Leaf Senescence DataBase

ABF1 ABF2 ABF3 ABF4 ABI5 ANAC012 ANAC013 ANAC016 ANAC017 ANAC029

ANAC032 ANAC042 ANAC046 ANAC071 ANAC075 ANAC087 ANAC092 ANAC096 ARF2 ATAF1

CCA1 EIN3 MYB44 MYC2 MYC3 RAV1 RD26 Revoluta TCP20 WRKY22

WRKY45 WRKY50 WRKY55 WRKY6 WRKY70 WRKY71 WRKY75

WRKY50 Targets	Description
AT1G44760	Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11)
AT3G14280	LL-diaminopimelate aminotransferase;(source:Araport11)
AT5G33415	transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 40%25 identity and 1.9e-148 P-value to GP\|14140286\|gb\|AAK54292.1\|AC034258_10\|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT5G35240	transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, blastp match of 47%25 identity and 9.3e-52 P-value to GP\|13122426\|dbj\|BAB32907.1\|\|AP003047 putative transposable element {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT2G15640	F-box family protein;(source:Araport11)
AT2G42140	VQ motif-containing protein;(source:Araport11)
AT3G55840	Hs1pro-1 protein;(source:Araport11)
AT5G52850	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G11330	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.3e-78 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT3G48640	transmembrane protein;(source:Araport11)
AT4G09090	Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT5G38020	encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus). SABATH family methyltransferase.
AT3G15630	plant/protein;(source:Araport11)
AT2G15650	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.0e-227 P-value blast match to gb\|AAO73527.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT4G00300	AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation.
AT4G08406	transmembrane protein;(source:Araport11)
AT4G03020	transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT3G02500	mental retardation GTPase activating protein;(source:Araport11)
AT3G42780	hypothetical protein;(source:Araport11)
AT1G09980	Putative serine esterase family protein;(source:Araport11)
AT1G74820	RmlC-like cupins superfamily protein;(source:Araport11)
AT1G03370	C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11)
AT4G03420	hypothetical protein (DUF789);(source:Araport11)
AT1G67060	peptidase M50B-like protein;(source:Araport11)
AT3G58330	phospholipase-like protein (PEARLI 4) family protein;(source:Araport11)
AT3G32917	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.0e-114 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10)
AT3G46170	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT1G07580	pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT3G17070	Peroxidase family protein;(source:Araport11)
AT1G51270	vesicle-associated protein 1-4;(source:Araport11)
AT3G14025	pseudogene of scarecrow transcription factor family protein
AT3G48235	transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10)
AT3G60940	Putative endonuclease or glycosyl hydrolase;(source:Araport11)
AT3G47800	Galactose mutarotase-like superfamily protein;(source:Araport11)
AT1G31355	pseudogene of Translation protein SH3-like family protein;(source:Araport11)
AT4G31875	hypothetical protein;(source:Araport11)
AT3G58090	Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT5G51400	PLAC8 family protein;(source:Araport11)
AT1G70780	hypothetical protein;(source:Araport11)
AT2G44600	hypothetical protein;(source:Araport11)
AT5G18590	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G40920	pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G33200	transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 28%25 identity and 4.2e-16 P-value to GP\|4760708\|dbj\|BAA77394.1\|\|AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10)
AT4G03460	Ankyrin repeat family protein;(source:Araport11)
AT5G53910	RING/U-box superfamily protein;(source:Araport11)
AT3G13500	hypothetical protein;(source:Araport11)
AT1G30550	S-adenosyl-L-methionine-dependent methyltransferase superfamily protein;(source:Araport11)
AT3G24518	Natural antisense transcript overlaps with AT3G24520;(source:Araport11)
AT1G17300	hypothetical protein;(source:Araport11)
AT3G04470	Ankyrin repeat family protein;(source:Araport11)
AT1G43005	F-box/associated interaction domain protein;(source:Araport11)
AT3G03828	transmembrane protein;(source:Araport11)
AT3G27845	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT1G56140	Leucine-rich repeat transmembrane protein kinase;(source:Araport11)
AT5G11220	hypothetical protein;(source:Araport11)
AT3G20650	mRNA capping enzyme family protein;(source:Araport11)
AT1G55365	hypothetical protein;(source:Araport11)
AT3G14470	NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT1G47480	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G42930	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G02440	transmembrane protein;(source:Araport11)
AT3G63240	DNAse I-like superfamily protein;(source:Araport11)
AT3G43200	pseudogene of target of trans acting-siR480/255 protein;(source:Araport11)
AT3G46690	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT2G21840	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G11490	zinc finger (C2H2 type) family protein;(source:Araport11)
AT2G42020	pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10)
AT1G04680	Pectin lyase-like superfamily protein;(source:Araport11)
AT5G55350	MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11)
AT5G44090	Calcium-binding EF-hand family protein;(source:Araport11)
AT3G54680	proteophosphoglycan-like protein;(source:Araport11)
AT4G10730	Protein kinase superfamily protein
AT4G35500	Protein kinase superfamily protein;(source:Araport11)
AT1G31840	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G31540	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G04645	Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G19050	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G40020	Myosin heavy chain-related protein;(source:Araport11)
AT2G27420	Cysteine proteinases superfamily protein;(source:Araport11)
AT1G52130	Mannose-binding lectin superfamily protein;(source:Araport11)
AT5G09670	loricrin-like protein;(source:Araport11)
AT2G33900	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT1G51620	Protein kinase superfamily protein;(source:Araport11)
AT3G11405	hypothetical protein;(source:Araport11)
AT2G17490	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-199 P-value blast match to gb\|AAO73521.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G61710	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G70720	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT5G13250	RING finger protein;(source:Araport11)
AT1G61730	DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11)
AT2G24480	Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11)
AT2G29010	pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G15700	Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast.
AT3G22845	emp24/gp25L/p24 family/GOLD family protein;(source:Araport11)
AT1G35210	hypothetical protein;(source:Araport11)
AT5G63700	zinc ion binding / DNA binding protein;(source:Araport11)
AT3G43420	hypothetical protein;(source:Araport11)
AT3G16900	LURP-one-like protein (DUF567);(source:Araport11)
AT1G05170	Galactosyltransferase family protein;(source:Araport11)
AT3G55672	Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G28980	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT5G05010	clathrin adaptor complexes medium subunit family protein;(source:Araport11)
AT2G28710	C2H2-type zinc finger family protein;(source:Araport11)
AT3G54460	SNF2 domain-containing protein / helicase domain-containing protein / F-box family protein;(source:Araport11)
AT1G10310	encodes a NADPH-dependent pterin aldehyde reductase that accepts pterin aldehyde as well as dihydropterin aldehyde as substrates involved in metabolism and salvage of folate and its derivatives.
AT5G02920	F-box/RNI-like superfamily protein;(source:Araport11)
AT2G15750	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06845.1);(source:TAIR10)
AT1G34044	pseudogene of 50S ribosomal protein L34;(source:Araport11)
AT5G54460	wound-responsive protein-like protein;(source:Araport11)
AT1G61900	hypothetical protein;(source:Araport11)
AT1G07476	transmembrane protein;(source:Araport11)
AT5G60760	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G08010	hypothetical protein;(source:Araport11)
AT1G34570	Essential protein Yae1, N-terminal;(source:Araport11)
AT3G31909	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.0e-54 P-value blast match to Q9S9L1 /206-367 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT3G53050	D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11)
AT5G35860	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10)
AT5G50140	Ankyrin repeat family protein;(source:Araport11)
AT4G20470	transmembrane protein;(source:Araport11)
AT3G44805	TRAF-like superfamily protein;(source:Araport11)
AT2G43210	Ubiquitin-like superfamily protein;(source:Araport11)
AT5G03775	pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10)
AT1G58410	Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11)
AT3G30390	Encodes a putative amino acid transporter.
AT3G54520	hypothetical protein;(source:Araport11)
AT3G56230	BTB/POZ domain-containing protein;(source:Araport11)
AT2G16660	Major facilitator superfamily protein;(source:Araport11)
AT1G37037	transposable_element_gene;(source:Araport11)
AT3G62630	stress response NST1-like protein (DUF1645);(source:Araport11)
AT4G17650	Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11)
AT2G40745	hypothetical protein;(source:Araport11)
AT5G35460	membrane protein;(source:Araport11)
AT5G27925	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.0e-249 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G07260	SMAD/FHA domain-containing protein;(source:Araport11)
AT4G23970	hypothetical protein;(source:Araport11)
AT3G58630	sequence-specific DNA binding transcription factor;(source:Araport11)
AT1G24320	Six-hairpin glycosidases superfamily protein;(source:Araport11)
AT1G10350	DNAJ heat shock family protein;(source:Araport11)
AT5G58150	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G33910	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT3G44850	Protein kinase superfamily protein;(source:Araport11)
AT5G41100	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT4G01200	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT5G03580	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G32435	transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase GI:4335720 from (Arabidopsis thaliana);(source:TAIR10)
AT2G36700	Pectin lyase-like superfamily protein;(source:Araport11)
AT2G07483	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 7.6e-13 P-value blast match to ref\|NP_189784.1\| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10)
AT4G38370	Phosphoglycerate mutase family protein;(source:Araport11)
AT5G10830	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G20135	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT5G64550	loricrin-like protein;(source:Araport11)
AT4G01210	glycosyl transferase family 1 protein;(source:Araport11)
AT3G57120	Protein kinase superfamily protein;(source:Araport11)
AT5G08680	Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile.
AT3G45790	Protein kinase superfamily protein;(source:Araport11)
AT4G15030	folate-sensitive fragile site protein;(source:Araport11)
AT1G23270	hypothetical protein;(source:Araport11)
AT3G01980	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G03920	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-40 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G04972	hypothetical protein;(source:Araport11)
AT4G38950	ATP binding microtubule motor family protein;(source:Araport11)
AT3G24460	Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11)
AT2G42110	hypothetical protein;(source:Araport11)
AT5G55100	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11)
AT4G13615	Uncharacterized protein family SERF;(source:Araport11)
AT5G37210	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G46900	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT2G24600	Ankyrin repeat family protein;(source:Araport11)
AT5G23380	hypothetical protein (DUF789);(source:Araport11)
AT2G24240	BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11)
AT1G22060	sporulation-specific protein;(source:Araport11)
AT1G23830	transmembrane protein;(source:Araport11)
AT5G16110	hypothetical protein;(source:Araport11)
AT4G39060	LOW protein: coatomer subunit alpha-1-like protein;(source:Araport11)
AT1G35745	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.5e-62 P-value blast match to GB:CAA38906 Tam3-transposase (hAT-element) (Antirrhinum majus);(source:TAIR10)
AT4G27740	Yippee family putative zinc-binding protein;(source:Araport11)
AT5G02710	zinc/iron-chelating domain protein;(source:Araport11)
AT4G01670	hypothetical protein;(source:Araport11)
AT1G21300	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-15 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G60380	NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11)
AT2G32340	TraB family protein;(source:Araport11)
AT4G01270	RING/U-box superfamily protein;(source:Araport11)
AT5G16990	molecular function has not been defined, was shown involved in oxidative stress tolerance. The mRNA is cell-to-cell mobile.
AT4G34480	O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT5G44330	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G23500	Pectin lyase-like superfamily protein;(source:Araport11)
AT4G23470	PLAC8 family protein;(source:Araport11)
AT1G57670	Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT3G55258	pseudogene similar to self-incompatibility
AT2G39960	Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11)
AT3G55252	Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G40690	histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11)
AT4G34330	transmembrane protein, putative (DUF677);(source:Araport11)
AT3G47670	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G78530	Protein kinase superfamily protein;(source:Araport11)
AT1G18170	FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT4G31460	Ribosomal L28 family;(source:Araport11)
AT4G01460	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G19190	zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT5G36930	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G62350	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G14820	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT4G26660	kinesin-like protein;(source:Araport11)
AT5G01320	Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11)
AT1G16170	ephrin-A3 protein;(source:Araport11)
AT2G45920	U-box domain-containing protein;(source:Araport11)
AT3G18450	PLAC8 family protein;(source:Araport11)
AT5G58720	smr (Small MutS Related) domain-containing protein;(source:Araport11)
AT3G30300	O-fucosyltransferase family protein;(source:Araport11)
AT3G61840	auxin response factor, putative (DUF688);(source:Araport11)
AT2G15060	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 1.8e-63 P-value blast match to ref\|NP_189784.1\| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10)
AT4G16195	Plant self-incompatibility protein S1 family;(source:Araport11)
AT4G13820	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G65870	Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT5G59050	G patch domain protein;(source:Araport11)
AT2G14910	MAR-binding filament-like protein;(source:Araport11)
AT1G74610	pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10)
AT4G34170	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G38212	Natural antisense transcript overlaps with AT5G38210;(source:Araport11)
AT4G16162	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT3G13800	Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11)
AT2G13431	transposable_element_gene;(source:Araport11)
AT3G28350	Pseudogene of AT3G28350; unknown protein
AT2G19130	S-locus lectin protein kinase family protein;(source:Araport11)
AT1G43580	Sphingomyelin synthetase family protein;(source:Araport11)
AT4G30910	Cytosol aminopeptidase family protein;(source:Araport11)
AT3G56880	VQ motif-containing protein;(source:Araport11)
AT2G01818	PLATZ transcription factor family protein;(source:Araport11)
AT1G72720	hypothetical protein (DUF3511);(source:Araport11)
AT5G45700	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G54620	Ankyrin repeat family protein;(source:Araport11)
AT3G01513	hypothetical protein;(source:Araport11)
AT2G41000	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G57650	ATP binding protein;(source:Araport11)
AT3G55690	hypothetical protein;(source:Araport11)
AT2G27315	egg cell-secreted-like protein (DUF1278);(source:Araport11)
AT5G41290	Receptor-like protein kinase-related family protein;(source:Araport11)
AT1G10140	Uncharacterized conserved protein UCP031279;(source:Araport11)
AT4G30010	ATP-dependent RNA helicase;(source:Araport11)
AT1G28510	Optic atrophy 3 protein (OPA3);(source:Araport11)
AT5G57150	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G09644	Encodes a defensin-like (DEFL) family protein.
AT5G29613	hypothetical protein;(source:Araport11)
AT5G54720	Ankyrin repeat family protein;(source:Araport11)
AT4G16400	transmembrane protein;(source:Araport11)
AT5G35339	pseudogene of Polynucleotidyl transferase;(source:Araport11)
AT3G14740	RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT1G51645	Natural antisense transcript overlaps with AT1G51640;(source:Araport11)
AT3G58180	ARM repeat superfamily protein;(source:Araport11)
AT1G21550	Calcium-binding EF-hand family protein;(source:Araport11)
AT5G54365	pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10)
AT3G59455	Encodes a Protease inhibitor/seed storage/LTP family protein
AT5G01950	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G18840	Major facilitator superfamily protein;(source:Araport11)
AT3G01325	Expressed protein;(source:Araport11)
AT5G05965	cell wall RBR3-like protein;(source:Araport11)
AT5G60615	Encodes a defensin-like (DEFL) family protein.
AT1G49790	F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G45660	adenine phosphoribosyltransferase;(source:Araport11)
AT4G20000	VQ motif-containing protein;(source:Araport11)
AT3G49930	C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT1G66460	Protein kinase superfamily protein;(source:Araport11)
AT5G37610	Eukaryotic porin family protein;(source:Araport11)
AT3G47590	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G31710	Vacuolar ATPase assembly integral membrane protein VMA21-like domain-containing protein;(source:Araport11)
AT5G25615	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.0e-122 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT5G25754	RNA polymerase I-associated factor PAF67;(source:Araport11)
AT4G37705	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb\|AAG52949.1\| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT1G05085	hypothetical protein;(source:Araport11)
AT2G34315	avirulence induced family protein;(source:Araport11)
AT5G38340	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT3G33555	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to hypothetical protein GB:AAD26889 (Arabidopsis thaliana);(source:TAIR10)
AT4G06632	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.9e-05 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G38035	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.9e-71 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G25720	hypothetical protein;(source:Araport11)
AT1G69030	BSD domain-containing protein;(source:Araport11)
AT1G28920	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT2G39415	F-box family protein;(source:Araport11)
AT2G34450	HMG-box (high mobility group) DNA-binding family protein;(source:Araport11)
AT2G35742	snoRNA;(source:Araport11)
AT5G19172	Encodes a defensin-like (DEFL) family protein.
AT2G40008	Natural antisense transcript overlaps with AT2G40010;(source:Araport11)
AT3G27410	transmembrane protein;(source:Araport11)
AT2G31420	B3 domain protein (DUF313);(source:Araport11)
AT1G09390	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G44180	syntaxin-related family protein;(source:Araport11)
AT1G02575	transmembrane protein;(source:Araport11)
AT1G03590	Protein phosphatase 2C family protein;(source:Araport11)
AT2G41830	Uncharacterized protein;(source:Araport11)
AT3G11310	Myb/SANT-like DNA-binding domain protein;(source:Araport11)
AT1G09370	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G59110	Protein kinase superfamily protein;(source:Araport11)
AT3G12910	NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11)
AT2G23530	Zinc-finger domain of monoamine-oxidase A repressor R1;(source:Araport11)
AT3G01202	Natural antisense transcript overlaps with AT3G01200;(source:Araport11)
AT4G39280	phenylalanyl-tRNA synthetase, putative / phenylalanine-tRNA ligase;(source:Araport11)
AT1G11125	hypothetical protein;(source:Araport11)
AT5G53720	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G27180	disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT1G09260	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G31090	F-box family protein;(source:Araport11)
AT1G78070	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G52200	PLAC8 family protein;(source:Araport11)
AT1G75900	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G01890	Pectin lyase-like superfamily protein;(source:Araport11)
AT1G32730	electron carrier/iron ion-binding protein;(source:Araport11)
AT5G57035	U-box domain-containing protein kinase family protein;(source:Araport11)
AT1G31983	pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G55055	pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10)
AT5G52480	RNI-like superfamily protein;(source:Araport11)
AT3G57100	transmembrane protein, putative (DUF677);(source:Araport11)
AT1G69070	nucleolar-like protein;(source:Araport11)
AT5G52840	NADH-ubiquinone oxidoreductase-like protein;(source:Araport11)
AT3G27950	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G38260	transport/golgi organization-like protein (DUF833);(source:Araport11)
AT4G13500	transmembrane protein;(source:Araport11)
AT3G16432	hypothetical protein;(source:Araport11)
AT3G15935	pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G08820	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G50280	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G06360	Ribosomal protein S8e family protein;(source:Araport11)
AT4G30990	ARM repeat superfamily protein;(source:Araport11)
AT1G52191	Thioesterase superfamily protein;(source:Araport11)
AT4G33100	protein phosphatase;(source:Araport11)
AT2G43590	Chitinase family protein;(source:Araport11)
AT4G06474	transposable_element_gene;(source:Araport11);retroelement pol polyprotein;(source:TAIR10)
AT3G26360	Ribosomal protein S21 family protein;(source:Araport11)
AT3G14830	epstein-barr nuclear antigen;(source:Araport11)
AT4G17690	Peroxidase superfamily protein;(source:Araport11)
AT5G33432	similar to En/Spm-like transposon
AT1G50730	hypothetical protein;(source:Araport11)
AT3G46850	Subtilase family protein;(source:Araport11)
AT3G19900	hypothetical protein;(source:Araport11)
AT3G15518	hypothetical protein;(source:Araport11)
AT1G22580	transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 32%25 identity and 1.1e-13 P-value to GP\|21952510\|gb\|AAM82604.1\|AF525305_2\|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10)
AT1G68400	leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11)
AT1G05785	Got1/Sft2-like vescicle transport protein family;(source:Araport11)
AT4G18840	Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11)
AT1G32120	serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11)
AT5G13890	plant viral-response family protein (DUF716);(source:Araport11)
AT2G14635	ARABIDILLO protein;(source:Araport11)
AT4G15165	N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11)
AT1G66780	MATE efflux family protein;(source:Araport11)
AT4G08360	KOW domain-containing protein;(source:Araport11)
AT5G25420	Xanthine/uracil/vitamin C permease;(source:Araport11)
AT4G20770	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G55180	O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT1G76610	MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT1G49032	hypothetical protein;(source:Araport11)
AT5G29635	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 7.7e-111 P-value blast match to gb\|AAG52024.1\|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10)
AT1G03260	SNARE associated Golgi protein family;(source:Araport11)
AT5G40910	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT2G47150	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G42792	transposable_element_gene;(source:Araport11);Mutator-related transposase, temporary automated functional assignment;(source:TAIR10)
AT4G21920	hypothetical protein;(source:Araport11)
AT2G16592	Encodes a Protease inhibitor/seed storage/LTP family protein
AT4G24265	homeobox protein;(source:Araport11)
AT2G21860	violaxanthin de-epoxidase-like protein;(source:Araport11)
AT3G20975	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb\|AAO73529.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G72740	Single Myb Histone (SMH) gene family member. Contains terminal acidic SANT domain.
AT3G52170	DNA binding protein;(source:Araport11)
AT1G69828	Encodes a defensin-like (DEFL) family protein.
AT3G05810	IGR motif protein;(source:Araport11)
AT5G60350	hypothetical protein;(source:Araport11)
AT1G74150	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G60095	Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G63740	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G60110	Mannose-binding lectin superfamily protein;(source:Araport11)
AT3G11590	golgin family A protein;(source:Araport11)
AT4G36430	Peroxidase superfamily protein;(source:Araport11)
AT5G51260	HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11)
AT5G24600	TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11)
AT1G24600	hypothetical protein;(source:Araport11)
AT1G50830	Aminotransferase-like, plant mobile domain family protein;(source:Araport11)
AT1G53380	hypothetical protein (DUF641);(source:Araport11)
AT3G01740	Mitochondrial ribosomal protein L37;(source:Araport11)
AT2G28010	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G02420	dihydroflavonol 4-reductase/flavanone protein;(source:Araport11)
AT1G60010	PADRE protein down-regulated after infection by S. sclerotiorun.
AT3G19250	transmembrane protein, putative (DUF677);(source:Araport11)
AT4G10220	NEP-interacting protein, putative (DUF239);(source:Araport11)
AT4G39840	cell wall integrity/stress response component-like protein;(source:Araport11)
AT1G64385	transmembrane protein;(source:Araport11)
AT4G31210	DNA topoisomerase, type IA, core;(source:Araport11)
AT2G05780	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.5e-37 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G09830	nuclear receptor family 2 group C protein;(source:Araport11)
AT3G59880	hypothetical protein;(source:Araport11)
AT2G42100	Actin-like ATPase superfamily protein;(source:Araport11)
AT2G20835	hypothetical protein;(source:Araport11)
AT3G48080	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G03850	Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT2G34330	LOW protein: protein BOBBER-like protein;(source:Araport11)
AT2G30850	pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT2G15555	other_RNA;(source:Araport11)
AT1G50575	Putative lysine decarboxylase family protein;(source:Araport11)
AT1G35143	transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G52950.1);(source:TAIR10)
AT2G31730	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT2G36040	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30610.1);(source:TAIR10)
AT1G35300	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.1e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G47250	RNA helicase family protein;(source:Araport11)
AT5G51930	Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11)
AT3G42830	RING/U-box superfamily protein;(source:Araport11)
AT1G52900	Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT3G44093	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-162 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10)
AT2G30600	BTB/POZ domain-containing protein;(source:Araport11)
AT4G30150	Urb2/Npa2 family protein;(source:Araport11)
AT1G63730	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G29870	tRNA synthetase class II (G, H, P and S) family protein;(source:Araport11)
AT4G26130	cotton fiber protein;(source:Araport11)
AT4G18340	Glycosyl hydrolase superfamily protein;(source:Araport11)
AT1G34050	Ankyrin repeat family protein;(source:Araport11)
AT1G45229	transmembrane protein;(source:Araport11)
AT3G03290	Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11)
AT5G39535	pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10)
AT5G02230	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT3G49160	Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT5G54148	sarcosine dehydrogenase-2C protein;(source:Araport11)
AT2G40630	Uncharacterized conserved protein (UCP030365);(source:Araport11)
AT2G18115	pseudogene of glycine-rich protein;(source:Araport11)
AT5G53486	transmembrane protein;(source:Araport11)
AT1G13635	DNA glycosylase superfamily protein;(source:Araport11)
AT5G35932	pseudogene of hypothetical protein;(source:Araport11)
AT1G77480	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G69526	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G19550	glutamate racemase;(source:Araport11)
AT1G04430	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G03160	B-cell receptor-associated-like protein;(source:Araport11)
AT1G22440	Zinc-binding alcohol dehydrogenase family protein;(source:Araport11)
AT5G43960	Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11)
AT1G61390	S-locus lectin protein kinase family protein;(source:Araport11)
AT3G24610	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G64830	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G71691	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G33170	Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11)
AT5G47635	Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT3G09930	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G26480	RNA-binding KH domain-containing protein;(source:Araport11)
AT1G24068	other_RNA;(source:Araport11)
AT4G04925	transmembrane protein;(source:Araport11)
AT5G28143	pseudogene of topoisomerase II;(source:Araport11)
AT2G30660	ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11)
AT4G35940	hypothetical protein;(source:Araport11)
AT2G22530	Alkaline-phosphatase-like family protein;(source:Araport11)
AT1G51970	B3 domain protein;(source:Araport11)
AT5G37240	hypothetical protein;(source:Araport11)
AT2G26810	Putative methyltransferase family protein;(source:Araport11)
AT1G11370	Pectin lyase-like superfamily protein;(source:Araport11)
AT4G16855	hypothetical protein;(source:Araport11)
AT2G15760	calmodulin-binding protein (DUF1645);(source:Araport11)
AT1G71695	Peroxidase superfamily protein;(source:Araport11)
AT5G22400	Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11)
AT5G59190	subtilase family protein;(source:Araport11)
AT5G26620	hypothetical protein;(source:Araport11)
AT4G15775	pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10)
AT1G66245	hypothetical protein;(source:Araport11)
AT3G47110	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G01060	lysine-tRNA ligase;(source:Araport11)
AT3G63360	Encodes a defensin-like (DEFL) family protein.
AT4G22285	Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11)
AT3G48208	Encodes a Plant thionin family protein
AT3G28810	mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11)
AT2G26450	Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT5G45590	Ribosomal protein L35;(source:Araport11)
AT5G59330	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT1G17285	transmembrane protein;(source:Araport11)
AT1G33840	LURP-one-like protein (DUF567);(source:Araport11)
AT5G56530	tRNA-splicing ligase (DUF239);(source:Araport11)
AT3G15240	Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11)
AT1G49570	Peroxidase superfamily protein;(source:Araport11)
AT2G42980	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G27230	Frigida-like protein;(source:Araport11)
AT1G69420	DHHC-type zinc finger family protein;(source:Araport11)
AT3G11810	transmembrane protein;(source:Araport11)
AT1G52060	Mannose-binding lectin superfamily protein;(source:Araport11)
AT1G44020	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G11190	Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT3G22510	Pre-rRNA-processing protein TSR2, conserved region;(source:Araport11)
AT2G27430	ARM repeat superfamily protein;(source:Araport11)
AT4G18820	AAA-type ATPase family protein;(source:Araport11)
AT4G06572	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-68 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT2G03510	SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11)
AT2G21300	ATP binding microtubule motor family protein;(source:Araport11)
AT4G19460	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G22057	cysteine-rich repeat secretory protein;(source:Araport11)
AT4G00165	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT1G53345	DHHA1 domain protein;(source:Araport11)
AT2G25200	hypothetical protein (DUF868);(source:Araport11)
AT1G55700	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G39805	Integral membrane Yip1 family protein;(source:Araport11)
AT3G45200	hypothetical protein;(source:Araport11)
AT4G22960	FAM63A-like protein (DUF544);(source:Araport11)
AT3G42550	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G05310	Ubiquitin-like superfamily protein;(source:Araport11)
AT1G61150	LisH and RanBPM domains containing protein;(source:Araport11)
AT5G23212	Encodes a defensin-like (DEFL) family protein.
AT4G03923	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G37190	plasma membrane, autoregulation-binding site, misato segment II, myosin-like, tubulin/FtsZ protein;(source:Araport11)
AT5G28545	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-08 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT3G50620	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G01410	NHL domain-containing protein;(source:Araport11)
AT5G66590	CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11)
AT1G31335	transmembrane protein;(source:Araport11)
AT4G17940	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G19615	beta-1,4-xylosidase;(source:Araport11)
AT5G22560	transmembrane protein, putative (DUF247);(source:Araport11)
AT3G46370	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G35736	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT1G49030	PLAC8 family protein;(source:Araport11)
AT1G17010	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G80610	hypothetical protein;(source:Araport11)
AT5G06990	MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT5G19230	Glycoprotein membrane precursor GPI-anchored;(source:Araport11)
AT4G34380	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G57400	transmembrane protein;(source:Araport11)
AT3G10430	F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G29310	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G03930	kinase-like protein;(source:Araport11)
AT5G52965	egg cell-secreted-like protein (DUF1278);(source:Araport11)
AT2G27590	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G47300	F-box family protein;(source:Araport11)
AT4G02250	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G05710	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G00090	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT2G41640	Glycosyltransferase family 61 protein;(source:Araport11)
AT2G45460	SMAD/FHA domain-containing protein;(source:Araport11)
AT5G32070	transposable_element_gene;(source:Araport11);similar to AT hook motif-containing protein-related [Arabidopsis thaliana] (TAIR:AT3G42100.1);(source:TAIR10)
AT3G29220	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10)
AT1G53640	transmembrane protein;(source:Araport11)
AT3G27090	DCD (Development and Cell Death) domain protein;(source:Araport11)
AT3G63095	Encodes a Protease inhibitor/seed storage/LTP family protein
AT1G54890	Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11)
AT5G23160	transmembrane protein;(source:Araport11)
AT4G39780	encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
AT3G52330	F-box associated ubiquitination effector family protein;(source:Araport11)
AT2G17320	pantothenate kinase;(source:Araport11)
AT1G51530	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT4G07950	DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11)
AT5G49920	Octicosapeptide/Phox/Bem1p family protein;(source:Araport11)
AT5G11840	YCF36, putative (DUF1230);(source:Araport11)
AT5G18210	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT4G23520	Cysteine proteinases superfamily protein;(source:Araport11)
AT5G22530	Unknown protein, knockout shows increased sensitivity to Al stress.
AT5G66060	2-oxoglutarate-dependent dioxygenase
AT2G07720	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-59 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G26747	pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10)
AT4G00160	F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G12930	inactive rhomboid protein;(source:Araport11)
AT5G14940	Major facilitator superfamily protein;(source:Araport11)
AT1G52950	Nucleic acid-binding, OB-fold-like protein;(source:Araport11)
AT2G43890	Pectin lyase-like superfamily protein;(source:Araport11)
AT3G61280	O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11)
AT3G59260	pirin;(source:Araport11)
AT3G19360	Zinc finger (CCCH-type) family protein;(source:Araport11)
AT1G70900	hypothetical protein;(source:Araport11)
AT1G64850	Calcium-binding EF hand family protein;(source:Araport11)
AT1G33250	beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11)
AT3G16510	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT2G36440	hypothetical protein;(source:Araport11)
AT4G27480	GT14 enzyme
AT2G47120	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G19420	Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11)
AT5G48200	hypothetical protein;(source:Araport11)
AT1G14650	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein;(source:Araport11)
AT5G48800	Phototropic-responsive NPH3 family protein;(source:Araport11)
AT2G14810	hypothetical protein;(source:Araport11)
AT1G77525	defensin-like protein;(source:Araport11)
AT5G52815	pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10)
AT1G63750	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G65483	hypothetical protein;(source:Araport11)
AT3G24780	Uncharacterized conserved protein UCP015417, vWA;(source:Araport11)
AT2G23755	transmembrane family 220 helix protein;(source:Araport11)
AT5G61330	rRNA processing protein-like protein;(source:Araport11)
AT1G75970	pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10)
AT1G35570	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10)
AT4G28260	acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11)
AT5G60580	RING/U-box superfamily protein;(source:Araport11)
AT1G77290	Glutathione S-transferase family protein;(source:Araport11)
AT5G06520	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11)
AT2G22805	Encodes a defensin-like (DEFL) family protein.
AT2G34350	Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11)
AT2G28960	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G22072	Natural antisense transcript overlaps with AT3G22070;(source:Araport11)
AT4G33170	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT2G33847	hypothetical protein;(source:Araport11)
AT5G64850	sorbin/SH3 domain protein;(source:Araport11)
AT5G43240	hypothetical protein (DUF674);(source:Araport11)
AT5G12300	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT4G36210	transmembrane/coiled-coil protein (DUF726);(source:Araport11)
AT1G33260	Protein kinase superfamily protein;(source:Araport11)
AT4G08630	fas-binding factor-like protein;(source:Araport11)
AT1G15840	hypothetical protein;(source:Araport11)
AT5G25470	AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT2G36580	Pyruvate kinase family protein;(source:Araport11)
AT4G32360	Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11)
AT3G12040	Encodes a 3-methyladenine-DNA glycosylase. Arabdiopsis cDNA complements the methyl methanesulfonate-sensitive phenotype of an Escherichia coli double mutant deficient in 3-methyladenine glycosylases (DNA-3-methyladenine glycosidases I and II, EC 3.2.2.20 and 3.2.2.21, respectively, encoded by tag and alkA).
AT3G52520	hypothetical protein;(source:Araport11)
AT1G24210	Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT4G20920	double-stranded RNA-binding domain (DsRBD)-containing protein;(source:Araport11)
AT2G39270	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G48710	DEK domain-containing chromatin associated protein;(source:Araport11)
AT5G42960	outer envelope pore 24B-like protein;(source:Araport11)
AT5G25320	ACT-like superfamily protein;(source:Araport11)
AT2G43630	nucleusenvelope protein;(source:Araport11)
AT5G34852	pseudogene of Intron maturase;(source:Araport11)
AT1G28850	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT3G20085	similarity to Retrotransposon - like protein (Copia-like retroelement pol polyprotein-like).
AT1G47950	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-238 P-value blast match to dbj\|BAA78425.1\| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10)
AT3G17225	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT4G30170	Peroxidase family protein;(source:Araport11)
AT1G04790	RING/U-box superfamily protein;(source:Araport11)
AT5G43040	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G46192	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G61200	Thioesterase superfamily protein;(source:Araport11)
AT1G23205	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G01331	Encodes a ECA1 gametogenesis related family protein
AT5G55610	isopentenyl-diphosphate delta-isomerase;(source:Araport11)
AT5G38250	Protein kinase family protein;(source:Araport11)
AT5G22930	enabled-like protein (DUF1635);(source:Araport11)
AT3G46260	kinase-like protein;(source:Araport11)
AT3G13403	Encodes a defensin-like (DEFL) family protein.
AT4G29990	Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11)
AT5G65380	MATE efflux family protein;(source:Araport11)
AT2G18070	hypothetical protein;(source:Araport11)
AT5G10190	Major facilitator superfamily protein;(source:Araport11)
AT3G13030	hAT transposon superfamily protein;(source:Araport11)
AT4G10507	other_RNA;(source:Araport11)
AT5G67020	hypothetical protein;(source:Araport11)
AT5G53135	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-199 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G30757	transmembrane protein;(source:Araport11)
AT4G23730	Galactose mutarotase-like superfamily protein;(source:Araport11)
AT1G70590	F-box family protein;(source:Araport11)
AT1G65541	hypothetical protein;(source:Araport11)
AT2G01560	Plant protein 1589 of unknown function;(source:Araport11)
AT5G35205	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-36 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT5G01200	Duplicated homeodomain-like superfamily protein;(source:Araport11)
AT4G37620	transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10)
AT5G19350	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G15830	hypothetical protein;(source:Araport11)
AT1G66830	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G48675	pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10)
AT3G11420	beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11)
AT2G28690	TOX high mobility group box protein, putative (DUF1635);(source:Araport11)
AT3G51360	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G77131	Annotated as pseudogene of PGSIP, glycogenin glucosyltransferase.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT5G24316	proline-rich family protein;(source:Araport11)
AT3G59850	Pectin lyase-like superfamily protein;(source:Araport11)
AT2G30150	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G11240	ribosomal RNA-processing protein;(source:Araport11)
AT2G40820	stomatal closure actin-binding-like protein;(source:Araport11)
AT2G34190	Xanthine/uracil permease family protein;(source:Araport11)
AT1G78840	F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G65120	Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT3G52470	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT5G47020	MraZ;(source:Araport11)
AT1G68875	hypothetical protein;(source:Araport11)
AT3G49350	Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT4G37030	membrane protein;(source:Araport11)
AT5G28491	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT1G28720	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT1G76780	HSP20-like chaperones superfamily protein;(source:Araport11)
AT1G31370	Ubiquitin-specific protease family C19-related protein;(source:Araport11)
AT1G65200	Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT1G14460	AAA-type ATPase family protein;(source:Araport11)
AT3G46186	pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT1G55221	Pseudogene of AT1G55240
AT1G79245	pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11)
AT3G06778	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT4G17486	PPPDE putative thiol peptidase family protein;(source:Araport11)
AT5G59662	Natural antisense transcript overlaps with AT5G59660;(source:Araport11)
AT3G29000	Calcium-binding EF-hand family protein;(source:Araport11)
AT3G27473	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G70505	transmembrane protein;(source:Araport11)
AT5G54370	Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11)
AT4G19360	SCD6 protein-like protein;(source:Araport11)
AT2G28970	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G15500	RNA-binding protein;(source:Araport11)
AT5G38220	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G11340	G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11)
AT4G22640	LTPG protein
AT5G36937	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT5G54350	C2H2-type zinc finger protein;(source:Araport11)
AT1G61260	cotton fiber (DUF761);(source:Araport11)
AT5G05830	RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT5G11325	pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10)
AT3G18150	RNI-like superfamily protein;(source:Araport11)
AT5G07315	pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10)
AT3G20620	F-box family protein-like protein;(source:Araport11)
AT1G21330	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10)
AT4G11300	ROH1, putative (DUF793);(source:Araport11)
AT3G60540	Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11)
AT2G03100	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-225 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G36860	pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10)
AT1G26660	Prefoldin chaperone subunit family protein;(source:Araport11)
AT5G50190	other_RNA;(source:Araport11)
AT3G32975	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-133 P-value blast match to gb\|AAL06422.1\|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10)
AT1G51790	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G56160	Sodium Bile acid symporter family;(source:Araport11)
AT1G66910	Protein kinase superfamily protein;(source:Araport11)
AT1G03280	Transcription factor TFIIE, alpha subunit;(source:Araport11)
AT4G17910	transferases, transferring acyl groups;(source:Araport11)
AT1G77765	transmembrane protein;(source:Araport11)
AT1G76290	AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT4G37700	hypothetical protein;(source:Araport11)
AT1G24420	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G46195	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.8e-38 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G05160	CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11)
AT3G24070	Zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT1G22140	zinc finger CCCH domain protein;(source:Araport11)
AT1G12180	14.7 kDa heat shock-like protein;(source:Araport11)
AT5G57230	Thioredoxin superfamily protein;(source:Araport11)
AT2G36680	Modifier of rudimentary (Mod(r)) protein;(source:Araport11)
AT1G21930	transmembrane protein;(source:Araport11)
AT1G15860	defective in cullin neddylation protein (DUF298);(source:Araport11)
AT1G72820	Mitochondrial substrate carrier family protein;(source:Araport11)
AT2G36255	Encodes a defensin-like (DEFL) family protein.
AT1G31220	N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide
AT4G31980	PPPDE thiol peptidase family protein;(source:Araport11)
AT5G23610	DYAD protein;(source:Araport11)
AT1G51310	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase;(source:Araport11)
AT5G33300	chromosome-associated kinesin-like protein;(source:Araport11)
AT1G72060	serine-type endopeptidase inhibitor;(source:Araport11)
AT5G48500	pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11)
AT3G43890	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G03440	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT2G29810	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT3G60200	hypothetical protein;(source:Araport11)
AT3G47610	transcription regulator/ zinc ion binding protein;(source:Araport11)
AT1G51040	Protein kinase superfamily protein;(source:Araport11)
AT5G08480	VQ motif-containing protein;(source:Araport11)
AT1G76070	hypothetical protein;(source:Araport11)
AT5G28310	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G36240	zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT5G42220	Ubiquitin-like superfamily protein;(source:Araport11)
AT1G04900	NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11)
AT1G30282	Natural antisense transcript overlaps with AT1G30280;(source:Araport11)
AT1G29580	mediator of RNA polymerase II transcription subunit;(source:Araport11)
AT1G23560	OBP32pep, putative (DUF220);(source:Araport11)
AT5G26830	Encodes a dual-targeted threonyl-tRNA synthetase found in both the chloroplast and mitochondrion. The mRNA is cell-to-cell mobile.
AT2G14900	Gibberellin-regulated family protein;(source:Araport11)
AT5G64880	transmembrane protein;(source:Araport11)
AT1G76580	Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11)
AT4G04296	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-13 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10)
AT1G33070	MADS-box family protein;(source:Araport11)
AT1G05670	Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11)
AT5G27238	Plant self-incompatibility protein S1 family;(source:Araport11)
AT2G43610	Chitinase family protein;(source:Araport11)
AT5G35735	Auxin-responsive family protein;(source:Araport11)
AT4G20730	transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10)
AT1G70400	NOSIC domain protein;(source:Araport11)
AT1G33230	TMPIT-like protein;(source:Araport11)
AT4G16563	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G69818	Encodes a defensin-like (DEFL) family protein.
AT5G66310	ATP binding microtubule motor family protein;(source:Araport11)
AT3G49960	Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells.
AT5G56570	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT4G33910	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G08600	transmembrane protein, putative (DUF1191);(source:Araport11)
AT3G57110	exonuclease V;(source:Araport11)
AT2G33845	Nucleic acid-binding, OB-fold-like protein;(source:Araport11)
AT1G77095	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT5G24220	Lipase class 3-related protein;(source:Araport11)
AT1G78865	other_RNA;(source:Araport11)
AT4G32990	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G23540	ARM repeat superfamily protein;(source:Araport11)
AT3G50300	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT4G39580	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G07485	hypothetical protein;(source:Araport11)
AT1G51860	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G16530	hypothetical protein;(source:Araport11)
AT2G37700	Fatty acid hydroxylase superfamily;(source:Araport11)
AT2G23321	hypothetical protein;(source:Araport11)
AT3G07450	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G36140	disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT5G42740	Sugar isomerase (SIS) family protein;(source:Araport11)
AT1G77790	Glycosyl hydrolase superfamily protein;(source:Araport11)
AT1G23037	F-box associated ubiquitination effector family protein;(source:Araport11)
AT4G06702	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G41140	Myosin heavy chain-related protein;(source:Araport11)
AT1G78170	E3 ubiquitin-protein ligase;(source:Araport11)
AT3G21940	Receptor protein kinase-like protein;(source:Araport11)
AT1G61460	G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11)
AT3G59310	solute carrier family 35 protein (DUF914);(source:Araport11)
AT4G09870	F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G22570	Major facilitator superfamily protein;(source:Araport11)
AT1G51035	hypothetical protein;(source:Araport11)
AT1G12670	Encodes a Plant thionin family protein [pseudogene]
AT3G43715	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10)
AT3G25495	pseudogene of leucine-rich repeat protein
AT4G32390	Nucleotide-sugar transporter family protein;(source:Araport11)
AT2G30780	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G75870	hypothetical protein;(source:Araport11)
AT2G25409	hypothetical protein;(source:Araport11)
AT5G66455	pseudogene of pentatricopeptide (PPR) repeat-containing protein
AT1G45140	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-37 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G16220	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G10490	GNAT acetyltransferase (DUF699);(source:Araport11)
AT1G43775	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj\|BAA78426.1\| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT2G36410	transcriptional activator (DUF662);(source:Araport11)
AT3G50010	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G39090	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G34847	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-27 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G13210	Uncharacterized conserved protein UCP015417, vWA;(source:Araport11)
AT5G24940	Protein phosphatase 2C family protein;(source:Araport11)
AT5G44600	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G59300	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G46190	TRAF-like family protein;(source:Araport11)
AT3G52500	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G27875	pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10)
AT1G28327	E3 ubiquitin-protein ligase;(source:Araport11)
AT2G42460	MATH domain/coiled-coil protein;(source:Araport11)
AT2G26270	BRCT domain DNA repair protein;(source:Araport11)
AT3G60710	F-box family protein.
AT1G79570	kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11)
AT1G70100	neurofilament heavy protein;(source:Araport11)
AT1G22830	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT2G35570	pseudogene of Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT1G13820	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G02260	Divalent ion symporter;(source:Araport11)
AT3G46360	transmembrane protein;(source:Araport11)
AT3G20590	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT1G11362	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G12760	Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11)
AT3G04300	RmlC-like cupins superfamily protein;(source:Araport11)
AT4G39952	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G05410	MATH domain/coiled-coil protein;(source:Araport11)
AT1G27752	Ubiquitin system component Cue protein;(source:Araport11)
AT3G33058	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT1G51520	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G22030	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G25930	kinase family with leucine-rich repeat domain-containing protein;(source:Araport11)
AT1G45015	MD-2-related lipid recognition domain-containing protein;(source:Araport11)
AT4G02540	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G65320	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT3G47100	hypothetical protein;(source:Araport11)
AT3G48220	F-box protein;(source:Araport11)
AT1G66650	Protein with RING/U-box and TRAF-like domain;(source:Araport11)
AT1G24388	hypothetical protein;(source:Araport11)
AT1G15405	other_RNA;(source:Araport11)
AT5G25415	hypothetical protein (DUF239);(source:Araport11)
AT3G06437	pseudogene of hypothetical protein;(source:Araport11)
AT4G04495	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.9e-24 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT4G36230	transmembrane protein;(source:Araport11)
AT1G61350	ARM repeat superfamily protein;(source:Araport11)
AT5G45630	senescence regulator (Protein of unknown function, DUF584);(source:Araport11)
AT1G30190	cotton fiber protein;(source:Araport11)
AT3G43710	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G47740	pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10)
AT3G25720	RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT3G47050	Glycosyl hydrolase family protein;(source:Araport11)
AT1G42980	Actin-binding FH2 (formin homology 2) family protein;(source:Araport11)
AT1G53370	F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G13851	pseudogene of hypothetical protein;(source:Araport11)
AT5G67411	GRAS family transcription factor;(source:Araport11)
AT5G42610	calcium uniporter (DUF607);(source:Araport11)
AT3G29680	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT4G01516	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G43910	pfkB-like carbohydrate kinase family protein;(source:Araport11)
AT4G00905	NC domain-containing protein-like protein;(source:Araport11)
AT5G48430	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G05080	F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G26270	Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11)
AT1G10865	cytochrome C oxidase assembly factor;(source:Araport11)
AT1G48220	Protein kinase superfamily protein;(source:Araport11)
AT5G53020	Ribonuclease P protein subunit P38-like protein;(source:Araport11)
AT5G65305	pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10)
AT3G46700	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G36650	transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 26%25 identity and 8.3e-12 P-value to GP\|20279456\|gb\|AAM18736.1\|AC092548_14\|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT4G28450	This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase
AT2G24170	Endomembrane protein 70 protein family;(source:Araport11)
AT1G21440	Phosphoenolpyruvate carboxylase family protein;(source:Araport11)
AT4G13580	Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT1G05790	lipase class 3 family protein;(source:Araport11)
AT3G19663	hypothetical protein;(source:Araport11)
AT3G10880	tropomyosin;(source:Araport11)
AT5G59080	hypothetical protein;(source:Araport11)
AT3G51350	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT3G10185	Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein
AT1G01540	Protein kinase superfamily protein;(source:Araport11)
AT3G45660	Encodes a member of the NAXT NPF subfamily.
AT1G61890	MATE efflux family protein;(source:Araport11)
AT4G34500	Protein kinase superfamily protein;(source:Araport11)
AT5G66330	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G50970	Membrane trafficking VPS53 family protein;(source:Araport11)
AT3G42796	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-31 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G44820	Peptidase M20/M25/M40 family protein;(source:Araport11)
AT1G14688	E3 ubiquitin ligase;(source:Araport11)
AT4G11580	RNI-like superfamily protein;(source:Araport11)
AT3G49200	O-acyltransferase (WSD1-like) family protein;(source:Araport11)
AT4G24050	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT1G29320	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT3G56830	Similar in sequence to NPQ6 and NPQ7, but loss of function mutant does not exhibit a nonphotochemical quenching phenotype.
