH to promote Al binding to the root cell wall. |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
| AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
| AT4G24190 | encodes an ortholog of GRP94, an ER-resident HSP90-like protein and is involved in regulation of meristem size and organization. Single and double mutant analyses suggest that SHD may be required for the correct folding and/or complex formation of CLV proteins. Lines carrying recessive mutations in this locus exhibits expanded shoot meristems, disorganized root meristems, and defective pollen tube elongation. Transcript is detected in all tissues examined and is not induced by heat. Endoplasmin supports the protein secretory pathway and has a role in proliferating tissues. |
| AT1G75520 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis. |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT2G21400 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT1G15360 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. This gene is involved in wax biosynthesis. Over-expression of the gene results in glossy leaf phenotype and increased drought tolerance. Two closely related genes, AT5G25390 and AT5G11190 have similar phenotypes when over-expressed. Strong expression levels in flowers. Binds to the promoter of LACS2. |
| AT5G25390 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT1G62360 | Class I knotted-like homeodomain protein that is required for shoot apical meristem (SAM) formation during embryogenesis and for SAM function throughout the lifetime of the plant. Functions by preventing incorporation of cells in the meristem center into differentiating organ primordia. It has also been shown to have a role in the specification of flower meristem identity. |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT2G41670 | Encodes SIN2 (SHORT INTEGUMENTS 2), a mitochondrial DAR GTPase. SIN2 is hypothesized to function in mitochondrial ribosome assembly. sin2 mutants produce ovules with short integuments due to early cessation of cell division in these structures. |
| AT4G39100 | Encodes a plant-specific histone reader capable of recognizing both H3K27me3 and H3K4me3 via its bromo-adjacent homology (BAH) and plant homeodomain (PHD) domains, respectively. Detailed biochemical and structural studies suggest a binding mechanism that is mutually exclusive for either H3K4me3 or H3K27me3. SHL plays a role in the repression of flowering. |
| AT1G10682 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G26612 | Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G29250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
| AT3G55290 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
| AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
| AT5G24740 | Encodes a vacuolar sorting protein that interacts with the plant-specific GRAS family transcription factor SHORT-ROOT and acts in a pathway that controls root growth and radial patterning. It provides a connections between gibberellic acid, SHR and PLT signaling in the root. |
| AT5G55480 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. The mRNA is cell-to-cell mobile. |
| AT1G66970 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58050 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G58170 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. |
| AT2G03120 | homologous to Signal Peptide Peptidases (SPP), required for pollen development and pollen germination. No homozygotes could be recovered from a T-DNA insertion mutant. The mRNA is cell-to-cell mobile. |
| AT1G73990 | Encodes a putative protease SppA (SppA). |
| AT1G63690 | SIGNAL PEPTIDE PEPTIDASE-LIKE 2;(source:Araport11) |
| AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4;(source:Araport11) |
| AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
| AT1G44800 | Encodes Siliques Are Red 1 (SIAR1). Functions as a bidirectional amino acid transporter that is crucial for the amino acid homeostasis of siliques. Member of nodulin MtN21-like transporter family. |
| AT3G47720 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
| AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
| AT2G47300 | Encodes a protein involved in rRNA but not tRNA maturation. |
| AT1G24190 | Enhances AtERF7-mediated transcriptional repression. RNAi lines show ABA hypersensitivity. Interacts with ERF7 and HDA19. |
| AT1G59890 | SIN3-like 5;(source:Araport11) |
| AT2G22990 | sinapoylglucose:malate sinapoyltransferase. Catalyzes the formation of sinapoylmalate from sinapoylglucose. Mutants accumulate excess sinapoylglucose. |
| AT5G16270 | Encodes a SCC1/REC8 ortholog that may be involved in mitosis and may represent a mitotic cohesin. Plays a role in somatic DNA double strand break damage repair. The mRNA is cell-to-cell mobile. |
| AT2G47980 | Essential to the monopolar orientation of the kinetochores during meiosis. |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT2G02350 | encodes a protein containing an F-box domain and physically interacts with SCF subunit SKP1/ASK1. The protein also exhibits similarity in sequence to phloem protein 2 (PP2) from cucumber. |
| AT3G21860 | SKP1-like 10;(source:Araport11) |
| AT3G25650 | SKP1-like 15;(source:Araport11) |
| AT1G10230 | Involved in protein degradation. One target is PHR1. |
| AT3G54480 | Encodes an SKP1 interacting partner (SKIP5). |
| AT4G28090 | SKU5 similar 10;(source:Araport11) |
| AT3G13390 | SKU5 similar 11;(source:Araport11) |
| AT1G55570 | SKU5 similar 12;(source:Araport11) |
| AT1G55560 | SKU5 similar 14;(source:Araport11) |
| AT4G37160 | SKU5 similar 15;(source:Araport11) |
| AT2G23630 | SKU5 similar 16;(source:Araport11) |
| AT5G51480 | GPI anchored protein, highly expressed in reproductive tissues. |
| AT5G48450 | Encodes a protein with two DUF26 domains and a signal peptide for secretion. The protein is transported to the apoplast when it is expressed as a GFP fusion protein. |
| AT1G21850 | SKU5 similar 8;(source:Araport11) |
| AT1G41830 | SKU5-similar 6;(source:Araport11) |
| AT5G24030 | Encodes a protein with ten predicted transmembrane helices. The SLAH3 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. Although it is not expressed in guard cells, it can complement an slac1-2 mutant suggesting that it performs a similar function. SLAH3:GFP localizes to the plasma membrane. |
| AT1G55040 | SED1 is a protein of unknown function that is located in the mitochondrion. sed1 mutants are embryo lethal. |
| AT4G33210 | Encodes SLOMO (SLOW MOTION), a F-box protein required for auxin homeostasis and normal timing of lateral organ initiation at the shoot meristem. |
| AT2G47990 | Encodes a transducin family nucleolar protein with six WD40 repeats that is most likely involved in 18S rRNA biogenesis. The slow progression of the gametophytic division cycles in swa1 suggested that the SWA1 protein is required for the normal progression of mitotic division cycles through the regulation of cell metabolism. Ubiquitously expressed throughout the plant. |
| AT1G21190 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT1G76860 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT5G18010 | Encodes SAUR19 (small auxin up RNA 19). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), At5g18010 is SAUR24. |
| AT2G45210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
| AT4G34770 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G51200 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G13790 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G53590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G31320 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G20220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G09870 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G34750 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G50760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G43040 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G60690 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G29420 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G20820 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G17345 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT2G35290 | hypothetical protein;(source:Araport11) |
| AT1G19020 | Modulates defense against bacterial pathogens and tolerance to oxidative stress. |
| AT5G05540 | small RNA degrading nuclease 2;(source:Araport11) |
| AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
| AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
| AT3G01090 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It can also interact with PRL1 DWD-containing protein. Based on in vitro degradation assays and cul4cs and prl1 mutants, there is evidence that AKIN10 is degraded in a proteasome-dependent manner, and that this depends on a CUL4-PRL1 E3 ligase |
| AT3G29160 | encodes a SNF1-related protein kinase that physically interacts with SCF subunit SKP1/ASK1 and 20S proteosome subunit PAD1. It has also been shown to interact with the WD protein PDL1. |
| AT1G60940 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