AT4G03370	Ubiquitin family protein;(source:Araport11)
AT3G04250	F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G30320	Remorin family protein;(source:Araport11)
AT5G51680	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G80120	LURP-one-like protein (DUF567);(source:Araport11)
AT4G06534	transmembrane protein;(source:Araport11)
AT1G35830	VQ motif-containing protein;(source:Araport11)
AT3G44280	peptidyl-prolyl cis-trans isomerase G;(source:Araport11)
AT3G45256	transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10)
AT1G33780	electron transporter, putative (DUF179);(source:Araport11)
AT1G11210	cotton fiber protein, putative (DUF761);(source:Araport11)
AT4G23490	fringe-like protein (DUF604);(source:Araport11)
AT2G18150	Peroxidase superfamily protein;(source:Araport11)
AT4G26380	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G11340	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G37790	Protein kinase superfamily protein;(source:Araport11)
AT1G61370	S-locus lectin protein kinase family protein;(source:Araport11)
AT2G28570	hypothetical protein;(source:Araport11)
AT4G24090	homer protein;(source:Araport11)
AT5G18750	DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT2G19360	tRNA-splicing ligase, putative (DUF239);(source:Araport11)
AT5G63180	Pectin lyase-like superfamily protein;(source:Araport11)
AT4G17440	chromogranin (DUF1639);(source:Araport11)
AT1G03982	PAK-box/P21-Rho-binding family protein;(source:Araport11)
AT1G02030	C2H2-like zinc finger protein;(source:Araport11)
AT1G06700	Protein kinase superfamily protein;(source:Araport11)
AT3G43550	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G12090	Cornichon family protein;(source:Araport11)
AT4G22280	F-box/RNI-like superfamily protein;(source:Araport11)
AT3G08910	DNAJ heat shock family protein;(source:Araport11)
AT5G24320	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G09584	pseudogene of nucleic acid binding / zinc ion binding protein;(source:Araport11)
AT5G05310	TLC ATP/ADP transporter;(source:Araport11)
AT4G11410	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT1G17495	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-213 P-value blast match to gb\|AAO73521.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT3G27340	Myb domain protein;(source:Araport11)
AT5G60700	glycosyltransferase family protein 2;(source:Araport11)
AT2G22942	growth factor;(source:Araport11)
AT4G30500	transmembrane protein (DUF788);(source:Araport11)
AT2G23834	hypothetical protein;(source:Araport11)
AT3G03610	ELMO/CED-12 family protein;(source:Araport11)
AT1G05450	Encodes a Protease inhibitor/seed storage/LTP family protein
AT4G15070	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G09620	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G24920	secE/sec61-gamma protein transport protein;(source:Araport11)
AT2G16895	pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT5G28515	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G48960	Ribosomal protein L13e family protein;(source:Araport11)
AT5G58610	PHD finger transcription factor;(source:Araport11)
AT5G66675	transmembrane protein, putative (DUF677);(source:Araport11)
AT1G29360	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-24 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT4G28930	hypothetical protein;(source:Araport11)
AT1G63820	CCT motif family protein;(source:Araport11)
AT4G29120	6-phosphogluconate dehydrogenase family protein;(source:Araport11)
AT1G53625	hypothetical protein;(source:Araport11)
AT1G67270	Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11)
AT4G21950	hypothetical protein;(source:Araport11)
AT5G09290	Inositol monophosphatase family protein;(source:Araport11)
AT5G47435	encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle.
AT5G15260	ribosomal protein L34e superfamily protein;(source:Araport11)
AT1G10455	B3 DNA-binding domain protein;(source:Araport11)
AT1G11572	Encodes a Plant thionin family protein
AT1G04490	hypothetical protein (DUF3527);(source:Araport11)
AT4G26210	Mitochondrial ATP synthase subunit G protein;(source:Araport11)
AT4G37820	transmembrane protein;(source:Araport11)
AT4G07820	CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11)
AT1G10720	BSD domain-containing protein;(source:Araport11)
AT1G76660	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT2G02510	NADH dehydrogenase (ubiquinone)s;(source:Araport11)
AT2G02795	transmembrane protein;(source:Araport11)
AT4G12065	pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT5G23650	Homeodomain-like transcriptional regulator;(source:Araport11)
AT2G32315	Natural antisense transcript overlaps with AT2G32310;(source:Araport11)
AT4G08340	transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10)
AT3G05160	Major facilitator superfamily protein;(source:Araport11)
AT2G39160	hypothetical protein;(source:Araport11)
AT2G28270	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G43570	Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860.
AT1G09645	transmembrane protein;(source:Araport11)
AT1G55830	coiled-coil protein;(source:Araport11)
AT1G73570	HCP-like superfamily protein;(source:Araport11)
AT3G17500	F-box family protein;(source:Araport11)
AT3G23245	hypothetical protein;(source:Araport11)
AT5G32678	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G52800	A20/AN1-like zinc finger family protein;(source:Araport11)
AT1G50000	methyltransferase;(source:Araport11)
AT4G10520	Subtilase family protein;(source:Araport11)
AT1G21286	Pseudogene of AT1G21245; wall-associated kinase-related protein
AT2G28780	P-hydroxybenzoic acid efflux pump subunit;(source:Araport11)
AT2G35658	transmembrane protein;(source:Araport11)
AT1G76185	NADH-ubiquinone oxidoreductase chain;(source:Araport11)
AT2G25520	Drug/metabolite transporter superfamily protein;(source:Araport11)
AT3G52527	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-22 P-value blast match to GB:AAC02672 polyprotein (Ty1_Copia-element) (Arabidopsis arenosa);(source:TAIR10)
AT4G10655	Encodes a defensin-like (DEFL) family protein.
AT1G33475	SNARE-like superfamily protein;(source:Araport11)
AT3G13280	Putative endonuclease or glycosyl hydrolase;(source:Araport11)
AT5G09876	hypothetical protein;(source:Araport11)
AT3G20380	TRAF-like family protein;(source:Araport11)
AT3G13560	O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT5G44860	polyadenylate-binding protein 1-B-binding protein;(source:Araport11)
AT2G33140	pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10)
AT3G21540	transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT4G32000	Protein kinase superfamily protein;(source:Araport11)
AT2G37440	DNAse I-like superfamily protein;(source:Araport11)
AT1G09620	ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11)
AT5G65660	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT4G13330	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G18790	pre-mRNA-splicing factor ISY1-like protein;(source:Araport11)
AT1G73970	obscurin-like protein;(source:Araport11)
AT5G35610	Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT3G52765	pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10)
AT1G61830	pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G28610	LOW protein: ATP-dependent RNA helicase DRS1-like protein;(source:Araport11)
AT1G53110	proton pump-interactor;(source:Araport11)
AT5G41800	Transmembrane amino acid transporter family protein;(source:Araport11)
AT3G23160	plant/protein (DUF668);(source:Araport11)
AT5G65180	ENTH/VHS family protein;(source:Araport11)
AT2G38823	hypothetical protein;(source:Araport11)
AT3G49630	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT4G08990	DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11)
AT4G33180	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G01030	C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT1G74750	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G76705	calmodulin binding protein;(source:Araport11)
AT3G58600	Adaptin ear-binding coat-associated protein 1 NECAP-1;(source:Araport11)
AT2G16760	Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT3G51440	Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT3G45935	pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10)
AT2G39710	Encodes a Cysteine-rich peptide (CRP) family protein
AT1G80690	PPPDE putative thiol peptidase family protein;(source:Araport11)
AT2G35250	NEP-interacting protein, putative (DUF239);(source:Araport11)
AT2G46455	OxaA/YidC-like membrane insertion protein;(source:Araport11)
AT2G13190	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-06 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT2G37510	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G42690	transcription factor, putative (Protein of unknown function, DUF547);(source:Araport11)
AT1G14455	hypothetical protein;(source:Araport11)
AT4G27620	intracellular protein transporter;(source:Araport11)
AT5G37476	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-18 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G43640	Signal recognition particle, SRP9/SRP14 subunit;(source:Araport11)
AT4G09432	Natural antisense transcript overlaps with AT4G09430;(source:Araport11)
AT3G10116	COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family;(source:Araport11)
AT5G19221	Natural antisense transcript overlaps with AT5G19220;(source:Araport11)
AT1G14730	Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11)
AT4G14280	ARM repeat superfamily protein;(source:Araport11)
AT5G55010	hypothetical protein;(source:Araport11)
AT4G29590	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT2G44198	hypothetical protein;(source:Araport11)
AT2G27630	Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT5G35738	pseudogene of zinc-dependent activator protein-1;(source:Araport11)
AT1G11670	MATE efflux family protein;(source:Araport11)
AT2G24615	Encodes a defensin-like (DEFL) family protein.
AT2G23710	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10)
AT1G77730	Pleckstrin homology (PH) domain superfamily protein;(source:Araport11)
AT5G04860	splicing factor 3A subunit;(source:Araport11)
AT5G50860	Protein kinase superfamily protein;(source:Araport11)
AT4G35985	Senescence/dehydration-associated protein-like protein;(source:Araport11)
AT5G03370	acylphosphatase family;(source:Araport11)
AT3G27330	zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT1G70770	Involved in cell wall modifications resulting in resistance to the biotroph Hpa.
AT1G05675	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT2G06922	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-20 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT1G02750	Drought-responsive family protein;(source:Araport11)
AT2G37540	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G49170	hypothetical protein;(source:Araport11)
AT2G23900	Pectin lyase-like superfamily protein;(source:Araport11)
AT3G61035	Cytochrome P450 superfamily protein;(source:Araport11)
AT3G62280	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G43675	similarity to non-LTR retroelement protein
AT5G45500	RNI-like superfamily protein;(source:Araport11)
AT1G14390	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G38870	Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860.
AT4G23720	transmembrane protein, putative (DUF1191);(source:Araport11)
AT3G51950	Contains single CCCH domain.
AT1G02590	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding protein;(source:Araport11)
AT3G57460	catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11)
AT3G48070	RING/U-box superfamily protein;(source:Araport11)
AT1G66440	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G28923	Pseudogene of AT5G01080; beta-galactosidase
AT1G74010	Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT5G24210	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G11925	Encodes a Stigma-specific Stig1 family protein
AT1G52070	Mannose-binding lectin superfamily protein;(source:Araport11)
AT5G24430	Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11)
AT2G48030	DNAse I-like superfamily protein;(source:Araport11)
AT5G38130	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT3G54880	zinc finger protein;(source:Araport11)
AT4G08145	transposable_element_gene;(source:Araport11);hypothetical protein, contains Pfam domain, PF04827: Protein of unknown function (DUF635);(source:TAIR10)
AT1G52110	Mannose-binding lectin superfamily protein;(source:Araport11)
AT4G00890	Encodes a putative glycosyl hydrolase family 10 protein (xylanase).
AT1G03210	Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11)
AT2G43620	Chitinase family protein;(source:Araport11)
AT2G41950	DNA-directed RNA polymerase subunit beta;(source:Araport11)
AT1G11360	Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11)
AT5G51220	ubiquinol-cytochrome C chaperone family protein;(source:Araport11)
AT3G20730	PPR superfamily protein;(source:Araport11)
AT4G07940	pre-mRNA-splicing factor CWC22-like protein, putative (DUF3245);(source:Araport11)
AT1G69900	Actin cross-linking protein;(source:Araport11)
AT3G48205	Encodes a Plant thionin family protein
AT3G12410	Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT3G55960	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT1G60783	cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11)
AT2G18830	RNA-binding (RRM/RBD/RNP motif) family protein;(source:Araport11)
AT1G61400	S-locus lectin protein kinase family protein;(source:Araport11)
AT5G05430	RNA-binding protein;(source:Araport11)
AT5G66670	pectinesterase, putative (DUF677);(source:Araport11)
AT5G13980	Glycosyl hydrolase family 38 protein;(source:Araport11)
AT2G33970	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT1G18485	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G51750	hypothetical protein;(source:Araport11)
AT5G36903	pseudogene of protein related to self-incompatibility
AT5G01715	pseudogene of RNI-like superfamily protein;(source:Araport11)
AT4G15563	F-box-like protein;(source:Araport11)
AT1G28990	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT3G29340	zinc finger (C2H2 type) family protein;(source:Araport11)
AT3G52285	pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10)
AT2G13975	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10)
AT1G18382	Natural antisense transcript overlaps with AT1G18380;(source:Araport11)
AT2G13665	Natural antisense transcript overlaps with AT2G13660;(source:Araport11)
AT2G34060	Peroxidase superfamily protein;(source:Araport11)
AT1G65070	DNA mismatch repair protein MutS, type 2;(source:Araport11)
AT2G15670	transmembrane protein;(source:Araport11)
AT4G06538	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G27220	NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT2G36630	Sulfite exporter TauE/SafE family protein;(source:Araport11)
AT4G04410	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-176 P-value blast match to dbj\|BAA78426.1\| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT5G25040	Major facilitator superfamily protein;(source:Araport11)
AT5G54240	membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11)
AT4G33440	Pectin lyase-like superfamily protein;(source:Araport11)
AT5G61260	Plant calmodulin-binding protein-like protein;(source:Araport11)
AT1G68630	PLAC8 family protein;(source:Araport11)
AT3G47230	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10)
AT4G23580	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G71170	6-phosphogluconate dehydrogenase family protein;(source:Araport11)
AT3G03000	Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner
AT1G55880	Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11)
AT3G46680	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT2G32295	EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT3G04600	Nucleotidylyl transferase superfamily protein;(source:Araport11)
AT2G30820	aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit;(source:Araport11)
AT3G41761	other_RNA;(source:Araport11)
AT1G10585	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT4G04200	Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11)
AT1G74640	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G13228	RING/U-box superfamily protein;(source:Araport11)
AT5G25360	hypothetical protein;(source:Araport11)
AT5G35118	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.5e-10 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10)
AT3G46540	ENTH/VHS family protein;(source:Araport11)
AT5G25970	Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT3G24927	pseudogene of expressed protein;(source:Araport11)
AT5G54860	Major facilitator superfamily protein;(source:Araport11)
AT3G28950	AIG2-like (avirulence induced gene) family protein;(source:Araport11)
AT4G22020	Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT3G26720	Glycosyl hydrolase family 38 protein;(source:Araport11)
AT2G02060	Homeodomain-like superfamily protein;(source:Araport11)
AT5G50030	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G03852	pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10)
AT3G25090	F-box associated ubiquitination effector family protein;(source:Araport11)
AT4G30380	Encodes a Plant Natriuretic Peptide (PNP). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive.
AT3G03280	PADRE protein up-regulated after infection by S. sclerotiorum.
AT3G46840	Subtilase family protein;(source:Araport11)
AT2G25210	Ribosomal protein L39 family protein;(source:Araport11)
AT3G58770	hypothetical protein;(source:Araport11)
AT5G20860	Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT4G08450	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G10890	myosin heavy chain-like protein;(source:Araport11)
AT1G11440	hypothetical protein;(source:Araport11)
AT4G37553	Natural antisense transcript overlaps with AT4G37550 and AT4G37560;(source:Araport11)
AT4G22190	serine/arginine repetitive matrix-like protein;(source:Araport11)
AT1G24733	pseudogene of CCoAMT (caffeoyl-CoA 3-O-methyltransferase)
AT5G22315	pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10)
AT5G17110	Cystatin/monellin superfamily protein;(source:Araport11)
AT3G22183	hypothetical protein;(source:Araport11)
AT3G22850	aluminum induced protein with YGL and LRDR motifs;(source:Araport11)
AT1G72141	transmembrane protein;(source:Araport11)
AT5G57000	DEAD-box ATP-dependent RNA helicase;(source:Araport11)
AT2G15780	Cupredoxin superfamily protein;(source:Araport11)
AT3G50120	transmembrane protein, putative (DUF247);(source:Araport11)
AT1G11920	Pectin lyase-like superfamily protein;(source:Araport11)
AT4G02655	transmembrane protein;(source:Araport11)
AT3G27997	pseudogene of expressed protein;(source:Araport11)
AT2G20142	Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT4G08953	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-22 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT3G03510	Phototropic-responsive NPH3 family protein;(source:Araport11)
AT5G19250	Glycoprotein membrane precursor GPI-anchored;(source:Araport11)
AT3G62330	Zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT3G11860	sterile alpha motif (SAM) domain protein;(source:Araport11)
AT4G23515	Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT3G03700	Plasma-membrane choline transporter family protein;(source:Araport11)
AT1G53610	transmembrane protein;(source:Araport11)
AT5G27495	Encodes a defensin-like (DEFL) family protein.
AT1G27921	Natural antisense transcript overlaps with AT1G27920;(source:Araport11)
AT4G03113	transmembrane protein;(source:Araport11)
AT3G54750	downstream neighbor of Son;(source:Araport11)
AT5G27510	Protein kinase superfamily protein;(source:Araport11)
AT5G47250	LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11)
AT5G03705	pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10)
AT5G43180	transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11)
AT4G07800	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G13250.1);(source:TAIR10)
AT1G26620	T-box transcription factor, putative (DUF863);(source:Araport11)
AT4G02480	AAA-type ATPase family protein;(source:Araport11)
AT3G11300	hypothetical protein;(source:Araport11)
AT3G13820	F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G62920	proteasome maturation factor;(source:Araport11)
AT1G19810	pseudogene of cell division cycle 48C;(source:Araport11)
AT5G10110	DNA-directed RNA polymerase subunit beta;(source:Araport11)
AT3G58940	F-box/RNI-like superfamily protein;(source:Araport11)
AT3G50190	transmembrane protein, putative (DUF247);(source:Araport11)
AT1G04425	other_RNA;(source:Araport11)
AT1G13609	Encodes a defensin-like (DEFL) family protein.
AT5G34920	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.2e-40 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G24750	pseudogene of glutamate receptor 2.2;(source:Araport11)
AT1G77520	O-methyltransferase family protein;(source:Araport11)
AT2G46735	death domain associated protein;(source:Araport11)
AT3G11680	aluminum activated malate transporter family protein;(source:Araport11)
AT2G33690	Late embryogenesis abundant protein, group 6;(source:Araport11)
AT3G09385	pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G07480	Transcription factor IIA, alpha/beta subunit;(source:Araport11)
AT1G05894	hypothetical protein;(source:Araport11)
AT1G67480	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT3G42100	transposable_element_gene;(source:Araport11);similar to AT hook motif-containing protein-related [Arabidopsis thaliana] (TAIR:AT1G35940.1);(source:TAIR10)
AT5G27095	pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G63990	Inositol monophosphatase family protein;(source:Araport11)
AT2G39040	Peroxidase superfamily protein;(source:Araport11)
AT1G23710	hypothetical protein (DUF1645);(source:Araport11)
AT1G05950	hypothetical protein;(source:Araport11)
AT1G27750	nucleic acid binding protein;(source:Araport11)
AT4G31130	keratin-associated protein (DUF1218);(source:Araport11)
AT5G28823	hypothetical protein;(source:Araport11)
AT3G53190	Pectin lyase-like superfamily protein;(source:Araport11)
AT5G03100	F-box/RNI-like superfamily protein, expressed in the peroxisome.
AT3G22540	hypothetical protein (DUF1677);(source:Araport11)
AT1G24485	ER protein carbohydrate-binding protein;(source:Araport11)
AT5G46890	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT1G02270	Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11)
AT5G18180	H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11)
AT2G46150	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT1G54610	Protein kinase superfamily protein;(source:Araport11)
AT5G36090	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G28010.1);(source:TAIR10)
AT1G26610	C2H2-like zinc finger protein;(source:Araport11)
AT5G12043	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT3G11720	Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT2G19060	SGNH hydrolase-type esterase superfamily protein;(source:Araport11)
AT3G29970	B12D protein;(source:Araport11)
AT3G53775	pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10)
AT5G16900	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G45690	Encodes a member of the NAXT NPF subfamily.
AT3G42255	transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10)
AT3G33530	Transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT1G22200	Endoplasmic reticulum vesicle transporter protein;(source:Araport11)
AT1G26860	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10)
AT5G04970	Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT5G65560	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G47770	Beta-galactosidase related protein;(source:Araport11)
AT4G17790	SNARE associated Golgi protein family;(source:Araport11)
AT4G19380	Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11)
AT3G15940	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT4G16800	3-methylglutaconyl-CoA hydratase localized to mitochondria. Knockout displays accelerated senescence when subjected to extended dark conditions;knockout senescing leaves and knockout seeds accumulate leu, ile, and val.
AT1G07190	Lon protease;(source:Araport11)
AT3G61898	transmembrane protein;(source:Araport11)
AT1G80450	VQ motif-containing protein;(source:Araport11)
AT3G59230	RNI-like superfamily protein;(source:Araport11)
AT1G10050	Encodes a putative glycosyl hydrolase family 10 protein (xylanase).
AT1G69520	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G35334	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.3e-50 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT1G21520	hypothetical protein;(source:Araport11)
AT4G28990	RNA-binding protein-like protein;(source:Araport11)
AT4G26940	Galactosyltransferase family protein;(source:Araport11)
AT5G08690	Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile.
AT1G03030	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G22760	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G16060	ATP binding microtubule motor family protein;(source:Araport11)
AT5G28600	transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10)
AT3G44516	Pseudogene of AT1G31990; unknown protein
AT1G62050	Ankyrin repeat family protein;(source:Araport11)
AT3G53342	hypothetical protein;(source:Araport11)
AT1G53120	RNA-binding S4 domain-containing protein;(source:Araport11)
AT2G36650	CHUP1-like protein;(source:Araport11)
AT1G13230	Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis.
AT5G10695	methionyl-tRNA synthetase;(source:Araport11)
AT1G28620	pseudogene of GDSL-like Lipase/Acylhydrolase superfamily protein;(source:Araport11)
AT5G22050	Protein kinase superfamily protein;(source:Araport11)
AT1G58050	RNA helicase family protein;(source:Araport11)
AT2G18370	Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15.
AT5G27705	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-58 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi\|4996363\|dbj\|BAA78424.1\| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT4G06542	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT4G15120	VQ motif-containing protein;(source:Araport11)
AT1G32928	Avr9/Cf-9 rapidly elicited protein;(source:Araport11)
AT1G15810	S15/NS1, RNA-binding protein;(source:Araport11)
AT3G23300	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G66860	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11)
AT1G45244	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT3G30430	F-box family protein;(source:Araport11)
AT4G02370	pectinesterase (Protein of unknown function, DUF538);(source:Araport11)
AT1G54700	hypothetical protein;(source:Araport11)
AT2G24735	other_RNA;(source:Araport11)
AT3G25210	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G54870	inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11)
AT1G52800	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G57950	cotton fiber protein;(source:Araport11)
AT3G44718	Encodes a Plant thionin family protein
AT1G48400	F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT4G06617	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-37 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G14860	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G20970	calponin-like domain protein;(source:Araport11)
AT5G28235	Ulp1 protease family protein;(source:Araport11)
AT3G58890	RNI-like superfamily protein;(source:Araport11)
AT1G32250	Calcium-binding EF-hand family protein;(source:Araport11)
AT3G07510	maternal effect embryo arrest protein;(source:Araport11)
AT1G64870	hypothetical protein;(source:Araport11)
AT2G23700	Itga6 (Protein of unknown function, DUF547);(source:Araport11)
AT4G19220	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G54905	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-08 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G36350	pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10)
AT5G06220	LETM1-like protein;(source:Araport11)
AT1G55690	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT3G14260	LURP-one-like protein (DUF567);(source:Araport11)
AT5G52530	dentin sialophosphoprotein-like protein;(source:Araport11)
AT1G63580	Encodes a plasma membrane-localized protein with two DUF26 domains and a GPI anchor domain.
AT1G33130	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.3e-125 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G08610	NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit;(source:Araport11)
AT1G80570	RNI-like superfamily protein;(source:Araport11)
AT5G58784	Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11)
AT5G35570	O-fucosyltransferase family protein;(source:Araport11)
AT3G27150	Target gene of MIR2111-5p.
AT2G05260	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G52960	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G13250.1);(source:TAIR10)
AT5G03430	phosphoadenosine phosphosulfate (PAPS) reductase family protein;(source:Araport11)
AT5G10820	Major facilitator superfamily protein;(source:Araport11)
AT3G29033	glycine-rich protein;(source:Araport11)
AT3G50900	hypothetical protein;(source:Araport11)
AT1G28740	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT4G26470	Calcium-binding EF-hand family protein;(source:Araport11)
AT5G67460	O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT1G67050	membrane-associated kinase regulator;(source:Araport11)
AT5G63085	Encodes a Plant thionin family protein
AT1G17940	Endosomal targeting BRO1-like domain-containing protein;(source:Araport11)
AT2G25460	EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11)
AT1G67620	Lojap-related protein;(source:Araport11)
AT2G35850	transmembrane protein;(source:Araport11)
AT5G51795	DNA/RNA-binding protein Kin17, conserved region;(source:Araport11)
AT5G64380	Inositol monophosphatase family protein;(source:Araport11)
AT3G23600	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G02550	hypothetical protein;(source:Araport11)
AT4G04090	BTB/POZ domain-containing protein;(source:Araport11)
AT5G52390	PAR1 protein;(source:Araport11)
AT3G57470	Insulinase (Peptidase family M16) family protein;(source:Araport11)
AT3G56300	Cysteinyl-tRNA synthetase, class Ia family protein;(source:Araport11)
AT5G05598	Encodes a Defensin-like (DEFL) family protein
AT4G13620	encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. The mRNA is cell-to-cell mobile.
AT1G71290	F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G16175	Thioesterase superfamily protein;(source:Araport11)
AT1G40104	hypothetical protein;(source:Araport11)
AT1G05440	C-8 sterol isomerase;(source:Araport11)
AT5G28280	pseudogene of sterol desaturase domain-containing protein;(source:Araport11)
AT1G58320	PLAC8 family protein;(source:Araport11)
AT2G17340	pantothenate kinase;(source:Araport11)
AT2G20780	Major facilitator superfamily protein;(source:Araport11)
AT1G16225	Target SNARE coiled-coil domain protein;(source:Araport11)
AT3G53590	LRR receptor-like Serine/Threonine-kinase;(source:Araport11)
AT4G19500	nucleoside-triphosphatase/transmembrane receptor/nucleotide binding/ATP binding protein;(source:Araport11)
AT1G11540	Sulfite exporter TauE/SafE family protein;(source:Araport11)
AT5G33230	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G28960.1);(source:TAIR10)
AT2G06760	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.4e-38 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10)
AT4G23215	pseudogene of cysteine-rich receptor-like protein kinase family protein
AT3G43522	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative Ta11-like non-LTR retroelement protein;(source:TAIR10)
AT3G58530	RNI-like superfamily protein;(source:Araport11)
AT5G60680	transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11)
AT1G47570	RING/U-box superfamily protein;(source:Araport11)
AT2G39580	zinc finger C3H1 domain protein;(source:Araport11)
AT1G69190	encodes a bifunctional cytosolic hydroxymethyldihydropterin pyrophosphokinase/ dihydropteroate synthase (HPPK/DHPS)that is involved in tetrahydrofolate biosynthesis and is responsive to oxidative stress.
AT1G02360	Chitinase family protein;(source:Araport11)
AT2G01460	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G07650	Actin-binding FH2 protein;(source:Araport11)
AT3G30705	transmembrane protein;(source:Araport11)
AT3G06665	pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10)
AT3G62790	NADH-ubiquinone oxidoreductase-like protein;(source:Araport11)
AT1G58130	pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT4G11200	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30370.1);(source:TAIR10)
AT1G02550	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G50340	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT4G15755	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT3G19120	PIF / Ping-Pong family of plant transposase;(source:Araport11)
AT4G30060	Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT2G40920	F-box and associated interaction domains-containing protein;(source:Araport11)
AT4G21215	transmembrane protein;(source:Araport11)
AT2G20805	DNA-binding storekeeper protein transcriptional regulator-like protein;(source:Araport11)
AT5G10560	Glycosyl hydrolase family protein;(source:Araport11)
AT3G09280	transmembrane protein;(source:Araport11)
AT1G61360	S-locus lectin protein kinase family protein;(source:Araport11)
AT4G38790	ER lumen protein retaining receptor family protein;(source:Araport11)
AT1G73325	Kunitz family trypsin and protease inhibitor protein;(source:Araport11)
AT5G62660	F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G07190	B-cell receptor-associated protein 31-like protein;(source:Araport11)
AT1G76600	PADRE protein up-regulated after infection by S. sclerotiorun.
AT4G11440	Mitochondrial substrate carrier family protein;(source:Araport11)
AT2G42170	Actin family protein;(source:Araport11)
AT1G35660	erythroid differentiation factor-like protein;(source:Araport11)
AT2G12640	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.7e-25 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT2G22122	hypothetical protein;(source:Araport11)
AT5G28580	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.3e-33 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT5G50310	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G37975	Yos1-like protein;(source:Araport11)
AT4G01110	late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G19055	hypothetical protein;(source:Araport11)
AT3G49270	extensin-like protein;(source:Araport11)
AT5G37750	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT2G40200	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G29720	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-94 P-value blast match to gb\|AAL06421.1\|AF378079_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10)
AT3G27390	transmembrane protein;(source:Araport11)
AT1G16230	Target SNARE coiled-coil domain protein;(source:Araport11)
AT5G07910	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G30310	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.6e-19 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT2G16990	Major facilitator superfamily protein;(source:Araport11)
AT2G17525	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G01750	LURP-one-like protein (DUF567);(source:Araport11)
AT4G06549	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, temporary gene name assignment;(source:TAIR10)
AT3G43850	hypothetical protein;(source:Araport11)
AT4G27840	SNARE-like superfamily protein;(source:Araport11)
AT3G01960	hypothetical protein;(source:Araport11)
AT3G03855	Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 .
AT5G54400	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G08350	Mutants have decreased tolerance to cold and oxidative stress. Gene expression induced by drought and ABA.
AT1G80520	Sterile alpha motif (SAM) domain-containing protein;(source:Araport11)
AT4G32960	BRISC/BRCA1-A complex protein;(source:Araport11)
AT1G48268	pseudogene of F-box family protein
AT5G38440	Plant self-incompatibility protein S1 family;(source:Araport11)
AT2G11220	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-16 P-value blast match to gb\|AAO73521.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G38065	O-fucosyltransferase family protein;(source:Araport11)
AT1G09890	Rhamnogalacturonate lyase family protein;(source:Araport11)
AT3G45050	transmembrane protein;(source:Araport11)
AT5G49990	Xanthine/uracil permease family protein;(source:Araport11)
AT1G32700	PLATZ transcription factor family protein;(source:Araport11)
AT2G14090	pseudogene of F-box/RNI-like superfamily protein;(source:Araport11)
AT2G33930	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT5G37795	pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10)
AT2G39920	HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11)
AT1G69910	Protein kinase superfamily protein;(source:Araport11)
AT3G45530	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G04990	serine/arginine repetitive matrix-like protein (DUF761);(source:Araport11)
AT1G59850	ARM repeat superfamily protein;(source:Araport11)
AT1G12890	encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT1G34330	Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT1G57840	pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT3G20350	actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11)
AT2G03972	pseudogene of heat shock protein
AT5G42210	Major facilitator superfamily protein;(source:Araport11)
AT1G10340	Ankyrin repeat family protein;(source:Araport11)
AT5G61495	hypothetical protein;(source:Araport11)
AT2G44040	Dihydrodipicolinate reductase, bacterial/plant;(source:Araport11)
AT5G55660	DEK domain-containing chromatin associated protein;(source:Araport11)
AT1G63860	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G08310	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G04030	eisosome protein;(source:Araport11)
AT4G07700	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-13 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G15270	RNA-binding KH domain-containing protein;(source:Araport11)
AT2G47500	P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11)
AT1G60075	pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G46295	transmembrane protein;(source:Araport11)
AT3G46600	GRAS family transcription factor;(source:Araport11)
AT5G53030	hypothetical protein;(source:Araport11)
AT5G48680	Sterile alpha motif (SAM) domain-containing protein;(source:Araport11)
AT1G66920	Protein kinase superfamily protein;(source:Araport11)
AT5G41380	CCT motif family protein;(source:Araport11)
AT1G04778	hypothetical protein;(source:Araport11)
AT1G53350	Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11)
AT3G56750	plant/protein;(source:Araport11)
AT3G50665	pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10)
AT5G41890	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G39380	TSL-kinase interacting-like protein;(source:Araport11)
AT1G31175	cytochrome C oxidase biogenesis Cmc1-like protein;(source:Araport11)
AT4G32375	Pectin lyase-like superfamily protein;(source:Araport11)
AT2G33890	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT5G46871	Encodes a defensin-like (DEFL) family protein.
AT2G27900	coiled-coil protein;(source:Araport11)
AT5G48770	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G58410	HEAT/U-box domain-containing protein;(source:Araport11)
AT3G24190	Protein kinase superfamily protein;(source:Araport11)
AT1G65720	transmembrane protein;(source:Araport11)
AT4G19340	SCD6 protein-like protein;(source:Araport11)
AT1G14710	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G17250	Protein phosphatase 2C family protein;(source:Araport11)
AT5G57820	zinc ion binding protein;(source:Araport11)
AT2G40270	Protein kinase family protein;(source:Araport11)
AT1G55840	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT1G71730	hypothetical protein;(source:Araport11)
AT1G61550	S-locus lectin protein kinase family protein;(source:Araport11)
AT2G11320	transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 1.7e-199 P-value to GP\|14140296\|gb\|AAK54302.1\|AC034258_20\|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT3G18250	Putative membrane lipoprotein;(source:Araport11)
AT1G62550	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10)
AT4G36470	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G14960	Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT4G01380	plastocyanin-like domain-containing protein;(source:Araport11)
AT1G03820	E6-like protein;(source:Araport11)
AT3G15357	phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11)
AT5G51620	Uncharacterized protein family (UPF0172);(source:Araport11)
AT4G05018	transmembrane protein;(source:Araport11)
AT3G21320	EARLY FLOWERING protein;(source:Araport11)
AT5G44530	Subtilase family protein;(source:Araport11)
AT1G34097	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-158 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT4G08490	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.7e-81 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G28927	transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT5G42830	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G16950	krueppel-like factor;(source:Araport11)
AT3G44060	F-box/RNI-like superfamily protein;(source:Araport11)
AT2G32450	Calcium-binding tetratricopeptide family protein;(source:Araport11)
AT2G03932	Encodes a defensin-like (DEFL) family protein.
AT3G15310	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32621.1);(source:TAIR10)
AT1G12100	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT1G09600	Protein kinase superfamily protein;(source:Araport11)
AT1G36622	transmembrane protein;(source:Araport11)
AT5G43030	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G65150	TRAF-like family protein;(source:Araport11)
AT2G45710	Zinc-binding ribosomal protein family protein;(source:Araport11)
AT5G24352	Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11)
AT4G11540	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G15810	LURP-one-like protein (DUF567);(source:Araport11)
AT3G06570	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G36630	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.5e-213 P-value blast match to ref\|NP_189784.1\| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10)
AT3G62500	F-box protein RMF;(source:Araport11)
AT5G17270	Protein prenylyltransferase superfamily protein;(source:Araport11)
AT4G13160	zein-binding protein (Protein of unknown function, DUF593);(source:Araport11)
AT5G24610	cyclic AMP-responsive element-binding protein;(source:Araport11)
AT2G18570	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G58720	RING/U-box superfamily protein;(source:Araport11)
AT2G16410	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G15550.1);(source:TAIR10)
AT1G45832	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.3e-80 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G06700	transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj\|BAB64937.1\| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10)
AT3G49140	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G74680	Exostosin family protein;(source:Araport11)
AT3G10195	Encodes a defensin-like (DEFL) family protein.
AT3G46280	kinase-like protein;(source:Araport11)
AT5G61940	Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT2G30984	Natural antisense transcript overlaps with AT2G30985;(source:Araport11)
AT1G07473	hypothetical protein;(source:Araport11)
AT3G54980	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G04780	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G39980	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT2G05171	Pseudogene of AT3G18310
AT1G16640	AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT3G43570	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G39630	Encodes a putative dolichyl-phosphate β-glucosyltransferase.
AT2G02061	Nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT3G42645	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-127 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT2G42760	DUF1685 family protein;(source:Araport11)
AT5G49665	Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT2G36180	EF hand calcium-binding protein family;(source:Araport11)
AT2G33255	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G01700	Protein phosphatase 2C family protein;(source:Araport11)
AT3G27420	bromodomain testis-specific protein;(source:Araport11)
AT5G48900	Pectin lyase-like superfamily protein;(source:Araport11)
AT4G25400	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G25820	Exostosin family protein;(source:Araport11)
AT1G04230	rRNA-processing EFG1-like protein (DUF2361);(source:Araport11)
AT1G42350	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-102 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G10613	RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11)
AT1G59950	NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT2G25975	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-14 P-value blast match to GB:CAA26446 ORF2 (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10)
AT1G07280	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G08430	SWIB/MDM2 and Plus-3 and GYF domain-containing protein;(source:Araport11)
AT5G23760	Copper transport protein family;(source:Araport11)
AT3G02270	Trimeric LpxA-like enzyme;(source:Araport11)
AT1G28930	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT3G22410	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT4G11385	hypothetical protein;(source:Araport11)
AT2G24130	Leucine-rich receptor-like protein kinase family protein;(source:Araport11)
AT5G47225	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10)
AT5G02940	ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11)
AT1G78922	transmembrane protein;(source:Araport11)
AT5G10460	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT2G24395	chaperone protein dnaJ-like protein;(source:Araport11)
AT1G77640	encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
AT1G04720	pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10)
AT2G29920	hypothetical protein;(source:Araport11)
AT2G26240	Transmembrane proteins 14C;(source:Araport11)
AT5G41550	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT4G35240	DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11)
AT2G13125	hypothetical protein;(source:Araport11)
AT2G34670	benzoyl-CoA reductase subunit C, putative (DUF630 and DUF632);(source:Araport11)
AT1G23201	GCK domain protein;(source:Araport11)
AT3G11560	LETM1-like protein;(source:Araport11)
AT3G63052	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G23340	RNI-like superfamily protein;(source:Araport11)
AT1G72600	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT2G03250	EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT3G15090	GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11)
AT4G19520	disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G03330	Cysteine proteinases superfamily protein;(source:Araport11)
AT3G12915	Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11)
AT2G31860	pseudogene of poly(ADP-ribose) glycohydrolase 2;(source:Araport11)
AT4G06750	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.0e-60 P-value blast match to gb\|AAG52024.1\|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10)
AT2G14160	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G29660	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G02840	ARM repeat superfamily protein;(source:Araport11)
AT2G19960	hAT family dimerization domain-containing protein;(source:Araport11)
AT3G52030	F-box family protein with WD40/YVTN repeat doamin;(source:Araport11)
AT5G11140	phospholipase-like protein (PEARLI 4) family protein;(source:Araport11)
AT5G04120	Encodes a cofactor-dependent phosphoglycerate mutase (dPGM) - like protein with phosphoserine phosphatase activity that may be responsible for serine anabolism.
AT2G36695	hypothetical protein;(source:Araport11)
AT5G56975	pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10)
AT1G74990	RING/U-box superfamily protein;(source:Araport11)
AT5G51880	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G59080	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G19650	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT4G18180	Pectin lyase-like superfamily protein;(source:Araport11)
AT3G14517	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-38 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G35023	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 9.4e-88 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT3G04545	Encodes a defensin-like (DEFL) family protein.
AT3G09080	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT3G19400	Cysteine proteinases superfamily protein;(source:Araport11)
AT3G54190	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G19300	methyltransferase C9orf114 protein;(source:Araport11)
AT2G30220	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT5G49280	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G11550	ARM repeat superfamily protein;(source:Araport11)
AT1G18700	DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT3G05350	Metallopeptidase M24 family protein;(source:Araport11)
AT4G01897	dihydroorotate dehydrogenase;(source:Araport11)
AT4G01245	hypothetical protein;(source:Araport11)
AT1G28940	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT2G02210	transposable_element_gene;(source:Araport11);pseudogene, Ulp1 protease family, contains Pfam profile PF02902: Ulp1 protease family, C-terminal catalytic domain;(source:TAIR10)
AT5G62610	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT3G20820	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G75810	transmembrane protein;(source:Araport11)
AT4G32440	Plant Tudor-like RNA-binding protein;(source:Araport11)
AT4G34103	pseudogene of protein binding / zinc ion binding protein
AT1G02650	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G66855	Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT2G13146	Pseudogene of AT2G12905
AT3G12850	COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11)
AT2G26695	Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11)
AT5G04730	Ankyrin-repeat containing protein;(source:Araport11)
AT3G11320	Nucleotide-sugar transporter family protein;(source:Araport11)
AT2G29995	PSY3-like protein;(source:Araport11)
AT2G11950	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-158 P-value blast match to gb\|AAO73527.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT1G18290	PADRE protein up-regulated after infection by S. sclerotiorum.
AT5G40348	Natural antisense transcript overlaps with AT5G40350;(source:Araport11)
AT3G29640	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G29632.1);(source:TAIR10)
AT1G59550	This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release.
AT3G26770	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G46535	hypothetical protein;(source:Araport11)
AT2G28440	proline-rich family protein;(source:Araport11)
AT1G16360	LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein;(source:Araport11)
AT2G32520	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT4G29905	hypothetical protein;(source:Araport11)
AT3G06880	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT2G32291	Pseudogene of AT2G31470; F-box family protein
AT1G57700	Protein kinase superfamily protein;(source:Araport11)
AT2G16595	Translocon-associated protein (TRAP), alpha subunit;(source:Araport11)
AT4G23915	Encodes an alanine tRNA with the anticodon CGC that recognizes the alanine codon GCG.
AT2G03130	Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11)
AT3G19025	pseudogene of alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G08240	transmembrane protein;(source:Araport11)
AT1G63600	Receptor-like protein kinase-related family protein;(source:Araport11)
AT3G61820	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G39020	SH3 domain-containing protein;(source:Araport11)
AT5G06540	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G18460	carboxyl-terminal peptidase (DUF239);(source:Araport11)
AT5G48605	Encodes a defensin-like (DEFL) family protein.
AT5G42905	Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT3G44261	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT4G07825	transmembrane protein;(source:Araport11)
AT1G31390	TRAF-like family protein;(source:Araport11)
AT1G58090	F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G11320	GDSL esterase/lipase;(source:Araport11)
AT3G55780	Glycosyl hydrolase superfamily protein;(source:Araport11)
AT4G16235	pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10)
AT3G54530	hypothetical protein;(source:Araport11)
AT2G32235	hypothetical protein;(source:Araport11)
AT4G28940	Phosphorylase superfamily protein;(source:Araport11)
AT2G05030	transposable_element_gene;(source:Araport11);contains domain GAG/POL/ENV POLYPROTEIN (PTHR10178);(source:TAIR10)
AT3G52710	hypothetical protein;(source:Araport11)
AT1G36700	pseudogene of Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT4G06599	ubiquitin family protein;(source:Araport11)
AT1G66860	Class I glutamine amidotransferase-like superfamily protein;(source:Araport11)
AT3G17120	transmembrane protein;(source:Araport11)
AT3G17710	F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G44935	hypothetical protein;(source:Araport11)
AT3G12150	alpha/beta hydrolase family protein;(source:Araport11)
AT4G08860	transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G27870.1);(source:TAIR10)
AT3G18620	DHHC-type zinc finger family protein;(source:Araport11)
AT2G33360	cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11)
AT1G26690	emp24/gp25L/p24 family/GOLD family protein;(source:Araport11)
AT3G48570	secE/sec61-gamma protein transport protein;(source:Araport11)
AT5G59500	protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase;(source:Araport11)
AT2G13274	Pseudogene of AT2G13150; transcription factor
AT1G75670	DNA-directed RNA polymerase;(source:Araport11)
AT4G33130	rho GTPase-activating protein;(source:Araport11)
AT3G57350	Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11)
AT5G22620	encodes a putative 2-carboxy-D-arabinitol 1-phosphate phosphatase
AT1G16760	kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT2G03900	pseudogene of zinc transporter 7 precursor;(source:Araport11)
AT5G58280	AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT4G34420	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G59725	DNAJ heat shock family protein;(source:Araport11)
AT4G16650	O-fucosyltransferase family protein;(source:Araport11)
AT4G23610	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT2G02515	hypothetical protein;(source:Araport11)
AT4G33830	Glycosyl hydrolase family 10 protein;(source:Araport11)
AT1G23330	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G25870	hypothetical protein;(source:Araport11)
AT4G33467	hypothetical protein;(source:Araport11)
AT3G06180	Ribosomal protein L34e superfamily protein;(source:Araport11)
AT2G16380	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT3G46616	hypothetical protein;(source:Araport11)
AT1G80200	transmembrane protein;(source:Araport11)
AT4G28706	pfkB-like carbohydrate kinase family protein;(source:Araport11)
AT1G56630	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G66480	Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun.
AT3G27200	Cupredoxin superfamily protein;(source:Araport11)
AT4G39900	adenine deaminase;(source:Araport11)
AT2G09860	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.1e-47 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT5G35607	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.6e-07 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT1G54955	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05145.1);(source:TAIR10)
AT3G13020	hAT transposon superfamily protein;(source:Araport11)
AT2G06985	pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G43826	pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G12280	copper amine oxidase family protein;(source:Araport11)
AT4G28380	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT3G46470	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G50790	esterase/lipase/thioesterase family protein;(source:Araport11)
AT4G10980	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-44 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G12460	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G08540	ribosomal RNA small subunit methyltransferase J;(source:Araport11)
AT4G21865	hypothetical protein;(source:Araport11)
AT4G28070	AFG1-like ATPase family protein;(source:Araport11)
AT4G39610	MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT2G13940	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.4e-197 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT4G33985	membrane insertase, putative (DUF1685);(source:Araport11)
AT1G07170	Similar to human splicing factor 3b, 14 kda subunit, SF3b14b.
AT3G45080	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G33950	pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10)
AT2G18420	Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein
AT1G45248	Nucleolar histone methyltransferase-related protein;(source:Araport11)
AT3G03845	pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10)
AT2G20463	Encodes a defensin-like (DEFL) family protein.
AT3G09050	8-amino-7-oxononanoate synthase;(source:Araport11)
AT3G12030	transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11)
AT5G01090	Concanavalin A-like lectin family protein;(source:Araport11)
AT1G67820	Protein phosphatase 2C family protein;(source:Araport11)
AT1G50770	Aminotransferase-like, plant mobile domain family protein;(source:Araport11)
AT4G15960	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G43755	non-LTR retrolelement reverse transcriptase-like protein;(source:Araport11)
AT1G74300	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G57840	encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091)
AT5G08440	transmembrane protein;(source:Araport11)
AT1G17147	VQ motif-containing protein;(source:Araport11)
AT4G03816	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-22 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT4G12423	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT3G50210	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT5G40275	other_RNA;(source:Araport11)
AT1G36640	transmembrane protein;(source:Araport11)
AT1G30130	DUF1365 family protein;(source:Araport11)
AT4G08039	Encodes a defensin-like (DEFL) family protein.
AT2G24693	Encodes a defensin-like (DEFL) family protein.
AT5G26700	RmlC-like cupins superfamily protein;(source:Araport11)
AT4G10780	LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11)
AT5G11960	magnesium transporter, putative (DUF803);(source:Araport11)
AT4G11521	Receptor-like protein kinase-related family protein;(source:Araport11)
AT1G18270	ketose-bisphosphate aldolase class-II family protein;(source:Araport11)
AT5G02680	methionine-tRNA ligase;(source:Araport11)
AT1G30350	Pectin lyase-like superfamily protein;(source:Araport11)
AT1G61910	pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10)
AT1G35200	pseudogene of Ribosomal protein L4/L1 family;(source:Araport11)
AT5G44220	F-box family protein;(source:Araport11)
AT2G14590	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27606.1);(source:TAIR10)
AT3G49950	GRAS family transcription factor;(source:Araport11)
AT5G37480	maltase-glucoamylase, intestinal protein;(source:Araport11)
AT2G40955	hypothetical protein;(source:Araport11)
AT4G19570	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT5G10080	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G32105	Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G50220	B3 domain protein;(source:Araport11)
AT4G09060	hypothetical protein;(source:Araport11)
AT5G39995	pseudogene of myb domain protein 110;(source:Araport11)
AT4G27850	Glycine-rich protein family;(source:Araport11)
AT1G65900	plant/protein;(source:Araport11)
AT1G35115	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-168 P-value blast match to gb\|AAO73527.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT3G21650	Encodes protein phosphatase 2A (PP2A) B'zeta subunit. Targeted to mitochondria.
AT5G27280	Zim17-type zinc finger protein;(source:Araport11)
AT5G23510	hypothetical protein;(source:Araport11)
AT5G21105	Plant L-ascorbate oxidase;(source:Araport11)
AT1G71300	Vps52 / Sac2 family;(source:Araport11)
AT1G61480	S-locus lectin protein kinase family protein;(source:Araport11)
AT4G31960	hypothetical protein;(source:Araport11)
AT4G18501	hypothetical protein;(source:Araport11)
AT3G50200	hypothetical protein (DUF247);(source:Araport11)
AT2G16240	pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10)
AT5G51180	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G54240	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G35170	TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11)
AT4G01700	Chitinase family protein;(source:Araport11)
AT5G66950	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT2G41380	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT2G23520	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT4G19902	pseudogene of Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT3G58193	snoRNA;(source:Araport11)
AT5G56980	Pathogen-associated molecular pattern-induced gene.Responsive to jasmonic acid and wounding.
AT5G38610	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT4G04313	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-52 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT4G11945	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to transposases;(source:TAIR10)
AT3G07180	GPI transamidase component PIG-S-like protein;(source:Araport11)
AT2G44580	zinc ion binding protein;(source:Araport11)
AT2G40230	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G06570	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G25185	Encodes a defensin-like (DEFL) family protein.
AT3G01380	sulfatase and phosphatidylinositolglycan class N domain-containing protein;(source:Araport11)
AT1G68470	Exostosin family protein;(source:Araport11)
AT1G77200	encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
AT5G56890	Protein kinase superfamily protein;(source:Araport11)
AT4G16040	transmembrane protein;(source:Araport11)
AT2G29910	F-box/RNI-like superfamily protein;(source:Araport11)
AT1G04850	ubiquitin-associated (UBA)/TS-N domain-containing protein;(source:Araport11)
AT1G16040	phosphatidylinositol-glycan biosynthesis class F-like protein;(source:Araport11)
AT5G02240	Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile.
AT5G41590	LURP-one-like protein (DUF567);(source:Araport11)
AT3G22800	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G07330	NFU1 iron-sulfur cluster protein;(source:Araport11)
AT3G28940	AIG2-like (avirulence induced gene) family protein;(source:Araport11)
AT5G17680	disease resistance protein (TIR-NBS-LRR class);(source:Araport11)
AT2G12770	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-24 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT4G24750	Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11)
AT3G11500	Small nuclear ribonucleoprotein family protein;(source:Araport11)
AT2G46915	DUF3754 family protein, putative (DUF3754);(source:Araport11)
AT4G23090	transmembrane protein;(source:Araport11)
AT2G03821	hypothetical protein;(source:Araport11)
AT1G06137	transmembrane protein;(source:Araport11)
AT5G62140	ATP-dependent Clp protease ATP-binding subunit;(source:Araport11)
AT4G36945	PLC-like phosphodiesterases superfamily protein;(source:Araport11)
AT3G53490	valine-tRNA ligase;(source:Araport11)
AT1G42602	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G32425	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.5e-44 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT1G36980	transmembrane 50A-like protein;(source:Araport11)
AT1G56120	Leucine-rich repeat transmembrane protein kinase;(source:Araport11)
AT1G55770	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G35780	N-lysine methyltransferase;(source:Araport11)
AT2G30985	hypothetical protein;(source:Araport11)
AT2G33205	Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11)
AT1G73740	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT5G41740	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G27771	pseudogene of (SAUR) auxin-responsive family protein
AT4G27657	hypothetical protein;(source:Araport11)
AT2G14080	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G36297	pseudogene of aspartyl protease family protein
AT3G58910	F-box family protein;(source:Araport11)
AT5G38260	Protein kinase superfamily protein;(source:Araport11)
AT5G60978	Encodes a ECA1 gametogenesis related family protein [pseudogene]
AT3G27990	None;(source:Araport11)
AT4G05497	RNI-like superfamily protein;(source:Araport11)
AT1G61100	disease resistance protein (TIR class);(source:Araport11)
AT4G33160	F-box family protein;(source:Araport11)
AT5G66790	Protein kinase superfamily protein;(source:Araport11)
AT3G17150	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT4G03010	RNI-like superfamily protein;(source:Araport11)
AT2G14870	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G45211	Encodes a ECA1 gametogenesis related family protein [pseudogene]
AT2G47680	zinc finger (CCCH type) helicase family protein;(source:Araport11)
AT3G10780	emp24/gp25L/p24 family/GOLD family protein;(source:Araport11)
AT2G28810	Dof-type zinc finger DNA-binding family protein;(source:Araport11)
AT3G49370	Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11)
AT4G09490	Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT1G03730	pyrroline-5-carboxylate reductase;(source:Araport11)
AT1G19968	other_RNA;(source:Araport11)
AT2G20298	pseudogene of exonuclease family protein
AT3G32043	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G40590	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G43250	coiled-coil protein (DUF572);(source:Araport11)
AT2G29030	pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10)
AT2G35360	ubiquitin family protein;(source:Araport11)
AT5G14330	transmembrane protein;(source:Araport11)
AT3G07230	wound-responsive protein-like protein;(source:Araport11)
AT4G37250	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G61600	DUF1262 family protein (DUF1262);(source:Araport11)
AT5G59700	Protein kinase superfamily protein;(source:Araport11)
AT1G56540	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G75530	Forkhead-associated (FHA) domain-containing protein;(source:Araport11)
AT5G59490	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT3G06780	glycine-rich protein;(source:Araport11)
AT4G29750	CRS1 / YhbY (CRM) domain-containing protein;(source:Araport11)
AT2G42320	nucleolar protein gar2-like protein;(source:Araport11)
AT1G05920	B3 domain protein (DUF313);(source:Araport11)
AT5G23903	transmembrane protein;(source:Araport11)
AT5G50130	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G38396	F-box/RNI-like superfamily protein;(source:Araport11)
AT5G51730	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G55560	Protein kinase superfamily protein;(source:Araport11)
AT1G21528	hypothetical protein;(source:Araport11)
AT1G20990	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G17740	hypothetical protein;(source:Araport11)
AT4G11950	transmembrane protein, putative (DUF1191);(source:Araport11)
AT4G21700	DUF2921 family protein, putative (DUF2921);(source:Araport11)
AT1G26773	hypothetical protein;(source:Araport11)
AT5G22545	hypothetical protein;(source:Araport11)
AT5G28630	glycine-rich protein;(source:Araport11)
AT2G26380	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G55550	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G16210	HEAT repeat-containing protein;(source:Araport11)
AT4G36750	Quinone reductase family protein;(source:Araport11)
AT1G20816	outer envelope pore-like protein;(source:Araport11)
AT3G43450	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G20760.1);(source:TAIR10)
AT5G64090	hyccin;(source:Araport11)
AT3G17920	Outer arm dynein light chain 1 protein;(source:Araport11)
AT4G04190	transmembrane protein;(source:Araport11)
AT4G07630	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03078: ATHILA ORF-1 family;(source:TAIR10)
AT3G55470	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT1G80745	Transcription factor TFIIIC, tau55-related protein;(source:Araport11)
AT3G04750	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G48960	HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11)
AT5G15040	Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11)
AT1G76770	HSP20-like chaperone
AT4G12990	transmembrane protein;(source:Araport11)
AT1G69110	pseudogene of Ribosomal protein S10p/S20e family protein;(source:Araport11)
AT3G57160	cysteine-rich TM module stress tolerance protein;(source:Araport11)
AT3G25130	acidic leucine-rich nuclear phosphoprotein 32 family B protein;(source:Araport11)
AT1G67340	HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11)
AT4G17250	transmembrane protein;(source:Araport11)
AT5G66250	kinectin-like protein;(source:Araport11)
AT1G27620	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G52710	Rubredoxin-like superfamily protein;(source:Araport11)
AT5G48440	FAD-dependent oxidoreductase family protein;(source:Araport11)
AT1G09510	similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase
AT5G49430	WD40/YVTN repeat and Bromo-WDR9-I-like domain-containing protein;(source:Araport11)
AT1G21280	Copia-like polyprotein/retrotransposon;(source:Araport11)
AT2G02770	4-phosphopantetheinyl transferase domain protein;(source:Araport11)
AT5G42560	Abscisic acid-responsive (TB2/DP1, HVA22) family protein;(source:Araport11)
AT3G22250	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G26940	Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT1G30930	F-box family protein;(source:Araport11)
AT3G22430	RNA recognition motif XS domain protein;(source:Araport11)
AT1G08710	F-box protein that is induced in roots by drought stress.
AT2G03010	hypothetical protein (DUF577);(source:Araport11)
AT3G27350	transcriptional regulator ATRX-like protein;(source:Araport11)
AT3G62580	Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT5G31821	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT3G33130	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-256 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT3G60260	ELMO/CED-12 family protein;(source:Araport11)
AT5G19175	Encodes a defensin-like (DEFL) family protein.
AT5G38000	Zinc-binding dehydrogenase family protein;(source:Araport11)
AT4G37100	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT5G65490	suppressor-like protein;(source:Araport11)
AT1G67920	hypothetical protein;(source:Araport11)
AT3G25240	sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11)
AT5G21090	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G11830	Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G30540	Glycosyl hydrolase superfamily protein;(source:Araport11)
AT1G56415	Expressed protein;(source:Araport11)
AT4G25690	stress response NST1-like protein;(source:Araport11)
AT4G09770	TRAF-like family protein;(source:Araport11)
AT5G47710	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT5G07150	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G23390	NEP-interacting protein, putative (DUF239);(source:Araport11)
AT2G13760	no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11)
AT3G28770	transmembrane protein, putative (DUF1216);(source:Araport11)
AT3G03405	F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G25597	transmembrane protein;(source:Araport11)
AT4G22530	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G33205	pseudogene of hypothetical protein (Protein of unknown function;(source:Araport11)
AT3G47090	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G15840	pseudogene of hypothetical protein;(source:Araport11)
AT2G44430	DNA-binding bromodomain-containing protein;(source:Araport11)
AT1G23170	Involved in cell wall modifications resulting in resistance to the biotroph Hpa.
AT1G24148	hypothetical protein;(source:Araport11)
AT5G54780	Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT1G06260	Cysteine peptidase,activity detected in leaf and flower.
AT5G11090	serine-rich protein-like protein;(source:Araport11)
AT1G12990	beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G75710	C2H2-like zinc finger protein;(source:Araport11)
AT4G29780	Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes.
AT5G03880	Thioredoxin family protein;(source:Araport11)
AT4G28340	pyrroline-5-carboxylate reductase;(source:Araport11)
AT1G02070	zinc ion-binding protein;(source:Araport11)
AT2G41710	Integrase-type DNA-binding superfamily protein;(source:Araport11)
AT4G28830	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G67620	PADRE protein up-regulated after infection by S. sclerotiorum.
AT5G05350	PLAC8 family protein;(source:Araport11)
AT1G27330	Ribosome associated membrane protein RAMP4;(source:Araport11)
AT5G56747	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-45 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT3G61198	other_RNA;(source:Araport11)
AT1G67880	beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G56700	Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11)
AT1G51200	A20/AN1-like zinc finger family protein;(source:Araport11)
AT1G31130	polyadenylate-binding protein 1-B-binding protein;(source:Araport11)
AT3G50180	transmembrane protein, putative (DUF247);(source:Araport11)
AT1G22040	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G09780	TRAF-like family protein;(source:Araport11)
AT1G29600	Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT5G51105	ECA1 gametogenesis family protein (DUF1278);(source:Araport11)
AT5G63340	hypothetical protein;(source:Araport11)
AT1G44790	ChaC-like family protein;(source:Araport11)
AT1G03290	ELKS/Rab6-interacting/CAST family protein;(source:Araport11)
AT5G67430	Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT1G16800	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G36960	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G56660	MAEBL domain protein;(source:Araport11)
AT5G48540	receptor-like protein kinase-related family protein;(source:Araport11)
AT5G09760	Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT5G43440	encodes a protein whose sequence is similar to ACC oxidase
AT5G45310	coiled-coil protein;(source:Araport11)
AT3G17080	Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G33870	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G30650	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G10175.1);(source:TAIR10)
AT2G41342	hypothetical protein;(source:Araport11)
AT2G25355	PNAS-3-like protein;(source:Araport11)
AT3G19660	hypothetical protein;(source:Araport11)
AT1G12190	F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G25630	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT3G29771	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G59070	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G63230	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G01180	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G07310	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT3G62180	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G51450	Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT2G34240	ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11)
AT5G08780	winged-helix DNA-binding transcription factor family protein;(source:Araport11)
AT1G19390	Wall-associated kinase family protein;(source:Araport11)
AT3G26115	Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11)
AT5G35760	Beta-galactosidase related protein;(source:Araport11)
AT1G13000	transmembrane protein, putative (DUF707);(source:Araport11)
AT1G31163	F-box associated ubiquitination effector family protein;(source:Araport11)
AT5G11080	Ubiquitin-like superfamily protein;(source:Araport11)
AT3G54100	O-fucosyltransferase family protein;(source:Araport11)
AT3G29725	pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G21060	Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11)
AT1G02540	hypothetical protein;(source:Araport11)
AT3G60480	StAR lipid transfer-like protein;(source:Araport11)
AT3G52870	IQ calmodulin-binding motif family protein;(source:Araport11)
AT1G28830	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT3G29034	transmembrane protein;(source:Araport11)
AT1G22800	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G24175	kinesin-like protein;(source:Araport11)
AT3G56410	hypothetical protein (DUF3133);(source:Araport11)
AT5G38820	Encodes a putative amino acid transporter.
AT4G06676	etoposide-induced protein;(source:Araport11)
AT2G14878	other_RNA;(source:Araport11)
AT2G46550	transmembrane protein;(source:Araport11)
AT2G14690	Encodes a putative glycosyl hydrolase family 10 protein (xylanase).
AT1G53366	hypothetical protein;(source:Araport11)
AT3G29690	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT5G26740	organic solute transporter ostalpha protein (DUF300);(source:Araport11)
AT3G59180	Protein with RNI-like/FBD-like domain;(source:Araport11)
AT1G48070	Thioredoxin superfamily protein;(source:Araport11)
AT2G04115	Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G06660	transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11)
AT4G35720	DUF241 domain protein, putative (DUF241);(source:Araport11)
AT1G45010	TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11)
AT3G10250	histidine-tRNA ligase;(source:Araport11)
AT2G44780	Encodes a Uclacyanin/Basic blue family protein [pseudogene]
AT5G19970	GRAS family transcription factor family protein;(source:Araport11)
AT3G19200	hypothetical protein;(source:Araport11)
AT1G10417	Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens.
AT2G01990	XRI1-like protein;(source:Araport11)
AT1G64295	F-box associated ubiquitination effector family protein;(source:Araport11)
AT2G40990	DHHC-type zinc finger family protein;(source:Araport11)
AT4G35750	SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11)
AT5G50220	F-box family protein;(source:Araport11)
AT4G21903	MATE efflux family protein;(source:Araport11)
AT2G36815	mid region of cactin;(source:Araport11)
AT1G62370	RING/U-box superfamily protein;(source:Araport11)
AT3G54780	Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT5G05140	Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT1G36970	transmembrane protein, putative (DUF1985);(source:Araport11)
AT4G03824	transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.5e-62 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10)
AT1G74088	galacturonosyltransferase;(source:Araport11)
AT4G16190	Papain family cysteine protease;(source:Araport11)
AT3G33030	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-50 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT4G27660	hypothetical protein;(source:Araport11)
AT2G23330	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT3G59320	solute carrier family 35 protein (DUF914);(source:Araport11)
AT4G34065	Pseudogene of AT5G06265; hyaluronan mediated motility receptor-related
AT5G14210	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G59680	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G37670	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G01925	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G35600	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.1e-41 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G01570	plectin-like protein;(source:Araport11)
AT2G05330	BTB/POZ domain-containing protein;(source:Araport11)
AT1G27100	Actin cross-linking protein;(source:Araport11)
AT1G68140	zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11)
AT1G09195	Ppx-GppA phosphatase;(source:Araport11)
AT5G35207	transposable_element_gene;(source:Araport11);pseudogene, similar to simiar to ribosomal protein, blastp match of 45%25 identity and 6.7e-47 P-value to GP\|19571128\|dbj\|BAB86552.1\|\|AP003566 simiar to ribosomal protein {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT5G44290	Protein kinase superfamily protein;(source:Araport11)
AT2G20740	Tetraspanin family protein;(source:Araport11)
AT3G50130	transmembrane protein, putative (DUF247);(source:Araport11)
AT1G76994	hypothetical protein;(source:Araport11)
AT1G58055	Encodes a defensin-like (DEFL) family protein.
AT5G27220	Frigida-like protein;(source:Araport11)
AT2G10950	BSD domain-containing protein;(source:Araport11)
AT1G50130	pseudogene of ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11)
AT3G01850	Aldolase-type TIM barrel family protein;(source:Araport11)
AT2G04925	Encodes a defensin-like (DEFL) family protein.
AT3G10290	Nucleotide-sugar transporter family protein;(source:Araport11)
AT5G47740	Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11)
AT5G56690	FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11)
AT2G28310	trimethylguanosine synthase (DUF707);(source:Araport11)
AT1G60970	SNARE-like superfamily protein;(source:Araport11)
AT2G42955	F-box/LRR protein;(source:Araport11)
AT5G28253	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-60 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT1G36660	pseudogene of FAR1-related sequence 5;(source:Araport11)
AT5G44730	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G45760	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT4G08230	glycine-rich protein;(source:Araport11)
AT1G73630	EF hand calcium-binding protein family;(source:Araport11)
AT5G02670	hypothetical protein;(source:Araport11)
AT3G16750	hypothetical protein;(source:Araport11)
AT1G28400	GATA zinc finger protein;(source:Araport11)
AT1G14600	Homeodomain-like superfamily protein;(source:Araport11)
AT3G48745	pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10)
AT5G49560	Putative methyltransferase family protein;(source:Araport11)
AT4G10140	transmembrane protein;(source:Araport11)
AT2G19150	Pectin lyase-like superfamily protein;(source:Araport11)
AT5G54067	B3 domain protein;(source:Araport11)
AT2G40113	Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT4G21902	hypothetical protein;(source:Araport11)
AT3G52580	Ribosomal protein S11 family protein;(source:Araport11)
AT2G10300	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT2G19010	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT2G30840	encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase
AT2G28750	transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 27%25 identity and 1.8e-07 P-value to GP\|14018103\|gb\|AAK52166.1\|AC084831_20\|AC084831 putative reverse transcriptase {Oryza sativa};(source:TAIR10)
AT2G28080	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT5G17500	Glycosyl hydrolase superfamily protein;(source:Araport11)
AT5G10970	C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT3G54925	Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G20852	pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10)
AT3G16565	threonyl and alanyl tRNA synthetase second additional domain-containing protein;(source:Araport11)
AT4G25620	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G73850	DNA ligase (DUF1666);(source:Araport11)
AT1G63530	hypothetical protein;(source:Araport11)
AT2G44260	DUF946 family protein (DUF946);(source:Araport11)
AT2G41810	imidazolonepropionase (Protein of unknown function, DUF642);(source:Araport11)
AT1G61500	S-locus lectin protein kinase family protein;(source:Araport11)
AT1G08340	Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11)
AT5G47730	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT1G61440	S-locus lectin protein kinase family protein;(source:Araport11)
AT1G47813	hypothetical protein;(source:Araport11)
AT3G59570	Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT1G70450	Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells.
AT2G40205	Ribosomal protein L41 family;(source:Araport11)
AT5G49580	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT3G32925	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT3G15700	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G06330	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT5G61345	pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10)
AT2G31800	Integrin-linked protein kinase family;(source:Araport11)
AT3G52105	DIS3-exonuclease-like protein;(source:Araport11)
AT5G66820	transmembrane protein;(source:Araport11)
AT5G51470	Auxin-responsive GH3 family protein;(source:Araport11)
AT3G25080	hypothetical protein;(source:Araport11)
AT1G08440	aluminum activated malate transporter family protein;(source:Araport11)
AT3G42160	Pectin lyase-like superfamily protein;(source:Araport11)
AT1G11110	LisH and RanBPM domains containing protein;(source:Araport11)
AT1G04555	transmembrane protein;(source:Araport11)
AT1G13310	Endosomal targeting BRO1-like domain-containing protein;(source:Araport11)
AT1G18210	Calcium-binding EF-hand family protein;(source:Araport11)
AT4G10860	hypothetical protein;(source:Araport11)
AT2G47200	hypothetical protein;(source:Araport11)
AT2G22160	Cysteine proteinases superfamily protein;(source:Araport11)
AT4G17850	hypothetical protein;(source:Araport11)
AT1G61770	J domain protein. The mRNA is cell-to-cell mobile.
AT5G32702	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-150 P-value blast match to dbj\|BAA78425.1\| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10)
AT2G31902	Natural antisense transcript overlaps with AT2G31900;(source:Araport11)
AT1G66450	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G37980	Zinc-binding dehydrogenase family protein;(source:Araport11)
AT2G37880	MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11)
AT3G30281	Pseudogene of AT1G19260; hAT dimerisation domain-containing protein
AT3G13882	Ribosomal protein L34;(source:Araport11)
AT1G13605	Encodes a defensin-like (DEFL) family protein.
AT3G58310	cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11)
AT4G29270	HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11)
AT2G07480	transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.4e-101 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10)
AT5G45170	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G18310	ubiquitin hydrolase;(source:Araport11)
AT5G25070	neurofilament light protein;(source:Araport11)
AT5G54062	egg cell-secreted-like protein;(source:Araport11)
AT5G05090	Homeodomain-like superfamily protein;(source:Araport11)
AT3G48830	tRNA nucleotidyltransferase/polyA polymerase family protein;(source:Araport11)
AT2G46375	hypothetical protein;(source:Araport11)
AT3G02590	Fatty acid hydroxylase superfamily protein;(source:Araport11)
AT2G27660	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G19160	transglutaminase family protein;(source:Araport11)
AT5G47050	SBP (S-ribonuclease binding protein) family protein;(source:Araport11)
AT3G22920	Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT1G66235	no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11)
AT1G66210	Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT3G27327	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-320 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G23510	OBP32pep protein;(source:Araport11)
AT2G43375	other_RNA;(source:Araport11)
AT4G31441	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT1G53635	hypothetical protein;(source:Araport11)
AT2G05910	LURP-one-like protein (DUF567);(source:Araport11)
AT3G06680	Ribosomal L29e protein family;(source:Araport11)
AT1G59770	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.2e-49 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G62330	hypothetical protein;(source:Araport11)
AT1G33590	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G51160	Ankyrin repeat family protein;(source:Araport11)
AT5G58595	snoRNA;(source:Araport11)
AT4G01740	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G52780	PII, uridylyltransferase (DUF2921);(source:Araport11)
AT5G49540	Rab5-interacting family protein;(source:Araport11)
AT5G50330	Protein kinase superfamily protein;(source:Araport11)
AT4G35710	DUF241 domain protein, putative (DUF241);(source:Araport11)
AT5G37250	RING/U-box superfamily protein;(source:Araport11)
AT2G31740	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G35070	SBP (S-ribonuclease binding protein) family protein;(source:Araport11)
AT5G51670	hypothetical protein (DUF668);(source:Araport11)
AT3G53270	Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11)
AT5G03020	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G46940	fold protein;(source:Araport11)
AT1G63220	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT5G41860	transmembrane protein;(source:Araport11)
AT1G32780	GroES-like zinc-binding dehydrogenase family protein;(source:Araport11)
AT2G42770	Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11)
AT5G25280	serine-rich protein-like protein;(source:Araport11)
AT1G63205	Cystatin/monellin superfamily protein;(source:Araport11)
AT5G37017	Pseudogene of AT5G16486
AT3G53080	D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11)
AT1G67130	F-box family protein;(source:Araport11)
AT2G44200	pre-mRNA splicing factor domain-containing protein;(source:Araport11)
AT4G38550	phospholipase-like protein (PEARLI 4) family protein;(source:Araport11)
AT2G31432	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT3G62650	hypothetical protein;(source:Araport11)
AT1G67570	zinc finger CONSTANS-like protein (DUF3537);(source:Araport11)
AT2G43141	snoRNA;(source:Araport11)
AT5G49680	Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots.
AT2G13280	transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 27%25 identity and 7.6e-27 P-value to GP\|20279456\|gb\|AAM18736.1\|AC092548_14\|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT1G23590	OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11)
AT2G37435	Cystatin/monellin superfamily protein;(source:Araport11)
AT4G31660	AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT2G31820	Ankyrin repeat family protein;(source:Araport11)
AT1G11620	F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G38255	hypothetical protein (DUF239);(source:Araport11)
AT3G03670	Peroxidase superfamily protein;(source:Araport11)
AT4G28900	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT4G32970	BRISC/BRCA1-A complex protein;(source:Araport11)
AT3G44150	Expp1 protein;(source:Araport11)
AT1G50690	Cystatin/monellin superfamily protein;(source:Araport11)
AT2G04680	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G23080	transmembrane protein, putative (DUF239);(source:Araport11)
AT3G20460	Major facilitator superfamily protein;(source:Araport11)
AT4G18255	pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10)
AT5G41660	transmembrane protein;(source:Araport11)
AT5G58210	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G02090	hypothetical protein;(source:Araport11)
AT5G41810	Avr9/Cf-9 rapidly elicited protein;(source:Araport11)
AT2G24620	S-locus glycoprotein family protein;(source:Araport11)
AT5G23460	hypothetical protein;(source:Araport11)
AT4G28088	Low temperature and salt responsive protein family;(source:Araport11)
AT5G51510	jagunal-like protein;(source:Araport11)
AT2G18690	transmembrane protein;(source:Araport11)
AT5G28288	Encodes a defensin-like (DEFL) family protein.
AT3G45030	Ribosomal protein S10p/S20e family protein;(source:Araport11)
AT5G02615	pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10)
AT2G04042	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-26 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G49120	DUF581 family protein, putative (DUF581);(source:Araport11)
AT3G10180	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT3G13990	dentin sialophosphoprotein, putative (DUF1296);(source:Araport11)
AT5G37450	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G08350	Endomembrane protein 70 protein family;(source:Araport11)
AT5G18550	Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT5G13810	Glutaredoxin family protein;(source:Araport11)
AT5G37130	Protein prenylyltransferase superfamily protein;(source:Araport11)
AT3G20300	extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11)
AT2G41835	zinc finger (C2H2 type, AN1-like) family protein;(source:Araport11)
AT5G13560	structural maintenance of chromosomes protein;(source:Araport11)
AT3G55735	pre-tRNA tRNA-Met;(source:Araport11, TAIR10)
AT4G29950	Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT1G74780	Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11)
AT3G55677	Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G22403	other_RNA;(source:Araport11)
AT4G14610	Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT4G02317	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-25 P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi\|2443320\|dbj\|BAA22288.1\| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10)
AT1G06540	hypothetical protein;(source:Araport11)
AT1G61105	Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT4G40011	hypothetical protein;(source:Araport11)
AT2G09992	pseudogene of disease-resistance protein
AT4G22440	hypothetical protein;(source:Araport11)
AT3G07195	RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11)
AT2G31990	Exostosin family protein;(source:Araport11)
AT3G15130	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G50350	membrane insertase, putative (DUF1685);(source:Araport11)
AT5G10660	calmodulin-binding protein-like protein;(source:Araport11)
AT1G54445	Encodes a defensin-like (DEFL) family protein.
AT4G18660	delay of germination protein;(source:Araport11)
AT2G46380	extra-large G-like protein, putative (DUF3133);(source:Araport11)
AT3G52535	Natural antisense transcript overlaps with AT3G52540;(source:Araport11)
AT2G14570	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10)
AT1G35430	transmembrane protein;(source:Araport11)
AT3G20150	Kinesin motor family protein;(source:Araport11)
AT2G44370	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G62990	myelin transcription factor-like protein;(source:Araport11)
AT1G47705	pseudogene of F-box/RNI/FBD-like domain protein;(source:Araport11)
AT3G30740	pseudogene of Ribosomal protein S25 family protein;(source:Araport11)
AT2G21520	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT1G09160	Protein phosphatase 2C family protein;(source:Araport11)
AT1G47655	Dof-type zinc finger DNA-binding family protein;(source:Araport11)
AT2G01580	transmembrane protein;(source:Araport11)
AT5G44910	Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT3G12390	Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11)
AT5G38393	pseudogene of F-box/RNI-like superfamily protein;(source:Araport11)
AT3G04840	Ribosomal protein S3Ae;(source:Araport11)
AT5G53990	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT1G35340	ATP-dependent protease La (LON) domain protein;(source:Araport11)
AT1G74790	catalytics;(source:Araport11)
AT4G21213	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G42440	Protein kinase superfamily protein;(source:Araport11)
AT5G52410	oxidoreductase/transition metal ion-binding protein;(source:Araport11)
AT2G04046	Encodes a defensin-like (DEFL) family protein.
AT3G28400	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.6e-39 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10)
AT5G60150	hypothetical protein;(source:Araport11)
AT3G60850	hypothetical protein;(source:Araport11)
AT5G28570	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G12725.1);(source:TAIR10)
AT3G44400	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT4G12180	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-28 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT2G46620	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G52120	Mannose-binding lectin superfamily protein;(source:Araport11)
AT3G25590	micronuclear linker histone polyprotein-like protein;(source:Araport11)
AT1G68330	membrane-associated kinase regulator;(source:Araport11)
AT3G19850	Phototropic-responsive NPH3 family protein;(source:Araport11)
AT5G55530	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT1G70581	other_RNA;(source:Araport11)
AT2G47540	Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT1G74290	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G58590	other_RNA;(source:Araport11)
AT1G12070	Immunoglobulin E-set superfamily protein;(source:Araport11)
AT4G03380	hypothetical protein;(source:Araport11)
AT4G17150	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G22060	contains Pfam profile: PF01657 Domain of unknown function that is usually associated with protein kinase domain Pfam:PF00069, however this protein does not have the protein kinase domain
AT5G34864	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.3e-143 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT5G23850	O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11)
AT4G28780	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G59710	actin cross-linking protein (DUF569);(source:Araport11)
AT5G46720	AIG2-like (avirulence induced gene) family protein;(source:Araport11)
AT5G48657	defense protein-like protein;(source:Araport11)
AT1G73490	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G26440	transmembrane protein, putative (DUF707);(source:Araport11)
AT3G21080	ABC transporter-like protein;(source:Araport11)
AT3G28695	pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT1G73655	FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT1G25460	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G44720	Molybdenum cofactor sulfurase family protein;(source:Araport11)
AT3G04854	hypothetical protein;(source:Araport11)
AT4G36640	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT3G62499	YTH family protein;(source:Araport11)
AT1G61475	ATP binding / protein kinase;(source:Araport11)
AT3G07320	O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT1G33610	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT1G43980	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G28703	RmlC-like cupins superfamily protein;(source:Araport11)
AT3G50540	hypothetical protein;(source:Araport11)
AT3G13590	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G58280	MATH domain/coiled-coil protein;(source:Araport11)
AT5G37470	hypothetical protein (DUF577);(source:Araport11)
AT3G04330	Kunitz family trypsin and protease inhibitor protein;(source:Araport11)
AT4G33140	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT1G21010	PADRE proteinup-regulated after infection by S. sclerotiorun.
AT2G23300	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G28894	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10)
AT1G78410	VQ motif-containing protein;(source:Araport11)
AT5G14140	nucleic acid binding / zinc ion binding protein;(source:Araport11)
AT4G35670	Pectin lyase-like superfamily protein;(source:Araport11)
AT5G50460	secE/sec61-gamma protein transport protein;(source:Araport11)
AT4G27654	transmembrane protein;(source:Araport11)
AT3G63020	hypothetical protein (DUF3049);(source:Araport11)
AT3G29120	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.8e-98 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT2G33855	transmembrane protein;(source:Araport11)
AT5G45220	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G60760	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT5G28295	hypothetical protein;(source:Araport11)
AT2G40995	Encodes a defensin-like (DEFL) family protein.
AT3G04980	DNAJ heat shock N-terminal domain-containing protein;(source:Araport11)
AT5G10605	methyltransferase;(source:Araport11)
AT4G01515	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-18 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT3G58210	TRAF-like family protein;(source:Araport11)
AT3G45095	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-140 P-value blast match to dbj\|BAA78426.1\| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT2G44380	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G47550	Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT2G39540	Gibberellin-regulated family protein;(source:Araport11)
AT2G30890	Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11)
AT4G26040	hypothetical protein;(source:Araport11)
AT1G53633	hypothetical protein;(source:Araport11)
AT4G17215	Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT5G65470	O-fucosyltransferase family protein;(source:Araport11)
AT5G22390	FANTASTIC four-like protein (DUF3049);(source:Araport11)
AT5G30380	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10)
AT1G25530	Transmembrane amino acid transporter family protein;(source:Araport11)
AT5G62970	Protein with RNI-like/FBD-like domain;(source:Araport11)
AT5G40510	Sucrase/ferredoxin-like family protein;(source:Araport11)
AT5G37040	F-box family protein;(source:Araport11)
AT4G18900	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G07140	Protein kinase superfamily protein;(source:Araport11)
AT5G22860	Serine carboxypeptidase S28 family protein;(source:Araport11)
AT1G28790	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT5G35370	S-locus lectin protein kinase family protein;(source:Araport11)
AT5G35380	kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT3G25990	Homeodomain-like superfamily protein;(source:Araport11)
AT4G00005	PRA1 (Prenylated rab acceptor) family protein;(source:Araport11)
AT5G52030	TraB family protein;(source:Araport11)
AT3G48140	B12D protein;(source:Araport11)
AT4G03695	pseudogene of hypothetical protein;(source:Araport11)
AT4G32630	ArfGap/RecO-like zinc finger domain-containing protein;(source:Araport11)
AT4G16146	cAMP-regulated phosphoprotein 19-related protein;(source:Araport11)
AT1G12380	hypothetical protein;(source:Araport11)
AT2G26050	hypothetical protein (DUF1644);(source:Araport11)
AT3G25400	dCTP pyrophosphatase-like protein;(source:Araport11)
AT3G04360	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT5G54760	Translation initiation factor SUI1 family protein;(source:Araport11)
AT3G05950	RmlC-like cupins superfamily protein;(source:Araport11)
AT5G24690	plant/protein, putative (DUF3411);(source:Araport11)
AT3G17400	F-box family protein;(source:Araport11)
AT4G23510	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT5G12040	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein;(source:Araport11)
AT3G51330	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT5G01210	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT4G06571	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT1G46552	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-184 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT4G31310	AIG2-like (avirulence induced gene) family protein;(source:Araport11)
AT5G17960	Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments.
AT2G28605	Encodes a PsbP domain-OEC23 like protein localized in thylakoid (peripheral-lumenal side).
AT4G08640	ATP binding protein;(source:Araport11)
AT5G39785	hypothetical protein (DUF1666);(source:Araport11)
AT3G22030	Receptor protein kinase-like protein;(source:Araport11)
AT4G10170	SNARE-like superfamily protein;(source:Araport11)
AT2G20350	encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
AT4G08780	Peroxidase superfamily protein;(source:Araport11)
AT2G32870	TRAF-like family protein;(source:Araport11)
AT3G46730	NB-ARC domain-containing disease resistance protein;(source:Araport11)
AT5G07820	Plant calmodulin-binding protein-like protein;(source:Araport11)
AT5G25860	F-box/RNI-like superfamily protein;(source:Araport11)
AT1G53660	Nucleotide/sugar transporter family protein
AT5G59210	myosin heavy chain-like protein;(source:Araport11)
AT5G51490	Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT4G00580	COP1-interacting protein-like protein;(source:Araport11)
AT2G41550	Rho termination factor;(source:Araport11)
AT3G51340	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G07795	transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10)
AT5G42330	hypothetical protein;(source:Araport11)
AT5G01660	influenza virus NS1A-binding protein;(source:Araport11)
AT4G11930	hypothetical protein;(source:Araport11)
AT3G55590	Glucose-1-phosphate adenylyltransferase family protein;(source:Araport11)
AT4G03480	Ankyrin repeat family protein;(source:Araport11)
AT4G30390	UDP-arabinopyranose mutase;(source:Araport11)
AT4G09300	LisH and RanBPM domains containing protein;(source:Araport11)
AT2G45610	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G69450	Early-responsive to dehydration stress protein (ERD4);(source:Araport11)
AT1G16930	F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G58412	Encodes a Plant thionin family protein
AT4G14190	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G23440	Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11)
AT2G10990	pseudogene of reverse transcriptase-like protein;(source:Araport11)
AT3G21351	transmembrane protein;(source:Araport11)
AT1G35710	kinase family with leucine-rich repeat domain-containing protein;(source:Araport11)
AT5G51800	Protein kinase superfamily protein;(source:Araport11)
AT1G05650	Pectin lyase-like superfamily protein;(source:Araport11)
AT2G05786	hypothetical protein;(source:Araport11)
AT2G31345	transmembrane protein;(source:Araport11)
AT2G22820	hypothetical protein;(source:Araport11)
AT1G64680	beta-carotene isomerase D27;(source:Araport11)
AT1G28640	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT3G53820	C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11)
AT3G61700	helicase with zinc finger protein;(source:Araport11)
AT3G23175	HR-like lesion-inducing protein-like protein;(source:Araport11)
AT5G59990	CCT motif family protein;(source:Araport11)
AT1G44191	Encodes a ECA1 gametogenesis related family protein
AT2G05133	Pseudogene of AT2G37680
AT2G02550	PIN domain-like family protein;(source:Araport11)
AT1G54450	Calcium-binding EF-hand family protein;(source:Araport11)
AT5G42290	transcription activator-like protein;(source:Araport11)
AT1G51823	hypothetical protein;(source:Araport11)
AT4G01040	Glycosyl hydrolase superfamily protein;(source:Araport11)
AT5G37270	RING/U-box superfamily protein;(source:Araport11)
AT5G39430	DUF1336 family protein, putative (DUF1336);(source:Araport11)
AT3G44710	transmembrane protein, putative (DUF247);(source:Araport11)
AT4G00895	ATPase, F1 complex, OSCP/delta subunit protein;(source:Araport11)
AT1G36070	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT2G40250	SGNH hydrolase-type esterase superfamily protein;(source:Araport11)
AT3G55710	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT5G63930	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G24450	Transcription factor IIIC, subunit 5;(source:Araport11)
AT5G17830	Plasma-membrane choline transporter family protein;(source:Araport11)
AT4G37483	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT1G03610	plant/protein (DUF789);(source:Araport11)
AT5G35740	Carbohydrate-binding X8 domain superfamily protein;(source:Araport11)
AT5G12340	PADRE protein up-regulated after infection by S. sclerotiorum.
AT5G15390	tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11)
AT3G46860	Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860.
AT2G20280	Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT4G36700	RmlC-like cupins superfamily protein;(source:Araport11)
AT4G23364	Pseudogene of AT4G23340; oxidoreductase, 2OG-Fe(II) oxygenase family protein
AT5G47860	Gut esterase (DUF1350);(source:Araport11)
AT2G44820	axoneme-associated protein MST101(2) protein;(source:Araport11)
AT1G11145	hypothetical protein (DUF674);(source:Araport11)
AT3G48660	transmembrane protein, putative (DUF 3339);(source:Araport11)
AT4G36660	polyol transporter, putative (DUF1195);(source:Araport11)
AT1G05120	Helicase protein with RING/U-box domain-containing protein;(source:Araport11)
AT3G27510	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G68680	SH3/FCH domain protein;(source:Araport11)
AT1G71910	hypothetical protein;(source:Araport11)
AT3G26130	Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11)
AT4G27852	Natural antisense transcript overlaps with AT4G27850 and AT4G27860;(source:Araport11)
AT2G13690	PRLI-interacting factor;(source:Araport11)
AT1G18900	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G15790	RING/U-box superfamily protein;(source:Araport11)
AT5G46260	disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT2G43720	FAM136A-like protein (DUF842);(source:Araport11)
AT5G47150	YDG/SRA domain-containing protein;(source:Araport11)
AT5G16700	Glycosyl hydrolase superfamily protein;(source:Araport11)
AT5G36980	U3 small nucleolar RNA-associated protein;(source:Araport11)
AT2G14520	CBS domain protein (DUF21);(source:Araport11)
AT2G23200	Protein kinase superfamily protein;(source:Araport11)
AT2G07600	pseudogene of NADH-Ubiquinone oxidoreductase (complex I);(source:Araport11)
AT1G24240	Ribosomal protein L19 family protein;(source:Araport11)
AT1G52910	fiber (DUF1218);(source:Araport11)
AT1G28970	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT5G20045	transmembrane protein;(source:Araport11)
AT3G14880	transcription factor-like protein;(source:Araport11)
AT1G79740	hAT transposon superfamily;(source:Araport11)
AT2G25482	Encodes a ECA1 gametogenesis related family protein
AT2G33390	hypothetical protein;(source:Araport11)
AT3G20260	DUF1666 family protein (DUF1666);(source:Araport11)
AT5G38275	pseudogene of PR5-like receptor kinase;(source:Araport11)
AT1G27470	transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT2G37195	acyl-CoA-binding domain protein;(source:Araport11)
AT1G49100	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G34550	F-box protein;(source:Araport11)
AT5G43000	hypothetical protein;(source:Araport11)
AT4G18940	RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11)
AT3G57820	pseudogene of Translation protein SH3-like family protein;(source:Araport11)
AT3G06950	Pseudouridine synthase family protein;(source:Araport11)
AT5G28830	calcium-binding EF hand family protein;(source:Araport11)
AT5G18500	Protein kinase superfamily protein;(source:Araport11)
AT5G66340	hypothetical protein;(source:Araport11)
AT1G63830	PLAC8 family protein;(source:Araport11)
AT5G25451	Pseudogene of AT5G25440; protein kinase family protein
AT5G62890	Xanthine/uracil permease family protein;(source:Araport11)
AT1G60180	pseudogene of F-box family protein
AT1G64380	encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
AT3G04140	Ankyrin repeat family protein;(source:Araport11)
AT5G52055	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-30 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT5G01960	RING/U-box superfamily protein;(source:Araport11)
AT4G19239	Pseudogene of AT5G01080; beta-galactosidase
AT1G24530	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G48210	Protein kinase superfamily protein;(source:Araport11)
AT3G53235	hypothetical protein;(source:Araport11)
AT1G52810	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G34690	pseudogene of maturase K;(source:Araport11)
AT3G27520	cryptic loci regulator;(source:Araport11)
AT3G07273	hypothetical protein;(source:Araport11)
AT2G25735	hypothetical protein;(source:Araport11)
AT1G52320	kinesin-like protein;(source:Araport11)
AT5G64830	programmed cell death 2 C-terminal domain-containing protein;(source:Araport11)
AT1G36940	myotubularin-like protein;(source:Araport11)
AT1G73400	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G62220	Protein kinase superfamily protein;(source:Araport11)
AT4G39270	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G15053	NEP-interacting protein, putative (DUF239);(source:Araport11)
AT1G68440	Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding.
AT1G70430	Protein kinase superfamily protein;(source:Araport11)
AT2G04500	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G72880	Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11)
AT1G62090	pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G30335	transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.2e-129 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT1G77530	O-methyltransferase family protein;(source:Araport11)
AT4G17915	pseudogene of pentatricopeptide (PPR) repeat-containing/C3HC4-type RING finger containing protein
AT5G43770	proline-rich family protein;(source:Araport11)
AT2G13170	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-88 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT2G19796	other_RNA;(source:Araport11)
AT1G19380	sugar, putative (DUF1195);(source:Araport11)
AT4G38940	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G21050	hyccin;(source:Araport11)
AT4G40050	signal transducer, putative (DUF3550/UPF0682);(source:Araport11)
AT3G18640	Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT4G34150	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT1G66180	The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile.
AT5G19015	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 8.7e-16 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10)
AT3G22937	pseudogene of no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11)
AT1G26100	Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11)
AT1G56090	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G11050	Protein kinase superfamily protein;(source:Araport11)
AT5G35076	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-45 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10)
AT3G28155	hypothetical protein;(source:Araport11)
AT1G27170	transmembrane receptors / ATP binding protein;(source:Araport11)
AT2G37820	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G70944	transmembrane protein;(source:Araport11)
AT5G45670	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT4G33870	Peroxidase superfamily protein;(source:Araport11)
AT1G65845	transmembrane protein;(source:Araport11)
AT5G44418	pseudogene of cytochrome P450;(source:Araport11)
AT1G69580	Homeodomain-like superfamily protein;(source:Araport11)
AT2G41170	F-box family protein;(source:Araport11)
AT1G21200	sequence-specific DNA binding transcription factor;(source:Araport11)
AT2G03470	ELM2 domain-containing protein;(source:Araport11)
AT3G22053	cysteine-rich repeat secretory protein;(source:Araport11)
AT3G42803	transposable_element_gene;(source:Araport11);pseudogene, similar to P0707D10.17, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10)
AT3G29773	pseudogene of nuclease;(source:Araport11)
AT4G15040	Subtilisin-like serine endopeptidase family protein;(source:Araport11)
AT2G15170	Plant basic secretory protein (BSP) family protein;(source:Araport11)
AT5G53050	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G33070	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-191 P-value blast match to gb\|AAG52949.1\| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT2G11600	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, and genefinder;(source:TAIR10)
AT4G24320	Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11)
AT3G13830	F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G38920	SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11)
AT5G27750	F-box/FBD-like domains containing protein;(source:Araport11)
AT1G48640	Transmembrane amino acid transporter family protein;(source:Araport11)
AT1G67328	Natural antisense transcript overlaps with AT1G67330;(source:Araport11)
AT5G56452	FBD-like domain family protein;(source:Araport11)
AT3G29300	transmembrane protein;(source:Araport11)
AT4G16840	transmembrane protein;(source:Araport11)
AT5G11970	ABC family ABC transporter, putative (DUF3511);(source:Araport11)
AT4G26960	hypothetical protein;(source:Araport11)
AT1G69980	structural polyprotein;(source:Araport11)
AT1G19485	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G01732	Natural antisense transcript overlaps with AT5G01730;(source:Araport11)
AT3G30685	transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase GB:AAD25149 from (Arabidopsis thaliana);(source:TAIR10)
AT2G24280	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G62410	MIF4G domain-containing protein;(source:Araport11)
AT2G22510	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G22780	Adaptor protein complex AP-2, alpha subunit;(source:Araport11)
AT2G32220	Ribosomal L27e protein family;(source:Araport11)
AT3G19430	late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11)
AT2G34655	hypothetical protein;(source:Araport11)
AT1G05136	hypothetical protein;(source:Araport11)
AT3G26147	hypothetical protein;(source:Araport11)
AT1G59865	transmembrane protein;(source:Araport11)
AT1G15757	Encodes a defensin-like (DEFL) family protein.
AT4G18460	D-Tyr-tRNA(Tyr) deacylase family protein;(source:Araport11)
AT2G25280	AmmeMemoRadiSam system protein B;(source:Araport11)
AT4G13968	Encodes a defensin-like (DEFL) family protein.