| AT3G19570 | Encodes SCO3 (snowy cotyledon3), a member of a largely uncharacterized protein family unique to the plant kingdom. The sco3-1 mutation alters chloroplast morphology and development, reduces chlorophyll accumulation, impairs thylakoid formation and photosynthesis in seedlings, and results in photoinhibition under extreme CO(2) concentrations in mature leaves. SCO3 is targeted to the periphery of peroxisomes. Together with QWRF2 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
| AT1G26210 | AtSOFL1 acts redundantly with AtSOFL2 as positive regulator of cytokinin levels. |
| AT1G54370 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT3G53530 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
| AT3G19490 | member of Na+/H+ antiporter-Putative family |
| AT2G13790 | somatic embryogenesis receptor-like kinase 4;(source:Araport11) |
| AT1G15240 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
| AT3G46110 | DUF966 domain containing protein, expressed during embryogenesis. |
| AT1G54150 | Encodes a chloroplast-localized putative RING-type ubiquitin E3 ligase. |
| AT4G11110 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA2 primarily regulates seedling development in darkness and has little function in light-grown seedlings or adult plants. |
| AT1G53090 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA4 (and SPA3) predominantly regulates elongation growth in adult plants. |
| AT2G23510 | BAHD acyltransferase which transfers acyl-groups from different acyl-donors specifically to amines. Catalyzes the multisite acylation of spermidine. Uses caffeoyl/feruoyl/sinapoyl-CoA with the N1 and N10 positions of spermidine. |
| AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
| AT1G69640 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT1G14290 | Encodes one of the two redundant sphingoid base hydroxylases (SBH). Involved in sphingolipid trihydroxy long-chain base (4-hydroxysphinganine) biosynthesis. Double mutants of SBHs were dwarfed and not able to progress from vegetative to reproductive growth. |
| AT2G46210 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
| AT4G21540 | Encodes a sphingosine kinase, also has enzyme activity towards other plant long-chain sphingoid bases. Involved in guard cell ABA signalling and seed germination. |
| AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
| AT4G16340 | Encodes SPIKE1 (SPK1), the lone DOCK family guanine nucleotide exchange factor (GEF) in Arabidopsis. SPK1 is a peripheral membrane protein that accumulates at, and promotes the formation of, a specialized domain of the endoplasmic reticulum (ER) termed the ER exit site (ERES). SPK1 promotes polarized growth and cell-cell adhesion in the leaf epidermis. Mutant has seedling lethal; cotyledon, leaf-shape, trichome defects. |
| AT2G47580 | encodes spliceosomal protein U1A |
| AT3G13170 | Encodes AtSPO11-1, one of the three Arabidopsis homologues of the archaeal DNA topoisomerase VIA subunit (topo VIA). Required for meiotic recombination. AtSPO11-1 and AtSPO11-2 have overlapping functions (i.e. both required for meiotic recombination) whereas AtSPO11-3 functions in DNA replication. AtSPO11-1 accumulates in foci in early G2. At 1 h post-S phase, no foci are observed, but by 3 h a majority (80%) of meiocytes at this time point contain >50 foci. However, by 5 h, AtSPO11-1 foci are no longer detectable. This suggests that the protein undergoes a rapid cycle of accumulation and disappearance in meiocytes over a period of between 1 and 5 h post-S phase. |
| AT2G22830 | squalene epoxidase 2;(source:Araport11) |
| AT5G24140 | Encodes a protein with similarity to squalene monoxygenases. |
| AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
| AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
| AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
| AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
| AT2G36390 | Encodes a starch branching enzyme (EC.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout plant tissues. The mRNA is cell-to-cell mobile. |
| AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
| AT4G18240 | Encodes a starch synthase. In Arabidopsis leaves, the catalytic C-terminal region of STARCH SYNTHASE 4 promotes starch granule initiation while its non-catalytic N-terminal region determines starch granules morphology. |
| AT5G01920 | Chloroplast thylakoid protein kinase STN8 is specific in phosphorylation of N-terminal threonine residues in D1, D2 and CP43 proteins, and Thr-4 in PsbH protein of photosystem II. Phosphorylation of Thr-4 in the wild type required both light and prior phosphorylation at Thr-2. |
| AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
| AT1G34130 | Encodes homolog of yeast STT3, a subunit of oligosaccharyltransferase. |
| AT3G02850 | Encodes SKOR, a member of Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mediates the delivery of K+ from stelar cells to the xylem in the roots towards the shoot. mRNA accumulation is modulated by abscisic acid. K+ gating activity is modulated by external and internal K+. Involved in response to low potassium. |
| AT2G25790 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT3G02580 | Brassinosteroid biosynthetic enzyme, catalyzes delta7 sterol C-5 desaturation step. Mutant has dwarf phenotype. |
| AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
| AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
| AT4G30620 | Homolog of STIC2, recent duplication. |
| AT1G79200 | Encodes a nuclear localized protein involved in auxin-dependent control of cell proliferation in pistil development. Loss of function mutations have increased cell proliferation in the stigma. |
| AT4G13266 | PGG domain containing transmembrane protein.Functions in the stigma to prevent interspecies pollen from forming pollen tubes. |
| AT1G04110 | Initially identified as a mutation affecting stomatal development and distribution. Encodes a protein similar to serine proteases. |
| AT5G54100 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT4G22820 | A member of the A20/AN1 zinc finger protein family involved in stress response.Expression is increased in response to water, salt , pathogen and other stressors.SAP9 can pull down both K48-linked and K63- linked tetraubiquitin chains and functions as a E3 ubiquitin ligase suggesting a role in proteasome-dependent protein degradation. |
| AT2G27580 | Regulated by heat shock. |
| AT1G31970 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
| AT1G55760 | Expression induced under NaCl, mannitol, ABA and indole-3-acetic acid (IAA) treatment. |
| AT1G74020 | Encodes AtSS-2 strictosidine synthase. |
| AT2G41300 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT1G08470 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT4G08390 | Encodes a chloroplastic stromal ascorbate peroxidase sAPX. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The mRNA is cell-to-cell mobile. |
| AT1G11130 | Encodes an atypical receptor-like kinase protein with a predicted extracellular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain expressed throughout the developing root but whose kinase activity is not essential for its function in vivo. Regulates expression of GLABRA2, CAPRICE, WEREWOLF, and ENHANCER OF GLABRA3. Required for floral organ shape, the development of the outer integument of ovules, and stem development. Regulates cell shape and cell division planes in the L2 layer of floral meristems and the L1-derived outer integument of ovules. Controls specification of epidermal root hairs. Participates in the coordination of cell morphogenesis between cell layers during floral development. |
| AT4G03390 | STRUBBELIG-receptor family 3;(source:Araport11) |
| AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
| AT1G53730 | STRUBBELIG-receptor family 6;(source:Araport11) |
| AT4G22130 | STRUBBELIG-receptor family 8;(source:Araport11) |
| AT5G48600 | member of SMC subfamily |
| AT5G62410 | SMC2-1 (SMC2) |
| AT5G07660 | Encodes SMC6A (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6A), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
| AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
| AT5G04940 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. SUVH1 has been shown to have a preference for binding methylated DNA. |
| AT2G22740 | Encodes a SU(VAR)3-9 homolog, a methyltransferase involved in histone methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs but has a preference for the latter two. This is a member of a subfamily of SET proteins that shares a conserved SRA domain. |
| AT2G23740 | Encodes a SET-domain protein SUVR5 that mediates H3K9me2 deposition and silencing at stimulus response genes in a DNA methylation-independent manner. |
| AT4G21326 | subtilase 3.12;(source:Araport11) |
| AT5G59090 | subtilase 4.12;(source:Araport11) |
| AT2G39851 | Proteinase inhibitor, propeptide;(source:Araport11) |
| AT5G67090 | Encodes a subtilisin-like serine protease with in vitro protease activity. |
| AT3G27380 | One of three isoforms of the iron-sulfur component of the succinate dehydrogenase complex, a component of the mitochondrial respiratory chain complex II. The product of the nuclear encoded gene is imported into the mitochondrion. Expressed during germination and post-germinative growth. |