AT4G04745	hypothetical protein;(source:Araport11)
AT3G15650	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G35350	EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11)
AT3G17365	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT2G16270	transmembrane protein;(source:Araport11)
AT2G40050	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G58225	hypothetical protein;(source:Araport11)
AT4G31985	Ribosomal protein L39 family protein;(source:Araport11)
AT4G10720	Ankyrin repeat family protein;(source:Araport11)
AT1G10650	SBP (S-ribonuclease binding protein) family protein;(source:Araport11)
AT3G45670	Protein kinase superfamily protein;(source:Araport11)
AT2G11610	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.6e-24 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT5G17340	Putative membrane lipoprotein;(source:Araport11)
AT1G64610	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT3G57320	threonine-tRNA ligase 2;(source:Araport11)
AT3G26934	hypothetical protein;(source:Araport11)
AT2G47010	calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11)
AT1G51920	transmembrane protein;(source:Araport11)
AT1G05291	GPI inositol-deacylase C, putative (DUF1218);(source:Araport11)
AT1G67325	Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11)
AT4G20430	Subtilase family protein;(source:Araport11)
AT1G23350	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT2G32380	Transmembrane protein 97, predicted
AT3G53840	Protein kinase superfamily protein;(source:Araport11)
AT5G42010	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G45207	Remorin family protein;(source:Araport11)
AT2G01050	zinc ion binding / nucleic acid binding protein;(source:Araport11)
AT5G47920	transcription elongation factor;(source:Araport11)
AT1G70550	NEP-interacting protein, putative (DUF239);(source:Araport11)
AT3G32047	Cytochrome P450 superfamily protein;(source:Araport11)
AT5G38310	hypothetical protein;(source:Araport11)
AT4G39970	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G01130	hypothetical protein (DUF674);(source:Araport11)
AT4G26483	nicotianamine synthase;(source:Araport11)
AT2G17590	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G23360	filament-like protein (DUF869);(source:Araport11)
AT3G15250	TPRXL;(source:Araport11)
AT3G41979	5.8SrRNA
AT1G14330	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT2G27385	Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT5G41680	Protein kinase superfamily protein;(source:Araport11)
AT5G07940	dentin sialophosphoprotein-like protein;(source:Araport11)
AT2G37980	O-fucosyltransferase family protein;(source:Araport11)
AT1G73170	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G17780	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G01445	hypothetical protein;(source:Araport11)
AT1G50450	Saccharopine dehydrogenase;(source:Araport11)
AT3G62200	Putative endonuclease or glycosyl hydrolase;(source:Araport11)
AT5G03110	protamine P1 family protein;(source:Araport11)
AT1G29465	transmembrane protein;(source:Araport11)
AT4G02340	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G01175	transmembrane protein;(source:Araport11)
AT1G55160	WAS/WASL-interacting family protein;(source:Araport11)
AT1G30590	RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11)
AT2G38260	Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT1G23840	transmembrane protein;(source:Araport11)
AT5G67510	Translation protein SH3-like family protein;(source:Araport11)
AT2G30650	ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11)
AT4G00560	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT1G07160	Protein phosphatase 2C family protein;(source:Araport11)
AT3G22020	Receptor-like protein kinase-related family protein;(source:Araport11)
AT1G54750	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G48655	RING/U-box superfamily protein;(source:Araport11)
AT5G25200	Ta11-like non-LTR retrotransposon;(source:Araport11)
AT3G48440	Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT3G05390	S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11)
AT1G55980	FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11)
AT2G38660	Amino acid dehydrogenase family protein;(source:Araport11)
AT4G06585	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.8e-06 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT2G44920	Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. Unlike other PRPs, At2g44920 consists exclusively of type II b-turns
AT2G36895	D-tagatose-1,6-bisphosphate aldolase subunit;(source:Araport11)
AT5G59640	transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.1e-159 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10)
AT4G18815	pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10)
AT3G52920	transcriptional activator (DUF662);(source:Araport11)
AT2G19940	Putative N-acetyl-gamma-glutamyl-phosphate reductase;(source:Araport11)
AT1G65850	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT3G01930	Major facilitator superfamily protein;(source:Araport11)
AT5G19590	DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11)
AT4G27360	Dynein light chain type 1 family protein;(source:Araport11)
AT5G08670	Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level.
AT1G20370	Pseudouridine synthase family protein;(source:Araport11)
AT4G27020	inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11)
AT5G49040	Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT2G13469	pseudogene of putative nucleic-acid protein;(source:Araport11)
AT5G62130	Per1-like family protein;(source:Araport11)
AT4G19930	F-box and associated interaction domains-containing protein;(source:Araport11)
AT4G17580	Bax inhibitor-1 family protein;(source:Araport11)
AT2G44220	NEP-interacting protein (DUF239);(source:Araport11)
AT5G10130	Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT1G64330	myosin heavy chain-like protein;(source:Araport11)
AT2G37220	Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT3G54270	sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11)
AT5G43196	Pseudogene of AT5G43210; endo/excinuclease amino terminal domain-containing protein
AT5G03700	D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11)
AT4G31650	Transcriptional factor B3 family protein;(source:Araport11)
AT5G14035	pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10)
AT3G13432	transmembrane protein;(source:Araport11)
AT5G47170	hypothetical protein;(source:Araport11)
AT2G44390	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G45238	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT2G15160	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.8e-86 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G15350	DUF4050 family protein;(source:Araport11)
AT3G62640	DUF3511 domain protein (DUF3511);(source:Araport11)
AT5G46080	Protein kinase superfamily protein;(source:Araport11)
AT4G05060	PapD-like superfamily protein;(source:Araport11)
AT5G67050	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G11000	hypothetical protein (DUF868);(source:Araport11)
AT1G77770	forkhead box protein, putative (DUF1644);(source:Araport11)
AT1G08270	vacuolar protein sorting-associated protein;(source:Araport11)
AT1G73160	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G29075	glycine-rich protein;(source:Araport11)
AT2G45530	RING/U-box superfamily protein;(source:Araport11)
AT2G30190	pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10)
AT3G49300	proline-rich family protein;(source:Araport11)
AT4G24160	Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels.
AT4G28420	Tyrosine transaminase family protein;(source:Araport11)
AT1G78250	pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10)
AT5G48730	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT4G09690	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G25610	C2H2-like zinc finger protein;(source:Araport11)
AT3G13662	Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT3G46140	Protein kinase superfamily protein;(source:Araport11)
AT2G34740	protein phosphatase 2C family protein;(source:Araport11)
AT5G40981	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G02930	F-box/RNI-like superfamily protein;(source:Araport11)
AT3G58920	F-box/RNI-like superfamily protein;(source:Araport11)
AT3G04500	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G35540	transmembrane protein;(source:Araport11)
AT3G28850	Glutaredoxin family protein;(source:Araport11)
AT5G67200	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G30945	pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G33260	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10)
AT3G03500	TatD related DNase;(source:Araport11)
AT5G04267	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT4G24290	MAC/Perforin domain-containing protein;(source:Araport11)
AT2G06822	Pseudogene of AT2G06822
AT2G11135	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04273.1);(source:TAIR10)
AT2G35345	hypothetical protein;(source:Araport11)
AT5G35753	DnaJ heat shock amino-terminal domain protein (DUF3444);(source:Araport11)
AT1G05700	Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11)
AT1G52100	Mannose-binding lectin superfamily protein;(source:Araport11)
AT2G01008	maternal effect embryo arrest protein;(source:Araport11)
AT2G06280	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G56960	basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11)
AT5G48175	transmembrane protein;(source:Araport11)
AT2G26030	F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT1G28880	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT2G32000	DNA topoisomerase, type IA, core;(source:Araport11)
AT1G21738	hypothetical protein;(source:Araport11)
AT5G40540	Protein kinase superfamily protein;(source:Araport11)
AT1G73860	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G21020	pseudogene of NOD26-like intrinsic protein 3;(source:Araport11)
AT5G63500	transmembrane protein, putative (DUF 3339);(source:Araport11)
AT4G39838	Natural antisense transcript overlaps with AT4G39840;(source:Araport11)
AT1G44160	HSP40/DnaJ peptide-binding protein;(source:Araport11)
AT1G15620	transmembrane protein;(source:Araport11)
AT2G28280	pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G46350	LRR receptor-like Serine/Threonine-kinase;(source:Araport11)
AT1G44707	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G35798	transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.9e-52 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10)
AT2G27310	F-box family protein;(source:Araport11)
AT2G19980	CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11)
AT5G63905	transmembrane protein;(source:Araport11)
AT4G12170	Thioredoxin superfamily protein;(source:Araport11)
AT5G52710	Copper transport protein family;(source:Araport11)
AT2G19920	RNA-dependent RNA polymerase family protein;(source:Araport11)
AT1G15450	pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10)
AT5G48140	Pectin lyase-like superfamily protein;(source:Araport11)
AT1G48730	hypothetical protein;(source:Araport11)
AT1G67410	Exostosin family protein;(source:Araport11)
AT2G38250	Homeodomain-like superfamily protein;(source:Araport11)
AT4G12870	Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11)
AT5G06480	Immunoglobulin E-set superfamily protein;(source:Araport11)
AT1G42420	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT1G32690	DUF740 family protein;(source:Araport11)
AT5G61660	glycine-rich protein;(source:Araport11)
AT4G27250	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G26430	Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters.
AT4G30180	hypothetical protein;(source:Araport11)
AT2G18140	Peroxidase superfamily protein;(source:Araport11)
AT5G47600	HSP20-like chaperones superfamily protein;(source:Araport11)
AT2G41470	agamous-like MADS-box protein;(source:Araport11)
AT5G60250	zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT5G57120	nucleolar/coiled-body phosphoprotein;(source:Araport11)
AT3G44970	Cytochrome P450 superfamily protein;(source:Araport11)
AT1G67510	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G35965	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.9e-244 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G49390	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G05730	Encodes a defensin-like (DEFL) family protein. The mRNA is cell-to-cell mobile.
AT2G21905	Encodes a ECA1 gametogenesis related family protein [pseudogene]
AT3G49400	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G51350	ARM repeat superfamily protein;(source:Araport11)
AT5G01670	NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT3G24510	Encodes a defensin-like (DEFL) family protein.
AT1G61420	S-locus lectin protein kinase family protein;(source:Araport11)
AT3G01323	ECA1-like gametogenesis related family protein;(source:Araport11)
AT5G24190	Lipase class 3-related protein;(source:Araport11)
AT1G78995	hypothetical protein;(source:Araport11)
AT1G54820	Protein kinase superfamily protein;(source:Araport11)
AT5G57535	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT5G49770	Leucine rich receptor kinase.
AT2G18560	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT3G58610	ketol-acid reductoisomerase;(source:Araport11)
AT2G29360	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G45638	other_RNA;(source:Araport11)
AT2G41178	Natural antisense transcript overlaps with AT2G41180;(source:Araport11)
AT5G42250	Zinc-binding alcohol dehydrogenase family protein;(source:Araport11)
AT1G32570	hypothetical protein;(source:Araport11)
AT1G65130	Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11)
AT5G64460	Phosphoglycerate mutase family protein;(source:Araport11)
AT4G28160	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT1G12030	phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11)
AT3G16555	F-box and associated interaction domains-containing protein;(source:Araport11).SON1 paralog.
AT1G10705	Encodes a Maternally expressed gene (MEG) family protein [pseudogene]
AT4G08250	GRAS family transcription factor;(source:Araport11)
AT2G29600	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G60710	Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT4G27270	Quinone reductase family protein;(source:Araport11)
AT1G20310	syringolide-induced protein;(source:Araport11)
AT1G43940	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42540.1);(source:TAIR10)
AT3G61610	Galactose mutarotase-like superfamily protein;(source:Araport11)
AT5G64735	pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10)
AT5G04045	Encodes a defensin-like (DEFL) family protein.
AT1G52180	Aquaporin-like superfamily protein;(source:Araport11)
AT1G18335	Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT4G28800	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT3G09735	S1FA-like DNA-binding protein;(source:Araport11)
AT1G62320	ERD (early-responsive to dehydration stress) family protein;(source:Araport11)
AT3G33187	Encodes a defensin-like (DEFL) family protein.
AT4G30640	RNI-like superfamily protein;(source:Araport11)
AT5G66580	PADRE protein.
AT3G44330	M28 Zn-peptidase nicastrin;(source:Araport11)
AT2G30300	Major facilitator superfamily protein;(source:Araport11)
AT1G01390	Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT1G54620	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT4G12750	Homeodomain-like transcriptional regulator;(source:Araport11)
AT5G13440	Ubiquinol-cytochrome C reductase iron-sulfur subunit;(source:Araport11)
AT4G03965	RING/U-box superfamily protein;(source:Araport11)
AT2G29065	GRAS family transcription factor;(source:Araport11)
AT1G09400	FMN-linked oxidoreductases superfamily protein;(source:Araport11)
AT5G19880	Peroxidase superfamily protein;(source:Araport11)
AT5G38195	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT2G25380	pseudogene of zinc finger protein-related
AT4G01960	transmembrane protein;(source:Araport11)
AT2G04070	Expression in rosette leaves is activated by high concentration of boron.
AT1G22330	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G47370	Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11)
AT5G35810	Ankyrin repeat family protein;(source:Araport11)
AT5G64690	neurofilament triplet H protein-like protein;(source:Araport11)
AT5G60530	Root tip expressed LEA protein involved in ribosome biogenesis.
AT4G32870	Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT2G02730	GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11)
AT5G22280	peptidyl-prolyl cis-trans isomerase G;(source:Araport11)
AT5G44990	Glutathione S-transferase family protein;(source:Araport11)
AT4G05170	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT3G56360	hypothetical protein;(source:Araport11)
AT1G63280	Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT1G75290	encodes a protein whose sequence is similar to an isoflavone reductase
AT1G10040	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G58520	Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11)
AT5G54710	Ankyrin repeat family protein;(source:Araport11)
AT3G10300	Calcium-binding EF-hand family protein;(source:Araport11)
AT5G16170	Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT2G34400	Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11)
AT5G24318	O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT4G19645	TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11)
AT3G23570	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G44840	Pectin lyase-like superfamily protein;(source:Araport11)
AT4G11550	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT5G45180	Flavin-binding monooxygenase family protein;(source:Araport11)
AT3G05725	hypothetical protein (DUF3511);(source:Araport11)
AT4G08280	Thioredoxin superfamily protein;(source:Araport11)
AT4G35165	egg cell-secreted-like protein (DUF1278);(source:Araport11)
AT1G49000	transmembrane protein;(source:Araport11)
AT1G28390	Protein kinase superfamily protein;(source:Araport11)
AT3G13965	Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT2G03955	Encodes a defensin-like (DEFL) family protein.
AT3G55860	hypothetical protein;(source:Araport11)
AT2G04860	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT2G07155	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.9e-17 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10)
AT1G30060	COP1-interacting protein-like protein;(source:Araport11)
AT1G14260	RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT4G39420	spatacsin carboxy-terminus protein;(source:Araport11)
AT2G26970	Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT5G41720	F-box associated ubiquitination effector family protein;(source:Araport11)
AT1G58037	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT4G00955	wall-associated receptor kinase-like protein;(source:Araport11)
AT1G52700	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G69660	TRAF-like family protein;(source:Araport11)
AT1G56480	pseudogene of Pectin lyase-like superfamily protein;(source:Araport11)
AT2G02700	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G62840	Small nuclear ribonucleoprotein family protein;(source:Araport11)
AT3G44205	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.5e-40 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10)
AT2G22426	hypothetical protein;(source:Araport11)
AT1G69150	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT1G67910	hypothetical protein;(source:Araport11)
AT1G32190	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G24650	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G09490	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G43020	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins, Arabidopsis thaliana;(source:TAIR10)
AT4G12230	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G45730	hypothetical protein;(source:Araport11)
AT2G23450	Protein kinase superfamily protein;(source:Araport11)
AT3G61545	pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10)
AT3G56060	Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11)
AT3G42910	transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G28250.1);(source:TAIR10)
AT3G13950	ankyrin;(source:Araport11)
AT4G14370	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G14010	emp24/gp25L/p24 family/GOLD family protein;(source:Araport11)
AT1G77750	Ribosomal protein S13/S18 family;(source:Araport11)
AT1G35545	Natural antisense transcript overlaps with AT1G35550 and AT1G35540;(source:Araport11)
AT1G60830	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G31700	transmembrane protein;(source:Araport11)
AT2G36600	pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10)
AT3G50170	transmembrane protein, putative (DUF247);(source:Araport11)
AT3G21810	Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT3G17110	Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167
AT1G11220	cotton fiber, putative (DUF761);(source:Araport11)
AT1G12590	pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10)
AT1G54550	F-box and associated interaction domains-containing protein;(source:Araport11)
AT3G26950	transmembrane protein;(source:Araport11)
AT5G31804	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT1G72190	D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11)
AT3G60520	zinc ion-binding protein;(source:Araport11)
AT1G21326	VQ motif-containing protein;(source:Araport11)
AT4G39560	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G71350	eukaryotic translation initiation factor SUI1 family protein;(source:Araport11)
AT5G44375	pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10)
AT1G63070	pentatricopeptide (PPR) repeat-containing protein;(source:Araport11)
AT3G21100	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT2G19460	DUF3511 domain protein (DUF3511);(source:Araport11)
AT2G04300	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G40680	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT1G65010	Encodes a microtubule-associated protein. Putative role in flower development. Comparison of SALK_061426C to Columbia wild type in normal lighting and under low light of 33 micromoles per meter-squared per second resulted in a trend toward earlier bolting in the mutant under low light (P=0.055) (Ann Stapleton and Patrick Pridgen, 2009, personal communication).
AT5G24750	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT4G06477	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.1e-112 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10)
AT2G04033	Encodes a defensin-like (DEFL) family protein.
AT3G06620	PAS domain-containing protein tyrosine kinase family protein;(source:Araport11)
AT1G55440	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G04220	Target of miR825/825. Mutants have decreased resistance to fungal pathogens.
AT4G25020	D111/G-patch domain-containing protein;(source:Araport11)
AT4G32640	Sec23/Sec24 protein transport family protein;(source:Araport11)
AT1G55930	CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11)
AT3G43352	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-09 P-value blast match to gb\|AAO73529.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT2G33760	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT1G08050	Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT3G60660	spindle/kinetochore-associated-like protein;(source:Araport11)
AT3G02700	NC domain-containing protein-like protein;(source:Araport11)
AT5G47980	HXXXD-type acyl-transferase family protein;(source:Araport11)
AT1G64910	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT4G07475	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to En/Spm-like transposon protein;(source:TAIR10)
AT3G57400	transmembrane protein;(source:Araport11)
AT5G57340	ras guanine nucleotide exchange factor Q-like protein;(source:Araport11)
AT3G09960	Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11)
AT4G08395	hypothetical protein;(source:Araport11)
AT5G46780	VQ motif-containing protein;(source:Araport11)
AT4G32030	hypothetical protein;(source:Araport11)
AT3G32023	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.7e-54 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G39345	pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10)
AT1G03660	Ankyrin-repeat containing protein;(source:Araport11)
AT3G10950	Zinc-binding ribosomal protein family protein;(source:Araport11)
AT1G53330	encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes.
AT5G25050	Major facilitator superfamily protein;(source:Araport11)
AT5G37330	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT5G60966	pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10)
AT5G39370	Curculin-like (mannose-binding) lectin family protein;(source:Araport11)
AT5G05330	Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664).
AT3G15760	cytochrome P450 family protein;(source:Araport11)
AT2G25730	zinc finger FYVE domain protein;(source:Araport11)
AT4G17765	pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10)
AT3G17580	SsrA-binding protein;(source:Araport11)
AT4G19970	nucleotide-diphospho-sugar transferase family protein;(source:Araport11)
AT5G08180	Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11)
AT3G50640	hypothetical protein;(source:Araport11)
AT2G23820	Metal-dependent phosphohydrolase;(source:Araport11)
AT5G05230	RING/U-box superfamily protein;(source:Araport11)
AT3G17490	F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G78780	pathogenesis-related family protein;(source:Araport11)
AT1G67310	Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11)
AT2G35859	Natural antisense transcript overlaps with AT2G35860;(source:Araport11)
AT3G21770	Peroxidase superfamily protein;(source:Araport11)
AT3G04700	carboxylate clamp-TPR protein (DUF1685);(source:Araport11)
AT3G28580	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G47940	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT3G12870	transmembrane protein;(source:Araport11)
AT5G13360	Auxin-responsive GH3 family protein;(source:Araport11)
AT5G40860	transmembrane protein;(source:Araport11)
AT2G25070	Protein phosphatase 2C family protein;(source:Araport11)
AT3G55070	LisH/CRA/RING-U-box domains-containing protein;(source:Araport11)
AT2G04260	pseudogene of P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11)
AT1G79890	RAD3-like DNA-binding helicase protein;(source:Araport11)
AT5G46325	pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10)
AT1G77145	transmembrane protein, putative (DUF506);(source:Araport11)
AT2G44798	Natural antisense transcript overlaps with AT2G44800;(source:Araport11)
AT4G08691	hypothetical protein;(source:Araport11)
AT1G43150	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.3e-25 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT1G23100	GroES-like family protein;(source:Araport11)
AT4G24530	O-fucosyltransferase family protein;(source:Araport11)
AT5G57480	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G15800	hypothetical protein;(source:Araport11)
AT5G07620	Protein kinase superfamily protein;(source:Araport11)
AT4G27810	hypothetical protein;(source:Araport11)
AT3G43635	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to gb\|AAO73521.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT5G07810	SNF2 domain-containing protein / helicase domain-containing protein / HNH endonuclease domain-containing protein;(source:Araport11)
AT3G21620	ERD (early-responsive to dehydration stress) family protein;(source:Araport11)
AT5G56745	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT1G33600	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G33330	Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT1G27020	plant/protein;(source:Araport11)
AT1G14780	MAC/Perforin domain-containing protein;(source:Araport11)
AT3G01830	Calcium-binding EF-hand family protein;(source:Araport11)
AT5G50805	pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10)
AT4G22066	Pseudogene of AT5G66830; F-box family protein
AT2G17723	Encodes a defensin-like (DEFL) family protein.
AT1G64355	1-acyl-sn-glycerol-3-phosphate acyltransferase;(source:Araport11)
AT3G44274	pseudogene of Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G43897	transposable_element_gene;(source:Araport11);pseudogene, similar to ORF-c, blastp match of 58%25 identity and 1.7e-32 P-value to GP\|6069570\|dbj\|BAA85461.1\|\|AB022081 ORF-c {Brassica rapa};(source:TAIR10)
AT2G13730	transposable_element_gene;(source:Araport11)
AT4G25680	PPPDE putative thiol peptidase family protein;(source:Araport11)
AT3G56720	pre-mRNA-splicing factor;(source:Araport11)
AT3G49610	B3 domain protein (DUF313);(source:Araport11)
AT1G48690	Auxin-responsive GH3 family protein;(source:Araport11)
AT1G55535	transmembrane protein;(source:Araport11)
AT3G58960	F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT5G09880	Splicing factor, CC1-like protein;(source:Araport11)
AT3G18535
AT2G05530	Glycine-rich protein family;(source:Araport11)
AT4G31230	kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT3G18840	LOW protein: PPR containing-like protein;(source:Araport11)
AT5G35601	pseudogene of aconitase 3;(source:Araport11)
AT4G36370	hypothetical protein;(source:Araport11)
AT4G32140	EamA-like transporter family;(source:Araport11)
AT1G74840	Homeodomain-like superfamily protein;(source:Araport11)
AT4G06619	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.0e-28 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G31520	hypothetical protein;(source:Araport11)
AT2G01023	hypothetical protein;(source:Araport11)
AT5G21080	Uncharacterized protein;(source:Araport11)
AT2G14110	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT3G54040	PAR1 protein;(source:Araport11)
AT1G68340	hypothetical protein (DUF1639);(source:Araport11)
AT5G24340	3-5 exonuclease domain-containing protein;(source:Araport11)
AT5G18920	Cox19-like CHCH family protein;(source:Araport11)
AT5G03795	Exostosin family protein;(source:Araport11)
AT1G47810	F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G07728	Natural antisense transcript overlaps with AT1G07725;(source:Araport11)
AT5G39770	Represents a non-function pseudogene homologous to AtMSU81 (At4g30870).
AT5G06125	pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10)
AT1G08165	hypothetical protein;(source:Araport11)
AT3G01870	hypothetical protein (DUF946);(source:Araport11)
AT3G14060	hypothetical protein;(source:Araport11)
AT5G03377	pseudogene of acylphosphatase family protein
AT3G21985	pseudogene of cysteine-rich repeat secretory-like protein (DUF26);(source:Araport11)
AT4G36850	PQ-loop repeat family protein / transmembrane family protein;(source:Araport11)
AT2G34700	Pollen Ole e 1 allergen and extensin family protein;(source:Araport11)
AT1G43835	transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10)
AT1G69860	Major facilitator superfamily protein;(source:Araport11)
AT3G61160	Protein kinase superfamily protein;(source:Araport11)
AT5G20060	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G62150	peptidoglycan-binding LysM domain-containing protein;(source:Araport11)
AT4G37240	PADRE protein down-regulated after infection by S. sclerotiorun.
AT3G44840	SABATH methyltransferase
AT2G44210	carboxyl-terminal peptidase (DUF239);(source:Araport11)
AT1G28080	RING finger protein;(source:Araport11)
AT3G56550	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G40080	Mitochondrial ribosomal protein L27;(source:Araport11)
AT5G11500	coiled-coil protein;(source:Araport11)
AT2G39640	glycosyl hydrolase family 17 protein;(source:Araport11)
AT5G56544	pseudogene of arginyl-tRNA synthetase
AT3G43980	Ribosomal protein S14p/S29e family protein;(source:Araport11)
AT2G04580	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10)
AT4G04320	malonyl-CoA decarboxylase family protein;(source:Araport11)
AT5G53742	Encodes a ECA1 gametogenesis related family protein
AT1G06640	encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile.
AT1G17145	RING/U-box superfamily protein;(source:Araport11)
AT4G05040	ankyrin repeat family protein;(source:Araport11)
AT1G13940	T-box transcription factor, putative (DUF863);(source:Araport11)
AT1G23610	hypothetical protein;(source:Araport11)
AT1G15885	hypothetical protein;(source:Araport11)
AT4G38650	Glycosyl hydrolase family 10 protein;(source:Araport11)
AT5G15030	paired amphipathic helix Sin3-like protein;(source:Araport11)
AT4G14390	Ankyrin repeat family protein;(source:Araport11)
AT5G56840	myb-like transcription factor family protein;(source:Araport11)
AT3G28880	serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit;(source:Araport11)
AT2G11880	None;(source:Araport11)
AT1G63660	GMP synthase (glutamine-hydrolyzing), putative / glutamine amidotransferase;(source:Araport11)
AT5G05180	myosin heavy chain, striated protein;(source:Araport11)
AT1G09490	similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565
AT5G08460	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G80400	RING/U-box superfamily protein;(source:Araport11)
AT5G38240	Protein kinase family protein;(source:Araport11)
AT5G59410	Rab5-interacting family protein;(source:Araport11)
AT5G29550	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.4e-126 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT4G12500	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT2G44360	ecotropic viral integration site protein;(source:Araport11)
AT4G22730	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G05190	pseudogene of cytochrome P450;(source:Araport11)
AT1G09880	Rhamnogalacturonate lyase family protein;(source:Araport11)
AT5G32630	transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, various predicted helicase proteins, Arabidopsis thaliana and others;(source:TAIR10)
AT1G53163	membrane-associated kinase regulator;(source:Araport11)
AT1G75140	membrane protein;(source:Araport11)
AT3G54740	zein-binding protein (Protein of unknown function, DUF593);(source:Araport11)
AT2G17760	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT2G41060	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G28560	BCS1 AAA-type ATPase;(source:Araport11)
AT3G32050	hypothetical protein;(source:Araport11)
AT1G37120	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.3e-14 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10)
AT3G26930	Protein with RNI-like/FBD-like domain;(source:Araport11)
AT1G49870	myosin-2 heavy chain-like protein;(source:Araport11)
AT1G62870	hypothetical protein;(source:Araport11)
AT1G12244	Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT2G06090	Plant self-incompatibility protein S1 family;(source:Araport11)
AT1G43030	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb\|AAG52949.1\| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT2G26360	Mitochondrial substrate carrier family protein;(source:Araport11)
AT2G24160	pseudogene of receptor like protein 37;(source:Araport11)
AT1G51300	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT1G52330	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT3G60790	F-box family protein;(source:Araport11)
AT5G47430	DWNN domain, a CCHC-type zinc finger;(source:Araport11)
AT4G17700	hypothetical protein;(source:Araport11)
AT5G61470	C2H2-like zinc finger protein;(source:Araport11)
AT4G36500	hypothetical protein;(source:Araport11)
AT2G27320	NEP-interacting protein, putative (DUF239);(source:Araport11)
AT3G23530	Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11)
AT3G43146	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.9e-55 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT3G50040	hypothetical protein;(source:Araport11)
AT2G11140	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-71 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT3G59765	None;(source:Araport11)
AT1G68735	Encodes a defensin-like (DEFL) family protein.
AT5G52890	AT hook motif-containing protein;(source:Araport11)
AT4G03945	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G70050	pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10)
AT3G18510	ATP-dependent helicase/nuclease subunit;(source:Araport11)
AT5G23370	GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11)
AT5G67350	hypothetical protein;(source:Araport11)
AT1G14170	RNA-binding KH domain-containing protein;(source:Araport11)
AT2G28990	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT5G15870	glycosyl hydrolase family 81 protein;(source:Araport11)
AT3G06750	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT5G54170	Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11)
AT2G44760	dihydroorotate dehydrogenase (DUF3598);(source:Araport11)
AT1G19240	transmembrane protein;(source:Araport11)
AT4G11680	Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11)
AT1G29650	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G48370	Thioesterase/thiol ester dehydrase-isomerase superfamily protein;(source:Araport11)
AT1G77270	hypothetical protein;(source:Araport11)
AT1G69510	cAMP-regulated phosphoprotein 19-related protein;(source:Araport11)
AT4G14226	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT1G76330	pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10)
AT3G24508	Encodes a defensin-like (DEFL) family protein.
AT5G62420	NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT3G05755	pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10)
AT1G69760	suppressor SRP40-like protein;(source:Araport11)
AT3G27540	beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT1G31274	Pseudogene of AT5G26622; beta-galactosidase
AT4G11860	FAM63A-like protein (DUF544);(source:Araport11)
AT2G31335	hypothetical protein;(source:Araport11)
AT1G65550	Xanthine/uracil permease family protein;(source:Araport11)
AT5G09345	pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10)
AT3G43610	Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11)
AT1G38140	transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 9.2e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G47445	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.6e-84 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT5G62750	hypothetical protein;(source:Araport11)
AT1G28840	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT2G37320	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT5G27970	ARM repeat superfamily protein;(source:Araport11)
AT1G64405	hypothetical protein;(source:Araport11)
AT2G45750	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G51810	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G58420	TRAF-like superfamily protein;(source:Araport11)
AT3G10720	Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT1G08210	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G55590	RNI-like superfamily protein;(source:Araport11)
AT2G05000	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G47320.1);(source:TAIR10)
AT1G19000	Homeodomain-like superfamily protein;(source:Araport11)
AT5G26050	Plant self-incompatibility protein S1 family;(source:Araport11)
AT3G47490	HNH endonuclease;(source:Araport11)
AT3G56610	prolamin-like protein;(source:Araport11)
AT5G37474	Encodes a defensin-like (DEFL) family protein.
AT2G27160	hypothetical protein;(source:Araport11)
AT2G01130	DEA(D/H)-box RNA helicase family protein;(source:Araport11)
AT1G62270	F-box and associated interaction domains-containing protein;(source:Araport11)
AT1G09932	Phosphoglycerate mutase family protein;(source:Araport11)
AT1G52565	cytochrome P450 family protein;(source:Araport11)
AT5G35930	AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT3G29785	Pol-like polyprotein/retrotransposon;(source:Araport11)
AT1G28250	transmembrane protein;(source:Araport11)
AT2G44510	CDK inhibitor P21 binding protein;(source:Araport11)
AT1G24440	RING/U-box superfamily protein;(source:Araport11)
AT2G14710	F-box family protein;(source:Araport11)
AT2G29340	NAD-dependent epimerase/dehydratase family protein;(source:Araport11)
AT5G38905	pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10)
AT1G07175	alternative NAD(P)H dehydrogenase;(source:Araport11)
AT5G22690	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT2G43450	hypothetical protein;(source:Araport11)
AT2G15327	hypothetical protein;(source:Araport11)
AT2G08986	hypothetical protein;(source:Araport11)
AT4G02405	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G04985	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G78060	Glycosyl hydrolase family protein;(source:Araport11)
AT3G47830	DNA glycosylase superfamily protein;(source:Araport11)
AT1G26850	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT1G61750	Receptor-like protein kinase-related family protein;(source:Araport11)
AT5G48420	hypothetical protein;(source:Araport11)
AT5G59170	Proline-rich extensin-like family protein;(source:Araport11)
AT1G47860	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10)
AT5G18490	vacuolar sorting-associated protein (DUF946);(source:Araport11)
AT3G15640	Rubredoxin-like superfamily protein;(source:Araport11)
AT5G45960	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT5G10290	leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11)
AT2G13080	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10)
AT5G34854	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb\|AAG52949.1\| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10)
AT4G04730	Ta11-like non-LTR retrotransposon;(source:Araport11)
AT2G47720	hypothetical protein;(source:Araport11)
AT5G14700	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G48180	CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase;(source:Araport11)
AT3G09110	hypothetical protein (DUF674);(source:Araport11)
AT5G07400	forkhead-associated domain-containing protein / FHA domain-containing protein;(source:Araport11)
AT4G22580	Exostosin family protein;(source:Araport11)
AT4G03440	Ankyrin repeat family protein;(source:Araport11)
AT2G22750	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G17100	Cystatin/monellin superfamily protein;(source:Araport11)
AT5G37072	pseudogene of Ribosomal protein S4 (RPS4A) family protein;(source:Araport11)
AT1G21770	Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT4G26550	Got1/Sft2-like vescicle transport protein family;(source:Araport11)
AT3G42251	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to contains similarity to Arabidopsis thaliana hypothetical protein (GB:AC004483);(source:TAIR10)
AT5G49525	transmembrane protein;(source:Araport11)
AT3G02100	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT2G11170	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT1G32460	hypothetical protein;(source:Araport11)
AT2G18480	Major facilitator superfamily protein;(source:Araport11)
AT2G24370	kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT2G13910	pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G55646	TPRXL;(source:Araport11)
AT4G32860	Avr9/Cf-9 rapidly elicited protein;(source:Araport11)
AT2G47440	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT3G60286	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT1G67460	Minichromosome maintenance (MCM2/3/5) family protein;(source:Araport11)
AT5G01365	pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10)
AT1G33550	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G51940	oxidoreductase/transition metal ion-binding protein;(source:Araport11)
AT4G14230	CBS domain protein with a domain protein (DUF21);(source:Araport11)
AT3G02315	pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10)
AT1G62840	ankyrin repeat/KH domain protein (DUF1442);(source:Araport11)
AT3G44100	MD-2-related lipid recognition domain-containing protein;(source:Araport11)
AT2G22220	pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10)
AT3G15420	Transcription factor TFIIIC, tau55-related protein;(source:Araport11)
AT3G15960	mismatched DNA binding / ATP binding protein;(source:Araport11)
AT5G27900	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-26 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT3G42180	Exostosin family protein;(source:Araport11)
AT5G24100	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT3G49340	Cysteine proteinases superfamily protein;(source:Araport11)
AT2G10530	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-42 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10)
AT1G13550	hypothetical protein (DUF1262);(source:Araport11)
AT3G50160	transmembrane protein, putative (DUF247);(source:Araport11)
AT3G20360	TRAF-like family protein;(source:Araport11)
AT5G20050	Protein kinase superfamily protein;(source:Araport11)
AT2G23860	pseudogene of PapD-like superfamily protein;(source:Araport11)
AT5G66490	hypothetical protein;(source:Araport11)
AT5G24180	Lipase class 3-related protein;(source:Araport11)
AT3G28480	Oxoglutarate/iron-dependent oxygenase;(source:Araport11)
AT5G22700	LOW protein: F-box/FBD/LRR-like protein;(source:Araport11)
AT1G13485	hypothetical protein;(source:Araport11)
AT1G17450	B-block binding subunit of TFIIIC;(source:Araport11)
AT1G02610	RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT2G38680	5-nucleotidase / magnesium ion binding protein;(source:Araport11)
AT5G50120	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G65676	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-191 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi\|4996363\|dbj\|BAA78424.1\| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10)
AT1G43280	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.6e-47 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT4G04426	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-149 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10)
AT5G53592	FBD-like domain family protein;(source:Araport11)
AT5G37030	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G05370	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT3G48490	hypothetical protein;(source:Araport11)
AT3G06210	ARM repeat superfamily protein;(source:Araport11)
AT1G16660	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-268 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT3G61810	Glycosyl hydrolase family 17 protein;(source:Araport11)
AT5G44970	Protein with RNI-like/FBD-like domain;(source:Araport11)
AT5G03905	Iron-sulfur cluster biosynthesis family protein;(source:Araport11)
AT3G26910	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G29170	transmembrane protein (DUF872);(source:Araport11)
AT3G05440	C2 domain-containing protein;(source:Araport11)
AT5G43230	EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11)
AT4G31100	wall-associated kinase;(source:Araport11)
AT1G70740	Protein kinase superfamily protein;(source:Araport11)
AT1G70420	DNA ligase-like protein, putative (DUF1645);(source:Araport11)
AT1G76440	HSP20-like chaperones superfamily protein;(source:Araport11)
AT3G17140	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT4G30020	PA-domain containing subtilase family protein;(source:Araport11)
AT5G10745	transmembrane protein;(source:Araport11)
AT3G30733	pseudogene of RING/U-box superfamily protein;(source:Araport11)
AT1G55450	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G48020	hypothetical protein;(source:Araport11)
AT1G77280	kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11)
AT1G33090	MATE efflux family protein;(source:Araport11)
AT3G13000	ubiquinone biosynthesis protein (Protein of unknown function, DUF547);(source:Araport11)
AT3G21781	Natural antisense transcript overlaps with AT3G21780;(source:Araport11)
AT5G14410	hypothetical protein;(source:Araport11)
AT5G35340	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G61270	O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11)
AT2G02630	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G29260	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT1G73350	ankyrin repeat protein;(source:Araport11)
AT4G31280	hypothetical protein;(source:Araport11)
AT4G32560	paramyosin-like protein;(source:Araport11)
AT1G20100	DNA ligase-like protein;(source:Araport11)
AT5G24230	Lipase class 3-related protein;(source:Araport11)
AT2G37730	glycosyltransferase (DUF604);(source:Araport11)
AT4G38225	glycerol kinase;(source:Araport11)
AT1G36130	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.2e-84 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT5G46490	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT2G07740	transposable_element_gene;(source:Araport11);similar to nucleic acid binding / zinc ion binding [Arabidopsis thaliana] (TAIR:AT2G01050.1);(source:TAIR10)
AT2G03810	18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11)
AT3G19530	hypothetical protein;(source:Araport11)
AT1G02490	hypothetical protein;(source:Araport11)
AT3G25680	SLH domain protein;(source:Araport11)
AT5G44230	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G21940	hybrid signal transduction histidine kinase M-like protein;(source:Araport11)
AT5G54700	Ankyrin repeat family protein;(source:Araport11)
AT5G35777	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-67 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT5G44680	DNA glycosylase superfamily protein;(source:Araport11)
AT4G31410	E3 ubiquitin-protein ligase, putative (DUF1644);(source:Araport11)
AT1G55100	transposable_element_gene;(source:Araport11);pseudogene, putative ATP synthase beta subunit;(source:TAIR10)
AT2G42060	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT3G48630	hypothetical protein;(source:Araport11)
AT1G22180	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT3G44717	Pseudogene of AT5G03495; nucleotide binding protein
AT1G43895	pseudogene of Protein kinase superfamily protein;(source:Araport11)
AT1G72855	Natural antisense transcript overlaps with AT1G72860;(source:Araport11)
AT1G69050	hypothetical protein;(source:Araport11)
AT5G57500	Galactosyltransferase family protein;(source:Araport11)
AT4G38030	Rhamnogalacturonate lyase family protein;(source:Araport11)
AT2G46630	serine/arginine repetitive matrix protein;(source:Araport11)
AT2G24165	pseudogene of receptor like protein 30;(source:Araport11)
AT3G57890	Tubulin binding cofactor C domain-containing protein;(source:Araport11)
AT3G17780	B-cell receptor-associated-like protein;(source:Araport11)
AT5G56590	O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT5G23520	smr (Small MutS Related) domain-containing protein;(source:Araport11)
AT1G78330	pseudogene of Trimeric LpxA-like enzymes superfamily protein;(source:Araport11)
AT1G49900	C2H2 type zinc finger transcription factor family;(source:Araport11)
AT2G07880	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G11090.1);(source:TAIR10)
AT1G25886	transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G14770.2);(source:TAIR10)
AT5G58530	Glutaredoxin family protein;(source:Araport11)
AT2G33350	CCT motif family protein;(source:Araport11)
AT5G12880	proline-rich family protein;(source:Araport11)
AT4G06548	transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10)
AT2G25950	PITH domain protein (DUF1000);(source:Araport11)
AT1G34095	hypothetical protein;(source:Araport11)
AT1G76120	Pseudouridine synthase family protein;(source:Araport11)
AT1G66710	pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT4G00356	Encodes a defensin-like (DEFL) family protein.
AT5G07360	Amidase family protein;(source:Araport11)
AT1G04540	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT4G14920	Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;(source:Araport11)
AT1G51230	Plant self-incompatibility protein S1 family;(source:Araport11)
AT5G48860	hypothetical protein;(source:Araport11)
AT2G47640	Small nuclear ribonucleoprotein family protein;(source:Araport11)
AT3G55790	transmembrane protein;(source:Araport11)
AT1G06923	transcription repressor OFP17-like protein;(source:Araport11)
AT5G51380	RNI-like superfamily protein;(source:Araport11)
AT3G09060	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT4G01780	XH/XS domain-containing protein;(source:Araport11)
AT5G10120	Ethylene insensitive 3 family protein;(source:Araport11)
AT4G23760	Cox19-like CHCH family protein;(source:Araport11)
AT5G46930	pectin methylesterase inhibitor
AT4G23740	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G03580	F-box family protein-like protein;(source:Araport11)
AT5G53940	Yippee family putative zinc-binding protein;(source:Araport11)
AT1G32172	other_RNA;(source:Araport11)
AT3G15710	Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11)
AT5G25270	Ubiquitin-like superfamily protein;(source:Araport11)
AT3G32475	transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10)
AT3G21970	cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11)
AT4G11000	Ankyrin repeat family protein;(source:Araport11)
AT1G01500	Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11)
AT1G26930	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT4G22980	molybdenum cofactor sulfurase-like protein;(source:Araport11)
AT1G56553	Encodes a defensin-like (DEFL) family protein.
AT1G66310	F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11)
AT2G07811	pseudogene of mitochondrial protein
AT1G57690	F-box/RNI-like superfamily protein;(source:Araport11)
AT4G32915	glutamyl-tRNA(Gln) amidotransferase subunit C;(source:Araport11)
AT3G29330	zinc finger RNA-binding-like protein;(source:Araport11)
AT4G15740	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT2G40020	Nucleolar histone methyltransferase-related protein;(source:Araport11)
AT3G04960	trichohyalin, putative (DUF3444);(source:Araport11)
AT3G16840	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G30780	F-box associated ubiquitination effector family protein;(source:Araport11)
AT3G43955	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G30910	Molybdenum cofactor sulfurase family protein;(source:Araport11)
AT3G50340	hypothetical protein;(source:Araport11)
AT2G17000	Mechanosensitive ion channel family protein;(source:Araport11)
AT2G30940	Protein kinase superfamily protein;(source:Araport11)
AT3G49050	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT3G20340	Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress.
AT4G06646	transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1081_B12.13, blastp match of 33%25 identity and 9.8e-51 P-value to GP\|27817864\|dbj\|BAC55632.1\|\|AP003865 OJ1081_B12.13 {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT2G04100	MATE efflux family protein;(source:Araport11)
AT2G01790	TRAF-like family protein;(source:Araport11)
AT4G11630	Ribosomal protein L19 family protein;(source:Araport11)
AT3G47580	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G32160	beta-casein (DUF760);(source:Araport11)
AT5G28285	transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10)
AT5G25920	hypothetical protein;(source:Araport11)
AT5G57890	Glutamine amidotransferase type 1 family protein;(source:Araport11)
AT2G16930	Ribosomal protein L27 family protein;(source:Araport11)
AT3G14240	Subtilase family protein;(source:Araport11)
AT3G48650	pseudogene of pectinesterase;(source:Araport11)
AT5G66800	membrane-associated kinase regulator-like protein;(source:Araport11)
AT1G11593	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT1G45760	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-37 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT4G11790	Pleckstrin homology (PH) domain superfamily protein;(source:Araport11)
AT5G24260	prolyl oligopeptidase family protein;(source:Araport11)
AT5G57210	Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT1G27350	Ribosome associated membrane protein RAMP4;(source:Araport11)
AT1G13480	hypothetical protein (DUF1262);(source:Araport11)
AT4G17590	NOL1/NOP2/sun family protein;(source:Araport11)
AT5G39850	Ribosomal protein S4;(source:Araport11)
AT3G60780	hypothetical protein (DUF1442);(source:Araport11)
AT3G29580	MATH domain/coiled-coil protein;(source:Araport11)
AT5G56350	Pyruvate kinase family protein;(source:Araport11)
AT1G62421	hypothetical protein;(source:Araport11)
AT5G60570	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT3G24530	AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11)
AT5G26731	hypothetical protein;(source:Araport11)
AT4G14780	Protein kinase superfamily protein;(source:Araport11)
AT1G74870	RING/U-box superfamily protein;(source:Araport11)
AT4G29090	Ribonuclease H-like superfamily protein;(source:Araport11)
AT5G49110	fanconi anemia group I-like protein;(source:Araport11)
AT1G45242	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT5G05400	LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11)
AT5G37540	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G07840	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi\|2443320\|dbj\|BAA22288.1\| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10)
AT3G03620	MATE efflux family protein;(source:Araport11)
AT1G19030	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G13655.1);(source:TAIR10)
AT5G59740	UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11)
AT3G60110	DNA-binding bromodomain-containing protein;(source:Araport11)
AT4G13230	Late embryogenesis abundant protein (LEA) family protein;(source:Araport11)
AT4G26830	O-Glycosyl hydrolases family 17 protein;(source:Araport11)
AT2G31290	Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11)
AT1G12630	encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
AT3G21965	pseudogene of Receptor-like protein kinase-related family protein;(source:Araport11)
AT5G45000	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT2G39430	Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11)
AT3G19310	PLC-like phosphodiesterases superfamily protein;(source:Araport11)
AT1G21651	zinc ion binding protein;(source:Araport11)
AT5G37840	PADRE protein, up-regulated after infection by S. sclerotiorum.
AT1G02990	hypothetical protein;(source:Araport11)
AT1G19860	Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11)
AT5G65440	transmembrane protein;(source:Araport11)
AT3G19370	filament-like protein (DUF869);(source:Araport11)
AT3G22750	Protein kinase superfamily protein;(source:Araport11)
AT1G13380	sodium/hydrogen exchanger (DUF1218);(source:Araport11)
AT3G10760	Homeodomain-like superfamily protein;(source:Araport11)
AT2G23870	pseudogene of Terpenoid cyclases family protein;(source:Araport11)
AT3G24840	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT2G24880	Plant self-incompatibility protein S1 family;(source:Araport11)
AT4G23000	Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11)
AT3G60370	Encodes an immunophilin, FKBP20-2, that belongs to the FK-506 binding protein (FKBP) subfamily functioning as peptidyl-prolyl isomerases (PPIases) in protein folding. FKBP20-2 has a unique pair of cysteines at the C terminus and was found to be reduced by thioredoxin (Trx) (itself reduced by NADPH by means of NADP-Trx reductase). The FKBP20-2 protein, which contains only two of the five amino acids required for catalysis, showed a low level of PPIase activity that was unaffected on reduction by Trx. Genetic disruption of the FKBP20-2 gene provide evidence that FKBP20-2 participates specifically in the accumulation of the PSII supercomplex in the chloroplast thylakoid lumen by means of a mechanism that has yet to be determined.