| AT1G47420 | predicted to encode subunit 5 of mitochondrial complex II and to participate in the respiratory chain |
| AT1G04920 | Encodes a sucrose-phosphate synthase whose activity is stimulated by Glc-6-P and inhibited by Pi. |
| AT4G10120 | Encodes a sucrose-phosphate synthase. |
| AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
| AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
| AT5G37180 | Encodes a protein with sucrose synthase activity (SUS5). |
| AT1G09960 | low affinity (10mM) sucrose transporter in sieve elements (phloem) |
| AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
| AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
| AT5G06170 | sucrose symporter with hight affinity for sucrose (K0.5=0.066 +/- 0.025mM), that can also transport a wide range of glucosides. |
| AT1G77210 | AtSTP14 belongs to the family of sugar transport proteins (AtSTPs)in volved in monosaccharide transport. Heterologous expression in yeast revealed that AtSTP14 is the transporter specifc for galactose and does not transport other monosaccharides such as glucose or fructose. |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
| AT5G23270 | Membrane localized sucrose transporter. |
| AT1G07340 | sugar transporter 2;(source:Araport11) |
| AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
| AT1G50310 | Sucrose transporter, expressed in pollen tubes. |
| AT4G21480 | Putative sugar transporter. Expressed in nematode-induced root syncytia. |
| AT5G10180 | Encodes a low-affinity sulfate transporter expressed in the root cap and central cylinder, where it is induced by sulfur starvation. Expression in the shoot vascular system is not induced by sulfur starvation. |
| AT3G51895 | Encodes a chloroplast-localized sulfate transporter. |
| AT4G02700 | sulfate transporter 3;(source:Araport11) |
| AT3G15990 | Vascular cambium-localized sulfate transporter, mediates xylem-to-phloem transfer of phosphorus. 2 for its preferential distribution |
| AT5G19600 | Encodes sulfate transporter Sultr3;5. |
| AT5G13550 | Encodes a sulfate transporter. |
| AT3G01910 | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
| AT4G33030 | involved in sulfolipid biosynthesis The mRNA is cell-to-cell mobile. |
| AT3G45070 | Encodes a sulfotransferase with sulfating activity toward flavonoids. |
| AT5G07000 | Encodes a member of the sulfotransferase family of proteins. Although it has 85% amino acid identity with ST2A (At5g07010), this protein is not able to transfer a sulfate group to 11- or 12-hydroxyjasmonic acid in vitro. It may be able to act on structurally related jasmonates. |
| AT4G08620 | Encodes a high-af?nity sulfate transporter. Contains STAS domain. Expressed in roots and guard cells. Up-regulated by sulfur deficiency. |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
| AT1G28170 | sulfotransferase 7;(source:Araport11) |
| AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
| AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
| AT2G21470 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
| AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
| AT3G14205 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT5G20840 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
| AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
| AT1G79820 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G23570 | Required for posttranscriptional gene silencing and natural virus resistance.SGS3 is a member of an 'unknown' protein family. Members of this family have predicted coiled coiled domains suggesting oligomerization and a potential zinc finger domain. Involved in the production of trans-acting siRNAs, through direct or indirect stabilization of cleavage fragments of the primary ta-siRNA transcript. Acts before RDR6 in this pathway. The mRNA is cell-to-cell mobile. |
| AT2G27600 | Encodes a SKD1 (Suppressor of K+ Transport Growth Defect1) homolog. Localized to the cytoplasm and to multivesicular endosomes. Involved in multivesicular endosome function. The mRNA is cell-to-cell mobile. |
| AT1G71696 | Encodes a Putative Zn2+ carboxypeptidase, 4 splice variants have been identified but not characterized for different functions and/or expression patterns.SOL1 isolated as a suppressor of root- specific overexpression of CLE19, a clavata3 like gene. sol1 partially suppresses the short root phenotype caused by CLE19 overexpression. |
| AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
| AT4G18470 | Negative regulator of systemic acquired resistance (SAR), repressor of pathogenesis-related PR gene expression which is removed by NPR1 upon induction of SAR. Encodes leucine-rich nuclear protein. Conserved in plants, with putative orthologs found in several plant species. Many NPR1-dependent PR gene are specifically derepressed in the sni1 mutant. The structural similarity of SNI1 to Armadillo repeat proteins implies that SNI1 may form a scaffold for interaction with proteins that modulate transcription. Histone modification may be involved in SNI1-mediated repression of PR genes.SNI1 is the NSE6 subunit of the SMC5/6 complex. It can interact with and inhibit E2F transcription factors. |
| AT1G21580 | Encodes a zinc-finger protein that co-localizes with the exosome-associated RNA helicase HEN2 and functions as a co-factor of nuclear RNA quality control by the nucleoplasmic exosome. |
| AT1G56500 | Encodes a thylakoid membrane protein with thioredoxin-like and beta-propeller domains located in the lumen and a haloacid-dehalogenase domain exposed to the chloroplast stroma. The protein's role may be to prevent formation of a slowly reversible form of antenna quenching, thereby maintaining the efficiency of light harvesting. The mRNA is cell-to-cell mobile. |
| AT5G46580 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
| AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
| AT5G11410 | Similar to receptor like kinase but does not appear to have kinase activity (psuedokinase). It is involved in HopZ1a effector triggered immunity. Interacts with ZAR1 and ZED1.Localization to membrane is dependent on N-terminal myristoylation domain |
| AT1G73720 | Encodes SMU1, a protein involved in RNA splicing. |
| AT2G45070 | Sec61 Beta Subunit |
| AT3G17910 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in embryo lethality. |
| AT1G48510 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis. |
| AT1G67140 | HEAT repeat-containing protein;(source:Araport11) |
| AT1G31760 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
| AT5G16830 | member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane. |
| AT4G17730 | member of SYP2 Gene Family. Together with SYP23 interacts with Tobacco mosaic virus 126 kDa protein; required for normal local virus accumulation and spread. |
| AT1G61290 | member of SYP12 Gene Family |
| AT1G11250 | member of SYP12 Gene Family |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT5G12850 | CCCH-type zinc finger protein with ARM repeat domain-containing protein;(source:Araport11) |
| AT5G58620 | Involved in control of defence gene expression post-transcriptionally through release from translation arrest within TZF9-PAB2-containing RNA granules. TZF9 shows phospho-mobility shift after flg22 treatment, inferred to be caused by phosphorylation through MPK3 and/or MPK6. The major MPK3/6-targeted phospho-sites are S181, S323, S343, S352, S356, S362 and S377. |
| AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
| AT3G05330 | Encodes a protein with moderate sequence similarity to the maize microtubule-binding protein TANGLED1. A single base-pair deletion (-A) at position Chr3:1519176 in Columbia relative to the Landsberg erecta and Achkarren-2 ecotype (see ESTs DR378436 and CB26450) introduces a frame-shift and premature termination codon. The protein encoded from the Columbia gene is truncated by 29 amino acids relative to the Landsberg erecta and Achkarren-2 encoded proteins. Involved in the identification of the division plane during mitosis amd cytokinesis |
| AT5G67180 | target of early activation tagged (EAT) 3;(source:Araport11) |
| AT5G60200 | Encodes a Dof-type transcription factor. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT5G14720 | Membrane-localized protein kinase which regulates thermomorphogenesis. |
| AT4G20280 | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). |
| AT1G20000 | Encodes TAF11b, a putative TBP-associated factor (TBP: TATA binding protein). |
| AT2G18000 | TBP-associated factor 14;(source:Araport11) |
| AT1G27720 | TBP-associated factor 4B;(source:Araport11) |
| AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
| AT4G34340 | Member of SAGA complex, SPT module, interacts with HAG1. |
| AT5G08070 | TCP gene involved in heterochronic control of leaf differentiation. |
| AT3G15030 | Arabidopsis thaliana TCP family transcription factor. Regulated by miR319. Involved in heterchronic regulation of leaf differentiation. |
| AT2G20080 | hypothetical protein;(source:Araport11) |
| AT5G24590 | Member of NAc protein family. Interacts with turnip crinkle virus (TCV) capsid protein. Transcription factor involved in regulating the defense response of Arabidopsis to TCV. |
| AT4G32700 | Encodes a DNA polymerase required for microhomology mediated repair of DNA double strand breaks and is required for T-DNA integration. The protein contains two conserved functional domains: an N-terminal superfamily II DNA/RNA helicase domain and a C-terminal prokaryotic-type DNA polymerase I domain. Required for regulated cell division and differentiation in meristems. Mutant plants show morphological defects, such as short roots, serrated leaves, and fasciation, as well as defective patterns of cell division and differentiation in the meristem. Mutant plants had 2.5 to 4.5-fold higher expression of ATGR1, ATBRCA1 and RAD51 genes. TEB is required for normal progression of DNA replication and for correct expression of genes during development. |
| AT5G16850 | Encodes the catalytic subunit of telomerase reverse transcriptase. Involved in telomere homeostasis. Homozygous double mutants with ATR show gross morphological defects over a period of generations. TERT shows Class II telomerase activity in vitro, indicating that it can initiate de novo telomerase synthesis on non-telomeric DNA, often using a preferred position within the telomerase-bound RNA. Loss of function mutants have reduced telomere length in roots and over a period of generations, decreasing root meristem function. |
| AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
| AT5G58070 | Encodes a temperature-induced lipocalin TIL1. Involved in thermotolerance. Peripherally associated with plasma membrane. |
| AT1G25560 | Encodes a member of the RAV transcription factor family that contains AP2 and B3 binding domains. Involved in the regulation of flowering under long days. Loss of function results in early flowering. Overexpression causes late flowering and repression of expression of FT. Novel transcriptional regulator involved in ethylene signaling. Promoter bound by EIN3. EDF1 in turn, binds to promoter elements in ethylene responsive genes. |
| AT1G53230 | Encodes a member of a recently identified plant transcription factor family that includes Teosinte branched 1, Cycloidea 1, and proliferating cell nuclear antigen (PCNA) factors, PCF1 and 2. Regulated by miR319. Involved in heterochronic regulation of leaf differentiation. |
| AT3G26120 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL1 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. |
| AT1G67770 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined. |
| AT5G03840 | Controls inflorescence meristem identity. Involved in the floral initiation process. Ortholog of the Antirrhinum gene CENTRORADIALIS (CEN). Involved in protein trafficking to the protein storage vacuole. TFL1 plays an antagonistic role to FT/TSF in the determination of inflorescence meristem identity. |
| AT5G17690 | Regulates the meristem response to light signals and the maintenance of inflorescence meristem identity. Influences developmental processes controlled by APETALA1. TFL2 silences specific genes within euchromatin but not genes positioned in heterochromatin. TFL2 protein localized preferentially to euchromatic regions and not to heterochromatic chromocenters. Involved in euchromatin organization. Required for epigenetic maintenance of the vernalized state. |
| AT4G16740 | Encodes an (E,E)-alpha-farnesene synthase in the Col ecotype of Arabidopsis. This enzyme can also catalyze the formation of (E)-beta-ocimene as well as trace amounts of myrcene and other related compounds in vitro. The cytosolic localization of the protein may make it favor (E,E)-alpha-farnesene biosynthesis because the precursor of this product, FPP, is primarily cytosolic. Transcript levels for this gene increase in response to treatment with the jasmonic acid mimic coronalon or in response to the insect Plutella xylostella. TPS03 transcripts can also be detected in flowers. A similar protein from the C24 ecotype with one amino acid change (S267F) has a different substrate specificity. |
| AT1G61120 | Encodes a geranyllinalool synthase that produces a precursor to TMTT, a volatile plant defense C16-homoterpene. GES transcript levels rise in response to alamethicin, a fungal peptide mixture that damages membranes. This transcriptional response is blocked in JA biosynthetic and JA signaling mutants, but GES transcript levels still rise in response to alamethicin in mutants with salicylic acid and ethylene biosynthetic and/or signaling defects. GES transcripts also accumulate in response to a larval infestation. This enzyme does not localize to the plastids, and it may be present in the cytosol or endoplasmic reticulum. The mRNA is cell-to-cell mobile. |
| AT2G24210 | terpene synthase 10;(source:Araport11) |
| AT5G48110 | The Col variant has no enzyme activity due to various substitution and deletion mutations. |
| AT5G23960 | Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in the stigma. |
| AT1G31950 | Sesterterpene synthase which produces various sesterpne backbones bia type-A cyclization mechanism. |
| AT4G20230 | terpenoid synthase superfamily protein;(source:Araport11) |
| AT4G20210 | Terpenoid cyclases/Protein prenyltransferases superfamily protein;(source:Araport11) |
| AT1G68540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G01960 | Member of TETRASPANIN family |
| AT2G23810 | Member of TETRASPANIN family |
| AT4G30430 | Member of TETRASPANIN family |
| AT3G43210 | Encodes a kinesin TETRASPORE. Required for cytokinesis in pollen. In mutants, all four microspore nuclei remain within the same cytoplasm after meiosis. |
| AT1G04130 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Interacts with Hsp90/Hsp70 as co-chaperone. |
| AT5G21990 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808). Functions as a chaperone receptor at the chloroplast outer envelope, mediating Hsp70-dependent protein targeting to chloroplasts. It has been localized to the ER membrane, interacts with the Sec translocon, and has a potential function in post-translational protein transport into the ER. The mRNA is cell-to-cell mobile. |
| AT4G08320 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
| AT1G77920 | bZIP transcription factor family protein;(source:Araport11) |
| AT1G24460 | Encodes a novel protein that co-immunoprecipitates with SYP41. It is involved in vacuolar trafficking and salt tolerance, potentially via a role in vesicle fusion and in maintaining TGN structure or identity. Mutants display delayed formation of the Brefeldin A (BFA) compartment in cotyledons upon application of BFA. |
| AT1G75030 | encodes a PR5-like protein |
| AT3G59280 | Encodes the ortholog of yeast PAM16, part of the mitochondrial inner membrane protein import motor. Single mutant plants exhibit a smaller size and enhanced resistance against virulent pathogens. They also display elevated reactive oxygen species (ROS) accumulation. |
| AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
| AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
| AT1G59730 | Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1. |
| AT1G08630 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Primarily expressed in seeds and seedlings. |
| AT3G04520 | Encodes a threonine aldolase, involved in threonine degradation to glycine. Expressed in vascular tissue through out the plant. |
| AT1G54780 | Encodes a thylakoid lumen protein regulating photosystem II repair cycle. Has acid phosphatase activity. The mRNA is cell-to-cell mobile. |
| AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT3G55160 | THADA is an orphan gene in Arabidopsis thaliana. It is the only DUF2428 domain containing protein in the genome. |
| AT1G53190 | Encodes a RING-type E3 ligase that positively regulates CIN-like TCP activity to promote leaf development by mediating the degradation of the TCP repressor TIE1. |
| AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
| AT5G52910 | homolog of Drosophila timeless |
| AT5G25810 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family (TINY). The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. Ectopic or overexpression of this gene in a Ds tagged line has reduced cell expansion. The expression of this gene is induced by ethylene and light and appears to stimulate cytokinin biosynthesis. |
| AT4G23640 | Functions as a potassium transporter and is required for the establishment of root tip growth. |
| AT5G11590 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
| AT4G23440 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
| AT1G72910 | Nucleotide-binding, leucine-rich repeat (NLR) gene regulated by nonsense-mediated mRNA decay (NMD) genes UPF1 and UPF3. |
| AT2G27170 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT4G21790 | encodes a host factor that is required for TMV virus multiplication. The mRNA is cell-to-cell mobile. |
| AT2G38410 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
| AT4G11780 | GAR2-like protein;(source:Araport11) |
| AT1G63670 | hypothetical protein (DUF3741);(source:Araport11) |
| AT3G61380 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
| AT3G53540 | afadin;(source:Araport11) |
| AT5G62170 | LOW protein: M-phase inducer phosphatase-like protein;(source:Araport11) |
| AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT1G74160 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