AT5G06265	hyaluronan mediated motility receptor-like protein;(source:Araport11)
AT3G01880	vacuolar sorting-associated protein (DUF946);(source:Araport11)
AT5G40290	HD domain-containing metal-dependent phosphohydrolase family protein;(source:Araport11)
AT2G46000	LDL receptor wingless signaling/trafficking chaperone;(source:Araport11)
AT1G15790	mediator of RNA polymerase II transcription subunit 15a-like protein;(source:Araport11)
AT5G44660	hypothetical protein;(source:Araport11)
AT5G38810	F-box and associated interaction domains-containing protein;(source:Araport11)
AT5G38570	F-box/RNI-like superfamily protein;(source:Araport11)
AT3G33055	transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10)
AT2G04135	transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33303.1);(source:TAIR10)
AT3G09010	Protein kinase superfamily protein;(source:Araport11)
AT1G54460	TPX2 (targeting protein for Xklp2) protein family;(source:Araport11)
AT4G13495	other_RNA;(source:Araport11)
AT3G48209	Encodes a Plant thionin family protein
AT4G35785	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G25800	Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11)
AT1G03740	Protein kinase superfamily protein;(source:Araport11)
AT2G21850	Cysteine/Histidine-rich C1 domain family protein;(source:Araport11)
AT2G35410	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT5G62760	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G30340	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10)
AT1G33817	transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-100 P-value blast match to gb\|AAO73521.1\| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10)
AT3G17230	plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT2G19160	Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11)
AT5G14030	translocon-associated protein beta (TRAPB) family protein;(source:Araport11)
AT2G42480	MATH domain/coiled-coil protein;(source:Araport11)
AT3G52120	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / D111/G-patch domain-containing protein;(source:Araport11)
AT4G30490	AFG1-like ATPase family protein;(source:Araport11)
AT2G44770	ELMO/CED-12 family protein;(source:Araport11)
AT4G05510	transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.0e-144 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10)
AT1G27990	transmembrane protein;(source:Araport11)
AT4G03230	G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11)
AT5G03660	transcriptional activator (DUF662);(source:Araport11)
AT5G55132	Encodes a defensin-like (DEFL) family protein.
AT4G16810	VEFS-Box of polycomb protein;(source:Araport11)
AT3G10595	Duplicated homeodomain-like superfamily protein;(source:Araport11)
AT1G06135	transmembrane protein;(source:Araport11)
AT5G65925	hypothetical protein;(source:Araport11)
AT5G47300	F-box and associated interaction domains-containing protein;(source:Araport11)
AT2G27770	DUF868 family protein (DUF868);(source:Araport11)
AT3G09760	RING/U-box superfamily protein;(source:Araport11)
AT1G51890	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G75510	Transcription initiation factor IIF, beta subunit;(source:Araport11)
AT5G14020	Endosomal targeting BRO1-like domain-containing protein;(source:Araport11)
AT3G13525	snoRNA;(source:Araport11)
AT3G29140	hypothetical protein;(source:Araport11)
AT3G05050	Protein kinase superfamily protein;(source:Araport11)
AT1G28900	pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10)
AT3G09330	Transmembrane amino acid transporter family protein;(source:Araport11)
AT3G06000	RNI-like superfamily protein;(source:Araport11)
AT2G32030	Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT1G10090	Early-responsive to dehydration stress protein (ERD4);(source:Araport11)
AT1G15890	Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11)
AT2G11150	pseudogene of putative replication protein A1
AT2G11910	hypothetical protein;(source:Araport11)
AT2G17610	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.6e-21 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10)
AT4G14819	hypothetical protein (DUF1677);(source:Araport11)
AT5G41420	This gene encodes a small protein and has either evidence of transcription or purifying selection.
AT4G05500	pseudogene of RNI-like superfamily protein;(source:Araport11)
AT3G51690	DNA helicase homolog PIF1.
AT2G12462	sterile alpha motif (SAM) domain protein;(source:Araport11)
AT5G45510	Leucine-rich repeat (LRR) family protein;(source:Araport11)
AT5G64250	Aldolase-type TIM barrel family protein;(source:Araport11)
AT1G49730	Protein kinase superfamily protein;(source:Araport11)
AT3G07890	Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT4G28360	Ribosomal protein L22p/L17e family protein;(source:Araport11)
AT3G49130	SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11)
AT5G36080	Myb/SANT-like DNA-binding domain protein;(source:Araport11)
AT1G36445	transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBa0026J14.30, blastp match of 62%25 identity and 5.5e-108 P-value to GP\|20146463\|dbj\|BAB89243.1\|\|AP004231 OSJNBa0026J14.30 {Oryza sativa (japonica cultivar-group)};(source:TAIR10)
AT2G26100	Galactosyltransferase family protein;(source:Araport11)
AT5G36260	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT4G25570	Encodes cytochrome b561.
AT4G33890	Component of SAGA complex, SPT module subunit, interacts with HAG1.
AT5G67410	transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11)
AT2G24530	Member of SAGA complex, SPT modulu subunit, interacts with HAG1.
AT1G27930	Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3.
AT5G06950	Transcription factor of the B-ZIP family that has high affinity for C-box motifs. Interacts with NPR1 and may regulate PR gene expression. Phosphorylated by a CK2-like protein in vitro. Phosphorylation is enhanced by salicylic acid treatment.
AT5G21170	Encodes AKINbeta1, a subunit of the SnRK1 kinase (Sucrose non-fermenting-1-related protein kinase). Involved in regulation of nitrogen and sugar metabolism. As part of the regulatory subunit, it binds maltose which promotes kinase activity. Acts as a global regulator of genes involved in carbon, lipid and nitrogen metabolism.
AT4G32660	Encodes protein kinase AME3.
AT4G03070	Encodes a possible 2-oxoglutarate-dependent dioxygenase that is involved in glucosinolate biosynthesis. The gene is expressed in all ecotypes examined but the enzymatic activity has not been determined experimentally. In Col, there is one copy of this gene (aka AOP1.1) but Ler contains two copies, AOP1.1 and a tightly linked AOP1.2.
AT2G30020	Encodes AP2C1. Belongs to the clade B of the PP2C-superfamily. Acts as a MAPK phosphatase that negatively regulates MPK4 and MPK6.
AT1G49050	Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds.
AT1G01020	ARV1 family protein;(source:Araport11)
AT2G30130	Overexpression/activation tagged allele has epinastic leaves, reduced apical dominance and is sterile. Gene is similar to asymmetric leaves (AS)/lateral organ boundary (LOB) genes which repress KNOX gene expression.
AT1G24140	Expression induced by fungal and bacterial pathogens.
AT4G38250	Transmembrane amino acid transporter family protein;(source:Araport11)
AT3G29590	At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis.
AT5G08790	induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain.
AT4G15415	B' regulatory subunit of PP2A (AtB'gamma)
AT1G01980	Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs).
AT1G30720	FAD-binding Berberine family protein;(source:Araport11)
AT1G30730	FAD-binding Berberine family protein;(source:Araport11)
AT1G30740	FAD-binding Berberine family protein;(source:Araport11)
AT4G20800	FAD-binding Berberine family protein;(source:Araport11)
AT4G20820	FAD-binding Berberine family protein;(source:Araport11)
AT1G26390	FAD-binding Berberine family protein;(source:Araport11)
AT1G26410	FAD-binding Berberine family protein;(source:Araport11)
AT1G26420	FAD-binding Berberine family protein;(source:Araport11)
AT1G30700	FAD-binding Berberine family protein;(source:Araport11)
AT5G65780	Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile.
AT3G13790	Encodes a protein with invertase activity.
AT1G61660	Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation.
AT4G33720	CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11)
AT4G01610	Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture.
AT3G58580	Encodes a protein that is involved in mRNA processing and localized to cytoplasmic p-bodies. Double mutants with CCR4a show decreased sensitivity to high concentrations of sucrose. Involved in starch and sucrose metabolism.
AT3G06010	Encodes AtCHR12, a SNF2/Brahma-type chromatin-remodeling protein. AtCHR12 mediates temporary growth arrest in Arabidopsis upon perceiving environmental stress.
AT2G28180	member of Putative Na+/H+ antiporter family
AT5G56340	RING/U-box superfamily protein;(source:Araport11)
AT2G44350	encodes a mitochrondrion targeted citrate synthase, the first enzyme of the tricarboxylic acid cycle, catalyzing the condensation of acetyl-CoA and oxaloacetate, finally yielding citrate and CoA.
AT5G03760	encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root.
AT2G24630	encodes a XyG glucan synthase; gene similar to cellulose synthase
AT2G25900	Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile.
AT5G10310	Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis.
AT1G22810	encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity.
AT5G48460	Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles.
AT3G11730	Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein.
AT3G51800	putative nuclear DNA-binding protein G2p (AtG2) mRNA,
AT5G48400	member of Putative ligand-gated ion channel subunit family
AT4G24990	geranylgeranylated protein ATGP4
AT4G37900	Protein of unknown function that contains DUF1399 domain and putative RNA binding motif. Expressed in many plant tissues and is involved in many aspects of plant growth and development as well as response to salt stress.
AT1G48605	Encodes a protein similar to yeast HAL3, which regulates the cell cycle and tolerance to salt stress through inhibition of the PPZ1 type-1 protein phosphatase. AtHAL3b mRNA levels are induced by salt stress. HAL3B presumably encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis as indicated by functional complementation of a double mutant hal3 aaBb.
AT4G03520	Encodes a redox activated co-chaperone, chloroplast localized thioredoxin, similar to prokaryotic types.
AT1G34360	translation initiation factor 3 (IF-3) family protein;(source:Araport11)
AT1G28210	DnaJ homolog AtJ1 (atj)
AT5G57160	Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4.
AT5G55460	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT2G01910	Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile.
AT4G29170	A homolog of yeast, mouse and human mnd1delta protein. Null mutants exhibit normal vegetative and flower development; however, during prophase I, chromosomes become fragmented resulting in random distribution of the fragments between polyads. Both male and female meiosis are defective and strong accumulation of AtRAD51 was observed in the inflorescence nuclei of mutant plants. Similarly to its yeast and animal homologues, AtMnd1 might play a role in DSB repair during meiosis.
AT4G24970	MORC7 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC4, it appears to repress the expression of genes involved in defense against pathogens.
AT3G27560	encodes a protein with kinase domains, including catalytic domains for serine/threonine as well as tyrosine kinases. a member of multi-gene family and is expressed in all tissues examined.
AT5G26770	NEAP2 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure.
AT5G62720	Integral membrane HPP family protein. Putative nitrate transporter.
AT2G31450	DNA glycosylase superfamily protein;(source:Araport11)
AT1G15700	One of two genes that encode the gamma subunit of Arabidopsis chloroplast ATP synthase. It is thought to be involved in the regulation of the ATP synthase activity.
AT1G35537	Encodes a defensin-like peptide with antifungal activity.
AT3G47380	Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease.
AT5G46960	Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. Closely related paralog of AT5G46950 (InvINH2).
AT3G14300	pectinesterase family protein;(source:Araport11)
AT2G43050	Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11)
AT5G21280	Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses.
AT4G25090	Riboflavin synthase-like superfamily protein;(source:Araport11)
AT2G23310	Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B.
AT1G08600	The Arabidopsis ATRX harbours a N-terminal ADD domain and a C-terminal helicase domain and is devoid of the large central region involved in DAXX interaction in mammals. Arabidopsis ATRX mutant alleles are viable, but with reduced fertility. Their combination with mutants for the H3.3 chaperone HIRA impairs plant survival. ATRX loss affects cellular histone H3.3 pools and modulates the H3.1/H3.3 balance. Notably, at a genome-wide scale, loss of ATRX leads to a reduced H3.3 level at genes characterized by elevated H3.3 occupancy and high expression, including the 45S ribosomal DNA (45S rDNA) loci. Indeed, expression of specific 45S rDNA sequence variants is altered by ATRX loss (DOI:10.1105/tpc.16.00877)
AT1G32200	Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol.
AT3G20920	Encodes an endoplasmic reticulum localized protein with similarity to yeast Sec62p. Mutants display growth defects and significantly reduced fertility. AtSec62 does not complement the thermosensitive phenotype of yeast Sec62 mutants.
AT3G01720	peptidyl serine alpha-galactosyltransferase;(source:Araport11)
AT1G29060	Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions.
AT1G32270	member of SYP2 Gene Family
AT3G18370	C2 domain-containing protein;(source:Araport11)
AT5G51460	homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases
AT3G54860	Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis.
AT4G12490	Encodes a member of the AZI family of lipid transfer proteins. Contains a PRR domain that appears to be required for localization to the chloroplast.
AT5G44380	FAD-binding Berberine family protein;(source:Araport11)
AT5G24240	Encodes PI4Kc3, localizes to the nucleus and has autophosphorylation activity, but no lipid kinase activity. Overexpression mutants display late-flowering phenotype.
AT4G21390	S-locus lectin protein kinase family protein;(source:Araport11)
AT4G21430	protein B160;(source:Araport11)
AT1G79900	encodes a mitochondrial ornithine transporter that exports ornithine from the mitochondria to the cytosol
AT3G59660	Encodes a C2-GRAM domain-containing protein that is induced by B. cinerea infection. It is required for cleavage of BAG6 and thus plays a role in mediating resistance to fungal infection.
AT4G32460	BDX is a DUF642 cell wall protein primarily expressed in vascular tissues of roots, leaves and embryos. Mutants show defects in seed and embryo development.
AT5G51780	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT1G03040	Governs the competence of pericycle cells to initiate lateral root primordium formation.
AT2G42300	Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation.
AT5G43650	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT1G71870	Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization.
AT3G57090	Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division.
AT5G42020	Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm nuclei.
AT4G37390	Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity.
AT3G11480	The gene encodes a SABATH methyltransferase that methylates both salicylic acid and benzoic acid. It is highly expressed in flowers, induced by biotic and abiotic stress and thought to be involved in direct defense mechanism.
AT2G40950	bZIP17 appears to regulate transcription as part of a salt and osmotic stress response. zip17 mutants show enhanced inhibition of primary root elongation in response to NaCl. Several salt-responsive genes, such as ATHB-7 show a reduced transcriptional response to a salt treatment in zip17 mutant seedlings. myc:bZIP17 undergoes proteolytic processing in salt-treated wild type seedlings, but not in s1p-3 (subtilase) mutants and there is also evidence for S1P-mediated cleavage of bZIP17 in vitro. In addition, an mGFP:bZIP17 protein moves from the ER to the nucleus following salt treatment. It is cleaved by S2P to allow translocation to the nucleus.
AT3G10800	Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment. It is cleaved by S2P to allow translocation to the nucleus. The mRNA is cell-to-cell mobile.
AT5G28770	BASIC LEUCINE ZIPPER protein which regulates the circadian oscillator gene PSEUDO RESPONSE REGULATOR7 (PRR7) to change the circadian phase in response to sugars. It upregulates PRR7 in response to low energy. bZIP63 and PRR7 are required for correct oscillator phase under light/dark cycles. bZIP protein BZO2H3 mRNA, partial cds
AT2G24300	Calmodulin-binding protein;(source:Araport11)
AT4G31000	Calmodulin-binding protein;(source:Araport11)
AT4G25370	Double Clp-N motif protein;(source:Araport11)
AT4G12060	Double Clp-N motif protein;(source:Araport11)
AT2G45770	chloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids.
AT5G08650	Critical for chloroplast protein synthesis under suboptimal conditions. Essential translation factor that promotes the efficiency of chloroplast protein synthesis.
AT2G04530	Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast.
AT2G04030	Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response and crucial for protein import into the chloroplast stroma. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR.
AT1G17760	Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex.
AT1G45180	RING/U-box superfamily protein;(source:Araport11)
AT4G31450	RING/U-box superfamily protein;(source:Araport11)
AT4G00070	RING/U-box superfamily protein;(source:Araport11)
AT1G17970	RING/U-box superfamily protein;(source:Araport11)
AT5G52140	RING/U-box superfamily protein;(source:Araport11)
AT3G27240	Cytochrome C1 family;(source:Araport11)
AT2G40140	zinc finger (CCCH-type) family protein;(source:Araport11)
AT5G54290	Encodes CcdA, a thylakoid membrane protein required for the transfer of reducing equivalents from stroma to thylakoid lumen.
AT4G27120	ER-resident adaptor protein. Part of complex with C53 and UFL1, the E3 ligase that mediates ufmylation. Involved in the pathway that links ribosome-associated quality control with selective autophagy at the ER.
AT4G04930	Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues.
AT3G54600	Class I glutamine amidotransferase-like superfamily protein;(source:Araport11)
AT3G01420	Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile.
AT2G21550	One of three DRTS genes, this is the most divergent one.THY3/DRTS3 is preferentially expressed in the shoot apex, stipules and root caps.
AT1G47530	MATE efflux family protein;(source:Araport11)
AT1G69890	Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response.
AT3G55410	Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase.
AT1G18100	Encodes a member of the FT and TFL1 family of phosphatidylethanolamine-binding proteins. It is expressed in seeds and up-regulated in response to ABA. Loss of function mutants show decreased rate of germination in the presence of ABA. ABA dependent regulation is mediated by both ABI3 and ABI5. ABI5 promotes MFT expression, primarily in the radicle-hypocotyl transition zone and ABI3 suppresses it in the seed.
AT1G07940	GTP binding Elongation factor Tu family protein;(source:Araport11)
AT2G32580	transmembrane protein, putative (DUF1068);(source:Araport11)
AT1G56050	GTP-binding protein-like protein;(source:Araport11)
AT1G34470	magnesium transporter, putative (DUF803);(source:Araport11)
AT4G23170	Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. The mRNA is cell-to-cell mobile.
AT4G32620	Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing.
AT3G05210	encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10.
AT1G19210	encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
AT5G61890	encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
AT2G32170	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G13610	Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile.
AT4G13050	Acyl-ACP thioesterase;(source:Araport11)
AT1G12130	Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates.
AT3G52750	Nuclear gene that encodes a plastidial division protein (FtsZ2-2). FtsZ2-2 is involved in chloroplast morphology and internal organisation in addition to participating in chloroplast partition
AT5G13480	Encodes a protein with similarity to yeast Pfs2p, an mRNA processing factor. Involved in regulation of flowering time; affects FCA mRNA processing. Homozygous mutants are late flowering, null alleles are embryo lethal.
AT3G06580	Encodes a protein with galactose kinase activity. The gene was shown to complement the yeast Agal1 mutant defective in the galactokinase gene GAL1.
AT1G27120	Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase.
AT5G62620	Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced seed coat mucilage and accelerated leaf senescence.
AT1G29670	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile.
AT1G17890	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G14960	encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin.
AT5G67540	Arabinanase/levansucrase/invertase;(source:Araport11)
AT3G11600	One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations.
AT1G08750	GPI8/PIG-K homolog involved in stomata development. Loss of function alleles do not transmit through the pollen.
AT4G12790	GPN GTPase involved in selective nuclear import of RNA polymerase II.
AT3G60210	GroES-like family protein;(source:Araport11)
AT1G28480	Encodes GRX480, a member of the glutaredoxin family that regulates protein redox state. GRX480 interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. GRX480 transcription is SA-inducible and requires NPR1. Maybe involved in SA/JA cross-talk. It has also been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity.
AT3G14130	Aldolase-type TIM barrel family protein;(source:Araport11)
AT5G47370	homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis.
AT4G37790	Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile.
AT2G22800	Encodes homeobox protein HAT9.
AT1G09940	Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins
AT3G55350	PIF / Ping-Pong family of plant transposase;(source:Araport11)
AT5G24580	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT4G08570	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G55650	HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11)
AT5G49760	Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species.
AT3G45980	Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases as well as the UBC1 and UBC2 E2 ubiquitin conjugating enzymes. Lysine 146 appears to be the site of the ubiquitin addition.
AT1G75600	Histone superfamily protein;(source:Araport11)
AT5G02490	Heat shock protein 70 (Hsp 70) family protein;(source:Araport11)
AT2G23430	Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1.
AT3G24810	Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization.
AT1G49620	Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle.
AT5G05300	IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens.
AT5G58100	Encodes a membrane protein involved in pollen nexine and sexine development.
AT1G56460	HIT zinc finger and PAPA-1-like domain-containing protein;(source:Araport11)
AT4G22220	Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein.
AT1G32130	The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression.
AT3G44110	homologous to the co-chaperon DNAJ protein from E coli
AT1G11950	Transcription factor jumonji (jmjC) domain-containing protein;(source:Araport11)
AT1G62310	Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3.
AT1G23760	Encodes aromatic rich glycoprotein JP630.
AT3G50240	Encodes a kinesin-related protein.
AT5G15960	cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level.
AT1G55460	DNA/RNA-binding protein Kin17, conserved region;(source:Araport11)
AT3G23670	Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast.
AT2G28060	Component of the regulatory subunit of SNF1-related protein kinase. As part of the regulatory complex it binds maltose which promotes kinase activity.
AT4G16850	6-transmembrane (6TM) protein that underlies a QTL for petal size with increased expression correlating to increased petal size.
AT1G48050	Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. Binds double stranded DNA breaks as a heterodimer with Ku70, involved in non-homologous end joining repair. Mutants are defective in T-DNA integration. Over expression confers increased resistance to DNA damage agents and increased susceptibility to T-DNA transformation.
AT3G24750	Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root
AT3G20270	Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression.
AT1G24170	Encodes a protein with putative galacturonosyltransferase activity.
AT4G15093	catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11)
AT1G25570	Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11)
AT3G22400	Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem.
AT1G09970	RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile.
AT3G52200	Encodes a dihydrolipoamide S-acetyltransferase, a subunit of the mitochondrial pyruvate dehydrogenase complex.
AT1G18680	HNH endonuclease domain-containing protein;(source:Araport11)
AT1G18160	required for ABA- and osmotic-stress-MAP3 kinase required for activation of SnRK2 kinases, enabling robust ABA and osmotic stress signal transduction.
AT5G14980	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G19290	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G39410	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G39420	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT2G47630	alpha/beta-Hydrolases superfamily protein;(source:Araport11)
AT5G41910	Mediator complex, subunit Med10;(source:Araport11)
AT3G21350	RNA polymerase transcriptional regulation mediator-like protein;(source:Araport11)
AT1G48950	C3HC zinc finger-like protein;(source:Araport11)
AT1G23360	Encodes a 2-phytyl-1,4-naphthoquinone methyltransferase that catalyzes the final step in phylloquinone (vitamin K1) biosynthesis.
AT1G74440	Similar to MPH1, can complement mph1-1 salt sensitivity phenotype.
AT1G78830	In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance.
AT5G26340	Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD.
AT1G62010	Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G56380	Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G62490	Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G21150	mTERF protein involved in mitochondrial development; required for salt tolerance.
AT1G61960	Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G61980	Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G62110	Mitochondrial transcription termination factor family protein;(source:Araport11)
AT1G62120	Mitochondrial transcription termination factor family protein;(source:Araport11)
AT3G58060	TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.)
AT3G24570	contributes to osmotic stress tolerance
AT5G08520	Duplicated homeodomain-like superfamily protein;(source:Araport11)
AT5G06560	myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11)
AT2G22770	Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica.
AT3G15950	Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies.
AT5G02290	Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl.
AT4G09320	nucleoside diphosphate kinase type 1 (NDPK1) gene, complete The mRNA is cell-to-cell mobile.
AT5G13950	nuclear factor kappa-B-binding protein;(source:Araport11)
AT3G20610	non-race specific disease resistance protein;(source:Araport11)
AT3G54200	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT5G41835	transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-43 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10)
AT1G10300	GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1.
AT5G18420	CCR4-NOT transcription complex subunit;(source:Araport11)
AT5G18230	transcription regulator NOT2/NOT3/NOT5 family protein;(source:Araport11)
AT5G60170	E3 ligase involved in regulation of chloroplast protein synthesis through activity of PGR3.
AT2G28540	RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT3G45710	Encodes a chloride permeable transporter. Modulates chloride efflux from roots.
AT1G22550	Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots.
AT2G38100	Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos.
AT3G26490	Phototropic-responsive NPH3 family protein;(source:Araport11)
AT4G18790	member of Nramp2 family
AT1G11475	Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10.
AT5G41010	Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12.
AT4G21710	Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit.
AT2G15430	Non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, encoded by At2g15400, can substitute for At2g15430 in the context of Pol V.
AT5G09920	Non-catalytic subunit specific to DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB4)
AT3G22900	Non-catalytic subunit specific to DNA-directed RNA polymerase IV; homologous to budding yeast RPB7
AT3G57080	Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB5.
AT4G17300	Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis.
AT3G20760	Nse4, component of Smc5/6 DNA repair complex;(source:Araport11)
AT5G60980	Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11)
AT1G05500	Encodes a endomembrane-localized synaptotagmin. Synaptotagmin family proteins are calcium sensors that regulate exocytosis in mammalian cells.
AT3G61050	Encodes a novel transcriptional regulator, a calcium-dependent lipid-binding protein containing a C2 domain, that binds specifically to the promoter of THAS1 (thalianol synthase 1). It can bind ceramide and is involved in drought and salt tolerance.
AT1G53590	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT2G40520	Nucleotidyltransferase family protein;(source:Araport11)
AT3G51620	PAP/OAS1 substrate-binding domain superfamily;(source:Araport11)
AT1G07640	A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division.
AT1G76405	outer envelope pore 21B-like protein;(source:Araport11)
AT1G32090	early-responsive to dehydration stress protein (ERD4);(source:Araport11)
AT1G65080	Structurally distinct member of Oxa1 superfamily , has tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2b.Involved in maturation of mitochondrial cytochrome c.
AT3G44370	Member of the Oxa1 super family protein insertases.It is structurally distinct having a tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2a. Involved in biogenesis of mitochondrial respiratory chain complex IV, specifically via membrane insertion of COX2.
AT5G61880	Encodes PAM16L, a paralog of PAM16 (AT3G59280).
AT1G30690	Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11)
AT3G51670	PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells.
AT3G18940	clast3-like protein;(source:Araport11)
AT5G14710	proteasome assembly chaperone-like protein;(source:Araport11)
AT5G35580	Protein kinase superfamily protein;(source:Araport11)
AT1G76360	Protein kinase superfamily protein;(source:Araport11)
AT4G32730	Encodes a putative c-myb-like transcription factor with three MYB repeats.
AT2G02120	Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. Mediates ammonium metabolism by regulatingglutamine synthetase activity.
AT5G38710	Methylenetetrahydrofolate reductase family protein;(source:Araport11)
AT5G47690	One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis.
AT2G36560	A paternally expressed imprinted gene.
AT2G39550	encodes the beta subunit of geranylgeranyl transferase (GGT-IB), involved in both ABA-mediated and auxin signaling pathways.
AT4G14450	A member of a small family of proline/serine rich proteins of unknown function. It interacts with defense related MAP kinase MPK6. It's expression is induced by PAMP elicitors. May play a role in response to pathogens.
AT1G04330	A proline/serine rich protein of unknown function. It interacts with defense related MAP kinase MPK6 and others. May be involved in signaling during defense or stress response.
AT1G43770	PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription.
AT5G61120	PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription.
AT5G49000	F-box protein, part of SCF complex.
AT4G11810	Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes.
AT4G22990	Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes.
AT5G10410	ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT5G65370	ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT5G35200	ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT2G25430	AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis.
AT1G33340	ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT1G10900	Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11)
AT1G08620	Member of family of Jumonji C (JmjC)-containing demethylases, its catalytic domain exhibits both H3K4 and H3K9 demethylation activities. Together with MMD1 promotes in male meiocytes gene expression in an H3K9me3-dependent manner and thereby contributes to meiotic chromosome condensation.
AT1G61850	Encodes a non-specific lipase that hydrolyzes phospholipids as well as galactolipids, at both sn-1 and sn-2 positions. Involved in basal jasmonic acid biosynthesis by releasing the precursor fatty acid from membrane lipids. Mutant plants were impacted in resistance to fungus B. cinerea.
AT3G17340	Ran effector.
AT1G21000	PLATZ transcription factor family protein;(source:Araport11)
AT4G17900	PLATZ transcription factor family protein;(source:Araport11)
AT3G27400	Encodes a pectate lyase involved in response to nematodes.
AT4G24780	Encodes a pectate lyase involved in response to nematodes.
AT5G11560	catalytics;(source:Araport11)
AT1G33612	Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8).
AT1G76140	Putative prolyl oligopeptidase.
AT3G26020	Encodes protein phosphatase 2A (PP2A) B'eta subunit. Targeted to nucleus and cytosol.
AT4G01690	Encodes protoporphyrinogen oxidase (PPOX).
AT1G76950	Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11)
AT5G52800	primase/polymerase protein
AT5G44565	transmembrane protein;(source:Araport11)
AT5G44580	transmembrane protein;(source:Araport11)
AT5G44572	transmembrane protein;(source:Araport11)
AT5G44575	hypothetical protein;(source:Araport11)
AT2G22420	Encodes a cell wall-localized class III peroxidase that is directly regulated by the MADS-box transcription factor AGL15 and is involved in lignified tissue formation.
AT5G64100	Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination.
AT4G21960	Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile.
AT5G01830	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G67340	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G37490	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G65920	Plant U-box type E3 ubiquitin ligase (PUB).
AT4G25160	Encodes a U-box domain-containing E3 ubiquitin ligase with central Ser/Thr protein kinase domain whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots.
AT1G68940	Plant U-box type E3 ubiquitin ligase (PUB).
AT4G36550	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G65500	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G61560	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G61550	U-box domain-containing protein kinase family protein;(source:Araport11)
AT5G51270	Plant U-box type E3 ubiquitin ligase (PUB).
AT1G01660	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G18560	Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression.
AT3G09260	Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica.
AT2G05635	DEAD helicase
AT3G05480	Involved in the regulation of DNA damage repair and homologous recombination.
AT1G70200	Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing.
AT5G57720	AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT5G41170	Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11)
AT4G33040	Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2.
AT5G61000	Replication factor-A protein 1-like protein;(source:Araport11)
AT1G15250	cytosolic ribosomal protein gene, part of eL20 family
AT2G01250	Cytosolic ribosomal 60S subunit protein.
AT4G29390	Ribosomal protein S30 family protein;(source:Araport11)
AT3G02250	O-fucosyltransferase family protein;(source:Araport11)
AT2G28620	Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement.
AT2G25420	WD40 domain protein which interacts with ROS1 in the base excision repair pathway through DNA methylation.
AT5G62460	RZFP is a zinc finger protein involved in mediating abiotic stress tolerance.
AT4G35740	Encodes RECQ3, an ATP-dependent helicase.
AT5G09460	transcription factor bHLH143;(source:Araport11)
AT5G63980	Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration and increased levels of 3'-phosphoadenosine 5'-phosphate (PAP). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity. Its activity is sensitive to the redox state of its environment, decreasing under oxidative conditions and is regulated by dimerization and intra and inter-molecular disulfide bond formation.
AT2G47820	arginine-glutamic acid dipeptide repeat protein;(source:Araport11)
AT1G32940	Subtilase family protein;(source:Araport11)
AT5G59810	Subtilase family protein;(source:Araport11)
AT5G51340	SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage.
AT4G12120	member of KEULE Gene Family
AT4G14870	Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. The mRNA is cell-to-cell mobile.
AT3G48900	Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria.
AT1G47710	Serine protease inhibitor (SERPIN) family protein;(source:Araport11)
AT5G27350	Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile.
AT4G23570	Closely related to SGT1B, may function in SCF(TIR1) mediated protein degradation. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. AtSGT1a is induced upon pathogen infection and can function in R gene-mediated resistance.
AT4G11260	Functions in plant disease resistance signaling, SCF(TIR1) mediated degradation of Aux/IAA proteins and HSP90 mediated degradation of R resistance proteins. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance.
AT1G69220	Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion.
AT1G54385	At1G54385 encodes the plant KASH protein SINE1; SINE1 interacts with SUN1 and SUN2, is colocalized with F-actin, and is localized at the nuclear envelope.
AT5G42190	Similar to SKP1 in yeast and humans which are involved in mitotic cell cycle control and ubiquitin mediated proteolysis.
AT2G28870	cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11)
AT5G59360	hypothetical protein;(source:Araport11)
AT5G02420	cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11)
AT5G40460	cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11)
AT1G17600	SOC3 is a TIR-NB-leucine-rich repeat (TNL) protein.Mutants suppress loss of chs2 phenotype of auto-activation of immunity. When the TIR domain of SOC3 interacts with CHS2 the binding results in temperature activation of cell death, the suppressors inhibit this interaction.
AT2G34210	Transcription elongation factor Spt5;(source:Araport11)
AT1G73820	Protein phosphatase which physically interacts with the RRM1 motif of FCA to antagonize FCA binding with COOLAIR, which is critical for PRC2 enrichment and H3K27me3 deposition.
AT5G44568	Secreted peptide which functions in plant growth and pathogen defense.
AT1G22890	Secreted peptide which functions in plant growth and pathogen defense.
AT1G65486	Secreted peptide which functions in plant growth and pathogen defense.
AT1G65490	Secreted peptide which functions in plant growth and pathogen defense.
AT1G65500	Secreted peptide which functions in plant growth and pathogen defense.
AT4G08810	Calcium binding protein involved in cryptochrome and phytochrome coaction
AT5G43990	Encodes SUVR2, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression.
AT1G30020	SVB family gene.
AT4G24130	ABA responsive SVB family gene.
AT3G48740	Encodes a member of the SWEET sucrose efflux transporter family proteins.
AT5G23660	Encodes a member of the SWEET sucrose efflux transporter family proteins.
AT3G14770	Nodulin MtN3 family protein;(source:Araport11)
AT5G53190	Nodulin MtN3 family protein;(source:Araport11)
AT4G10850	Nodulin MtN3 family protein;(source:Araport11)
AT5G40260	Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores.
AT2G39060	Encodes a sucrose transporter that is expressed in nectaries and is involved in nectar secretion.
AT2G14880	SWIB/MDM2 domain superfamily protein;(source:Araport11)
AT3G03590	SWIB/MDM2 domain superfamily protein;(source:Araport11)
AT5G40840	Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair.
AT1G20080	Encodes a synaptotagmin localized on the Golgi apparatus and that regulates protein secretion via the unconventional protein transport from the cytosol to the extracellular matrix in plant cells.
AT5G11100	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT3G19100	Encodes a protein kinase that positively regulates gibberellic acid (GA) signaling by inactivating the E3 ubiquitin ligase GARU. GARU mediates ubiquitin-dependent degradation of GID1s, which are GA receptors.
AT2G20110	Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes.
AT1G24706	Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. Mutations in THO have severe developmental defects and affect the production of several different classes of small RNAs indicating a broader role in small RNA biosynthesis.
AT3G02950	Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis.
AT1G74950	Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators.
AT4G22300	Formerly known as SOBER1, this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. This locus is now known as TIPSY1 and AT4G22305 corresponds to SOBER1.
AT4G12650	Endomembrane protein 70 protein family;(source:Araport11)
AT5G25100	Endomembrane protein 70 protein family;(source:Araport11)
AT1G12930	Ran effector.
AT5G27840	Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580).
AT5G07170	TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity.
AT5G37478	TPX2 (targeting protein for Xklp2) protein family;(source:Araport11)
AT2G17930	Component of the SPT module of the SAGA complex.
AT4G36080	Component of the SPT module of the SAGA complex.
AT5G54750	Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking.
AT4G40000	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT3G50590	WD40/YVTN repeat protein.
AT1G30660	A truncated version of Twinkle that retains only the DNA primase domain.
AT1G14205	Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. Essential for the splicing of the first intron of rps12 in plastid.
AT5G16310	Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1;(source:Araport11)
AT5G26310	UGT72E3 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl alcohol as well as sinapic acid. The enzyme is thought to be involved in lignin- and phenylpropanoid metabolism. A knockdown mutant line (72E3KD) was obtained using RNAi silencing. No reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype, in contrast with the knockdown line constructed for UGT72E2 displayed a twofold reduction in the these phenylpropanoid 4-O-glucosides. Can influence the kinetics of lignin deposition by regulating monolignol flow to the cell wall as well as the potential of this compartment to incorporate monomers into the growing lignin polymer.
AT4G27560	Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation.
AT4G15480	Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity.
AT1G06000	encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols
AT1G33980	Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). Regulates AT1G72910, AT1G72940, and ADR1-LIKE 2 in a temperature dependent manner.
AT4G24060	Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis.
AT3G28710	Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes, which plays an important role in plant growth. VHA-d1 is one of the two subunit isoforms.
AT4G26710	Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes.
AT4G02620	Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes.
AT1G16780	Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves.
AT1G50360	member of Myosin-like proteins
AT5G14510	Armadillo (ARM) repeat containing protein involved in vascular development.
AT4G19003	E2F/DP family winged-helix DNA-binding domain-containing protein;(source:Araport11)
AT5G04920	EAP30/Vps36 family protein;(source:Araport11)
AT1G73030	Encodes an ESCRT-related protein: CHMP1A/AT1G73030; CHMP1B/AT1G17730. CHMP1A and B mediate multivesicular body sorting of auxin carriers and are required for plant development. ESCRT: Endosomal Sorting Complexes Required For Transport machinery; CHMP: Charged Multivesicular Body Protein/Chromatin Modifying Protein.
AT2G22880	VQ motif-containing protein;(source:Araport11)
AT3G14370	The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons.
AT5G65130	encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.
AT1G49160	Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its
AT4G12020	Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002,7(7):301. Co-regulates with DSC1 basal levels of immunity to root-knot nematodes.
AT4G01250	AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence.
AT4G23550	Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile.
AT4G11070	member of WRKY Transcription Factor; Group III
AT4G04450	member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold.
AT4G01720	member of WRKY Transcription Factor; Group II-b
AT4G23810	member of WRKY Transcription Factor; Group III
AT1G58440	Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity.
AT4G33200	member of Myosin-like proteins
AT1G08730	Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes.
AT4G28710	member of Myosin-like proteins The mRNA is cell-to-cell mobile.
AT3G04490	Ran effector. XPO4 coordinates the nuclear accumulation of TOPLESS and TOPLESS-Related transcription corepressors, which plays a role in regulating salicylic acid-mediated defense feedback and modulating the strength of immunity induced by cpr5, a nucleoporin mutant.
AT1G51510	This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm.
AT2G38860	Encodes protease I (pfpI)-like protein YLS5.
AT4G21160	ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT3G53600	Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity.
AT2G45120	C2H2-like zinc finger protein;(source:Araport11)
AT5G38600	Proline-rich spliceosome-associated (PSP) family protein / zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT1G59590	ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile.
AT1G58340	Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress.
AT4G33020	member of Fe(II) transporter isolog family
AT3G57700	Protein kinase superfamily protein;(source:Araport11)
AT3G57640	Protein kinase superfamily protein;(source:Araport11)
AT3G57760	Protein kinase superfamily protein;(source:Araport11)
AT1G58350	Putative serine esterase family protein;(source:Araport11)
AT1G58270	ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile.
AT1G22260	One of two nearly identical proteins (ZYP1b) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility.
AT1G22275	One of two nearly identical proteins (ZYP1a) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility.
AT2G16770	Basic-region leucine zipper (bZIP23) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs.
AT1G44318	Aldolase superfamily protein;(source:Araport11)
AT5G14220	Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development.
AT2G20960	phospholipase-like protein (PEARLI 4) family protein;(source:Araport11)
AT4G31430	Encodes a plant-specific protein that physically interacts with CRWN1 and its homolog CRWN4 and localizes at the inner nuclear membrane. KAKU4 deforms the nuclear envelope in a dose-dependent manner, in association with nuclear membrane invagination and stack formation.
AT1G01480	a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library.
AT4G26200	Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA.
AT4G37770	Encodes an auxin inducible ACC synthase.
AT1G12010	Encodes a protein that appears to have 1-amino-cyclopropane-1-carboxylic acid oxidase activity based on mutant analyses. The mRNA is cell-to-cell mobile.
AT4G08040	encodes an aminotransferase that belongs to ACC synthase gene family structurally
AT3G49700	encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings.
AT4G11280	encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile.
AT2G26420	Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth.
AT1G76690	Encodes one of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Predicted to be a cytosolic protein.
AT1G09780	Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement.
AT3G08590	Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement.
AT3G19010	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT1G13060	Encodes 20S proteasome beta subunit PBE1 (PBE1).
AT2G20580	encoding the RPN subunits of the 26S proteasome The mRNA is cell-to-cell mobile.
AT5G53000	PP2A-associated protein with a possible function in the chilling response
AT4G03415	Encodes a myristoylated 2C-type protein phosphatase that interacts with AGB1 and is localized to the plasma membrane.
AT2G17370	Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds.
AT4G14440	encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation
AT1G01120	Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis.
AT2G26250	epidermis-specific, encodes KCS10, a putative 3-ketoacyl-CoA synthase. probably involved in the synthesis of long-chain lipids found in the cuticle.
AT2G28630	Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT4G34520	Encodes KCS18, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT5G04530	Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT1G07720	Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT1G25450	Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT1G68530	Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids).
AT4G24770	Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Required for editing and stability of specific chloroplast mRNAs.
AT2G26260	Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound.
AT1G65060	encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. mRNA levels are not induced in response to wounding or to fungal infection by P. parasitica. mRNA is expressed in flowers, to a lesser degree in mature leaves and siliques and marginally in seedling roots and bolting stems of mature plants. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, cinnamic acid and 5-OH-ferulic acid. At4CL3 was unable to use sinapic acid as substrate.
AT3G21230	The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo.
AT3G04770	40s ribosomal protein SA B;(source:Araport11)
AT5G41670	6-phosphogluconate dehydrogenase family protein;(source:Araport11)
AT1G13700	Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP).
AT1G01100	Co-orthologous gene of large ribosomal subunit protein RPP1.
AT4G00810	Co-orthologous gene of large ribosomal subunit protein RPP1.
AT5G47700	Co-orthologous gene of large ribosomal subunit protein RPP1.
AT1G04620	Encodes a 7-hydroxymethyl chlorophyll a reductase, an enzyme of the chlorophyll cycle that converts 7-hydroxymethyl chlorophyll a to chlorophyll a.
AT1G21710	Encodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme.
AT1G52340	Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose.
AT4G26080	Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure.
AT3G24650	Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230).
AT2G40220	Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings.
AT5G64750	Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile.
AT4G11890	Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction.
AT4G38480	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT1G55870	Encodes a poly(A)-specific ribonuclease, AtPARN. Expression of AtPARN is upregulated by ABA or stress treatment. Mutant is hypersensitivity to salicylic acid as well as ABA. Functions with AGS1 to regulate the poly(A) status of mitochondrial mRNA.
AT3G18950	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G66070	E3 ubiquitin ligase that functions in negative regulation of ABA signaling.
AT3G56850	Encodes an ABA-responsive element binding protein with a bZIP domain. Located in the nucleus and expressed in the embryo during seed maturation.
AT4G01660	Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant The mRNA is cell-to-cell mobile.
AT4G31390	Protein kinase superfamily protein;(source:Araport11)
AT3G23560	Member of the multidrug and toxic compound extrusion (MATE) family, protects roots from inhibitory compounds.
AT2G38185	RING/U-box superfamily protein;(source:Araport11)
AT3G29575	ABI five binding protein 3;(source:Araport11)
AT3G19290	bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediates ABA-dependent stress responses.ABF4 acts through SnRK2 pathway and binds to ABA response elements of the promoters of NYE1 and regulates their expression to promote chlorophyll degradation.
AT1G67080	Encodes a protein involved in the photoprotection of PSII. An aba4-1 mutant completely lacks neoxanthin,a component of the chromophore of the peripheral antenna system in PSII. ABA4 is required for neoxanthin biosynthesis, an intermediary step in abscisic acid biosynthesis, but no catalytic activity has been detected for the ABA4 protein.
AT1G45249	Leucine zipper transcription factor that binds to the abscisic acid (ABA)?responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment.
AT2G27150	Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis.
AT3G61510	Encodes a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. The gene is transcriptionally active but enzymatically inactive. The predicted amino-acid sequence of ACS1 is missing the highly conserved tripeptide, Thr-Asn-Pro (TNP), between Ile204 and Ser205. Introduction of TNP into ACS1 restores the ACS activity.
AT5G65800	1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition.
AT4G37000	Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae.
AT4G14400	encodes a novel protein with putative ankyrin and transmembrane regions. It is a member of one of the largest uncharacterized gene families in higher plants. The gene is involved in resistance to Pseudomonas syringae.
AT2G23600	Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES2 appears to be involved in MeSA hydrolysis in planta. This protein does not act on MeGA4, or MEGA9 in vitro and has been show to be capable of hydrolyzing methyl ester nicotinate back to nicotinate.
AT1G36160	Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile.
AT5G36880	Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway
AT4G26970	Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile.
AT2G05710	Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. ACO3 is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile.
AT1G76990	ACT domain repeat 3;(source:Araport11)
AT2G36840	Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes.
AT1G16880	Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile.
AT1G49240	Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen.
AT1G01750	actin depolymerizing factor 11;(source:Araport11)
AT3G46000	Encodes depolymerizing factor 2.
AT2G16700	Encodes actin depolymerizing factor 5 (ADF5).
AT4G00680	actin depolymerizing factor 8;(source:Araport11)
AT3G27000	encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. its transcript level is down regulated by light and is expressed in very low levels in all organs examined.
AT1G33560	Encodes a NBS-LRR disease resistance protein that possesses N-terminal kinase subdomains. Activation tagged mutant of ADR1 showed elevated levels of SA and reactive oxygen species in addition to number of defense gene transcripts. Exhibits resistance to number of microbial pathogens.
AT3G12890	Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes.
AT1G55320	Encodes a protein with similarity to acyl activating enzymes. AAE18 is localized to the peroxisome where it may be involved in metabolism of auxin precursors to active auxins.
AT3G16910	Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle.
AT3G02610	Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm.
AT5G16230	Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm.
AT5G27630	Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content.
AT4G16760	Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate.
AT4G24230	acyl-CoA-binding protein ACBP3. Localized extracellularly in transiently expressed tobacco BY-2 cells and onion epidermal cells. Binds arachidonyl-CoA with high affinity. Microarray data shows up-regulation of many biotic- and abiotic-stress-related genes in an ACBP3 OE-1 in comparison to wild type.
AT1G06090	Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation.
AT3G02630	One of seven acyl acyl carrier proteins. Expressed primarily in developing seeds.Involved in fatty acid metabolism. Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD1 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase.
AT3G50860	Clathrin adaptor complex small chain family protein;(source:Araport11)
AT2G19790	Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins.
AT4G24550	Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins.
AT4G01100	Adenine nucleotide transporter. Located in mitochondrion. Expressed in a broad range of tissues, but predominantly in root tips. Loss of function mutants exhibit reduced root growth and respiration.
AT4G12440	adenine phosphoribosyl transferase 4;(source:Araport11)
AT3G57610	encoding adenylosuccinate synthetase (AdSS), the enzyme involved in the first step of the formation of the purine nucleotide AMP (conversion of IMP to adenylo-succinate)
AT4G11940	Encodes a nuclear localized dosage sensitive paternally expressed imprinted gene. It is a member of a family of molecular chaperones called J-domain. Loss of ADM function suppresses seed abortion of triploid embryos and also partially rescues the effect of mea mutations.
AT1G23490	Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct.
AT3G03120	A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins.
AT1G02440	A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins.
AT5G13490	Encodes mitochondrial ADP/ATP carrier
AT4G33300	Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors.
AT4G18960	Floral homeotic gene encoding a MADS domain transcription factor. Specifies floral meristem and carpel and stamen identity. Binds CArG box sequences. It is the only C function gene. It interacts genetically with the other homeotic genes to specify the floral organs.
AT1G22130	Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth.
AT1G71692	Encodes a member of the MADS box family of transcription factors. Involved in root cell differentiation and flowering time. Loss of function mutations have abnormal cellular differentiation in the roots and are late flowering. AGL12 along with AGL14, and AGL17 is preferentially expressed in root tissues and represent the only characterized MADS box genes expressed in roots.
AT3G61120	Encodes AGL13, a member of the AGL6 clade of the MADS-box gene family. Expressed in both pollen and ovules. Functions in male and female gametophyte morphogenesis.
AT5G13790	AGL15 (AGAMOUS-Like 15) is a member of the MADS domain family of regulatory factors. Although AGL15 is preferentially expressed during embryogenesis, AGL15 is also expressed in leaf primordia, shoot apical meristems and young floral buds, suggesting that AGL15 may play a role during post-germinative development. Transgenic plants that ectopically express AGL15 show delays in the transition to flowering, perianth abscission and senescence and fruit and seed maturation. Role in embryogenesis and gibberellic acid catabolism. Targets B3 domain transcription factors that are key regulators of embryogenesis.AGL15 binds the HAE promoter in floral receptacles and represses HAE expression. AGL15 is phosphorylated in a MKK4/5 dependent manner in floral receptacles. Serines 231 and 257 are phosphorylated in floral receptacles. AGL15 also directly regulates the expression of the peroxidase PRX17, linking it to lignified tissue expression.
AT3G57230	MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions.
AT2G45660	Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA.
AT1G65360	Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development.
AT4G24540	Encodes a MADS-box protein involved in flowering. Regulates the expression of SOC1 and is also upregulated by SOC1. Binds with IMK3 kinase domain. Phosphorylated by IMK3; likely to be a target for IMK3 kinase domain.
AT5G26880	Root Specific
AT2G26320	AGAMOUS-like 33;(source:Araport11)
AT5G26630	MADS-box transcription factor family protein;(source:Araport11)
AT5G62165	Encodes a MADS box transcription factor. Expressed in quiescent center. Involved in floral transition.
AT3G04100	AGAMOUS-like 57;(source:Araport11)
AT2G45650	Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis.
AT1G77980	Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth.
AT5G51870	Encodes a MADS-box transcription factor involved in floral transition.
AT3G30260	Agamous-like transcription factor. A target of SPL10, AGL79 knockdowns show defects in leaf shape, shoot branching, and flowering time.
AT3G66656	AGAMOUS-like 91;(source:Araport11)
AT1G46408	AGAMOUS-like 97;(source:Araport11)
AT3G25250	Arabidopsis protein kinase The mRNA is cell-to-cell mobile.
AT3G44610	Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation.
AT5G03640	AGCVIII kinase involved in the pulse-induced first positive phototropism.
AT2G13810	ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid.
AT1G74800	Encodes a Golgi-localized hydroxyproline galactosyltransferase GALT5. Functions together with GALT2 as redundant GALTs that control AGP (arabinogalactan-proteins) O-glycosylation, which is essential for normal growth and development. Mutants display multiple phenotypes including reduced root hair growth.
AT4G37750	ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis.
AT5G10510	Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation.
AT1G72330	Encodes for alanine aminotransferase ALAAT2.
AT1G50200	Alanyl-tRNA synthetase;(source:Araport11)
AT5G01370	Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence.
AT3G24503	Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively
AT1G54100	Aldehyde dehydrogenase
AT3G53880	NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11)
AT5G60360	Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile.
AT5G26210	Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7).
AT4G34860	Plant neutral invertase family protein;(source:Araport11)
AT3G06500	Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile.
AT1G72000	Plant neutral invertase family protein;(source:Araport11)
AT5G16970	encodes a 2-alkenal reductase (EC 1.3.1.74), plays a key role in the detoxification of reactive carbonyls
AT3G25780	Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis that encode this enzyme. mRNA expression is upregulated in senescing leaves. Note: Nomenclature for Arabidopsis allene oxide cyclase 3 (AOC3, AT3G25780) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC3 (AT3G25780) is also referred to as AOC2 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile.
AT3G52720	Encodes an alpha carbonic anhydrase (CAH1) located in the chloroplast stroma. Most chloroplast proteins are encoded by the nuclear genome and imported with the help of sorting signals that are intrinsic parts of the polypeptides. CAH1 takes an alternative route through the secretory pathway, and becomes N-glycosylated before entering the chloroplast. Glycosylation and intra-molecular disulfide bridge fromation are necessary for the correct folding, ER export, trafficking and activity of the protein.
AT2G28210	alpha carbonic anhydrase 2;(source:Araport11)
AT5G04180	alpha carbonic anhydrase 3;(source:Araport11)
AT1G73680	Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives.
AT5G22770	AP-2 complex subunit alpha-1. Part of endomembrane trafficking system.
AT4G25000	Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830).
AT1G68560	Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases.
AT3G54720	Encodes glutamate carboxypeptidase. Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1.
AT3G51290	pyridoxal-phosphate-dependent serine hydroxymethyltransferase, putative (DUF632);(source:Araport11)
AT1G68370	DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins.
AT5G10940	ASG2 is farnesylated protein and this post-translational modification impacts its subcellular localization. It is the homolog of the human anti-obesity factor WDTC1 and is involved in the negative regulation of fatty acid biosynthesis. The non-farnesylated form displays a nucleo-cytosolic subcellular localization. The farnesylated form displays a cytosolic subcellular localization. Interaction with At4g05420 (DDB1a) was shown using BiFC approach.
AT1G20650	Protein kinase superfamily protein;(source:Araport11)
AT5G47580	transmembrane protein;(source:Araport11)
AT3G22370	Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile.
AT4G17970	Anion transporter involved in stomatal closure. Gene has 3 splicing variants.
AT5G27610	protein ALWAYS EARLY 1;(source:Araport11)
AT1G58360	Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root.
AT5G63850	Amino acid transporter whose expression is downregulated by dehydration.
AT1G44100	amino acid permease 5
AT5G49630	Is a high affinity amino acid transporter capable of transporting aspartate and tryptophan. May be involved in the amino acid uptake from xylem.
AT1G10010	Encodes a high affinity amino acid transporter that is probably responsible for import of organic nitrogen into developing seeds. One of eight gene family members that encode amino acid permeases. Most closely related to AAP1 (75%) identity.
AT4G21120	Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile.
AT4G33090	encodes an aminopeptidase, a ortholog of mouse microsomal AP (EC 3.4.11.2).
AT1G26130	ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT1G17500	ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein. ALA4 acts redundantly with ALA3, ALA5, ALA9, ALA10 and ALA11 in root and shoot development
AT1G72700	ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT1G68710	ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT3G25610	Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane.
AT4G13510	Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile.
AT1G64780	encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root.
AT3G24300	Encodes a plasma membrane localized ammonium transporter.
AT2G38290	encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively.
AT2G18290	Encodes APC10 (anaphase promoting complex 10). Overexpression of APC10 likely mimics auxin and ethylene sensitive phenotypes. Plays an essential role in cell proliferation during leaf development.
AT2G39090	tetratricopeptide repeat (TPR)-containing protein;(source:Araport11)
AT1G05020	ENTH/ANTH/VHS superfamily protein;(source:Araport11)
AT5G61160	anthocyanin 5-aromatic acyltransferase 1;(source:Araport11)
AT4G00730	Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of anthocyanin and in root development. Loss of function mutants have increased cell wall polysaccharide content.
AT5G05730	ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots.
AT1G25220	Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2).
AT5G28680	Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip.
AT4G36920	Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner.
AT4G13040	Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation.
AT3G54340	Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies petal and stamen identities. Associates with PISTILLATA.
AT1G69120	Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24.
AT5G10760	Eukaryotic aspartyl protease family protein;(source:Araport11)
AT1G78860	curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein
AT1G34780	Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group.
AT3G03860	Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile.
AT2G14750	Encodes adenosine-5'-phosphosulfate kinase. Provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. Essential for pollen viability. The mRNA is cell-to-cell mobile.
AT4G04610	Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile.
AT4G39940	adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile.
AT3G04080	Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP.
AT1G14240	GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11)
AT4G38220	Peptidase M20/M25/M40 family protein;(source:Araport11)
AT2G44900	ARABIDILLO-1 and its homolog, ARABIDILLO -2, are unique among Arabidopsis Arm-repeat proteins in having an F-box motif and fall into a phylogenetically distinct subgroup from other plant Arm-repeat proteins Similar to arm repeat protein in rice and armadillo/beta-catenin repeat family protein / F-box family protein in Dictyostelium. ARABIDILLO-1 promote lateral root development. Mutant plants form fewer lateral roots, while ARABIDILLO-1-overexpressing lines produce more lateral roots than wild-type seedlings.
AT3G23620	BRIX domain containing protein, similar to RNA biogenesis factors in yeast. Binds rRNA and likely also functions in RNA biogenesis in Arabidopsis. Essential gene, mutants are embryo lethal and does not transmit well through the gametophyte.
AT1G52930	Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing.
AT2G37940	Inositol phosphorylceramide synthase 2;(source:Araport11)
AT2G29525	Inositol phosphorylceramide synthase
AT1G62700	Encodes a NAC-domain transcription factor. Expressed in the vascular tissue.
AT5G18270	NAC domain containing protein 87;(source:Araport11)
AT1G77360	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G33920	Protein phosphatase 2C family protein;(source:Araport11)
AT5G06750	Protein phosphatase 2C family protein;(source:Araport11)
AT2G17800	A member of ROP GTPase family. Rac-like GTP-binding protein ARAC1/ATGP2. Encodes a geranylgeranylated GTP binding protein. Involved in the auxin-activated 26S proteasome-dependent Aux/IAA proteolysis pathway.
AT1G72200	RING/U-box superfamily protein;(source:Araport11)
AT2G20030	RING/U-box superfamily protein;(source:Araport11)
AT5G43420	RING/U-box superfamily protein;(source:Araport11)
AT1G28040	RING/U-box superfamily protein;(source:Araport11)
AT2G46495	RING/U-box superfamily protein;(source:Araport11)
AT2G25410	RING/U-box superfamily protein;(source:Araport11)
AT1G74410	RING/U-box superfamily protein;(source:Araport11)
AT4G40070	RING/U-box superfamily protein;(source:Araport11)
AT4G09110	RING/U-box superfamily protein;(source:Araport11)
AT4G09120	RING/U-box superfamily protein;(source:Araport11)
AT4G09130	RING/U-box superfamily protein;(source:Araport11)
AT2G34990	RING/U-box superfamily protein;(source:Araport11)
AT2G42350	RING/U-box superfamily protein;(source:Araport11)
AT2G42360	RING/U-box superfamily protein;(source:Araport11)
AT1G72220	RING/U-box superfamily protein;(source:Araport11)
AT3G18930	RING/U-box superfamily protein;(source:Araport11)
AT2G35910	RING/U-box superfamily protein;(source:Araport11)
AT5G06490	RING/U-box superfamily protein;(source:Araport11)
AT3G18773	RING/U-box superfamily protein;(source:Araport11)
AT4G24015	RING/U-box superfamily protein;(source:Araport11)
AT2G28920	RING/U-box superfamily protein;(source:Araport11)
AT2G44578	RING/U-box superfamily protein;(source:Araport11)
AT2G44581	RING/U-box superfamily protein;(source:Araport11)
AT2G46494	RING/U-box superfamily protein;(source:Araport11)
AT2G46493	RING/U-box superfamily protein;(source:Araport11)
AT5G53110	RING/U-box superfamily protein;(source:Araport11)
AT2G34000	RING/U-box superfamily protein;(source:Araport11)
AT1G17860	Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites.
AT5G61670	Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis.
AT5G55240	Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes.
AT1G04360	RING/U-box superfamily protein;(source:Araport11)
AT1G22500	Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus.
AT1G49230	RING/U-box superfamily protein;(source:Araport11)
AT1G30680	Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B.
AT5G44930	Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges.
AT4G37450	AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores.
AT3G01700	Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth.
AT5G11740	Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile.
AT2G46330	Encodes arabinogalactan protein (AGP16).
AT2G22470	Encodes arabinogalactan-protein (AGP2).
AT3G61640	arabinogalactan protein 20;(source:Araport11)
AT5G53250	arabinogalactan protein 22;(source:Araport11)
AT2G47930	arabinogalactan protein 26;(source:Araport11)
AT2G33790	pollen Ole e 1 allergen protein containing 14.6% proline residues, similar to arabinogalactan protein (Daucus carota) GI:11322245, SP:Q03211 Pistil-specific extensin-like protein precursor (PELP) {Nicotiana tabacum}; contains Pfam profile PF01190: Pollen proteins Ole e I family
AT5G10430	Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby.
AT1G35230	Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile.
AT5G14380	Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6 function results in decreased fertility due to defects in pollen tube growth.
AT2G14890	putative proline-rich protein (At2g14890) mRNA, complete The mRNA is cell-to-cell mobile.
AT5G36925	hypothetical protein;(source:Araport11)
AT5G36920	Secreted peptide which functions in plant growth and pathogen defense.
AT1G08680	A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15.
AT5G61980	A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD1 belongs to the class 1, together with AGD2, AGD3 and AGD4. Not expressed in hypocotyls and cotyledons.
AT4G05330	A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT1G10870	A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3.
AT4G17890	A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.
AT5G46750	A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. The mRNA is cell-to-cell mobile.
AT1G59980	ARG1-like 2;(source:Araport11)
AT4G08900	Encodes an arginase, likely to be involved in polyamine biosynthesis in pollen.
AT2G16500	Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements.
AT5G05700	Encodes an arginyl-tRNA:protein transferase (ATE1), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. Mutants of ATE1 also display delayed leaf senescence and altered responses to pathogens.
AT4G25500	Encodes an arginine/serine-rich splicing factor. The transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS40 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis (DOI:10.1093/nar/gkv751).
AT5G52040	Encodes an arginine/serine-rich splicing factor. Transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS41 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis.
AT3G53500	Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926.
AT2G27040	AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation, abnormal ovule/megagametophyte develoment and increased susceptibility to bacterial pathogens including Tobacco rattle virus.
AT2G27880	AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X.
AT2G32940	Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing.
AT5G21150	AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes.
AT1G69440	Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds.
AT5G63750	RING/U-box superfamily protein;(source:Araport11)
AT1G05890	RING/U-box superfamily protein;(source:Araport11)
AT2G31770	RING/U-box superfamily protein;(source:Araport11)
AT5G19330	Encodes an armadillo repeat protein involved in the abscisic acid response. The protein interacts with a transcription factor, ABF2, which controls ABA-dependent gene expression via the G-box-type ABA-responsive elements.
AT3G26600	Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules.
AT1G11790	Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identiﬁed in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250].
AT3G44720	Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identiﬁed in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile.
AT2G20340	Encodes an aromatic aldehyde synthase (AtAAS), which catalyzes the in vitro conversion of phenylalanine and 3,4-dihydroxy-L-phenylalanine to phenylacetaldehyde and dopaldehyde, respectively. The mRNA is cell-to-cell mobile.
AT2G16220	Stress induced gene. Mutants show increased sensitivity to arsenate.
AT4G32320	Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms.
AT2G19640	ASH1-related protein 2;(source:Araport11)
AT3G02890	PHD protein which cooperates with PAIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription.
AT5G10240	Encodes asparagine synthetase (ASN3).
AT5G42050	Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation.
AT2G22250	Encodes a prokaryotic-type plastidic aspartate aminotransferase with glutamate/aspartate-prephenate aminotransferase (PAT) activity.
AT5G19550	Nitrogen metabolism. Major cytosolic isoenzyme controlling aspartate biosynthesis in the light. The mRNA is cell-to-cell mobile.
AT5G13280	Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH).
AT1G31230	Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.
AT4G19710	Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine.
AT1G11910	Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8).
AT1G65620	required for formation of a symmetric flat leaf lamina, encodes a member of a family of proteins characterized by cysteine repeats and a leucine zipper; involved in KNOX gene regulation. Acts together with ASL1 in proximal-distal symmetry determination. Forms a complex with AS1 that binds to the BP promoter and leads to silencing of BP.
AT5G66870	Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination.
AT2G46980	Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis.
AT1G76510	ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11)
AT3G09470	Protein similar to UNC93 of C.elegans. Mutants are hypersensitive to ABA treatment and salt sensitive and have disregulated K+ accumulation.
AT3G60870	Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development.
AT3G61310	AT hook motif DNA-binding family protein;(source:Araport11)
AT1G63480	AT hook motif DNA-binding family protein;(source:Araport11)
AT4G17950	AT-hook motif containing nuclear localized (AHL) DNA-binding protein; substrate of immune MAPKs. Phosphorylation regulates AHL13 protein stability and thereby its immune functions. Regulates key factors of jasmonic acid biosynthesis and signaling and affects immunity toward Pseudomonas syringae and Botrytis cinerea pathogens.
AT3G04590	AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain.
AT4G35390	AT-hook protein of GA feedback 1;(source:Araport11)
AT4G12050	Putative AT-hook DNA-binding family protein;(source:Araport11)
AT4G25320	AT hook motif DNA-binding family protein;(source:Araport11)
AT5G51590	Member of the 29 AT-hook family TFs involved in the development of root xylem.
AT1G63470	AT hook motif DNA-binding family protein;(source:Araport11)
AT5G62260	AT hook motif DNA-binding family protein;(source:Araport11)
AT4G00200	AT hook motif DNA-binding family protein;(source:Araport11)
AT2G45850	AT hook motif DNA-binding family protein;(source:Araport11)
AT3G43240	Interacts with CHR11, CHR17, and RTL1, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation.
AT4G02940	ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering.
AT1G48980	2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
AT3G48190	Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres.
AT3G17100	sequence-specific DNA binding transcription factor;(source:Araport11)
AT1G09250	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT2G45980	Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1.
AT1G58080	ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis
AT3G52300	ATP synthase D chain;(source:Araport11)
AT1G71960	Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses.
AT3G47780	member of ATH subfamily The mRNA is cell-to-cell mobile.
AT2G36910	Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR1.Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AT3G28860. PGP1 mediates cellular efflux of IAA and interacts with PIN genes that may confer an accelerated vectoral component to PGP-mediated transport. The non-polar localization of PGP1 at root and shoot apices, where IAA gradient-driven transport is impaired, may be required to confer directionality to auxin transport in those tissues. The mRNA is cell-to-cell mobile.
AT1G02520	Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile.
AT1G02530	P-glycoprotein 12;(source:Araport11)
AT3G28345	Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem.
AT3G28380	P-glycoprotein 17;(source:Araport11)
AT4G28620	Half-molecule ABC transporter ATM2. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth.
AT2G47000	Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation.
AT4G01830	P-glycoprotein 5;(source:Araport11)
AT1G30400	glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim.
AT1G30420	member of MRP subfamily
AT1G30410	member of MRP subfamily
AT2G07680	Encodes ABCC13/MRP11, a member of the multidrug resistance associated protein MRP/ABCC subfamily. Its expression is induced by gibberellic acid and downregulated by naphthalene acetic acid, abscisic acid, and zeatin.
AT2G34660	encodes a multidrug resistance-associated protein that is MgATP-energized glutathione S-conjugate pump. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. The mRNA is cell-to-cell mobile.
AT3G13080	encodes an ATP-dependent MRP-like ABC transporter able to transport glutathione-conjugates as well as chlorophyll catabolites. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim.
AT4G39850	Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome.
AT1G64550	Encodes a member of GCN subfamily. Predicted to be involved in stress-associated protein translation control. The mutant is affected in MAMP ((microbe-associated molecular patterns)-induced stomatal closure, but not other MAMP-induced responses in the leaves. Arabidopsis has five ABCF proteins, which are all closely related by sequence to yeast GCN20. None of these five are individually required for GCN2 kinase activity.
AT2G39350	Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16).
AT1G51500	Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones.
AT3G55090	Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16).
AT3G25620	ABC-2 type transporter family protein;(source:Araport11)
AT5G06530	Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility.
AT5G60740	ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species.
AT3G16340	Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis.
AT2G28070	ABC-2 type transporter family protein;(source:Araport11)
AT2G37280	Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem.
AT2G36380	pleiotropic drug resistance 6;(source:Araport11)
AT3G53480	Negative regulator of auxin polar transport inhibitors. ABCG37 regulates auxin distribution and homeostasis in roots by excluding IBA from the root apex, but does not act directly in basipetal transport. ABCG37 and ABCG36 act redundantly at outermost root plasma membranes and, transport IBA out of the cells. Also involved in root transmembrane secretion of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile.
AT3G30842	pleiotropic drug resistance 10;(source:Araport11)
AT4G25750	ABC-2 type transporter family protein;(source:Araport11)
AT4G15215	pleiotropic drug resistance 13;(source:Araport11)
AT3G21580	cobalt ion transmembrane transporter;(source:Araport11)
AT1G67940	member of NAP subfamily The mRNA is cell-to-cell mobile.
AT1G10670	One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress.
AT1G60810	One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase
AT1G09430	Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity.
AT5G07320	Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter.
AT3G22150	Involved in RNA editing of plastid atpF and mitochondrial nad5.
AT1G56310	DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation.
AT5G61440	Encodes a member of the thioredoxin family protein. Located in the chloroplast. The mRNA is cell-to-cell mobile.
AT2G32980	HAUS augmin-like complex subunit;(source:Araport11)
AT3G63380	ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT3G22910	ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11)
AT4G29900	one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain.
AT3G21180	one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain.
AT5G57110	Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane.
AT1G27770	Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor.
AT3G57330	Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate)
AT1G13210	Autoinhibited Ca2+/ATPase II. ALA11 acts redundantly with ALA3, ALA4, ALA5, ALA9, ALA10 in root and shoot development as well as PIN trafficking and polarity .
AT3G13970	Autophagy protein.
AT3G19190	Encodes autophagy-related 2 (ATG2). The mRNA is cell-to-cell mobile.
AT3G60640	Autophagy protein.
AT3G06420	Autophagy protein.
AT1G30280	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT5G49980	auxin F-box protein 5;(source:Araport11)
AT5G43700	Auxin inducible protein similar to transcription factors.
AT2G38120	Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile.
AT2G28350	Involved in root cap cell differentiation.
AT2G46530	auxin response factor 11;(source:Araport11)
AT1G35540	auxin response factor 14;(source:Araport11)
AT1G77850	Encodes a transcriptional regulator that directly binds to the promoter of MYB108 and plays a crucial role in anther dehiscence, pollen wall pattern formation, tapetum development, and auxin signal transduction in anthers. It is post-transcriptionally regulated by miR160 and regulates early auxin response genes.
AT1G19220	Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin.
AT1G34410	auxin response factor 21;(source:Araport11)
AT1G30330	Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167.
AT3G07390	isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile.
AT2G04160	isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell.
AT2G34680	isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular.
AT3G59900	Encodes ARGOS (Auxin-Regulated Gene Involved in Organ Size). Inducible by auxin. Involved in lateral organ size control. Transgenic plants expressing sense or antisense ARGOS cDNA display enlarged or reduced aerial organs, respectively. The alteration in organ size is attributable mainly to changes in cell number and the duration of organ growth.
AT5G39720	avirulence induced protein 2 like protein;(source:Araport11)
AT3G10960	Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2).
AT5G50300	Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2).
AT4G12470	Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction.
AT1G25440	B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11)
AT2G21320	B-box zinc finger family protein;(source:Araport11)
AT1G75540	Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile.
AT4G27310	Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering.
AT5G54470	B-box type zinc finger family protein;(source:Araport11)
AT3G21150	Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation.
AT5G48250	B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11)
AT2G47890	Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T
AT5G17430	Encodes an AP2-domain containing protein similar to ANT. Expressed in embryos and lateral root primordium. PLT4 acts after PLT3,5 and 7 during lateral roof formation.
AT5G48380	Encodes a BAK1-interacting receptor-like kinase named BIR1. Negatively regulates multiple plant resistance signaling pathways, one of which is the SOBIR1(AT2G31880)-dependent pathway.
AT1G27190	Activated by TCP8/14/15/22, involved in modulation of GA-dependent stamen filament elongation.
AT4G17840	CAAX protease self-immunity protein;(source:Araport11)
AT3G45260	BIB is a member of the BIRD family of zinc finger proteins that includes JKD. BIB functions redundantly with JKD to retain SHR in the nucleus and thereby restrict SHR movement in root tissues.
AT5G15160	BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time.
AT5G65700	Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile.
AT4G20270	Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile.
AT4G15370	Encodes an oxidosqualene cyclase that primarily produces the tetracyclic triterpene baruol in vitro and when expressed in yeast. It can also make 22 other minor triterpenoid products with varying numbers of rings.
AT1G06170	Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48.
AT5G49450	Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses.
AT2G18160	Encodes a b-ZIP transcription factor.
AT4G38900	Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11)
AT2G21230	bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1.
AT1G59530	basic leucine-zipper 4;(source:Araport11)
AT1G13600	basic leucine-zipper 58;(source:Araport11)
AT5G60830	basic leucine-zipper 70;(source:Araport11)
AT2G35550	basic pentacysteine 7;(source:Araport11)
AT3G09000	Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development.
AT1G27850	Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development.
AT3G51540	mucin-5AC-like protein;(source:Araport11)
AT2G17770	Encodes a paralog of bZIP transcription factor FD. This protein interacts with FD and FT.
AT3G62420	Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene.
AT1G42990	bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus.
AT5G47120	Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile.
AT2G44330	RING/U-box superfamily protein;(source:Araport11)
AT1G52670	Single hybrid motif superfamily protein;(source:Araport11)
AT5G52060	A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development.
AT3G60920	beige/BEACH domain protein;(source:Araport11)
AT1G77890	One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis.
AT2G35940	Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm.
AT1G75430	BEL1-like homeodomain 11;(source:Araport11)
AT3G50750	BES1/BZR1 homolog 1;(source:Araport11)
AT4G36780	BES1/BZR1 homolog 2;(source:Araport11)
AT4G18890	BES1/BZR1 homolog 3;(source:Araport11)
AT1G70410	Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels.
AT3G13750	beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile.
AT1G45191	beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1
AT5G42260	beta glucosidase 12;(source:Araport11)
AT2G44480	beta glucosidase 17;(source:Araport11)
AT5G28510	beta glucosidase 24;(source:Araport11)
AT3G60120	beta glucosidase 27;(source:Araport11)
AT5G24540	beta glucosidase 31;(source:Araport11)
AT2G32860	beta glucosidase 33;(source:Araport11)
AT1G26560	beta glucosidase 40;(source:Araport11)
AT1G61820	beta glucosidase 46;(source:Araport11)
AT1G62710	Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins.
AT5G20330	beta-1,3-glucanase 4;(source:Araport11)
AT3G52060	Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth.
AT2G45880	Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays.
AT1G55120	Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity.
AT4G26140	putative beta-galactosidase
AT1G77410	beta-galactosidase 16;(source:Araport11)
AT1G72990	beta-galactosidase 17;(source:Araport11)
AT1G45130	beta-galactosidase 5;(source:Araport11)
AT1G61810	beta-glucosidase 45;(source:Araport11)
AT5G39990	Encodes GlcAT14A, a beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan. The protein was localized to the Golgi apparatus when transiently expressed in Nicotiana benthamiana. Plays a role in cell elongation during seedling growth.
AT1G24470	Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene.
AT5G09730	Encodes a protein similar to a beta-xylosidase located in the extracellular matrix. It is able to degrade terminal arabinosyl residues and likely participates in the in-vivo hydrolysis of arabinan. This is a member of glycosyl hydrolase family 3 and has six other closely related members.
AT1G75380	Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression.
AT3G02260	Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance.
AT1G54200	DNA mismatch repair Msh6-like protein;(source:Araport11)
AT3G13980	SKI/DACH domain protein;(source:Araport11)
AT1G69160	suppressor;(source:Araport11)
AT1G13670	hypothetical protein;(source:Araport11)
AT1G59640	A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS.
AT4G35380	Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking.
AT4G22840	Sodium Bile acid symporter family;(source:Araport11)
AT2G26900	Sodium Bile acid symporter family;(source:Araport11)
AT5G15530	biotin carboxyl carrier protein isoform 2 (BCCP2) mRNA,
AT3G57130	Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus.
AT2G41370	Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP2 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP2 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP3 expression is restricted to pedicel axils by BP and PNY; promotes KNAT6 (At1g23380) expression.
AT4G18950	BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening.
AT3G54810	Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified.
AT1G14580	C2H2-like zinc finger protein;(source:Araport11)
AT5G11250	Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET.
AT5G45100	Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea.
AT1G79110	Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea.
AT3G12920	Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea.
AT2G45760	encodes a protein that is similar to BONZAI1-binding protein BAP1.
AT1G73177	The BONSAI gene encodes a protein with similarity to the APC13 component of the Anaphase Promoting Complex. Plants with lowered level of BONSAI expression, resulting from hypomethylation, RNAi knock-down, or a T-DNA insertion show some abnormalities in shoot and inflorescence development.
AT2G39660	Encodes a plasma membrane-localized ser/thr protein kinase that is a crucial component of host response signaling required to activate the resistance responses to Botrytis and A. brassicicola infection. It is likely a negative regulator of salicylic acid accumulation and basal defense against virulent bacterial pathogens. Together with ER plays opposing roles in leaf morphogenesis and inflorescence architecture. Required to maintain appropriate auxin response during leaf margin morphogenesis. Interacts with ER-family proteins and directly phosphorylates ER.
AT1G79420	C-type mannose receptor (DUF620);(source:Araport11)
AT1G27690	lipase, putative (DUF620);(source:Araport11)
AT4G17720	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G14340	ACD11 binding partner, negatively regulates ROS-mediated defense response.
AT5G32450	ACD11 binding partner, negatively regulates ROS-mediated defense response.
AT1G18400	Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings.
AT1G73830	Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings.
AT2G46020	Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D.
AT5G11360	Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11)
AT4G15400	Encodes BIA1, a member of the BAHD acyltransferase family. Plays a role in controlling brassinosteroids levels, particularly in the root and hypocotyl in darkness.
AT5G47950	BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. BIA2 may function in BR homeostasis by regulating the pool of bioactive BR.
AT4G18710	Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation.
AT3G61460	Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide.
AT4G35230	Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized.
AT5G46570	Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized.
AT4G00710	Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized.
AT1G63500	kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11)
AT3G09240	kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11)
AT3G15120	Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions.
AT4G21070	Encodes AtBRCA1, an ortholog of the human breast cancer susceptibility gene 1. Contains one N-terminal RING finger, two C-terminal BRCT and the p300/CBP interacting domain. Strongly induced by gamma rays, consistent with a putative role in DNA repair and in cell cycle control.
AT4G30610	Encodes a secreted glycosylated serine carboxypeptidase with broad substrate preference that is involved in brassinosteroid signalling via BRI1. It is proteolytically processed in vivo by a separate as yet unidentified protease.
AT1G03445	encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid.
AT4G03080	Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells.
AT4G33430	Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola.
AT5G55040	DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components.
AT5G62040	BFT is a member of The FLOWERING LOCUS T (FT)/TERMINAL FLOWER 1 (TFL1) gene family that encodes regulators involved in control of flower development.
AT1G03457	RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11)
AT1G18910	E3 ubiquitin ligase that functions redundantly in the root with BTSL1 to negatively regulate iron uptake.
AT2G40400	Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development.
AT3G48360	Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones.
AT4G37610	BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves.
AT2G21480	BUSP2 plays a smaller role than BUSP1 in pollen tube growth. bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule but single busp2 mutants are fertile. BUSP2 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth.
AT5G18930	S-adenosylmethionine decarboxylase family member.
AT1G01550	Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis.
AT4G01360	Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal.
AT1G18740	DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs.
AT4G25490	Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid.
AT1G29290	Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2.
AT1G59835	DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11)
AT3G50610	DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11)
AT1G70810	Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11)
AT4G01840	Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo.
AT5G49480	AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile.
AT4G27280	EF-hand Ca2 + -binding protein, which is a Ca2+-dependent transducer of auxin-regulated gene expression and interacts with ICR1.
AT5G44070	Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile.
AT4G34050	Methyltransferase in the lignin biosynthetic pathway.
AT1G67980	Encodes S-adenosyl-L-methionine: transcaffeoyl Coenzyme A 3-O-methyltransferase. Methyltransferase in the lignin biosynthetic pathway.
AT4G17615	Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation.
AT4G01420	Encodes calcineurin B-like protein 5 (CBL5). Overexpression confers tolerance to drought and salt stress.
AT4G16350	Calcium sensor protein. Binds CIPK14.
AT4G26560	Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2.
AT5G47100	member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo.
AT4G37640	Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor.
AT2G17290	Encodes calcium dependent protein kinase 6 (CPK6), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK6 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. The protein kinase CPK6 is shown in biochemical assays to be directly activated by elevations in calcium concentrations in the physiological range (Laanements et al., 2013 PlantPhys.; PMID: 23766366). These data correlate with the in vivo function of CPK6 in Ca2+ and ABA activation of S-type anion channels (Mori et al., 2006 PLoS Biol.; PMID: 17032064) and the ability of CPK6 to mediate ABA activation of SLAC1 (Brandt et al., 2012 PNAS; PMID: 22689970). The mRNA is cell-to-cell mobile.
AT4G38810	SnRK2-Interacting Calcium Sensor. Encodes two different isoforms that can both inhibit SnRK2. The longer form (AT4G38810.2) is calcium dependant, the other is not.
AT1G18890	encodes a calcium-dependent protein kinase whose gene expression is induced by dehydration and high salt. Kinase activity could not be detected in vitro.
AT2G41860	member of Calcium Dependent Protein Kinase
AT5G12180	member of Calcium Dependent Protein Kinase
AT4G36070	member of Calcium Dependent Protein Kinase
AT4G04720	member of Calcium Dependent Protein Kinase
AT4G04710	member of Calcium Dependent Protein Kinase
AT4G04700	member of Calcium Dependent Protein Kinase
AT1G76040	member of Calcium Dependent Protein Kinase
AT4G04695	member of Calcium Dependent Protein Kinase. Involved in response to salicylic acid.
AT3G57530	Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. AtCPK32 has autophosphorylation activity and can phosphorylate ABF4 in vitro
AT4G23650	Encodes calcium dependent protein kinase 3 (CPK3), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK3 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK6 is also a member of the Arabidopsis CDPK family.
AT5G54590	Splice variant At5g54590.2 encodes CRLK1 (440-amino acid in length) calcium/calmodulin-regulated receptor-like kinase crucial for cold tolerance. CRLK1 is Primarily localized in the plasma membrane.
AT5G15730	Protein kinase superfamily protein;(source:Araport11)
AT1G05570	Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48.
AT2G13680	Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen.
AT1G06490	Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding.
AT3G16030	lectin protein kinase family protein;(source:Araport11)
AT2G41010	Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress.
AT2G41110	Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile.
AT3G56800	encodes a calmodulin
AT5G21274	Encodes a calmodulin isoform. Expressed in leaves.
AT3G51920	encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid.
AT3G25600	Calmodulin like protein. Paralog of CML15.
AT5G42380	calmodulin like 37;(source:Araport11)
AT5G44460	Calcium sensor.
AT4G35987	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11)
AT5G58940	Arabidopsis thaliana calmodulin-binding receptor-like kinase mRNA The mRNA is cell-to-cell mobile.
AT2G11520	high overall homology to CRCK1
AT3G16940	Calmodulin binding transcription factor. Mutants display increased salt tolerance during early germination. Involved in regulation of salt stress responsive genes.
AT4G35310	calmodulin-domain protein kinase CDPK isoform 5 (CPK5)
AT5G12480	calmodulin-domain protein kinase CDPK isoform 7 (CPK7)
AT3G22930	Encodes a calmodulin-like protein.
AT5G39670	Calmodulin like protein involved in negative regulation of pattern triggered immunity.
AT3G56690	encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined.
AT1G78955	Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system.
AT3G59090	tobamovirus multiplication protein;(source:Araport11)
AT5G02630	Lung seven transmembrane receptor family protein;(source:Araport11)
AT5G27210	Protein of unknown function, transmembrane-40;(source:Araport11)
AT2G46410	Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF.
AT3G27740	Encodes carbamoyl phosphate synthetase (CPS) small subunit (carA), also named as VEN6. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins.
AT1G29900	Encodes carbamoyl phosphate synthetase (CPS) large subunit (CARB), also named as VEN3. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins.
AT5G27420	Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile.
AT3G01500	Encodes a putative beta-carbonic anhydrase betaCA1. Together with betaCA4 (At1g70410) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. Activated by OXS2 under the treatment of salt.
AT5G62180	Carboxyesterase that binds stringolactones.
AT1G49660	Encodes a protein with carboxylesterase whose activity was tested using pNA.
AT5G01270	Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses.
AT3G63520	Encodes a protein with 9-cis-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-trans-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-cis-double or allenic bonds. The mRNA is cell-to-cell mobile.
AT4G32810	Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching.
AT4G26100	Encodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization (member of CKL-B group).
AT5G67380	Casein kinase II (CK2) catalytic subunit (alpha 1). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis.
AT4G14340	Phosphorylates serine or threonine residues that are near and C-terminal to acidic side chains on a variety of target proteins. Member of CKL gene family (CKL-C group).
AT5G57015	Member of CKL gene family (member of CKL-B group).
AT4G28880	Member of CKL gene family (CKL-A group)
AT4G28860	Member of CKL gene family (CKL-A group)
AT3G60250	Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis
AT1G04440	Member of CKL gene family (CKL-C group).
AT5G44550	Uncharacterized protein family (UPF0497);(source:Araport11)
AT4G03540	Uncharacterized protein family (UPF0497);(source:Araport11)
AT3G14380	Uncharacterized protein family (UPF0497);(source:Araport11)
AT3G16300	Uncharacterized protein family (UPF0497);(source:Araport11)
AT2G39530	Uncharacterized protein family (UPF0497);(source:Araport11)
AT2G39518	Uncharacterized protein family (UPF0497);(source:Araport11)
AT4G37235	Uncharacterized protein family (UPF0497);(source:Araport11)
AT2G16385	CAF1 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF2 it is required for formation of the casparian band.
AT4G35600	Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile.
AT1G73875	Deadenylase.
AT1G20630	Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2.
AT4G35090	Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2).
AT1G20620	Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile.
AT1G54115	Involved in cation (Na and K) homeostasis.
AT3G13320	low affinity calcium antiporter CAX2 The mRNA is cell-to-cell mobile.
AT5G01490	Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress.
AT1G55730	member of Low affinity calcium antiporter CAX2 family
AT5G22910	member of Putative Na+/H+ antiporter family
AT1G64170	member of Putative Na+/H+ antiporter family
AT4G23700	member of Putative Na+/H+ antiporter family
AT3G53720	member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells.
AT5G01680	member of Putative Na+/H+ antiporter family
AT1G58030	Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Localized to the tonoplast.
AT5G36940	Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs.
AT1G17120	Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs.
AT1G26310	Floral homeotic gene encoding a MADS domain protein homologous to AP1. Enhances the flower to shoot transformation in ap1 mutants.
AT2G38270	Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4.
AT4G18700	Encodes CBL-interacting protein kinase 12 (CIPK12).
AT2G34180	Encodes CBL-interacting protein kinase 13 (CIPK13).
AT2G25090	Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance.
AT5G57630	CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress.
AT2G38490	member of AtCIPKs
AT1G30270	Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile.
AT4G14580	CBL-interacting protein kinase
AT5G10930	Encodes CBL-interacting protein kinase 5 (CIPK5).
AT3G23000	Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile.
AT1G80090	Cystathionine beta-synthase (CBS) family protein;(source:Araport11)
AT1G65320	Cystathionine beta-synthase (CBS) family protein;(source:Araport11)
AT2G16940	Splicing factor which interacts with IRR and SR45 to mediate pre-mRNA splicing to facilitate protein function, however not contributing to target specificity.
AT2G33590	Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The expression pattern of AtCRL1 indicates that CRL1 has a role in embryogenesis and seed germination. AtCRL1 is induced by ABA, drought and heat, and is highly expressed in seeds. The mRNA is cell-to-cell mobile.
AT2G33600	Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. Its expression pattern suggests that AtCRL2 is involved in the synthesis and/or maintenance of vascular tissue.
AT5G22250	Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses.
AT1G27890	Deadenylase.
AT1G61470	Deadenylase.
AT5G02800	Encodes CDL1, a homolog of CDG1. CDL1 positively regulates brassinosteroid signaling and plant growth.
AT1G62430	Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis.
AT3G50530	CDPK-related kinase
AT1G50180	Host immune receptor which recognizes the conserved effectors AvrE and HopAA1.
AT1G47960	Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. This protein may inhibit their activity.
AT3G52600	Cell wall invertase expressed in flowers and ovary placental tissues. Reduced expression is correlated with decreased ovule production suggesting a link between sugar sensing and ovule initiation.
AT3G13784	cell wall invertase 5;(source:Araport11)
AT4G32410	Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening.
AT2G25540	cellulose synthase
AT5G44030	Encodes a cellulose synthase involved in secondary cell wall biosynthesis. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. The mRNA is cell-to-cell mobile.
AT1G44120	CELLULOSE SYNTHASE INTERACTIVE 2;(source:Araport11)
AT2G35650	a member of Glycosyltransferase- Family 2 and encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. Mutants exhibit defects in pollen tube growth and embryo development. The defective embryonic development was associated with reduced proliferation and failed cellularization of the endosperm.
AT5G16190	encodes a gene similar to cellulose synthase
AT3G56000	encodes a gene similar to cellulose synthase
AT1G55850	encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile.
AT4G24010	encodes a protein similar to cellulose synthase
AT4G23990	encodes a protein similar to cellulose synthase
AT5G22740	Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture.
AT1G23480	encodes a gene similar to cellulose synthase
AT2G32610	encodes a gene similar to cellulose synthase
AT1G02730	Encodes a gene similar to cellulose synthase. Knock-out mutant has reduced growth, reduced xylan level and reduced xylan synthase activity in stems.It's expression is cell cycle dependent and it appears to function in cell plate formation.
AT1G32180	encodes a gene similar to cellulose synthase
AT2G33420	hypothetical protein (DUF810);(source:Araport11)
AT5G16910	encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile.
AT4G37010	Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair.
AT1G15660	Encodes a homologue of the human centromeric protein C (CENP-C). CENP-C co-localizes with the 180 bp centromeric regions of chromosomes throughout the cell cycle, but does not completely cover the 180 bp regions.
AT1G34750	Protein phosphatase 2C family protein;(source:Araport11)
AT3G22820	Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis.
AT5G16070	TCP-1/cpn60 chaperonin family protein;(source:Araport11)
AT5G56500	Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230).
AT3G62080	Encodes a charged multi-vesicular body protein (CHMP7) homolog, that is an ESCRT-III-related protein and functions in the endosomal sorting pathway in humans. The Brassica homolog has been shown to be involved in plant growth and leaf senescence.
AT3G21630	LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity,
AT5G24090	Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity.
AT3G04000	ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro.
AT2G44650	Encodes a chloroplast-localized chaperonin 10 whose mRNA is expressed in leaves and stems but not roots.
AT1G71697	Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile.
AT3G29200	L-ascorbate peroxidase
AT5G10870	Encodes chorismate mutase AtCM2.
AT5G66750	Protein is similar to SWI2/SNF2 chromatin remodeling proteins. DDM1 is appears to act as a chromatin-remodeling ATPase involved in cytosine methylation in CG and non-CG contexts. Involved in gene silencing and maintenance of DNA methylation and histone methylation. Hypomethylation of many genomic regions occurs in ddm1 mutants, and can cause several phenotypic abnormalities, but some loci, such as BONSAI (At1g73177) can be hypermethylated in ddm1 mutants after several generations, leading to different phenotypes. DDM1 might be involved in establishing a heterochromain boundary. A line expressing an RNAi targeted against DDM1 shows some resistance to agrobacterium-mediated root transformation.
AT2G21450	chromatin remodeling 34;(source:Araport11)
AT2G13370	Chromatin-remodeling factor; has large number of MAPK docking sites (D-sites).
AT5G18620	Encodes a member of the A. thaliana imitation switch (AtISWI) subfamily of chromatin remodeling factors. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density.
AT1G80740	ecotype Kl-0 chromomethylase (CMT1). A plant line expressing an RNAi construct directed against DMT4 has reduced agrobacterium-mediated tumor formation.
AT1G69770	Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing.
AT5G40090	Disease resistance protein (TIR-NBS class);(source:Araport11)
AT3G23690	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT2G30490	Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development.
AT1G80820	Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis.
AT4G37970	cinnamyl alcohol dehydrogenase 6;(source:Araport11)
AT4G39330	cinnamyl alcohol dehydrogenase 9;(source:Araport11)
AT2G17570	Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11)
AT4G19810	ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile.
AT1G68110	An ENTH (Epsin NH2 terminal homology)/ANTH/VHS superfamily protein with adenylate cyclase activity and a role in clathrin assembly and endocytosis.
AT2G40060	Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile.
AT3G51890	Clathrin light chain protein;(source:Araport11)
AT1G75820	Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain.
AT5G65480	CCL1 is induced by WUS and binds to the kinase domains of BAM1 and CLV1. Localizes to lipid rich plasma membrane rafts. Likely to be involved in WUS/CLV signaling pathway.
AT4G38060	hypothetical protein;(source:Araport11)
AT5G45780	Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis.
AT1G73165	Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo.
AT1G68795	Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT1G73965	Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo.
AT1G63245	Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo.
AT1G70895	Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT4G18510	CLE2, putative ligand, member of large gene family homologous to Clavata3
AT1G05065	Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT3G25905	Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon.
AT3G24770	Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE41 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE44 (At4g13195). The protein is expressed in the vascular system and is involved in axillary bud formation. The mRNA is cell-to-cell mobile.
AT1G25425	CLAVATA3/ESR-RELATED 43;(source:Araport11)
AT4G13195	Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation.
AT2G31085	Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo.
AT2G23950	Encodes an LLR receptor kinase that is expressed in protophloem and is required for CLE peptide sensing in roots. One of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that acts as a co-regulator and has essential roles in regulating CLV3-mediated stem cell homeostasis.
AT5G51660	cleavage and polyadenylation specificity factor 160;(source:Araport11)
AT2G20190	Encodes a microtubule-associated protein that is involved in both cell division and cell expansion. It likely promotes microtubule stability.
AT3G44340	homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions.
AT4G15560	Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis
AT5G45390	One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile.
AT5G39930	Encodes a protein with similarity to the CLP1 polyadenylation factor.
AT5G55130	putative molybdopterin synthase sulphurylase (cnx5)
AT3G02210	COBRA-like protein 1 precursor;(source:Araport11)
AT4G16120	putative membrane-anchored cell wall protein
AT1G16670	Encodes a cold-activated plasma membrane protein cold-responsive protein kinase that phosphorylates 14-3-3 proteins. The phosphorylated 14-3-3 proteins shuttle from the cytosol to the nucleus, where they interact with and destabilize the key cold-responsive C-repeat-binding factor (CBF) proteins, modulate CBF stability and the response to cold stress.
AT1G45688	CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress.
AT4G35170	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT2G25240	Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death.
AT5G67370	DUF1230 family protein (DUF1230);(source:Araport11)
AT4G24840	oligomeric golgi complex subunit-like protein;(source:Araport11)
AT3G21290	Nuclear-localized intrinsically disordered protein involved in promoting miRNA activity.
AT2G32950	Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile.
AT5G05690	Encodes a member of the CP90A family, a cytochrome P450 monooxygenase which converts 6-deoxocathasterone to 6-deoxoteasterone in the late C6 oxidation pathway and cathasterone to teasterone in the early C6 oxidation pathway of brassinolide biosynthesis. Expressed in cotyledons and leaves. Mutants display de-etiolation and derepression of light-induced genes in the dark, dwarfism, male sterility and activation of stress-regulated genes in the light. The expression of the gene using a CPD promoter:LUC fusion construct was shown to be under circadian and light control. Additionally, the circadian regulation was shown to be independent of BR levels as it remains unchanged in bri1 mutant lines. CPD appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through a BRI1-mediated signaling pathway that affects FLC expression levels, as uncovered by double mutant analyses.
AT5G17880	Encodes a TIR-NBS-LRR protein CSA1 that functions in photomorphogenic development. csa1 mutants display a constitutive shade-avoidance (CSA) phenotype (long stem) under high red:far-red rations (i.e. in the absence of a shade signal). csa1 mutation can be complemented by RPS4, a TIR-NBS-LRR protein that confers resistance against bacterium Pseudomonas syringae.