| AT3G63430 | zinc finger CCCH domain protein;(source:Araport11) |
| AT5G47560 | Encodes a tonoplast malate/fumarate transporter. |
| AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
| AT1G80080 | Encodes a transmembrane leucine-repeat containing receptor-like protein that is expressed in proliferative postprotodermal cells. Recessive mutation leads to disruption of asymmetric cell division during stomata development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT1G80490 | Encodes a protein with a Lissen-cephaly type-1-like homology (LisH) domain at the N terminus,a C-terminal to LisH (CTLH) domain, and 12 WD (tryptophan-aspartic acid)-40 repeats at the C terminus. It is closely related to Topless (TPL), which mediates auxin-dependent transcriptional repression during embryogenesis. |
| AT3G23890 | Encodes a topoisomerase II that is highly expressed in young seedlings. The protein is localized in the nucleus and gene expression levels are increased in proliferative tissues. |
| AT5G55860 | WEB1/PMI2 related protein involved in mecahnotransduction.TREPH1 is phosphorylated at position S625 in response to touch, and this is required for mechanosensitive growth response. |
| AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
| AT4G11990 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity. |
| AT5G48920 | tracheary element differentiation-related 7;(source:Araport11) |
| AT3G25795 | Encodes a trans-acting siRNA that is phosphate starvation-upregulated and activated by PAP1 (MYB75). Has been identified as a translated small open reading frame by ribosome profiling. |
| AT3G10330 | Cyclin-like family protein;(source:Araport11) |
| AT4G35610 | Interacts with EIN3 to regulate transcriptional repression that leads to an inhibition of shoot growth in response to ethylene. |
| AT5G58450 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G60750 | Transketolase;(source:Araport11) |
| AT2G45290 | Transketolase;(source:Araport11) |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT5G43970 | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
| AT3G46560 | Encodes a small zinc finger-like protein that is a component of the mitochondrial protein import apparatus. Together with AtTIM10, AtTIM9 is non-redundantly essential for maintaining mitochondrial function of early embryo proper cells and endosperm free-nuclei. |
| AT1G06950 | Encodes a protein thought to be a part of the translocon at the chloroplast inner envelope. Involved in protein import into the chloroplast and chloroplast biogenesis. C-terminal half of Tic110 functions as scaffolds for protein-protein interactions. |
| AT2G47840 | Encodes a component of the TIC (translocon at the inner envelope membrane of chloroplasts) protein translocation machinery mediating the protein translocation across the inner envelope of plastids. The Arabidopsis genome encodes four Tic20 homologous proteins, AT1G04940(Tic20-I), AT2G47840(Tic20-II), AT4G03320(Tic20-IV) and AT5G55710(Tic20-V). |
| AT2G24820 | translocon at the inner envelope membrane of chloroplasts 55-II;(source:Araport11) |
| AT3G18890 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G02510 | An integral membrane GTPase that functions as a transit-sequence receptor required for the import of proteins necessary for chloroplast biogenesis. Located in the outer chloroplast membrane. Phosphorylation of the G-domains regulate translocon assembly. The mRNA is cell-to-cell mobile. |
| AT3G16620 | component of TOC complex, plastid protein import machinery. |
| AT2G01820 | Transmembrane kinase (TMK), member of the plant receptor-like kinase (RLK) family. TMKs are characterized by an extracellular leucine-rich-repeat (LRR) domain, a single transmembrane region and a cytoplasmic kinase domain. TMKs have been shown to act as critical modulators of cell expansion and cell proliferation. |
| AT3G24660 | member of Receptor kinase-like protein family |
| AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
| AT5G48100 | Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. |
| AT5G13930 | Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism. The mRNA is cell-to-cell mobile. |
| AT5G23260 | Encodes a MADS box protein. Regulates proanthocyanidin biosynthesis in the inner-most cell layer of the seed coat. Also controls cell shape of the inner-most cell layer of the seed coat. Also shown to be necessary for determining the identity of the endothelial layer within the ovule. Paralogous to GOA. Plays a maternal role in fertilization and seed development. |
| AT3G17900 | Plant specific component of TRAPPII vesicle transport complex. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT2G18700 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G60140 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
| AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
| AT1G22210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G35910 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G39770 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G10100 | Trehalose-6-phosphate phosphatase which enhances drought tolerance by regulating stomatal apertures. |
| AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT1G17460 | Arabidopsis thaliana myb family transcription factor (At1g17460) |
| AT1G72650 | Arabidopsis thaliana myb family transcription factor (At1g72650) |
| AT1G06910 | Arabidopsis thaliana myb family transcription factor (At1g06910) |
| AT3G12560 | Encodes a telomeric DNA-binding protein. |
| AT5G53770 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
| AT3G12060 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G19160 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G20680 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G15890 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G23790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues.A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT2G34070 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). TBL37 expression is regulated by MYC2 and activated in response to JA. |
| AT1G29050 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G49340 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G14850 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G62390 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G06230 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT1G19835 | TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly. |
| AT1G45231 | Encodes a trimethylguanosine synthase that is required for chilling tolerance. tgs1 mutant have a striking chilling sensitive phenotype in which leaf and flower development are dramatically disrupted after long-term chilling treatment. |
| AT4G20850 | Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant. |
| AT5G53200 | Encodes a R3MYB transcription inhibitor that regulates trichome patterning. Mutants produce trichome clusters whereas other transcriptional inhibitors involved in this patterning are involved in trichome density regulation. Natural hypofunctional alleles producing trichome development in fruits have been found. |
| AT1G05830 | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1. |
| AT3G21300 | RNA methyltransferase family protein;(source:Araport11) |
| AT4G17610 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
| AT4G27340 | Met-10+ like family protein;(source:Araport11) |
| AT5G13830 | FtsJ-like methyltransferase family protein;(source:Araport11) |
| AT1G74700 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. |
| AT2G43520 | Encodes putative trypsin inhibitor protein which may function in defense against herbivory. Member of the defensin-like (DEFL) family. |
| AT1G34060 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT5G17990 | Encodes the tryptophan biosynthetic enzyme phosphoribosylanthranilate transferase (PAT1, called trpD in bacteria). Converts anthranilate and phosphoribosylpyrophosphate into phosphoribosylanthranilate and inorganic pyrophosphate. The mRNA is cell-to-cell mobile. |
| AT5G54810 | A.thaliana tryptophan synthase beta subunit (trpB) |
| AT1G52410 | Contains a novel calcium-binding repeat sequence. Binds TSK in vitro. Localizes to small cytoplasmic vesicles in interphase cells. In cells synchronized for cell division, TSA1 and TSK relocalize to ends of spindle microtubules that are ahead of separating chromatids during metaphase and anaphase of mitosis. May be involved in mitosis together with TSK. Expressed preferentially in the flower and shoot apex. Can form multimers. The mRNA is cell-to-cell mobile. |
| AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
| AT5G62690 | encodes tubulin beta-2/beta-3 chain The mRNA is cell-to-cell mobile. |
| AT5G61780 | Involved in the regulation of AtGA20ox3 expression, as well as seed germination. The mRNA is cell-to-cell mobile. |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT1G16570 | Encodes a encodes a putative UDP-glycosyltransferase superfamily protein belonging to the glycosyltransferase (GT) family 33 that is localized to the endoplasmic reticulum. Loss of function alleles are male sterile, with pollen tubes bursting after germination. Loss of function also causes increased callose deposition in the female gametophyte, pollen tube overgrowth and reduced transmission. |
| AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
| AT5G36160 | Encodes a cytosolic L-tyrosine aminotransferase. AtTAT2 exhibits much broader amino donor specificity than AtTAT1 and can use not only Tyr but also Phe, Trp, His, Met, Leu, Ala, Ser, Cys, Asp, Asn, Gln, and Arg as amino donors. |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
| AT3G14735 | U6;(source:Araport11) |
| AT5G46315 | U6-29;(source:Araport11) |
| AT4G05050 | polyubiquitin gene, belongs to a subtype group with UBQ10 and UBQ14. Various ecotypes of Arabidopsis have different numbers of ubiquitin repeats within this gene. |
| AT3G52590 | Ubiquitin extension protein The mRNA is cell-to-cell mobile. |
| AT5G53300 | Encodes a ubiquitin conjugating enzyme. |
| AT1G50490 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells. |
| AT5G05080 | ubiquitin-conjugating enzyme 22;(source:Araport11) |
| AT3G17000 | Group XIV ubiquitin-conjugating enzyme that functions negative regulation of drought stress. |
| AT1G16890 | UBC36/UBC13B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair. It can bind to the MMZ/UEV1 proteins in vitro. |
| AT2G46030 | Ubiquitin conjugating enzyme E2 |
| AT3G45180 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
| AT4G10590 | encodes a member of the ubiquitin-specific protease family, UBP10 |
| AT1G32850 | ubiquitin-specific protease 11;(source:Araport11) |
| AT3G11910 | Ubiquitin-specific protease, which together with UBP12 deubiquitinates DA1, DAR1 and DAR2, hence reducing their peptidase activity. Works upstream of DA1, DAR1 and DAR2 to restrict their protease activity and hence fine-tune plant growth and development. |
| AT3G20630 | Encodes a ubiquitin-specific protease. Identical to TTN6. Loss of function mutations are embryo lethals, having development arrested at the preglobular/globular stage. Also involved in root responses to phosphate deficiency. |
| AT4G24560 | Encodes a ubiquitin-specific protease. There is no evidence for a phenotype in ubp16-1 mutants, however, double mutant analysis with ubp15 mutants reveals a role for UBP16 in plant development and cell proliferation. |
| AT5G65450 | Encodes a ubiquitin-specific protease. The mRNA is cell-to-cell mobile. |
| AT5G57990 | Encodes a ubiquitin-specific protease. |
| AT5G22030 | ubiquitin-specific protease 8;(source:Araport11) |
| AT3G56860 | encodes a nuclear protein that binds to RNA with a specificity for oligouridylates in vitro. Along with UBP1 and UBA1a, it may act as a component of a complex recognizing U-rich sequences in plant 3'-UTRs and contributing to the stabilization of mRNAs in the nucleus. |
| AT2G32300 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
| AT4G12250 | UDP-D-glucuronate 4-epimerase |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
| AT2G02810 | Encodes a multitransmembrane hydrophobic protein that functions as transporter of UDP-galactose and UDP-glucose into the Golgi. Localized in the ER. Involved in the unfolded protein response, a mechanism that controls proper protein folding in the ER. |
| AT3G59360 | UDP-galactose transporter 6;(source:Araport11) |
| AT1G26570 | UDP-glucose dehydrogenase 1;(source:Araport11) |
| AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
| AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
| AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
| AT3G21800 | UDP-glucosyl transferase 71B8;(source:Araport11) |
| AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
| AT4G34131 | UDP-glucosyl transferase 73B3;(source:Araport11) |
| AT2G36760 | UDP-glucosyl transferase 73C2;(source:Araport11) |
| AT2G36790 | The At2g36790 gene encodes a UDP-glucose:flavonol-3-O-glycoside-7-O-glucosyltransferase (UGT73C6)attaching a glucosyl residue to the 7-O-position of the flavonols kaempferol, quercetin and their 3-O-glycoside derivatives. |
| AT2G31750 | Encodes an auxin glycosyltransferase that is likely to be involved in regulation of auxin by glycosylation. |
| AT1G05530 | Encodes a protein with glucosyltransferase activity with high sequence homology to UGT1 (AT1G05560). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT2 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05860 | Encodes a cytokinin N-glucosyltransferase that is involved in cytokinin homeostasis and cytokinin response in planta through cytokinin N-glucosylation. Expression is induced by ABA, mannitol and drought stress. Analysis of overexpressors and loss of function mutants indicate a role in response to osmotic and drought stress. |
| AT3G46670 | UDP-glucosyl transferase 76E11;(source:Araport11) |
| AT3G46660 | UDP-glucosyl transferase 76E12;(source:Araport11) |
| AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
| AT1G30530 | The At1g30530 gene encodes a UDP-rhamnose:flavonol-3-O-rhamnosyltransferase (UGT78D1) attaching a rhamnosyl residue to the 3-O-position of the flavonols kaempferol and quercetin |
| AT3G21560 | Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi. |
| AT2G23250 | UDP-glucosyl transferase 84B2;(source:Araport11) |
| AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
| AT1G22380 | Encodes a putative UDP-glucosyl transferase. At1g22380 was initially identified as encoding the protein AAF87154, which has been classified as a bHLH protein (AtbHLH152). Subsequently it has been found that the AAF87154 protein appears to be encoded by the AT1G23970 genomic locus. |
| AT1G22340 | UDP-glucosyl transferase 85A7;(source:Araport11) |
| AT2G30140 | Encodes a putative glycosyltransferase. Regulates flowering time via FLOWERING LOCUS C. |
| AT3G16520 | UDP-glucosyl transferase 88A1;(source:Araport11) |
| AT1G73880 | UDP-glucosyl transferase 89B1;(source:Araport11) |
| AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
| AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
| AT3G53520 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT2G15490 | UDP-glycosyltransferase 73B4;(source:Araport11) |
| AT5G49690 | UDP-glycosyltransferase that can act upon sulcotrione herbicide. Overexpression confers resistance to herbicide. |
| AT1G21070 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G34020 | Nucleotide-sugar transporter family protein. Can function in yeast as glucose transporter. |
| AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
| AT1G14140 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G29300 | intracellular protein transporter, putative (DUF641);(source:Araport11) |
| AT4G00050 | Encodes a phytochrome interacting factor that inhibits phytochrome A-mediated far-red light responses and binds to promoter regions of AT2G46970 and AT3G62090. |
| AT4G26330 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT2G47470 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. The mRNA is cell-to-cell mobile. |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT3G58450 | USP domain containing protein, member of the universal stress protein family, regulated by ABA and possibly regulated by the ABA-dependent transcription factor AREB/ABF. Involved in the regulation of seed germination. |
| AT1G49320 | Encodes USPL1, a BURP domain protein targeted to the protein storage vacuoles. Overexpression of USPL1 affects seed development, protein storage vacuoles and lipid vesicles morphology and function. |
| AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT2G31670 | Stress responsive alpha-beta barrel domain protein;(source:Araport11) |
| AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression. |
| AT3G18630 | Encodes a uracil-DNA glycosylase (UDG) involved in a base excision DNA repair pathway in mitochondria. |
| AT2G26230 | Encodes a urate oxidase that is involved in peroxisome maintenance. |
| AT2G35035 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
| AT2G03590 | Encodes a member of a class of allantoin transporters. |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT3G27190 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT1G55810 | One of the homologous genes predicted to encode proteins with UPRT domains (Uracil phosphoribosyltransferase). Five of these genes (At5g40870, At3g27190, At1g55810, At4g26510 and At3g27440) show a high level of identity, and are annotated as also containing a N-terminal uracil kinase (UK) domain. These genes are referred to as UKL1 (UK-like 1), UKL2, UKL3, UKL4 and UKL5, respectively. |
| AT1G05620 | Encodes a cytosolic inosine nucleoside hydrolase. It forms a heterocomplex with NSH1 with almost two orders of magnitude higher catalytic efficiency for xanthosine hydrolysis than observed for NSH1 alone. Transcript levels for this gene are elevated in older leaves suggesting that it may play a role in purine catabolism during senescence. |
| AT3G56620 | nodulin MtN21-like transporter family protein |
| AT4G19185 | nodulin MtN21-like transporter family protein |
| AT4G08290 | nodulin MtN21-like transporter family protein |
| AT5G64700 | nodulin MtN21-like transporter family protein |
| AT1G25270 | nodulin MtN21-like transporter family protein |
| AT1G09380 | nodulin MtN21-like transporter family protein |