AT1G29690	Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity.
AT5G50000	Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation.
AT3G50260	Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile.
AT1G61620	Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile.
AT5G41790	encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile.
AT1G22920	AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. Required for the recovery of AUX/IAA repressor levels following recurrent heat stress to regulate auxin homeostasis.
AT4G26430	one of two genes encoding subunit 6 of COP9 signalosome complex
AT1G71230	Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses.
AT5G20650	Encodes COPT5, a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast. Plays an important role in the plant response to environmental copper scarcity, probably by remobilizing copper from prevacuolar vesicles, which could act as internal stores or recycling vesicles to provide the metal cofactor to key copper-dependent processes such as photosynthesis.
AT2G26975	Plasma membrane Cu transporter.
AT3G19610	Member of a novel, plant specific family of microtubule associated proteins.
AT1G28680	Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots.
AT3G59420	Encodes a membrane localized protein with similarity to receptor kinases which is involved in epidermal cell differentiation. Flowers of mutants have disorganized ovule integument growth and abnormal sepal margins. In the roots, mutants initiate more lateral roots but fewer laterals actually emerge due to defects in lateral root formation. Mutants also display disorganized columella. The root phenotypes can be traced to abnormalities in asymmetric divisions in the pericycle and root apex. Conflicting data regarding the role of the kinase domain- which may or may not be required for function. Complementation studies indicate that the C-terminal domain is also not required for signaling function. May be regulated by protein turnover which is mediated by endocytic processes. ACR4 phosphorylates the PROTEIN PHOSPHATASE 2A-3 (PP2A-3) catalytic subunit of the PP2A phosphatase holoenzyme and PP2A
AT3G09780	CRINKLY4 related 1;(source:Araport11)
AT3G55950	CRINKLY4 related 3;(source:Araport11)
AT5G47850	CRINKLY4 related 4;(source:Araport11)
AT3G28630	actin cross-linking protein, putative (DUF569);(source:Araport11)
AT4G01710	belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome.
AT4G24460	Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection.
AT5G48560	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT3G07340	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT1G10120	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT3G49390	RNA-binding protein, putative, RNA-binding protein RBP37, Arabidopsis thaliana, PIR:T04196.Member of a family of PAB2 domain containing proteins.
AT3G14450	RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain.
AT4G02120	Cytidine triphosphate synthase.
AT1G26830	Cullin, putative, similar to Cullin homolog 3 (CUL-3) SP:Q13618, GI:3639052 from (Homo sapiens); contains Pfam profile PF00888: Cullin family. Interacts with other components of E3 ligase complex suggesting it functions in RUB-modification. Forms complexes with BTB domain proteins forming a novel class of E3-based ubiquitin protein-ligase complexes. Mutant is early flowering and has a reduced sensitivity to far-red light. cul3a/cul3b homozygous/heterozygous plants are embryo lethal.
AT1G76420	Identified in an enhancer trap line; member of the NAC family of proteins. Expressed at the boundary between the shoot meristem and lateral organs and the polar nuclei in the embryo sac. Together with CUC2-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates axillary meristem initiation by directly binding to the DA1 promoter.
AT5G53950	Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2. Together with CUC3-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates the axillary meristem initiation, directly binding to the DA1 promoter.
AT4G39830	role in the degradation of ascorbate to (mono)dehydroascorbate
AT4G30140	Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence.
AT4G34180	Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development.
AT1G44542	Cyclase family protein;(source:Araport11)
AT1G19780	Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility.
AT2G46430	Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance.
AT4G30560	member of Cyclic nucleotide gated channel family. Required for constitutive growth of root hairs as Ca2+-permeable channels.
AT3G17700	cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile.
AT2G46440	Member of Cyclic nucleotide gated channel family. Positive regulator of resistance against avirulent fungal pathogen. The mRNA is cell-to-cell mobile.
AT4G30360	member of Cyclic nucleotide gated channel family
AT2G23980	Encodes a cyclic GMP-activated non-selective cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels.
AT1G17330	cGMP-activated phosphodiesterase responsible for UVA induced decrease in cGMP.
AT1G44110	Cyclin A1;(source:Araport11)
AT1G15570	A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues.
AT1G70210	Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination.
AT2G22490	encodes a D-type cyclin whose transcription level is regulated by sucrose but not phytohormones or nitrate. Protein physically interacts with CDC2A. CycD2 kinase activity is regulated by sequestration of CycD2 protein in a form inaccessible to immunoprecipitation and probably not complexed to CDC2A.
AT4G34160	encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1.
AT3G50070	Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development.
AT5G65420	Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl.
AT5G10440	Encodes a cyclin involved in cell proliferation during stomatal cell lineage development.
AT4G03270	Cyclin D6, involved in cortex/endodermis asymmetric stem cell division.
AT2G45080	cyclin p3;(source:Araport11)
AT1G27630	cyclin T 1;(source:Araport11)
AT2G38620	Encodes a member of a plant specific family of cyclin dependent kinases.
AT1G69570	CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism.
AT2G07050	Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol.
AT4G33060	Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT3G44600	Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3.
AT4G34960	Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11)
AT5G64660	CYS, MET, PRO, and GLY protein 2;(source:Araport11)
AT4G11320	Papain family cysteine protease;(source:Araport11)
AT4G36880	cysteine proteinase1;(source:Araport11)
AT4G23180	Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile.
AT4G23190	Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307)
AT4G23210	Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid.
AT4G23220	Encodes a cysteine-rich receptor-like protein kinase.
AT4G23230	Encodes a cysteine-rich receptor-like protein kinase.
AT4G23260	Encodes a cysteine-rich receptor-like protein kinase.
AT4G23310	Encodes a cysteine-rich receptor-like protein kinase.
AT4G23320	Encodes a cysteine-rich receptor-like protein kinase.
AT4G05200	Encodes a cysteine-rich receptor-like protein kinase.
AT4G38830	Encodes a cysteine-rich receptor-like protein kinase.
AT4G21230	Encodes a cysteine-rich receptor-like protein kinase.
AT4G21400	Encodes a cysteine-rich receptor-like protein kinase.
AT1G70530	Encodes a cysteine-rich receptor-like protein kinase.
AT4G11470	Encodes a cysteine-rich receptor-like protein kinase.
AT4G11530	Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile.
AT4G04490	Encodes a cysteine-rich receptor-like protein kinase.
AT4G04510	Encodes a cysteine-rich receptor-like protein kinase.
AT4G00970	Encodes a cysteine-rich receptor-like protein kinase.
AT4G23130	Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307)
AT4G23140	Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307)
AT1G70520	Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 .
AT4G22340	cytidinediphosphate diacylglycerol synthase 2;(source:Araport11)
AT2G46650	member of Cytochromes b5 The mRNA is cell-to-cell mobile.
AT5G53560	Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase.
AT1G60660	member of Cytochromes b5
AT1G02410	Encodes a member of the cytochrome c oxidase 11 protein family. It is an integral mitochondrial protein and likely plays an important role as a mitochondrial chaperone in COX complex assembly, affecting plant growth and pollen germination.
AT1G69750	cytochrome c oxidase 19-2;(source:Araport11)
AT1G22450	subunit 6b of cytochrome c oxidase
AT2G35030	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT2G17330	putative obtusifoliol 14-alpha demethylase. Expressed pseudogene.
AT1G17060	Encodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls.
AT3G61880	Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis.
AT5G04330	Cytochrome P450 superfamily protein;(source:Araport11)
AT4G15310	a member of the cytochrome P450 gene family. molecular function unknown.
AT4G15398	cytochrome P450 pseudogene
AT2G45510	member of CYP704A
AT5G42580	a member of the cytochrome P450 family
AT2G14100	a member of the cytochrome P450 family
AT3G20080	cytochrome P450, family 705, subfamily A, polypeptide 15;(source:Araport11)
AT3G20090	cytochrome P450, family 705, subfamily A, polypeptide 18;(source:Araport11)
AT4G15350	member of CYP705A
AT3G20110	member of CYP705A
AT3G20120	cytochrome P450, family 705, subfamily A, polypeptide 21;(source:Araport11)
AT3G20130	Encodes a member of the CYP705A family of cytochrome P450 enzymes. Mutants show altered gravitropic responses.
AT1G28430	member of CYP705A
AT1G50560	member of CYP705A
AT1G50520	member of CYP705A The mRNA is cell-to-cell mobile.
AT3G20935	cytochrome P450, family 705, subfamily A, polypeptide 28;(source:Araport11)
AT3G20960	cytochrome P450, family 705, subfamily A, polypeptide 33;(source:Araport11)
AT4G15380	member of CYP705A
AT5G47990	Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses.
AT2G05180	member of CYP705A
AT2G27000	member of CYP705A
AT2G27010	member of CYP705A
AT4G12300	member of CYP706A
AT4G12330	member of CYP706A
AT4G19230	Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy.
AT5G45340	Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor).
AT1G55940	cytochrome P450 family protein;(source:Araport11)
AT5G48000	Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation.
AT2G46960	member of CYP709B
AT1G13110	member of CYP71B The mRNA is cell-to-cell mobile.
AT2G30750	Putative cytochrome P450; together with CYP71A13 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth.
AT5G24960	putative cytochrome P450
AT4G13290	putative cytochrome P450
AT3G26170	putative cytochrome P450
AT1G13080	cytochrome P450 monooxygenase
AT3G26190	putative cytochrome P450
AT3G26200	putative cytochrome P450 The mRNA is cell-to-cell mobile.
AT3G26210	putative cytochrome P450 The mRNA is cell-to-cell mobile.
AT3G26230	putative cytochrome P450
AT1G13070	putative cytochrome P450
AT3G26220	cytochrome P450 monooxygenase
AT3G26300	putative cytochrome P450
AT3G26320	putative cytochrome P450
AT5G35715	encodes a protein with cytochrome P450 domain
AT2G28850	member of CYP710A
AT5G24900	Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs.
AT2G42850	cytochrome P450, family 718;(source:Araport11)
AT3G14680	putative cytochrome P450
AT3G14610	putative cytochrome P450
AT3G14620	putative cytochrome P450 The mRNA is cell-to-cell mobile.
AT1G75130	member of CYP721A
AT1G19630	cytochrome P450, family 722, subfamily A, polypeptide 1;(source:Araport11)
AT5G38450	cytochrome P450, family 735, subfamily A, polypeptide 1;(source:Araport11)
AT1G67110	cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11)
AT2G45580	cytochrome P450, family 76, subfamily C, polypeptide 3;(source:Araport11)
AT2G45550	Member of CYP76C family of cytochrome P450 enzymes.Has geraniol 9- or 8-hydroxylase activity.
AT1G13710	Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell.
AT1G01190	cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11)
AT4G39950	Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile.
AT5G36220	member of CYP81D family of cytochrome p450s. This gene was originally called CYP91A1, but was later renamed to CYP81D1.
AT4G37340	member of CYP81D
AT2G23190	member of CYP81D
AT4G37400	member of CYP81F
AT5G10610	member of CYP81K The mRNA is cell-to-cell mobile.
AT5G10600	member of CYP81K
AT4G31970	Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. CYP82C2 acts as a hydroxylase on indole-3-carbonyl nitrile to generate 4-OH-ICN.
AT4G31950	member of CYP82C
AT4G31940	The gene encodes a cytochrome P450 enzyme, CYP82C. It is involved in the early Fe deficiency response.CYP82C4 hydroxylates fraxetin to generate sideretin (5-hydroxyfraxetin). Fraxetin and sideretin are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.The mRNA is cell-to-cell mobile.
AT2G25160	cytochrome P450, family 82, subfamily F, polypeptide 1;(source:Araport11)
AT4G13770	Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis.
AT4G31500	Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction.
AT5G58860	Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue.
AT4G00360	Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.
AT1G01600	Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers.
AT1G63710	Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers.
AT2G45970	Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347).
AT1G24540	member of CYP86C
AT1G64900	Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile.
AT5G63450	AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance.
AT3G01900	member of CYP94B
AT2G23180	member of CYP96A
AT5G02900	member of CYP96A
AT1G65340	member of CYP96A
AT5G52320	cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11)
AT2G40890	encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level.
AT2G39770	Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+.
AT2G19500	It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.
AT4G29740	It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.
AT5G21482	This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate.
AT2G41510	It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on zeatin 9-riboside-50-triphosphate substrate.
AT4G11140	Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin.
AT3G25890	encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile.
AT5G53290	encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin.
AT4G27950	Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin.
AT2G46310	CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves.
AT2G43230	Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA.
AT1G35580	CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9.
AT4G09510	CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues.
AT1G04270	Encodes cytosolic ribosomal protein S15.
AT4G36400	Encodes a (D)-2-hydroxyglutarate dehydrogenase.
AT3G17090	Protein phosphatase 2C family protein;(source:Araport11)
AT3G12620	Protein phosphatase 2C family protein;(source:Araport11)
AT3G55050	Protein phosphatase 2C family protein;(source:Araport11)
AT3G51370	Protein phosphatase 2C family protein;(source:Araport11)
AT4G39800	** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT3G24420	DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism.
AT1G19270	Encodes a ubiquitin-activated peptidase that is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. Together with CUC2/CUC3-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture.
AT1G78420	Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth.
AT4G36860	DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue.
AT5G17890	Encodes a protein that appears to be involved in defense responses. Contains TIR, NB-LRR and LIM domains. A gain of function allele exhibits cold dependent phenotypes including apparent activation of defense responses and an increased freezing tolerance. The mRNA is cell-to-cell mobile.
AT5G66620	DA1-related protein 6;(source:Araport11)
AT1G30370	Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability.
AT4G18550	DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings.
AT4G05420	Structurally similar to damaged DNA binding proteins. DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. DDB1a is shown to be RUB-modified.
AT3G60140	Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile.
AT1G67070	Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell.
AT4G31160	Encodes a DCAF/DWD protein capable of interacting with DDB1 and associating with CUL4, likely as part of a nuclear ubiquitin ligase complex. DCAF1 appears to be required for plant embryogenesis and to affect several other developmental processes including leaf, shoot, and flower development.
AT2G38050	Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway.
AT1G12840	Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. The mRNA is cell-to-cell mobile.
AT1G03310	Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex.
AT5G13570	Encodes DCP2 with mRNA decapping activity. DCP2 forms a mRNA decapping complex with DCP1 (At1g08370) and VCS (VARICOSE) (At3g13300). Recombinant DCP2 is enzymatically active in vitro, generating from capped mRNAs m7GDP, and 5?-phosphorylated mRNAs. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP1.
AT1G26110	Encodes Decapping 5, required for mRNA decapping, P-body formation and translational repression during postembryonic development.
AT1G17400	Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle.
AT4G33400	Together with DEM2 plays an essential role in cell division in plants, most likely through an interaction with RAN1.
AT3G19240	Together with DEM1 plays an essential role in cell division in plants, most likely through an interaction with RAN1.
AT3G09090	Encodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development.
AT2G16390	Putative chromatin remodeling protein, member of a plant-specific subfamily of SWI2/SNF2-like proteins. Mutations nearly eliminate non-CpG methylation at a target promoter but do not affect rDNA or centromere methylation. Cooperates with PolIVb to facilitate RNA-directed de novo methylation and silencing of homologous DNA. Endogenous targets include intergenic regions near retrotransposon LTRs or short RNA encoding sequences that might epigenetically regulate adjacent genes. May be used to establish a basal yet reversible level of silencing in euchromatin.
AT1G55350	Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm.
AT4G11393	Encodes a defensin-like (DEFL) family protein.
AT3G16550	Encodes a putative DegP protease.
AT3G03380	Encodes a putative DegP protease. The mRNA is cell-to-cell mobile.
AT5G39830	Encodes DEG8. Forms a hexamer with DEG5 in the thylakoid lumen. Involved in the cleavage of photodamaged D2 protein of photosystem II (PSII). Recombinant DEG8 is proteolytically active toward both a model substrate (beta-casein) and photodamaged D1 protein of photosystem II.
AT5G45380	urea-proton symporter DEGRADATION OF UREA 3 (DUR3);(source:Araport11)
AT1G21910	encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10.
AT1G54410	Encodes a KS-type dehydrin can reduce the formation of reactive oxygen species (ROS) from Cu.
AT2G21490	dehydrin LEA;(source:Araport11)
AT1G64750	Involved in the maintenance of genome integrity through homologous recombination. This function of DSS1 is performed through its interaction with the BRCA2 protein.
AT3G55610	encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development.
AT1G48760	Encodes the putative delta subunit of the AP(adaptor protein)-3 complex and plays a role in vacuolar function.
AT2G39800	encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner.
AT5G04560	Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele.
AT3G10010	Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks.
AT1G11500	DUF1218 family member.
AT3G23550	MATE efflux family protein;(source:Araport11)
AT5G52050	MATE efflux family protein;(source:Araport11)
AT5G06250	Transcription repressor involved in regulation of inflorescence architecture.
AT5G12290	Encodes a mitochondrial outer membrane protein that is found in a complex with MIC60, TOM40, RISP and TOM20. Involved in galactoglycerolipid biosynthesis/lipid homeostasis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background.
AT3G51520	Encodes a functional acyl-CoA:diacylglycerol acyltransferase with different acyl-CoA substrate preferences and shows higher DAG to TAG conversion rate than AtDGAT1. It increases both C18:2 and C18:3 polyunsaturated fatty acids at the expense of C16:0.
AT1G48300	Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity).
AT5G63770	a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold.
AT4G24570	Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile.
AT5G64290	dicarboxylate transport 2.1;(source:Araport11)
AT3G03300	Encodes a Dicer-like protein that functions in the antiviral silencing response in turnip-crinkle virus-infected plants but not in TMV or CMV-strain-Y-infected plants. Involved in the production of ta-siRNAs. Partially antagonizes the production of miRNAs by DCL1. Substitutes for DCL4 to produce viral siRNA when DCL4 is missing or inhibited. Able to produce siRNAs but not miRNAs.
AT3G43920	Encodes a ribonuclease III family protein that is required for endogenous RDR2-dependent siRNA (but not miRNA) formation.
AT4G34570	Encodes a bifunctional dihydrofolate reductase - thymidylate synthase gene. This is unique in Arabidopsis and protozoa. Other organisms have independent genes for this function.
AT1G27980	Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response.
AT1G51360	Involved in defense against fungal pathogens and located in cytosol.
AT4G23690	Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol.
AT5G04760	R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis.
AT4G38000	DNA binding with one finger 4.7;(source:Araport11)
AT5G04130	Encodes a protein that when expressed together with GYRA generates an active supercoiling DNA gyrase enzyme that shares similar properties to its bacterial counterpart, including sensitivity to gyrase-specific antibiotics.
AT3G17830	Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11)
AT1G80030	Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11)
AT3G13310	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT1G08130	Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. In addition, it is an important component of the active DNA demethylation machinery and is indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus.
AT1G66730	Encodes a novel plant specific DNA ligase that is involved in seed germination and DNA repair.
AT4G14140	This gene is predicted to encode a DNA methyltransferase. A plant line expressing an RNAi construct directed against DMT2 has reduced agrobacterium-mediated tumor formation.
AT1G67630	DNA polymerase alpha 2;(source:Araport11)
AT1G10520	Encodes a homolog of the mammalian DNA polymerase lambda that is involved in the repair of UV-B induced DNA damage.
AT5G55310	Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality.
AT4G21040	Dof-type zinc finger domain-containing protein;(source:Araport11)
AT4G21080	Dof-type zinc finger domain-containing protein;(source:Araport11)
AT3G13235	ubiquitin family protein;(source:Araport11)
AT1G51700	Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile.
AT3G21270	Encodes Dof zinc finger protein adof2.
AT3G19800	Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence.
AT2G46840	Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype. Overexpression increases plant organ size, possibly by influencing the expression of the cell wall formation and auxin transporter genes that regulate cell size.
AT2G47230	Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins.
AT3G62300	Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype.
AT5G14620	A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues.
AT3G17310	Encodes DRM3 (Domains Rearranged Methyltransferase3), a catalytically mutated paralog of the cytosine methyltransferase DRM2. Despite being catalytically mutated, DRM3 is required for normal maintenance of non-CG DNA methylation, establishment of RNA-directed DNA methylation triggered by repeat sequences and accumulation of repeat-associated small RNAs.
AT4G12010	Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. Co-regulates with WRKY19 basal levels of immunity to root-knot nematodes.
AT5G18370	Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity.
AT2G36800	Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype.
AT1G05800	Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues.
AT4G25670	stress response NST1-like protein;(source:Araport11)
AT4G22470	Encodes a hybrid proline-rich protein that contains two tandem PRD-8CMs (proline-rich domain-eight cysteine motif) that is involved in systemic acquired resistance.
AT1G45190	downregulated in DIF1 18;(source:Araport11)
AT2G45830	downstream target of AGL15 2;(source:Araport11)
AT5G24530	Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile.
AT3G48160	E2F-like protein, an inhibitor of the endocycle, preserves the mitotic state of proliferating cells by suppressing transcription of genes that are required for cells to enter the DNA endoreduplication cycle.
AT3G01330	Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway.
AT1G59660	Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control.
AT1G06770	Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. The DRIP1-GFP fusion protein is nuclear-localized. DRIP1 seems to be involved in regulating stress-related transcriptional changes and drought tolerance.
AT5G17460	glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11)
AT1G73330	encodes a plant-specific protease inhibitor-like protein whose transcript level in root disappears in response to progressive drought stress. The decrease in transcript level is independent from abscisic acid level.
AT5G55970	Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase.
AT5G41070	Encodes a double-stranded RNA binding protein.
AT3G23610	Encodes a dual specificity protein phosphatase whose activity is modulated by CaM binding.
AT5G03390	hypothetical protein (DUF295);(source:Araport11)
AT5G46130	hypothetical protein (DUF295);(source:Araport11)
AT5G46140	hypothetical protein (DUF295);(source:Araport11)
AT5G55440	F-box protein, putative (DUF295);(source:Araport11)
AT1G05550	DUF295 domain protein of unknown function. Expressed in ovule integuments and nucellus.
AT5G55270	hypothetical protein (DUF295);(source:Araport11)
AT5G52940	DUF295 domain protein.
AT3G21550	transmembrane protein, putative (DUF679 domain membrane protein 2);(source:Araport11)
AT4G24310	transmembrane protein, putative (DUF679);(source:Araport11)
AT3G02430	transmembrane protein, putative (DUF679);(source:Araport11)
AT3G62230	Target promoter of the male germline-specific transcription factor DUO1. Increases seed oil content by attenuating GL2 inhibition. Overexpression results in reduced trichome numbers.
AT4G35560	Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile.
AT3G19820	Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein.
AT3G50660	Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate.
AT5G54510	Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3).
AT4G03400	Encodes a GH3-related gene involved in red light-specific hypocotyl elongation. Analysis of sense and antisense transgenic plants suggests that DFL2 is located downstream of red light signal transduction and determines the degree of hypocotyl elongation.
AT1G03055	Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway.
AT2G14120	Encodes a dynamin related protein. DRPs are self-assembling GTPasse involved in fission and fusion of membranes. DRP3B functions in mitochondrion and peroxisome fission in combination with DRP3A.
AT1G14830	Encodes a dynamin-like protein that is involved in mitochondrial morphogenesis and pollen development. Protein is localized as speckles in the cytoplasm, partially co-localizes with mitochondrial markers, cell plate of dividing cells, and the tip of root hairs, root cap cells, and expanding part of trichoblasts.
AT5G42080	Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis.
AT2G15690	Encodes an atypical PPR-DYW protein containing five predicted PPR domains and a C-terminal DYW domain separated by an amino acid sequence that do not clearly correspond to an E domain. It is expressed in both the mitochondrion and chloroplast and is also involved in RNA editing in the mitochondrion and chloroplast as a core member of E+-type PPR editosomes.
AT3G05640	EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane.
AT5G27930	EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane.
AT2G40550	Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression. Required for sister chromatid cohesion and DNA repair.
AT2G36010	Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway.
AT2G33850	Stigmatic factor that plays a role during the early post-pollination stages.
AT4G12480	Encodes a putative lipid transfer protein, vernalization-responsive and cold-induced. It is involved in priming the SAR and ISR responses, specifically in propagating the cell-to-cell mobile signal. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction.
AT2G40080	Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback loop involving the circadian clock central oscillator components CCA1 and LHY. ELF4 is necessary for light-induced expression of both CCA1 and LHY, and conversely, CCA1 and LHY act negatively on light-induced ELF4 expression. ELF4 promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. It is involved in the phyB-mediated constant red light induced seedling de-etiolation process and may function to coregulate the expression of a subset of phyB-regulated genes.
AT5G04240	Early Flowering 6 (ELF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a repressor in the photoperiod pathway. ELF6 interacts with BES1 in a Y2H assay, in vitro, and in Arabidosis protoplasts (based on BiFC). ELF6 may play a role in brassinosteroid signaling by affecting histone methylation in the promoters of BR-responsive genes.
AT5G19700	Encodes a MATE transporter involved in leaf senescence and iron homeostasis.
AT4G14690	Encodes an early light-induced protein. ELIPs are thought not to be directly involved in the synthesis and assembly of specific photosynthetic complexes, but rather affect the biogenesis of all chlorophyll-binding complexes. A study (PMID 17553115) has shown that the chlorophyll synthesis pathway was downregulated as a result of constitutive ELIP2 expression, leading to decreased chlorophyll availability for the assembly of pigment-binding proteins for photosynthesis.
AT2G25060	early nodulin-like protein 14;(source:Araport11)
AT3G01070	early nodulin-like protein 16;(source:Araport11)
AT5G15350	early nodulin-like protein 17;(source:Araport11)
AT1G08500	early nodulin-like protein 18;(source:Araport11)
AT1G17800	early nodulin-like protein 22;(source:Araport11)
AT1G48940	early nodulin-like protein 6;(source:Araport11)
AT3G30775	Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element.
AT4G24510	Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function.
AT5G57800	encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile.
AT3G60500	Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis.
AT4G34100	Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid.
AT3G55830	A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation.
AT5G56780	Encodes a transcriptional regulator that is required for the induction of dormancy during late seed development.ET2 contains DNA and Zinc binding domains and is involved in DNA methylation. ET2 may function in DNA repair.
AT4G39340	Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion.
AT1G54270	member of eIF4A - eukaryotic initiation factor 4A
AT4G24800	MA3 domain-containing protein;(source:Araport11)
AT3G18910	EIN2 targeting protein2;(source:Araport11)
AT1G50940	Encodes the electron transfer flavoprotein ETF alpha, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF beta is At5g43430.1) in Arabidopsis. Mutations of the ETF beta gene results in accelerated senescence and early death compared to wild-type during extended darkness.
AT4G16355	Produces a long non-coding RNA that enhances resistance against Pseudomonas syringe pv. tomato DC3000. It directly interacts with Mediator subunit 19a and enhances the expression of innate immune response genes, like PR1.
AT2G29950	Member of a small family of proteins containing DUF1313 domain. Involved in flowering time.
AT1G72630	ELF4-like 2;(source:Araport11)
AT1G17455	ELF4-like 4;(source:Araport11)
AT5G64905	elicitor peptide 3 precursor;(source:Araport11)
AT2G22000	elicitor peptide 6 precursor;(source:Araport11)
AT5G09978	elicitor peptide 7 precursor;(source:Araport11)
AT1G75000	ELO family protein.
AT5G11260	Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels.
AT2G45330	RNA 2-phosphotransferase, Tpt1 / KptA family;(source:Araport11)
AT4G23250	cysteine-rich receptor-like protein kinase 17;(source:Araport11)
AT1G56200	Encodes a chloroplast localized protein that is essential for chloroplast development.
AT2G26060	Encodes a homolog of the yeast Cytosolic Iron-sulfur protein Assembly protein CIA1.
AT5G49930	zinc knuckle (CCHC-type) family protein;(source:Araport11)
AT2G37920	copper ion transmembrane transporter;(source:Araport11)
AT3G54350	Forkhead-associated (FHA) domain-containing protein;(source:Araport11)
AT2G28880	ADCS encodes a protein that has two functional domains. The N-terminal domain has glutamine amidotransferase activity while the C-terminal domain has aminodeoxychorismate synthase (ADCS) activity. These two domains act together to catalyze the transformation of chorismate to 4-amino-4-deoxychorismate. This reaction is required for 4-aminobenzoate (pABA) production and ultimately for folate biosynthesis. The putative target peptide of ADCS can direct GFP to the chloroplast.
AT3G16290	Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357).
AT1G02780	Ribosomal protein L19e family protein;(source:Araport11)
AT3G48470	embryo defective 2423;(source:Araport11)
AT2G41720	Encodes a pentatricopeptide repeat protein that is essential for trans-splicing of a chloroplast small ribosomal subunit transcript.
AT3G20440	Encodes BE1, a putative glycoside hydrolase. Involved in organogenesis and somatic embryogenesis by regulating carbohydrate metabolism. Mutation in BE1 has pleotrophic effect on the whole plant development.
AT3G12080	Encodes a putative plastid-targeted GTP-binding protein that is essential for embryogenesis and chloroplast development.
AT4G14590	embryo defective 2739;(source:Araport11)
AT5G39680	Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11)
AT5G63420	Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA.
AT2G38770	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G45000	Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal.
AT3G02660	Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial;(source:Araport11)
AT5G15540	Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis.
AT2G31060	elongation factor family protein;(source:Araport11)
AT2G32590	condensin complex subunit;(source:Araport11)
AT2G39080	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G03870	Small nuclear ribonucleoprotein family protein;(source:Araport11)
AT5G40480	embryo defective 3012;(source:Araport11)
AT2G36000	Encodes an mTERF protein localized in the chloroplast stroma.
AT3G14900	hypothetical protein;(source:Araport11)
AT4G00620	Amino acid dehydrogenase family protein;(source:Araport11)
AT5G14320	Ribosomal protein S13/S18 family;(source:Araport11)
AT5G51200	Originally identified as EDS4, enhanced disease sensitive phenotype and subsequently cloned and identified as NUCLEOPORIN205. Affects circadian clock and downstream genes including those involved in defense response.
AT2G30200	Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content.
AT2G01860	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT1G01960	Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking.
AT2G35950	embryo sac development arrest 12;(source:Araport11)
AT2G34920	RING/U-box superfamily protein;(source:Araport11)
AT4G13235	Encodes a defensin-like (DEFL) family protein.
AT1G70540	Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11)
AT2G34860	DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development.
AT3G10000	Homeodomain-like superfamily protein;(source:Araport11)
AT4G00140	Calcium-binding EF-hand family protein;(source:Araport11)
AT4G13890	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11)
AT4G33050	Encodes a calmodulin-binding protein involved in stomatal movement.
AT4G37890	Involved in shoot regenaration from root explants.
AT3G23440	embryo sac development arrest 6;(source:Araport11)
AT4G00310	Putative membrane lipoprotein;(source:Araport11)
AT1G10745	Encodes a Maternally expressed gene (MEG) family protein
AT5G51430	Encodes a protein that is homologous to Cog7, a subunit of the conserved oligomeric Golgi (COG) complex, which is required for the normal morphology and function of the Golgi apparatus. It is likely to be involved in transport or retention of Golgi-localized proteins and in maintenance of Golgi morphology.
AT5G51230	Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3.
AT5G64360	EIP9 interacts with EMF1 to regulate flowering. It functions partially redundantly with SDJ2 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes.
AT3G12140	Agenet domain containing nucleosome binding protein. Binds H3K36 sites.
AT5G62500	Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis.
AT1G32280	Encodes a homolog of the barley endosperm-specific gene END1 with seed and pollen specific expression.
AT5G05460	Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine.
AT1G72280	Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state.
AT2G38960	Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO2 is mainly present in the Ox2 redox state.
AT1G29330	Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves.
AT3G09030	EAP3 is a cytolsolic BTB/POZ-domain protein involved in trafficking of PEN3.
AT1G10130	Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis.
AT5G05190	hypothetical protein (DUF3133);(source:Araport11)
AT4G39030	Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient.
AT1G74710	Encodes a protein with isochorismate synthase activity. Mutants fail to accumulate salicylic acid. Its function may be redundant with that of ICS2 (AT1G18870).
AT1G17440	Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis.
AT1G11300	The annotation for At1g11300 in TAIR10 is incorrect. This locus has been split into two At1g11300 (symbol: EGM1) and At1g11305 (symbol: EGM2) (Olivier Loudet, personal communication, 2013-04-03). See Comment field for revised annotation.
AT1G63650	Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY.
AT4G31820	A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development.
AT5G10810	enhancer of rudimentary homolog ATER
AT3G13437	Brassicaceae specific gene. Overexpression results in Verticillium wilt resistance.
AT2G20875	Encodes a secretory peptide EPF1 involved in stomatal development. EPF1 is related to EPF2 which controls asymmetric cell divisions during stomatal devlopment. Its transcript levels change after inducing MUTE expression in a mute background.
AT1G34245	Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM.
AT3G13898	Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis.
AT4G05520	Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290).
AT4G05130	equilibrative nucleoside transporter 4;(source:Araport11)
AT1G70330	encodes an adenosine transporter that catalyze a proton-dependent adenosine transport. The mRNA is cell-to-cell mobile.
AT4G00900	Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm.
AT1G75220	Encodes a vacuolar glucose exporter that is induced in response to factors that activate vacuolar glucose pools like darkness, heat stress and wounding and repressed during conditions that trigger glucose accumulation in the vacuole like cold stress and external sugar supply.
AT2G20880	Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response.
AT5G44210	encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT3G55990	Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile.
AT2G01480	ESMD1 is a golgi localized putative O-fucosyltransferase.
AT1G47370	RBA1 variant in Ag0 background is a TIR-only receptor protein that binds to the bacterial type III effector protein HopBA. The Col-0 variant, which is not expressed, is likely a psuedogene and more highly methylated than the Ag0 variant which is expressed.
AT5G43060	Peptidase, activity detected in extracts of root, leaf and cell culture.
AT5G42950	EXA1 is a GYF domain-containing gene of the SMY2 subgroup. Mutants exhibit resistance to potexviruses.
AT2G21800	Forms a complex with MUS81 that functions as endonuclease in DNA recombination and repair processes.
AT2G25820	encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
AT5G03280	Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile.
AT3G23240	encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3.
AT5G61600	encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture.
AT5G07310	encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting.
AT3G16280	encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY.
AT3G20310	Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19.
AT1G53170	encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole.
AT5G43410	Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Expression of ERF96 is induced by pathogens, JA and ethylene and over expression leads to increased resistance to resistance to necrotrophic pathogens. It is a nuclear localized, transcriptional activator that binds to GCC elements that is involved in positive regulation of ABA responses.
AT2G40940	Ethylene receptor, subfamily 1. Has histidine kinase activity.
AT4G17500	Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile.
AT1G05010	Encodes 1-aminocyclopropane-1-carboxylate oxidase
AT3G20770	Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. EIN3 interacts with MYC2, MYC3 and MYC4 to inhibit jasmonate-induced expression of wound-responsive genes and herbivory-inducible genes, and plant defense against generalist herbivores.
AT1G73730	Encodes a putative transcription factor involved in ethylene and sulfate starvation signalling. Isolated DNA binding domain has been shown to bind DNA in vitro.
AT1G04370	encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
AT2G31230	encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
AT2G33860	ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes.
AT1G69410	Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410.
AT5G25780	member of eIF3b - eukaryotic initiation factor 3b
AT3G26400	member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile.
AT4G18040	eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein.
AT5G57870	Encodes a putative eukaryotic translation initiation factor The mRNA is cell-to-cell mobile.
AT5G27700	Cytosolic ribosomal protein. Similar to EVR1 and redundant with EVR1. Also enhances VAR2 mutant varigation, but to a lesser extent than evr1.
AT3G17330	evolutionarily conserved C-terminal region 6;(source:Araport11)
AT5G07280	Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther.
AT3G54150	Encodes a DNA methyltransferase required for pollen exine formation and male fertility via the regulation of callose wall and primexine formation.
AT1G10180	LOW protein: exocyst complex component-like protein;(source:Araport11)
AT4G02350	Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile.
AT1G76850	Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile.
AT5G52350	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G58430	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. Targeted by AvrPtoB to manipulate the defense molecule secretion machinery.
AT1G07000	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G13990	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane and is not found to colocalize with or interact with core exocyst subunits.
AT3G29400	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G61010	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G50380	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT3G55150	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT2G39380	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT2G28640	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree.
AT5G59730	A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. The mRNA is cell-to-cell mobile.
AT2G35150	Encodes EXORDIUM LIKE 7.
AT5G56320	member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT2G03090	member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT4G01630	member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT3G29365	member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT5G39280	member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT2G39700	putative expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT2G28950	Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT2G40610	member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana.
AT5G02260	member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT3G45960	member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio)
AT5G17020	Encodes a member of the exportin protein family (XPO1A) which functions as receptors for nuclear export. Binds to a variety of proteins having leucine rich export signals.Along with XPO1B involved with development of the male and female gametophytes. Sensitive to heat and oxidative stress.
AT3G03110	Encodes a member of the exportin family (XPO1B)which function as receptors for nuclear transport.Along with XPO1A involved in the development of male and female gametophytes.
AT5G35190	proline-rich extensin-like family protein;(source:Araport11)
AT1G23720	Proline-rich extensin-like family protein;(source:Araport11)
AT3G28550	Proline-rich extensin-like family protein;(source:Araport11)
AT2G43150	Proline-rich extensin-like family protein;(source:Araport11)
AT4G08380	Proline-rich extensin-like family protein;(source:Araport11)
AT1G21310	Encodes extensin 3.
AT1G70990	Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility.
AT1G76930	Encodes an Arabidopsis extensin gene that belongs to cell-wall hydroxyproline-rich glycoproteins. The cross-link of extensins enforces cell wall strength. Transgenic plants overexpressing this gene show an increase in stem thickness.
AT3G57630	Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype.
AT4G34390	extra-large GTP-binding protein 2;(source:Araport11)
AT1G31930	Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses.
AT1G75930	member of Lipase proteins
AT3G14100	Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes.
AT4G08980	Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins.
AT2G17036	F-box SKIP23-like protein (DUF295);(source:Araport11)
AT2G24250	LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11)
AT2G24255	LOW protein: F-box/kelch-repeat protein;(source:Araport11)
AT4G35733	F-box SKIP23-like protein (DUF295);(source:Araport11)
AT5G24040	F-box SKIP23-like protein (DUF295);(source:Araport11)
AT1G57906	F-box protein;(source:Araport11)
AT2G05970	F-box protein (DUF295);(source:Araport11)
AT2G14290	LL-diaminopimelate protein (DUF295);(source:Araport11)
AT2G33200	F-box family protein;(source:Araport11)
AT4G14165	F-box family protein-like protein;(source:Araport11)
AT4G17565	F-box protein (DUF295);(source:Araport11)
AT4G22030	F-box protein with a domain protein;(source:Araport11)
AT4G22170	F-box protein (DUF295);(source:Araport11)
AT5G38270	F-box family protein;(source:Araport11)
AT1G27580	F-box protein (DUF295);(source:Araport11)
AT2G04810	F-box only protein (DUF295);(source:Araport11)
AT1G15910	Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5).
AT1G13790	Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5).
AT1G26380	Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile.
AT1G35530	Encodes FANCM, a highly conserved helicase that functions as a major factor limiting meiotic crossover formation. It is not directly involved in the repair of DNA lesions but suppresses spontaneous somatic homologous recombination via a RecQ helicase (At-RECQ4A)-independent pathway.
AT4G14970	Encodes a protein that is required for meiotic homologous recombination and acts in parallel to both MUTS HOMOLOG 4 (AtMSH4), known for its role in promoting interfering cross-overs (COs) and MMS AND UV SENSITIVE 81 (AtMUS81), known for its role in the formation of non-interfering COs.
AT1G03170	A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines.
AT2G37678	Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus.
AT4G19990	FAR1-related sequence 1;(source:Araport11)
AT1G76320	FAR1-related sequence 4;(source:Araport11)
AT3G59470	Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. FRF1 has been shown to bind the RB-box in vitro. The RB-box contributes to restricting SHOOTMERISTEMLESS expression to the shoot apical meristem.
AT3G07500	Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins.
AT4G33360	Encodes an NAD+-dependent dehydrogenase that oxidizes farnesol more efficiently than other prenyl alcohol substrates.
AT5G63530	Farnesylated protein that binds metals.
AT2G36305	Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast.
AT5G63910	Encodes a farnesylcysteine lyase (EC 1.8.3.5) involved in a salvage /detoxification pathway of farnesylcysteine (FC) residues that are liberated during the degradation of prenylated proteins. Because FC is a competitive inhibitor of prenylcysteine methyltransferases involved in the down-regulation of ABA signaling, fcly mutants with elevated FC levels are hypersensitive to ABA. The protein also appears to be glycosylated when translated in vitro in the presence of microsomal membranes and it likely requires FAD for enzymatic activity.
AT5G64630	Chromatin Assembly Factor-1 (CAF-1) p60 subunit. Involved in organization of the shoot and root apical meristems. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis.
AT5G55730	Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development.
AT3G52370	Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development.
AT3G11700	Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development.
AT1G15190	Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development.
AT4G31370	fasciclin-like arabinogalactan-protein, putative (FLA5)
AT5G18580	fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system.
AT4G30950	Chloroplastic enzyme responsible for the synthesis of 16:2 and 18:2 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation resulted in reduced level of unsaturated fatty acids leading to susceptibility to photoinhibition.
AT3G57280	Encodes a chloroplast inner envelope localized member of the Tmemb_14 gene family. FAX1 is involved in fatty acid and lipid homeostasis and likely functions as a fatty acid transporter that exports fatty acids from the plastid. The mRNA is cell-to-cell mobile.
AT2G38550	Mediates fatty acid transport from plastid.
AT2G34770	encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death.
AT5G22500	Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue.
AT3G44540	Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile.
AT4G13985	FBD-associated F-box protein;(source:Araport11)
AT1G57790	F-box family protein;(source:Araport11)
AT5G55150	F-box SKIP23-like protein (DUF295);(source:Araport11)
AT2G30766	Functions in iron homeostasis, activates iron deficiency response genes such as bHLH38, bHLH39, IRT1, and FRO2.
AT1G47400	Involved in regulation of iron deficiency response genes. Overexpression results in hyperaccumulation of Fe and Mn.
AT1G31420	Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.
AT2G28160	Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled.
AT3G51550	Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER.
AT2G27510	ferredoxin 3;(source:Araport11)
AT1G01590	Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings.
AT1G01580	Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1.
AT1G23020	Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon.
AT5G23990	Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons.
AT5G50160	Encodes a ferric chelate reductase that is expressed in shoots and flowers.
AT5G26030	encodes ferrochelatase I located in plastids. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins The mRNA is cell-to-cell mobile.
AT1G26870	NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions.
AT4G22910	FIZZY-related 2;(source:Araport11)
AT5G46330	Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile.
AT1G19250	FMO1 is required for full expression of TIR-NB-LRR conditioned resistance to avirulent pathogens and for basal resistance to invasive virulent pathogens. Functions in an EDS1-regulated but SA-independent mechanism that promotes resistance and cell death at pathogen infection sites. FMO1 functions as a pipecolate N-hydroxylase and catalyzes the biochemical conversion of pipecolic acid to N-hydroxypipecolic acid (NHP). NHP systemically accumulates in the plant foliage and induces systemic acquired resistance to pathogen infection.
AT1G62560	belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile.
AT1G12140	Encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates. It is a suppressor of the bp mutant phenotype.
AT5G54500	Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene.
AT5G63595	flavonol synthase 4;(source:Araport11)
AT2G19190	Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6.
AT3G12145	A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor.
AT5G25260	Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking.
AT5G25250	Encodes a protein that is involved in a membrane microdomain-dependent, but clathrin-independent, endocytic pathway required for optimal seedling development. The mRNA is cell-to-cell mobile.
AT1G35460	Encodes a bHLH transcription factor involved in CFL1-mediated regulation of cuticle development. Overexpression leads to abnormal cuticle development.
AT5G10140	MADS-box protein encoded by FLOWERING LOCUS C - transcription factor that functions as a repressor of floral transition and contributes to temperature compensation of the circadian clock. Expression is downregulated during cold treatment. Vernalization, FRI and the autonomous pathway all influence the state of FLC chromatin. Both maternal and paternal alleles are reset by vernalization, but their earliest activation differs in timing and location. Histone H3 trimethylation at lysine 4 and histone acetylation are associated with active FLC expression, whereas histone deacetylation and histone H3 dimethylation at lysines 9 and 27 are involved in FLC repression. Expression is also repressed by two small RNAs (30- and 24-nt) complementary to the FLC sense strand 3? to the polyA site. The small RNAs are most likely derived from an antisense transcript of FLC. Interacts with SOC1 and FT chromatin in vivo. Member of a protein complex.
AT1G65480	FT, together with LFY, promotes flowering and is antagonistic with its homologous gene, TERMINAL FLOWER1 (TFL1). Together with TSF, it plays an antagonistic role to TFL1 in the determination of inflorescence meristem identity. FT is expressed in leaves and is induced by long day treatment. Either the FT mRNA or protein is translocated to the shoot apex where it induces its own expression. Recent data suggests that FT protein acts as a long-range signal. FT is a target of CO and acts upstream of SOC1.
AT3G63300	Encodes a pleckstrin homology domain- and DUF828-containing protein. Mutants have defects in leaf vascular pattering, with vascular bundles that fail to meet distally in both the cotyledons and leaves. Necessary to the formation of the closed leaf vascular pattern characteristic of dicot leaves in response to auxin. Redundant with FKD2. FKD1 may influence PIN1 localization in an auxin dependent manner. proposed to be a key component of the auxin canalization pathway. FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions.
AT4G16670	FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions.
AT3G07540	Actin-binding FH2 (formin homology 2) family protein;(source:Araport11)
AT1G70140	Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton.
AT5G07770	Actin-binding FH2 protein;(source:Araport11)
AT5G07780	Encodes a class II formin that nucleates actin assembly, binds to the barbed-end of actin filaments and antagonizes the effect of FH1 on actin dynamics. The mRNA is cell-to-cell mobile.
AT1G24150	Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense.
AT1G59910	Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains.
AT1G31810	Encodes the Type II Arabidopsis formin14. Interacts with microtubules and microfilaments to regulate cell division.
AT5G54650	Encodes a protein with similarity to formins that is involved in cytokinesis. Loss of function mutations exhibit delayed cellularization during endosperm development. FH5 is expressed in the endosperm and the protein localizes to the cell plate. FH5 was shown to be a maternally expressed imprinted gene.
AT4G33240	Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant.
AT1G34260	Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile.
AT4G31380	encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves.
AT5G22940	Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase.
AT5G47820	Encodes a kinesin-like protein with an N-terminal microtubule binding motor domain. Protein is localized to the periphery of the cytoplasm and mutants in the gene exhibit altered orientation of cellulose microfibrils and reduced mechanical strength of fibers.
AT5G51830	Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development.
AT1G06030	Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens).
AT5G03690	Aldolase superfamily protein;(source:Araport11)
AT2G36460	Aldolase superfamily protein;(source:Araport11)
AT1G50250	encodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes.
AT5G15250	Encodes an FtsH protease that is localized to the chloroplast. AtFtsH6 is involved in the degradation of both Lhcb3 and Lhcb1 during senescence and high-light acclimation.
AT1G06430	encodes a FtsH protease that is localized to the chloroplast
AT2G15350	member of Glycosyltransferase Family- 37
AT2G15390	Encodes an alpha-(1,2)-fucosyltransferase.
AT2G15370	Predicted fucosyltransferase, based on similarity to FUT1, but not functionally redundant with FUT1.
AT4G24740	a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins.
AT3G61140	Represses photomorphogenesis and induces skotomorphogenesis in the dark. Component of the nuclear-localized COP9 complex. Mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons, first become defective during embryogenesis and exhibit limited seedling development.
AT3G26790	Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed.
AT2G46270	encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2.
AT4G34590	Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection.
AT5G10450	Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation.