| AT1G01070 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT4G01430 | Encodes a plasma membrane-localized amino acid transporter likely involved in amino acid export in the developing seed. |
| AT3G45870 | nodulin MtN21-like transporter family protein |
| AT4G01450 | nodulin MtN21-like transporter family protein |
| AT4G28040 | nodulin MtN21-like transporter family protein |
| AT4G30420 | nodulin MtN21-like transporter family protein |
| AT1G70260 | Encodes an endoplasmic reticulum (ER)-localized nodulin MtN21-like transporter family protein that negatively regulates resistance against biotrophic pathogens but not the necrotrophic pathogen, B. cinerea, possibly by regulating ROS production, cell death and PR1 expression. |
| AT3G28050 | nodulin MtN21-like transporter family protein |
| AT5G40210 | nodulin MtN21-like transporter family protein |
| AT3G28100 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
| AT3G28070 | nodulin MtN21-like transporter family protein |
| AT5G47470 | nodulin MtN21-like transporter family protein |
| AT2G45620 | Nucleotidyltransferase family protein involved in transcript polyadenylation. TUTase which connects decapping activators and prevents the accumulation of excessively deadenylated mRNAs to avoid siRNA biogenesis. |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT2G14740 | Encodes a vacuolar sorting receptor that participates in vacuolar sorting in vegetative tissues and in seeds. The mRNA is cell-to-cell mobile. |
| AT3G03090 | Encodes a vacuolar membrane-localized glucose transporter that can also transport fructose. Mutations in these gene have effects on seed germination and time to flowering. |
| AT1G64200 | vacuolar H+-ATPase subunit E isoform 3;(source:Araport11) |
| AT1G75630 | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile. |
| AT1G78920 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
| AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
| AT2G01770 | Encodes an iron transporter required for iron sequestration into vacuoles. Expressed in developing embryo and seed. Localized in the vacuolar membrane. |
| AT1G21140 | The gene encodes nodulin-like1 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
| AT1G76800 | The gene encodes nodulin-like2 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
| AT3G25190 | The gene encodes nodulin-like21 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
| AT1G63010 | Encodes an SPX domain protein that transports Pi into the vacuole and is essential for phosphate homeostasis. |
| AT2G05170 | Homologous to yeast VPS11. Forms a complex with VCL1 and AtVPS33. Involved in vacuolar biogenesis. The mRNA is cell-to-cell mobile. |
| AT3G61770 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
| AT4G21560 | vacuolar protein sorting-associated protein-like protein;(source:Araport11) |
| AT2G28520 | Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network. The mRNA is cell-to-cell mobile. |
| AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
| AT3G52850 | Encodes the Vacuolar Sorting Receptor-1 (VSR-1)/Epidermal Growth Factor Receptor-like protein1(VSR-1/ATELP1). Binds vacuolar targeting signals. Involved in sorting seed storage proteins into vacuoles. The mRNA is cell-to-cell mobile. |
| AT2G38020 | necessary for proper vacuole formation and morphogenesis in Arabidopsis |
| AT3G13300 | Encodes VCS (VARICOSE). Involved in mRNA decapping. VCS forms a mRNA decapping complex with DCP1 (At1g08370) and DCP2 (At5g13570). Unlike DCP2, VCS itself does not have mRNA decapping activity in vitro. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. VCS is also required for leaf development. |
| AT2G30950 | Metalloprotease that functions in thylakoid membrane biogenesis. Involved in the repair of PSII following damaged incurred during photoinhibition. Forms a complex with VAR1. Mutants show a variegated phenotype, which decreases during development. Transcript and protein levels increase with light intensity. In plsp1-1 mutant plastids, the nonmature form of the protein localizes in the membrane. |
| AT5G17790 | Encodes a zinc-finger motif containing protein that is essential for chloroplast RNA editing. The protein physically interacts with ORRM1 and other components of chloroplast editosomes. VAR3 is a part of a protein complex required for normal chloroplast and palisade cell development. Mutants display a variegated phenotype due to somatic areas lacking or containing developmentally retarded chloroplasts and greatly reduced numbers of palisade cells. |
| AT1G71930 | Encodes a NAC-domain transcription factor with transcriptional activation activity that is involved in xylem formation. Induces transdifferentiation of various cells into protoxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids. |
| AT3G21710 | transmembrane protein;(source:Araport11) |
| AT3G20557 | hypothetical protein;(source:Araport11) |
| AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
| AT4G24220 | encodes a progesterone-5beta-reductase-like protein. It has enone reductase activity against a wide range of substrates, including 3-oxo-Δ-4,5-steroids in vitro. The in vivo substrates and product of this enzyme have not yet been elucidated but it is likely to participate in steroid metabolism. The protein contains a mammalian death domain involved in programmed cell death. The gene is expressed in the vascular system and mutants carrying a dominant mutation in the gene have defective vascular patterning. VEP1 gene expression is induced specifically by wounding. |
| AT5G18000 | Encodes VERDANDI (VDD), a putative transcription factor belonging to the reproductive meristem (REM) family. VDD is a direct target of the MADS domain ovule identity complex. Mutation in VDD affects embryo sac differentiation. |
| AT5G61150 | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. Member of PAF-C complex. |
| AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
| AT3G05270 | Encodes a protein that localizes at motile vesicle-like small compartments in differentiating xylem cells that is associated with microtubule plus-ends. VETH-positive compartments are unlikely to be elements in conventional endomembrane trafficking pathways. It can associate with COG2, and together these two proteins co-localize with the EXO70A1 exocyst subunit, tethering EXO70A1 to compartments associated with cortical microtubules. |
| AT2G32670 | member of Synaptobrevin -like protein family |
| AT3G50080 | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
| AT2G41740 | Encodes a protein with high homology to animal villin. |
| AT5G57320 | actin filament bundling protein P-115-ABP protein;(source:Araport11) |
| AT4G11220 | VIRB2-interacting protein 2;(source:Araport11) |
| AT4G26850 | Encodes a novel protein involved in ascorbate biosynthesis, which was shown to catalyze the transfer of GMP from GDP-galactose to a variety of hexose-1-phosphate acceptors. Recessive mutation has a reduced amount of vitamin C, lower level of non-photochemical quenching, and reduced rate of conversion of violaxanthin to zeaxanthin in high light. |
| AT5G04490 | Encodes a protein with phytol kinase activity involved in tocopherol biosynthesis. |
| AT5G57490 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. |
| AT4G37710 | VQ motif-containing protein;(source:Araport11) |
| AT2G44340 | VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development. |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G79680 | Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP. |
| AT1G21240 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
| AT1G21210 | cell wall-associated ser/thr kinase involved in cell elongation and lateral root development |
| AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16140 | Encodes a predicted WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
| AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
| AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
| AT1G72290 | Encodes a Kunitz-protease inhibitor, a water-soluble chlorophyll protein involved in herbivore resistance activation. |
| AT2G26570 | Encodes a coiled-coil protein WEB1 (weak chloroplast movement under blue light 1). WEB1, together with another coiled-coil protein WEB2/PMI2 (At1g66840), maintains the chloroplast photorelocation movement velocity. |
| AT1G56510 | TIR-NB-LRR protein that confers resistance to four races of Albugo candida. The mRNA is cell-to-cell mobile. |
| AT1G11060 | Encodes one of two redundant proteins (the other is WAPL2) that are involved in prophase removal of cohesion during meiosis. Double mutants with wapl2 exhibit reduced fertility due to defects in meiosis and also some abnormal embryo development in rare cases where embryos are formed. |
| AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
| AT3G04910 | Serine/threonine protein kinase, whose transcription is regulated by circadian rhythm. |
| AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
| AT5G56210 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
| AT3G54320 | WRINKLED1 encodes transcription factor of the AP2/ERWEBP class. Protein has two plant-specific (AP2/EREB) DNA-binding domains and is involved in the control of storage compound biosynthesis in Arabidopsis. Mutants have wrinkled seed phenotype, due to a defect in the incorporation of sucrose and glucose into triacylglycerols. Transgenic sGsL plants (21-day-old) grown on 6% sucrose for 24 hours had 2-fold increase in levels of expressions (sGsL line carries a single copy of T-DNA containing the Spomin::GUS-Spomin::LUC dual reporter genes in the upper arm of chromosome 5 of ecotype Col-0. The sporamin .minimal. promoter directs sugar-inducible expression of the LUC and GUS reporters in leaves). Regulation by LEC2 promotes fatty acid accumulation during seed maturation. Splice form 3 is the major form expressed in seedlings.Mutations in the C terminal intrinsically disordered region increase the stability of WRI1 and lead to increased oil production. |
| AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
| AT4G39410 | Encodes a member of the Group II-c WRKY Transcription Factor family that is involved in stem development and has been shown to directly bind to the promoter of NST2. WRKY13 binds to the promoter of DCD to upregulate its expression and hydrogen sulfide production to enhance plant cadmium tolerance. Mutants show a weak stem phenotype and show decreased expression of lignin-synthesis-related genes. |
| AT1G30650 | member of WRKY Transcription Factor; Group II-e |
| AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
| AT2G30590 | Encodes WRKY DNA-binding protein 21 (WRKY21). |
| AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
| AT2G30250 | member of WRKY Transcription Factor; Group I. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. |
| AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
| AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
| AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
| AT4G22070 | member of WRKY Transcription Factor; Group II-b |
| AT2G34830 | member of WRKY Transcription Factor; Group II-e |
| AT2G46130 | member of WRKY Transcription Factor; Group II-c |
| AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
| AT2G21900 | member of WRKY Transcription Factor; Group II-c |
| AT2G25000 | Pathogen-induced transcription factor. Forms protein complexes with itself and with WRKY40. Coexpression with WRKY18 or WRKY40 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. |
| AT1G18860 | member of WRKY Transcription Factor; Group II-b |
| AT5G01900 | member of WRKY Transcription Factor; Group III |
| AT1G80590 | member of WRKY Transcription Factor; Group III |
| AT3G58710 | member of WRKY Transcription Factor; Group II-e |
| AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
| AT3G49210 | WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
| AT5G35690 | WT-like growth phenotype mutants of WSS1B do not display hypersensitivities after treatment with DNA-Protein crosslink inducing agents like camptothecin or cis-platin. |
| AT2G17950 | Homeobox gene controlling the stem cell pool. Expressed in the stem cell organizing center of meristems. Required to keep the stem cells in an undifferentiated state. Regulation of WUS transcription is a central checkpoint in stem cell control. The size of the WUS expression domain controls the size of the stem cell population through WUS indirectly activating the expression of CLAVATA3 (CLV3) in the stem cells and CLV3 repressing WUS transcription through the CLV1 receptor kinase signaling pathway. Repression of WUS transcription through AGAMOUS (AG) activity controls stem cell activity in the determinate floral meristem. Binds to TAAT element core motif. WUS is also involved in cell differentiation during anther development. Responds to CMV infection and represses virus accumulation in the meristem central and peripheral zones; inhibits viral protein synthesis by repressing the expression of plant S-adenosyl-L-methionine?dependent methyltransferases, which are involved in ribosomal RNA processing and ribosome stability. |
| AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT1G20700 | Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
| AT5G59340 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. WOX2 has a putative Zinc finger domain downstream of the homeodomain. Transcripts are expressed in the egg cell, the zygote and the apical cell lineage and are reduced in met3-1 early embryos. This gene is necessary for cell divisions that form the apical embryo domain. |
| AT5G05770 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT3G04630 | Member of a small gene family which have a KLEEK domain which may be involved in protein- protein interactions. Over expression of WDL1 results in abnormal root development. |
| AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
| AT3G23280 | Encodes a ubiquitin ligase that is a novel player in ethylene signaling involved in negatively regulating apical hook curvature, with alternative splicing controlling dual targeting to the nuclear and cytoplasmic compartments. |
| AT3G18000 | Encodes a N-methyltransferase-like protein. Double mutants of NMT1 and NMT3 are defective in leaf, root, flower, seed, and pollen development. |
| AT1G20850 | Cysteine peptidase. Enzyme activity detected in leaf. |
| AT5G64530 | xylem NAC domain 1;(source:Araport11) |
| AT4G00230 | xylem serine peptidase 1;(source:Araport11) |
| AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
| AT2G14620 | xyloglucan endotransglucosylase/hydrolase 10;(source:Araport11) |
| AT3G48580 | xyloglucan endotransglucosylase/hydrolase 11;(source:Araport11) |
| AT5G57540 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. |
| AT1G65310 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
| AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
| AT4G18990 | xyloglucan endotransglucosylase/hydrolase 29;(source:Araport11) |
| AT4G37800 | xyloglucan endotransglucosylase/hydrolase 7;(source:Araport11) |
| AT3G62720 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. |
| AT5G49650 | Encodes a cytosolic protein capable of phosphorylating xylulose and deoxy-xylulose. It most likely plays a role in producing precursors for isoprenoid biosynthesis. |
| AT3G54380 | SAC3/GANP/Nin1/mts3/eIF-3 p25 family;(source:Araport11) |
| AT4G24120 | Member of a small family of oligopeptide transporters similar to the yellow stripe locus of maize (ZmYS1). |
| AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
| AT1G65730 | Arabidopsis thaliana metal-nicotianamine transporter YSL4 |
| AT3G51430 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT5G51640 | Encodes leaf-senescence-related protein. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G06634 | Encodes an ABA responsive C2H2-type zinc finger transcription factor with both transcriptional repression and activation domains, that binds a G-rich, 11-bp DNA-binding motif. YY1 binds to the promoter of ABR1 and disruption represses ABA- and salt-induced ABR1 expression. |
| AT2G18840 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT4G32540 | Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis |
| AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
| AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
| AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
| AT5G25620 | Encodes a member of a family of flavin monooxygenases with an important role in auxin biosynthesis. YUC6 possesses an additional thiol-reductase activity that confers drought resistance independently of auxin biosynthesis. |
| AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
| AT5G16540 | Encodes a zinc finger protein. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT4G17810 | C2H2 domain regulatory protein. Functions downstream of GL2 during root hair development and regulates expression of targets RDH6, RSL2 and RSL4. |
| AT5G57520 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G24625 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT5G13750 | zinc induced facilitator-like 1;(source:Araport11) |
| AT3G43790 | zinc induced facilitator-like 2;(source:Araport11) |
| AT3G54826 | Zim17-type zinc finger protein;(source:Araport11) |
| AT3G12750 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. |
| AT1G55910 | member of Putative zinc transporter ZIP2 - like family |
| AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
| AT1G05300 | member of Fe(II) transporter isolog family |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT2G48020 | Encodes a zinc transporter ZIF2. Expression of ZIF2 is regulated by alternative splicing. |
| AT5G59520 | encodes a metal ion transporter whose expression is regulated by copper. |
| AT2G01210 | ZAR1 encodes a plasma membrane localized leucine-rich repeat receptor-like kinase (LRR-RLK) that contains a putative CaM-binding domain and a Gβ-binding motif within its intracellular kinase region. Homozygous of function mutations are embryo-lethal and fail to properly make the first asymmetric division of the zygote. ZAR1 interacts with both CaM and Gβ in vivo and that interaction activates ZAR1 kinase activity. |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |
| AT4G31877 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC. Pri-mRNA coordinates for MIR156c (converted to TAIR10 based on PMID19304749): Chr4: 15415873-15413295 (reverse), length: 2580 bp; exon coordinates: exon 1: 15415873 |