AT5G45580	GARP-G2-like transcription factor involved in low temperature regulation of flavonoid biosynthesis.
AT3G05120	Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The DELLA region alone can interact with GID1A in GA-dependent manner in a Y2H assay.
AT5G27320	Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4.
AT2G47180	GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress.
AT1G60470	Predicted to encode a galactinol synthase.
AT5G23790	Predicted to encode a galactinol synthase.
AT3G53950	Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification.
AT1G75620	Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification.
AT3G10700	Encodes a GHMP kinase family protein that acts as a galacturonic acid-1-phosphate kinase that catalyzes the production of galacturonic acid-1-phosphate. This is a precursor of the important cell wall building block UDP-galacturonic acid. Based on gene trap line GT8007, the gene appears to be expressed in a petal and stamen-specific manner, between flower stages 8 to 11, however, later RT-qPCR analysis demonstrates that the transcript is present throughout the plant in all tissues tested.
AT1G06780	Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility.
AT3G28340	Encodes a protein with putative galacturonosyltransferase activity.
AT1G13250	Encodes a protein with putative galacturonosyltransferase activity.
AT1G02720	Encodes a protein with putative galacturonosyltransferase activity.
AT2G36830	Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile.
AT1G23900	Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane.
AT5G26220	ChaC-like family protein;(source:Araport11)
AT1G78660	The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.
AT1G78680	The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole.
AT4G39640	The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast.
AT1G64970	gamma-tocopherol methyltransferase (g-TMT) mRNA, nuclear; mutant has Deficient in alpha and beta tocopherol; Accumulates gamma tocopherol in leaves
AT4G34450	Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation.
AT5G44700	Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis.
AT4G20140	Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain.
AT3G02885	GASA5, is involved in the regulation of seedling thermotolerance.
AT3G24050	Encodes a member of the GATA factor family of zinc finger transcription factors.
AT2G28340	Encodes a member of the GATA factor family of zinc finger transcription factors.
AT3G45170	Encodes a member of the GATA factor family of zinc finger transcription factors.
AT5G49300	Encodes a member of the GATA factor family of zinc finger transcription factors.
AT5G47140	Encodes a member of the GATA factor family of zinc finger transcription factors.
AT5G66320	Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate.
AT3G51080	Encodes a member of the GATA factor family of zinc finger transcription factors.
AT5G56860	Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression.
AT4G16141	GATA type zinc finger transcription factor family protein;(source:Araport11)
AT5G37500	Encodes a guard cell outward potassium channel. Belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutants have increased water consumption and limited stomatal closure in response to abscisic and jasmonic acids. It forms a heteromeric K(out) channels with SKOR. The gene is expressed ubiquitously in root and the vasculature and guard cells of leaves. Expression is suppressed during agrobacterium-induced tumor formation and increased in response to water deprivation and cold.
AT5G22990	Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ.
AT4G19985	Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT2G06025	Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT4G28030	Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11)
AT1G73250	encodes a bifunctional 3, 5-epimerase-4-reductase in L-fucose synthesis and converts GDP-D-mannose to GDP-L-fucose in vitro along with MUR1 (GDP-D-mannose 4,6-dehydratase). It is expressed in all tissues examined, but most abundantly in roots and flowers.
AT5G66280	GDP-D-mannose 4,6-dehydratase
AT1G54000	GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates.
AT1G53940	Encodes a lipase, has in vitro lipase activity with p-nitrophenyl acetate and p-nitrophenyl butyrate, gene expression induced by hormones, negatively regulates auxin signaling, involved in disease resistance
AT3G14225	Contains lipase signature motif and GDSL domain.
AT3G45240	Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. Involved in resistance to S. sclerotiorum, fungal sRNA target.
AT5G60550	Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro.
AT1G22300	Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Might act as a stabilization factor to mediate the oligomerization of REM on the plasma membrane.
AT3G02520	Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν).
AT4G27600	Encodes a phosphofructokinase B-type carbohydrate kinase family protein, NARA5. Regulates photosynthetic gene expression.
AT2G18640	Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase
AT1G09560	Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile.
AT3G05930	germin-like protein (GLP8)
AT1G02335	Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems.
AT2G36690	Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development.
AT5G56300	A member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT2, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development.
AT1G47990	Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities.
AT4G21200	Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins.
AT5G07200	encodes a gibberellin 20-oxidase.
AT1G44090	Encodes a gibberellin 20-oxidase.
AT4G21690	gibberellin 3-oxidase 3;(source:Araport11)
AT5G41315	Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation.
AT1G68360	Encodes a nuclear localized member of the C2H2 family of TFIIIA transcription factors.GIS3 is involved in trichome initiation and development downstream of GA and cytokinin signaling. GIS regulates the expression GIS and GIS2.
AT2G19880	Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone.
AT1G30540	Actin-like ATPase superfamily protein;(source:Araport11)
AT2G41760	Controls the expression of specific defence-response genes, activates the synthesis pathway for the phytoalexin camalexin and influences basal resistance to Pseudomonas syringae pv tomato (Pst).
AT1G65440	Related to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. It encodes a putative WG/GW-repeat protein involved in the regulation of apical-basal polarity of embryo
AT5G10550	This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation.
AT5G15770	Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum.
AT5G13110	Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is most highly expressed in root.
AT3G27300	glucose-6-phosphate dehydrogenase 5;(source:Araport11)
AT5G40760	Encodes a cytosolic glucose-6-phosphate dehydrogenase that is insensitive to reduction by DTT and whose mRNA is expressed ubiquitously. The mRNA is cell-to-cell mobile.
AT1G67490	Encodes an alpha-glucosidase I enzyme that catalyzes the first step in N-linked glycan processing. Localized to the endoplasmic reticulum (ER).
AT2G25450	Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate.
AT1G70090	Encodes a protein with putative galacturonosyltransferase activity.
AT5G61250	Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted.
AT1G33800	Encodes a glucuronoxylan(GX)-speciﬁc 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile.
AT1G09610	glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11)
AT5G17330	Encodes one of two isoforms of glutamate decarboxylase. The mRNA is cell-to-cell mobile.
AT1G65960	glutamate decarboxylase (GAD2) The mRNA is cell-to-cell mobile.
AT2G02010	glutamate decarboxylase 4;(source:Araport11)
AT5G18170	Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells.
AT5G07440	Encodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells.
AT3G04110	putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis.
AT5G48410	member of Putative ligand-gated ion channel subunit family
AT2G17260	Encodes a glutamate receptor. Involved in calcium-programmed stomatal closure.
AT5G27100	member of Putative ligand-gated ion channel subunit family
AT5G11210	member of Putative ligand-gated ion channel subunit family
AT1G42540	member of Putative ligand-gated ion channel subunit family
AT2G32400	Glr5
AT3G48730	glutamate-1-semialdehyde 2,1-aminomutase 2;(source:Araport11)
AT5G63570	Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile.
AT5G57685	Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7).
AT5G24920	Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7).
AT1G66200	encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium
AT5G37600	encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium
AT5G35630	chloroplastic glutamine synthetase The mRNA is cell-to-cell mobile.
AT3G15660	Mitochondrial glutaredoxin involved in Fe-S cluster assembly.
AT5G40370	Glutaredoxin family protein;(source:Araport11)
AT2G31570	glutathione peroxidase GPx
AT2G43350	Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1.
AT3G63080	Encodes glutathione peroxidase.
AT4G31870	Encodes glutathione peroxidase. Role in the degradation of H2O2 to water using glutathione as electron donor.
AT1G02920	Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002).
AT4G02520	Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim.
AT1G74590	Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G69930	Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G59670	Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT1G10360	Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT3G43800	Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile.
AT2G29470	Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT3G09270	Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT5G62480	Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002).
AT5G41220	Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002).
AT2G02390	Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. It functions in vitro as a maleylacetoacetate isomerase and is likely to be involved in tyrosine catabolism.
AT1G12900	glyceraldehyde 3-phosphate dehydrogenase A subunit 2;(source:Araport11)
AT1G42970	Encodes chloroplast localized glyceraldehyde-3-phosphate dehydrogenase that can use both NADH and NADPH to reduce 1,3-diphosphate glycerate. It forms A2B2 heterotetramers with GapA forms of the GADPH enzyme. These complexes are active in the light under reducing conditions, but show reduced NADPH-dependent activity in response to oxidized thioredoxins and increased NAD(H)/NADP(H) ratios due to the formation of inactive A8B8 hexadecamers. The mRNA is cell-to-cell mobile.
AT1G16300	Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots.
AT1G30560	Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5).
AT1G06520	sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile.
AT4G01950	putative sn-glycerol-3-phosphate 2-O-acyltransferase
AT5G06090	putative sn-glycerol-3-phosphate 2-O-acyltransferase
AT5G43300	Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family.
AT5G45350	proline-rich family protein;(source:Araport11)
AT5G07530	encodes a glycine-rich protein that has oleosin domain and is expressed specifically during flower stages 10 to 12. Protein is found on mature pollen coat.
AT4G38680	Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development.
AT2G22660	Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors.
AT5G07510	encodes a glycine-rich protein that is expressed in low abundance in stems and leaves, and very low abundance in flowers.
AT5G07550	member of Oleosin-like protein family
AT2G21060	Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality.
AT2G05520	Encodes a glycine-rich protein that is expressed mainly in stems and leaves. AtGRP3 functions in root size determination during development and in Al stress. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to desiccation. The mRNA is cell-to-cell mobile.
AT2G05380	glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile.
AT4G18360	Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance.
AT1G21360	glycolipid transfer protein 2;(source:Araport11)
AT1G70710	endo-1,4-beta-glucanase. Involved in cell elongation.
AT4G38990	glycosyl hydrolase 9B16;(source:Araport11)
AT4G39000	glycosyl hydrolase 9B17;(source:Araport11)
AT4G11050	glycosyl hydrolase 9C3;(source:Araport11)
AT2G27130	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G12360	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G14805	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT5G09370	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT1G70250	Encodes a Protease inhibitor/seed storage/LTP family protein.
AT1G36150	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G22650	lipid transfer protein;(source:Araport11)
AT4G08670	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT1G55260	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G37690	Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat.
AT1G32930	Galactosyltransferase family protein;(source:Araport11)
AT1G67290	Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification.
AT2G31350	Encodes a mitochondrial glyoxalase 2 that can accommodate a number of different metal centers and with the predominant metal center being Fe(III)Zn(II).
AT5G57040	Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress.
AT1G64185	Vicinal oxygen chelate (VOC) superfamily member.
AT2G35110	Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs. Its ER localization is independent of upstream SPK1 activation signaling and the physical association with the WAVE/SCAR Regulatory complex binding partner SRA1. ER-localized NAP1 has little colocalization with actin and represent the inactive pool of NAP1 in these cell types.
AT5G44190	Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus.
AT5G14950	Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans.
AT1G18190	This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC2 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (508?668 aa) portion of the protein.
AT2G46180	This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein.
AT3G02242	root meristem growth factor-like protein;(source:Araport11)
AT1G55325	Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation.
AT5G58960	Mutant plants display impaired light-regulation of the hypocotyl randomization response.
AT1G28130	Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin.
AT1G53130	Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space.
AT3G61570	This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC3 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (161 aa) portion of the protein.
AT4G37740	Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower
AT2G36400	Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower.
AT3G52910	Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower.
AT4G03190	Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression.
AT5G28300	Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor.
AT5G64300	encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile.
AT5G28050	Cytidine/deoxycytidylate deaminase family protein;(source:Araport11)
AT2G44100	GDP dissociation inhibitor involved in vesicular membrane traffic
AT3G57550	guanylate kinase
AT2G41880	Guanylate kinase. Involved in nucleotide metabolism.
AT1G03830	Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles.
AT2G38840	Guanylate-binding family protein;(source:Araport11)
AT5G46070	Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Within membraneless organelles termed GBPL defence-activated condensates (GDACs), directly binds defence-gene promoters and recruited specifc transcriptional coactivators of the Mediator complex and RNA polymerase II machinery to massively reprogram host gene expression for disease resistance.
AT5G60730	One of 3 GET paralogs in Arabidopsis. GET3c is a mitochondrion localized protein with no obvious role in Tail Anchored (TA) protein insertion.
AT2G18960	Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile.
AT5G62670	H[+]-ATPase 11;(source:Araport11)
AT4G30190	Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent.
AT2G24520	plasma membrane H+-ATPase;(source:Araport11)
AT2G07560	H[+]-ATPase 6;(source:Araport11)
AT3G60330	H[+]-ATPase 7;(source:Araport11)
AT1G80660	H[+]-ATPase 9;(source:Araport11)
AT5G20140	Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress.
AT4G28490	Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile.
AT1G28440	HAESA-like 1;(source:Araport11)
AT3G19700	Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments.
AT1G60780	?1 adaptin component of heterotetrameric protein complex that regulates protein sorting at the trans-Golgi network/early endosome. The observed pleiotropic cellular and developmental defects in mutants are primarily due to defects in sorting of targets such as KNOLLE.
AT4G21150	ribophorin II (RPN2) family protein;(source:Araport11)
AT5G56250	hapless 8;(source:Araport11)
AT3G05040	Encodes member of importin/exportin family. Involved in timing of shoot maturation. Involved in miRNA transport. Mutants flower early and have small, curled leaves and reduced abundance of certain miRNA species.
AT1G06840	Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner.
AT5G20470	Encodes a headless derivative of myosin XI-K, which likely arose from a partial duplication of the XI-K gene and is developmentally regulated.
AT4G13550	Heat stress inducible plastid monogalactosyldiacylglycerol lipase.
AT4G36990	Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins.
AT4G18880	Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses.
AT3G51910	member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile.
AT1G46264	Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions.
AT2G41690	member of Heat Stress Transcription Factor (Hsf) family
AT3G17210	Encodes a heat stable protein with antimicrobial and antifungal activity.
AT4G29770	Target of trans acting-siR480/255. Testing.
AT1G22990	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT4G35060	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G56210	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT2G28090	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT2G28660	Chloroplast-targeted copper chaperone protein;(source:Araport11)
AT1G06330	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT2G36950	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT3G05220	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT3G06130	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT3G24450	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT4G16380	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT5G19090	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G23000	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT4G30120	encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc
AT1G63440	The Arabidopsis P-type ATPase HMA5 is involved in Cu detoxification. hma5 mutant plants exhibit Cu hypersensitivity, which is especially dramatic in roots where HMA5 is mostly expressed.
AT1G01490	Heavy metal transport/detoxification superfamily protein;(source:Araport11)
AT1G58300	Encodes a member (HO4) of the heme oxygenase family.
AT4G32690	Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast.
AT4G30850	heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors
AT1G30570	Encodes HERCULES2 (HERK2), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth.
AT5G63620	Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria.
AT4G29130	Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment.
AT2G19860	Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses.
AT1G47840	Encodes a putative hexokinase.
AT4G13420	Encodes a protein of the KUP/HAK/KT potassium channel class that is upregulated in the roots by K levels.
AT3G45060	member of High affinity nitrate transporter family
AT5G23120	encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile.
AT3G09650	RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit.
AT4G31560	Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane.
AT4G37200	Encodes thioredoxin-like protein with disulfide reductase activity that is involved in the biogenesis of the plastid cytochrome b6f complex. Protein is located in the thylakoid membrane with the C-terminal hydrophilic portion, containing the thioredoxin like domain, extending into the thylakoid lumen.
AT4G35250	HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex.
AT3G17040	It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. It binds in the psbT?psbH intercistronic region and blocks the progression of 5′ → 3′ exoribonucleases, which defines the 5′ end of processed psbH transcripts and also stabilizes the downstream RNA segment. In addition, HCF107 binding remodels the structure of the psbH 5′ UTR in a way that can account for its ability to enhance psbH translation.
AT3G54050	Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile.
AT1G20693	Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile.
AT1G20696	Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile.
AT4G35570	Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha.
AT4G10310	encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots.
AT3G24430	Encodes chloroplast protein HCF101 (high chlorophyll fluorescence 101). Serves as a chloroplast scaffold protein that specifically assembles [4Fe-4S] clusters and transfers them to the chloroplast membrane and soluble target proteins.
AT2G30470	HSI2 is a member of the ABI3 family of B3 domain proteins and functions as an active repressor of the Spo minimal promoter through the EAR motif. It contains a plant-specific B3 DNA-binding domain. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50?M ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. HSI2 is also an epigenetic repressor as it also contains functional plant homeodomain-like (PHD-L) and zinc-finger Cys- and Trp-containing (CW) domains associated with epigenetic regulation. The PHD-L domain of HSI2 is connected to promoting trimethylation of Lys-27 on histone 3 (H3K27me3), while the CW domain can bind directly to H3K4me3. Through these domains, HSI2 represses the seed maturation program during seed germination by repressing transcription of the core LAFL (LEC1, ABI3, FUS3, and LEC2) seed developmental transcriptional regulators. In developing A. thaliana embryos, HSI2 suppresses expression of a large number of genes, many identified as targets of FUS3. However, the absence of HSI2 had no effect on transcript levels of the LAFL regulators and the levels of measured metabolites and phytohormones (ABA, auxin, and JA derivatives) in developing Arabidopsis embryos. HSI2 likely fine-tunes seed maturation by repressing genes involved in early embryogenesis that are not required later for seed maturation and desiccation.
AT5G23420	Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain.
AT5G62630	hipl2 protein precursor;(source:Araport11)
AT3G56490	Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro.
AT5G35750	Encodes histidine kinase AHK2.
AT5G10720	member of Histidine Kinase
AT1G61270	Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC).
AT1G03430	Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6).
AT3G21510	Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6).
AT5G63890	Encodes histidinol dehydrogenase. Up-regulated in response to UV-B.
AT2G30620	winged-helix DNA-binding transcription factor family protein;(source:Araport11)
AT3G27360	Histone superfamily protein;(source:Araport11)
AT1G79000	Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation.
AT1G67220	histone acetyltransferase of the CBP family 2;(source:Araport11)
AT1G55970	HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain.
AT3G12980	Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14. The mRNA is cell-to-cell mobile.
AT3G44490	histone deacetylase 17;(source:Araport11)
AT3G44680	Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD.
AT5G61070	Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation.
AT3G54560	Encodes HTA11, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA9) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z.
AT1G55250	Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B.
AT2G44150	Encodes a protein-lysine N-methyltransferase. Located in ER.
AT2G20000	Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap.
AT3G01470	Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33).
AT5G15150	homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem.
AT5G66700	Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development.
AT4G40060	Encodes a homeodomain leucine zipper class I (HD-Zip I) protein.
AT4G16780	Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile.
AT5G39760	Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation.
AT2G18350	homeobox protein 24;(source:Araport11)
AT5G15210	Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family.
AT3G28920	homeobox protein 34;(source:Araport11)
AT2G33880	Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling.
AT5G46880	homeobox-7;(source:Araport11)
AT2G01430	ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes.
AT1G70920	homeobox-leucine zipper protein 18;(source:Araport11)
AT3G60390	Encodes homeobox protein HAT3.
AT2G44910	Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome.
AT3G61150	Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT1G34650	Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT1G73360	Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development.
AT1G05230	Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Mutants have trichomes that appear glass-like under a dissecting microscope as compared to the wild-type trichomes. The mutations do not affect trichome growth or branch number.
AT2G32370	Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development.
AT5G52170	Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT3G03260	Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family.
AT5G54080	Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism.
AT2G18950	Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading.
AT3G11945	Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950.
AT1G79050	recA DNA recombination family protein;(source:Araport11)
AT3G54420	encodes an EP3 chitinase that is expressed during somatic embryogenesis in 'nursing' cells surrounding the embryos but not in embryos themselves. The gene is also expressed in mature pollen and growing pollen tubes until they enter the receptive synergid, but not in endosperm and integuments as in carrot. Post-embryonically, expression is found in hydathodes, stipules, root epidermis and emerging root hairs.
AT4G25540	encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH3 heterodimers bound 'insertion-deletion' DNA with three nucleotides (+AAG) or one nucleotide (+T) looped out much better than they bound DNA with a base/base mispair (T/G).
AT5G11170	One of two genes encoding an ATP-dependent RNA helicase that localizes predominantly to euchromatic regions of Arabidopsis nuclei, and associates with genes transcribed by RNA polymerase II independently from the presence of introns. It is not detected at non-transcribed loci. It interacts with ssRNA, dsRNA and dsDNA, but not with ssDNA. Its ATPase activity is stimulated by RNA and dsDNA and its ATP-dependent RNA helicase activity unwinds dsRNA but not dsDNA.
AT1G56110	NOP56-like protein
AT3G19210	Encodes RAD54, a member of the SWI2/SNF2 family of DNA-stimulated ATPases. Functions in DNA repair via homologous recombination.
AT3G50470	Homolog of RPW8
AT3G50480	Homolog of RPW8
AT4G22970	Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature.
AT1G04050	Encodes SUVR1, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression.
AT3G23100	A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. Yeast two-hybrid analysis demonstrated a strong interaction between A. thaliana DNA ligase IV and the A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. This interaction is shown to be mediated via the tandem BRCA C-terminal domains of A. thaliana DNA ligase IV protein.
AT5G02410	Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response.
AT5G54730	yeast autophagy 18 F-like protein;(source:Araport11)
AT3G54710	Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division.
AT1G10030	Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor.
AT5G48120	ARM repeat superfamily protein;(source:Araport11)
AT4G16440	Encodes a [FeFe]-hydrogenase-like protein named Gollum (for Growth in different Oxygen LeveLs inﬂUences Morphogenesis). Heterologous expression of Gollum in E. coli indicates that it probably contains two [Fe-S] clusters with different magnetic properties. Sequence alignment analysis indicates that these two clusters would be topologically equivalent to the mesial and proximal [Fe-S] centers of [FeFe]-hydrogenases. Knockdown mutants (RNAi) show a dwarf phenotype at the normal atmospheric partial oxygen pressure of 21 kPa. This dwarf phenotype could be rescued by growing the plant under low oxygen pressure (5kPa), suggesting a role for this gene in oxygen sensing.
AT5G08110	Plays a role in the maintenance of genome stability and the repair of aberrant replication intermediates in the root meristem. Is involved with RAD1, FAN1, and RECQ4A in the repair of DNA CLs.
AT4G04330	Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco.
AT4G13940	Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile.
AT2G17265	Encodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts. Mutation of this gene results in higher level of the amino acid homoserine and resistance to downy mildew pathogen Hyaloperonospora arabidopsidis.
AT1G12270	Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT5G18360	Host immune receptor which recognizes the conserved effector HopB1.
AT3G43300	AtMIN7 is an immunity associated Arabidopsis protein targeted by HopM1, a conserved Pseudomonas syringae virulence protein. AtMIN7 encodes one of the eight members of the Arabidopsis adenosine diphosphate (ADP) ribosylation factor (ARF) guanine nucleotide exchange factor (GEF) protein family. The AFR GEF proteins are key components of the vesicle trafficking system in eukaryotic cells. HopM1 mediates the destruction of AtMIN7 via the host proteasome. Critical for cuticle formation and related leaf surface defense against the bacterial pathogen Pseudomonas syringae pathovar tomato (Pto).
AT1G70690	Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain.
AT3G50950	Encodes a canonical CC-type NLR protein that is required for the recognition of the T3SE HopZ1a as well as several other Hop effectors from the pathogenic bacteria P. syringae.
AT5G59830	Interacts with several P. syringae effectors. Regulates a wide range of pathogen-responsive biological processes.
AT1G49560	Homeodomain-like superfamily protein;(source:Araport11)
AT4G32010	Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing.
AT5G08230	HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions.
AT1G69700	Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. The mRNA is cell-to-cell mobile.
AT2G36020	HVA22-like protein J;(source:Araport11)
AT1G76490	Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile.
AT4G20930	Encodes a 3-hydroxyisobutyrate dehydrogenase.
AT4G11820	Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis.
AT1G79870	Hydroxyphenylpyruvate reductase (HPPR), which catalyzes the reduction of 4-hydroxyphenylpyruvic acid (pHPP) to 4-hydroxyphenyllactic acid (pHPL). Together with HPPR3 and TAT1 involved in the biosynthesis of pHPL from tyrosine.
AT2G45630	Hydroxyphenylpyruvate reductase (HPPR) family member with low activity.
AT1G69840	SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11)
AT3G01290	SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11)
AT1G67700	multidrug resistance protein;(source:Araport11)
AT5G61460	Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage.
AT5G49230	Identified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction.
AT1G13300	Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance.
AT3G01100	unknown protein, has cDNAs and ESTs associated to it
AT5G55510	PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Acts in the export of proteins from chloroplasts during leaf senescence.
AT4G27450	aluminum induced protein with YGL and LRDR motifs;(source:Araport11)
AT1G05575	transmembrane protein;(source:Araport11)
AT3G10020	plant/protein;(source:Araport11)
AT4G24110	NADP-specific glutamate dehydrogenase;(source:Araport11)
AT3G27220	Galactose oxidase/kelch repeat superfamily protein;(source:Araport11)
AT5G10040	transmembrane protein;(source:Araport11)
AT5G27760	Hypoxia-responsive family protein;(source:Araport11)
AT3G05550	Hypoxia-responsive family protein;(source:Araport11)
AT5G55250	Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase.
AT1G68100	member of IAA-alanine resistance protein 1
AT1G44350	encodes a protein similar to IAA amino acid conjugate hydrolase.
AT5G54680	basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
AT5G54140	encodes a protein similar to IAA amino acid conjugate hydrolase
AT4G37550	Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM.
AT4G30410	sequence-specific DNA binding transcription factor;(source:Araport11)
AT2G32320	Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C).
AT1G72270	Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation.
AT1G64790	ILITHYIA (ILA) is a HEAT repeat protein involved in plant immunity. The gene is also involved in systemic acquired resistance induced by P. syringae expressing avrRps4. Loss-of-function mutants of ILA caused pleiotropic defects in the mutant plants. The mutant plants are smaller in size and the leaves are serrated and yellow to light green in color. Required for bacterium-triggered stomatal closure.
AT4G09930	Avirulence induced gene (AIG1) family protein;(source:Araport11)
AT4G09950	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G33880	One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance.
AT1G33900	One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance.
AT1G33930	One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance.
AT1G33970	IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens.
AT1G18670	Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do.
AT1G51800	The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile.
AT4G27640	Nuclear import receptor for GRF-interacting factors (GIFs),roles in ovule development.
AT1G48490	Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network.
AT5G66730	C2H2-like zinc finger protein;(source:Araport11)
AT4G02670	indeterminate(ID)-domain 12;(source:Araport11)
AT1G68130	Encodes the longer of two splice variants of a transcription factor involved in regulating starch metabolism in response to cold.
AT2G02080	C2H2 BIRD transcription factor family.
AT2G02070	RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW.
AT1G21100	O-methyltransferase family protein;(source:Araport11)
AT1G21120	O-methyltransferase family protein;(source:Araport11)
AT1G21110	O-methyltransferase family protein;(source:Araport11)
AT1G21130	O-methyltransferase family protein;(source:Araport11)
AT3G23050	Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover.
AT4G14550	IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19.
AT1G51950	indole-3-acetic acid inducible 18;(source:Araport11)
AT3G23030	auxin inducible gene expressed in the nucleus
AT5G25890	encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene.
AT3G62100	Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis.
AT2G04550	Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1.
AT2G22670	Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile.
AT3G09922	Encodes a gene product whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots.
AT3G56370	LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue.
AT3G25655	Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission.
AT5G64667	Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission.
AT5G09805	Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission.
AT3G18715	Similar to Inflorescance deficient in abscission (IDA). Involved in floral organ abscission.
AT1G76952	Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission.
AT5G52200	Encodes an inhibitor of protein phosphatase one (PP1).
AT5G48820	Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization.
AT2G46470	inner membrane protein OXA1-like protein;(source:Araport11)
AT4G33770	Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7.
AT4G16480	Encodes a high affinity H+:myo-inositol symporter. The only other compound shown to be transported was pinitol, a methylated derivative of myo-inositol. The mRNA is cell-to-cell mobile.
AT4G18010	Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays.
AT5G42810	Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level.
AT1G05630	Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light?stimulated increase in cytosolic calcium ion.
AT5G46950	One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo.
AT1G29250	Alba DNA/RNA-binding protein;(source:Araport11)
AT3G09710	Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family.
AT3G59690	Member of IQ67 (CaM binding) domain containing family.
AT4G14750	Member of IQ67 (CaM binding) domain containing family.
AT3G49260	IQ-domain 21;(source:Araport11)
AT5G62070	Member of IQ67 (CaM binding) domain containing family.
AT4G29150	Member of IQ67 (CaM binding) domain containing family.
AT3G16490	Member of IQ67 (CaM binding) domain containing family.
AT2G26180	Transient Expression of Pro35S:YFP-IQD5 in leaves of N. benthamiana alters microtubule organization.Member of IQ67 (CaM binding) domain containing family.
AT5G26820	Mutations in MAR1 confer resistance, while MAR1 overexpression causes hypersensitivity to multiple aminoglycoside antibiotics. Localizes to the chloroplast envelope. MAR1 may act as a plastid transporter involved in cellular iron homeostasis. The mRNA is cell-to-cell mobile.
AT4G19690	The gene encodes Fe2+ transporter protein. It is a member of the Zrt/Irt-like protein (ZIP) family of transporters. AtIRT1 has broad specificity for divalent heavy metals, mediating the transport of zinc, manganese, cobalt and cadmium under Fe-deficient conditions. IRT1 is monoubiquitinated to promote endocytic trafficking. The mRNA is cell-to-cell mobile.
AT2G38080	LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype.
AT4G36890	IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation.
AT5G67210	Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall.
AT2G39930	Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex.
AT1G18870	Encodes a protein with isochorismate synthase activity involved in phylloquinone biosynthesis. Mutant studies of this gene's function suggest that its function is redundant with that of ICS1 (AT1G7410).
AT3G02780	Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that it functions in the mevalonate, but not the MEP biosynthetic pathway.
AT1G68460	Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis.
AT5G19040	Encodes cytokinin synthase.
AT3G23630	Encodes an isopentenyl transferase involved in cytokinin biosynthesis.
AT4G13430	Encodes a methylthioalkylmalate isomerase involved in glucosinolate biosynthesis.
AT2G14830	Ist1p;(source:Araport11)
AT1G51900	Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11)
AT4G29440	Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11)
AT1G75100	Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress.
AT3G16430	Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro.
AT3G16460	Mannose-binding protein
AT2G46370	Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses.
AT3G22160	VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses.
AT2G38240	One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA.
AT1G19180	JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile.
AT5G13220	Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa.
AT3G17860	JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine.
AT1G17380	jasmonate-zim-domain protein 5;(source:Araport11)
AT1G72450	JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation.
AT5G46910	H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering.
AT1G01790	Encodes a member of the cation/proton antiporters-2 antiporter superfamily, the K efflux antiporter KEA1 that is localized to the chloroplast envelope.
AT4G00630	Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids.
AT5G11800	member of Putative potassium proton antiporter family
AT2G26650	Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500).
AT1G31120	potassium transporter
AT1G70300	potassium transporter
AT5G16560	Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis.
AT4G17695	Homeodomain-like superfamily protein;(source:Araport11)
AT1G11160	One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules.
AT5G08390	One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules.
AT5G23430	One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules.
AT3G61980	Encodes a Kazal-type serine proteinase inhibitor that is highly expressed in seedlings and flowers.
AT3G52890	KCBP-interacting protein kinase interacts specifically with the tail region of KCBP
AT2G17220	Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated.
AT5G19280	kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region
AT4G05190	ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts.
AT1G21730	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G21380	Kinesin motor family protein;(source:Araport11)
AT5G10470	Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells.
AT3G44730	kinesin-like protein 1;(source:Araport11)
AT5G02520	Arabidopsis KNL2 localizes at chromocenters during all stages of the mitotic cell cycle, except from metaphase to mid-anaphase, and its level is strictly regulated by the proteasome degradation pathway. Knockout of KNL2 via a T-DNA insertion resulted in a reduced amount of centromeric cenH3, mitotic and meiotic abnormalities, and reduced growth and fertility.
AT3G19150	Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility.
AT1G15670	Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase.
AT3G59940	Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile.
AT1G70510	A member of class I knotted1-like homeobox gene family (together with KNAT1). Similar to the knotted1 (kn1) homeobox gene of maize. KNAT2 acts synergistically with cytokinins and antagonistically with ethylene based on ectopic expression studies in different mutant backgrounds and hormone treatments. In addition, KNAT2 is negatively regulated by AS and YABBY genes. KNAT2 is strongly expressed in the shoot apex of seedlings, while in mature plants the gene is primarily expressed in flowers and inflorescence stems.
AT1G74910	KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1.
AT1G65610	Six-hairpin glycosidases superfamily protein;(source:Araport11)
AT1G16970	Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity.
AT1G73260	Encodes a trypsin inhibitor involved in modulating programmed cell death in plant-pathogen interactions.
AT2G46750	Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid.
AT5G11540	Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid.
AT2G46760	D-arabinono-1,4-lactone oxidase family protein;(source:Araport11)
AT1G01220	Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis.
AT3G24090	Encodes a glutamine-fructose-6-phosphate transaminase that likely plays a role in UDP-N-acetylglucosamine biosynthesis.
AT3G45330	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G60310	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G60320	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT3G45390	LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11)
AT3G45410	encodes a receptor-like kinase that has serine/threonine kinase activity whose expression is induced by high salt stress. This induction is inhibited by tobacco ethylene receptor.
AT3G45420	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT3G45440	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G60270	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G60280	Plasma membrane localized receptor kinase. Binds NAD+ and induces expression of disease resistance genes.
AT5G59260	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G59270	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT2G29220	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT3G53810	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT4G02410	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G10530	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT1G15530	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT2G32800	protein kinase family protein;(source:Araport11)
AT3G46760	Protein kinase superfamily protein;(source:Araport11)
AT3G55550	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G06740	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT2G43690	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT2G43700	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT3G59700	Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000.
AT5G01550	Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination.
AT4G04960	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT4G28350	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G03140	Concanavalin A-like lectin protein kinase family protein;(source:Araport11)
AT5G01540	Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity.
AT4G28680	Encodes a stress-induced tyrosine decarboxylase (TyrDC). Recombinant (His)6-TyrDC expressed in E. coli catalyzes the conversion of L-tyrosine to tyramine. Recombinant TyrDC forms tetramers.
AT5G21160	Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover.
AT4G35890	Encodes a cytoplasmic LAM domain containing protein that is involved in leaf senescence. The mRNA is cell-to-cell mobile.
AT5G46250	RNA-binding protein;(source:Araport11)
AT5G01190	putative laccase, a member of laccase family of genes (17 members in Arabidopsis).
AT5G03260	LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis).
AT5G05390	putative laccase, a member of laccase family of genes (17 members in Arabidopsis).
AT5G60020	LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there.
AT2G29130	Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency.
AT2G40370	putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine.
AT3G25440	RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11)
AT1G13580	Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26).
AT1G18850	PCP2 encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1.
AT2G44060	Late embryogenesis abundant protein, group 2;(source:Araport11)
AT1G02820	Late embryogenesis abundant 3 (LEA3) family protein;(source:Araport11)
AT2G40170	Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation.
AT2G14560	Encodes LURP1, a member of the LURP cluster (late upregulated in response to Hyaloperonospora parasitica) which exhibits a pronounced upregulation after recognition of the pathogenic oomycte H. parasitica. LURP1 is required for full basal defense to H. parasitica and resistance to this pathogen mediated by the R-proteins RPP4 and RPP5. The mRNA is cell-to-cell mobile.
AT5G63090	Involved in lateral organ development
AT2G42430	LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation.
AT1G55580	Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching.
AT1G77220	LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1.
AT4G38360	LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways.
AT5G38210	Protein kinase family protein;(source:Araport11)
AT1G25390	Protein kinase superfamily protein;(source:Araport11)
AT1G66930	Protein kinase superfamily protein;(source:Araport11)
AT1G11755	Encodes a cis-prenyltransferase, involved in dolichol biosynthesis. Wilted leaves in mutants due to cell membrane lesions. Mutants have increased drought tolerance, but hypersensitve to dark stress.
AT5G01560	Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination.
AT1G02050	Chalcone and stilbene synthase family protein;(source:Araport11)
AT5G51410	LUC7 N terminus domain-containing protein;(source:Araport11)
AT3G59820	LETM1-like protein;(source:Araport11)
AT1G07650	Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves.
AT4G22880	encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation.
AT2G24200	Cytosol aminopeptidase family protein;(source:Araport11)
AT4G32551	LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors.
AT2G32700	Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion and mediates aluminium sensitivity through PECTIN METHYLESTERASE46-modulated root cell wall pectin methylesterification.
AT3G04290	Li-tolerant lipase 1;(source:Araport11)
AT2G42610	LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11)
AT1G07090	LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11)
AT5G28490	Encodes a nuclear protein that mediates light regulation of seedling development in a phytochrome-dependent manner.
AT1G78600	light-regulated zinc finger protein 1;(source:Araport11)
AT3G01510	Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves.
AT2G15230	Lipase active on medium and short chain triacylglycerols, but not on phospho- or galactolipids. Active between pH4 and 7 with an optimum at pH6. Knock-out mutant has not obvious phenotype. Predicted to be extracellular.
AT3G50920	Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma.
AT5G66450	Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon2) and LPPepsilon1, appear to be less important for diacylglycerol formation in the plastids than LPPgamma.
AT4G05210	Trimeric LpxA-like enzymes superfamily protein;(source:Araport11)
AT3G45140	Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile.
AT1G17420	LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs).
AT1G72520	PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11)
AT5G65770	Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5.
AT2G45450	ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity.
AT1G07900	LOB domain-containing protein 1;(source:Araport11)
AT2G28500	LOB domain-containing protein 11;(source:Araport11)
AT2G30340	Lateral Organ Boundaries domain protein. LOB13 promotes lateral root formation.
AT2G45410	LOB domain-containing protein 19;(source:Araport11)
AT3G11090	LOB domain-containing protein 21;(source:Araport11)
AT3G13850	LOB domain-containing protein 22;(source:Araport11)
AT3G26660	LOB domain-containing protein 24;(source:Araport11)
AT3G27940	LOB domain-containing protein 26;(source:Araport11)
AT4G00210	LOB domain-containing protein 31;(source:Araport11)
AT5G35900	LOB domain-containing protein 35;(source:Araport11)
AT3G02550	LOB domain-containing protein 41;(source:Araport11)
AT1G36000	LOB domain-containing protein 5;(source:Araport11)
AT2G19820	LOB domain-containing protein 9;(source:Araport11)
AT1G10920	Encodes LOV1, a disease susceptibility gene that, paradoxically, is a member of the NBS-LRR resistance gene family. Conditions susceptibility to the fungus Cochliobolus victoriae and victorin-dependent induction of defense-associated proteins. Saturation mutagenesis identified 59 lov mutations that all display reduced susceptibility to vitorin. Mutations in known defense response pathways do not prevent susceptibility to C. victoriae.
AT5G19080	Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export.
AT3G06140	Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export.
AT3G05780	Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins.
AT2G28305	Putative lysine decarboxylase family protein;(source:Araport11)
AT2G37210	Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950.
AT3G53450	Putative lysine decarboxylase family protein;(source:Araport11)
AT4G35190	Putative lysine decarboxylase family protein;(source:Araport11)
AT5G03270	lysine decarboxylase family protein;(source:Araport11)
AT1G64625	Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin.
AT3G55850	Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids.
AT1G77590	Encodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids.
AT2G47240	Encodes an acyl-CoA synthetase that acts on long-chain and very-long-chain fatty acids, involved in cuticular wax and cutin biosynthesis The mRNA is cell-to-cell mobile.
AT1G49430	Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation.
AT1G64400	AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT4G23850	AMP-dependent synthetase and ligase family protein;(source:Araport11)
AT2G46090	Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs.
AT5G15580	Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function.
AT4G28280	LORELEI-LIKE-GPI ANCHORED PROTEIN 3;(source:Araport11)
AT3G09770	Encodes a ubiquitin E3 ligase LOG2 (LOSS OF GDU2). Required for GLUTAMINE DUMPER1(GDU1)-induced amino secretion.
AT4G34120	Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile.
AT1G56070	encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive.
AT1G71040	Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability.
AT1G02910	Mutants defective in this gene were shown to have a reduced PSII content (overall reduction in the levels of several PSII subunits) and a disrupted grana stack structure. The N-terminal half of the protein contains two tetratricopeptide repeat (TPR) motifs that are arranged tandemly, each consisting of a 34-residue degenerate consensus sequence. The N-terminal sequence is rich in positive and hydroxylated amino acid residues.
AT1G75690	Thylakoid Thiol/Disulfide-Modulating Protein.
AT5G48905	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT1G49435	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G11760	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G30074	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G29285	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G29300	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT2G10535	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT1G28335	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G09984	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G09153	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G13095	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G19905	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT3G23167	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT2G14935	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT3G07005	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT3G42473	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT3G48231	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT2G28355	low-molecular-weight cysteine-rich 5;(source:Araport11)
AT4G30070	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT2G20208	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT4G30067	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT1G61070	Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT2G02135	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT2G04425	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT2G14365	Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family.
AT5G52300	Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance.
AT5G52310	cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile.
AT1G32540	Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death.
AT4G21610	Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains.
AT5G57030	Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase
AT4G35180	LYS/HIS transporter 7;(source:Araport11)
AT5G40780	Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll.
AT4G33150	This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation.
AT3G14840	Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile.
AT2G17120	Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsCEBiP.
AT2G23770	Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain.
AT2G33580	Encodes a putative LysM-containing receptor-like kinase. LYK5 is a major chitin receptor and forms a chitin-induced complex with related kinase CERK1. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain.
AT1G63050	Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. Involved in triacylglycerol biosynthesis.
AT4G15570	Similar to yeast Sen1 (splicing endonuclease 1)helicase protein. Involved in female gametophyte development. The mRNA is cell-to-cell mobile.
AT3G19640	Transmembrane magnesium transporter. One of nine family members.
AT1G03840	MGP is a nuclear-localized putative transcription factor with three zinc finger domains. MGP can interact with three proteins implicated in root patterning: SCR, SHR, and JKD in Y2H assays, and these interactions depend on the first zinc finger in MGP. MGP appears to be a direct transcriptional target of SHR and SCR, based on promoter binding assays, though it is not expressed in the QC, based on in situ hybridizations.
AT3G47810	Homolog of yeast retromer subunit VPS29. Part of a retromer-like protein complex involved in endosome to lysosome protein transport.
AT3G47700	Involved in transportation of seed storage proteins from the ER to the vacuole. Mutant seed cell accumulates the precursors of 12S globulin and 2S albumin instead of the vacuolar-located mature proteins. Member of MAG2 complex, involved in the development of vegetative organs.
AT1G48120	Encodes a nuclear localized aminotransferase-like protein containing a plant mobile domain.
AT1G17930	Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing.
AT4G34950	Major facilitator superfamily protein;(source:Araport11)
AT1G66170	Encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to nuclear euchromatin specifically during diplotene. Required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1.
AT1G19890	histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1.
AT4G20900	Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein.
AT4G27940	manganese tracking factor for mitochondrial SOD2;(source:Araport11)
AT1G51630	O-fucosyltransferase family protein;(source:Araport11)
AT1G78850	curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants.
AT5G43710	Glycosyl hydrolase family 47 protein;(source:Araport11)
AT1G01560	Member of MAP Kinase family. Flg22-induced activation is blocked by AvrRpt2.
AT2G01450	MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress.
AT3G14720	member of MAP Kinase The mRNA is cell-to-cell mobile.
AT2G42880	member of MAP Kinase
AT4G01370	Encodes a nuclear and cytoplasmically localized MAP kinase involved in mediating responses to pathogens. Its substrates include MKS1 and probably MAP65-1.The MAP65-1 interaction is involved in mediating cortical microtuble organization. Required for male-specific meiotic cytokinesis. The mRNA is cell-to-cell mobile.
AT2G43790	Encodes a MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress.Also involved in ovule development. Homozygous mutants in a MPK3 heterozygous background are female sterile due to defects in integument development.MPK6 appears to be associated with the microsomal compartment and may be involved in mediating secretory processes. The mRNA is cell-to-cell mobile.
AT4G29810	encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2.
AT3G18690	Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators.
AT4G26070	Member of MAP Kinase Kinase. Likely functions in a stress-activated MAPK pathway. Can phosphorylate the MAPK AtMPK4, in response to stress. Gets phosphorylated by MEKK1 in response to wounding.
AT1G15400	Tightly connected with MAPK signaling to fine-tune stomatal production and patterning.
AT5G11850	MAP3 kinase involved phosphorylation of a critical Ser171 for OST1/SnRK2.6 activation.
AT2G41970	Encodes MRI, a plasma membrane-localized member of the RLCK-VIII subfamily. Preferentially expressed in both pollen tubes and root hairs. mri-knockout mutants display spontaneous pollen tube and root-hair bursting.
AT5G42600	Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development.
AT2G15890	Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance.
AT2G18650	RING/U-box superfamily protein;(source:Araport11)
AT2G34790	Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes.
AT2G34870	hydroxyproline-rich glycoprotein family protein;(source:Araport11)
AT3G06350	Encodes a bi-functional dehydroquinate-shikimate dehydrogenase enzyme that catalyzes two steps in the chorismate biosynthesis pathway.
AT3G11270	Mov34/MPN/PAD-1 family protein;(source:Araport11)
AT3G46330	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT1G04630	GRIM-19 protein;(source:Araport11)
AT4G00060	Nucleotidyltransferase family protein;(source:Araport11)
AT4G00950	hypothetical protein (DUF688);(source:Araport11)
AT4G13345	Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11)
AT5G45800	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT2G02240	F-box family protein;(source:Araport11)
AT1G70170	Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence.
AT4G08850	MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated.
AT1G78610	mechanosensitive channel of small conductance-like 6;(source:Araport11)
AT5G20170	RNA polymerase II transcription mediator;(source:Araport11)
AT1G23230	Mediator tail subunit, involved in transcriptional regulation. Mediator Complex Subunit, interacts with MED2, MED5, MED16 in the Regulation of Phenylpropanoid Biosynthesis.
AT5G09850	Transcription elongation factor (TFIIS) family protein;(source:Araport11)
AT5G38990	Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth.
AT5G39000	Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth.
AT5G39020	Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth.
AT1G37140	Amember of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. MCT1 expression is increased in the presence of ABA and RNAi suppression showed increased germination rates in the presence of ABA.
AT1G29400	A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices.
AT5G24290	Vacuolar iron transporter (VIT) family protein;(source:Araport11)
AT5G15460	membrane-anchored ubiquitin-fold protein 2;(source:Araport11)
AT3G26980	membrane-anchored ubiquitin-fold protein 4 precursor;(source:Araport11)
AT5G26230	Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6).
AT5G52870	Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6).
AT5G52900	Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6).
AT5G54110	Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. The mRNA is cell-to-cell mobile.
AT2G36900	member of Membrin Gene Family
AT4G21750	Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development.
AT3G56100	Protein kinase expressed in meristematic cells. Phosphorylates AGL24.
AT5G11880	Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway.
AT4G25110	Encodes a type I metacaspase. Two Arabidopsis metacaspases, AT1G02170 (MC1) and AT4G25110 (MC2) antagonistically control programmed cell death in Arabidopsis. MC1 is a positive regulator of cell death and requires conserved caspase-like putative catalytic residues for its function. MC2 negatively regulates cell death. This function is independent of the putative catalytic residues. A third type I Arabidopsis metacaspase is MC3 (AT5g64240).
AT1G79330	Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200.
AT1G79320	Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200.
AT3G58810	Member of Zinc transporter (ZAT) family. Contributes to basic cellular Zn tolerance and controls Zn partitioning, particularly under conditions of high rates of Zn influx into the root symplasm. Localizes to the vacuolar membrane.
AT3G12100	Cation efflux family protein;(source:Araport11)
AT1G07600	metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage.
AT3G25740	Encodes a plastid localized methionine aminopeptidase. Formerly called MAP1C, now called MAP1B.
AT2G44180	Encodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci.
AT3G01120	encodes a cystathionine gamma-synthase, which performs the first committed step in methionine biosynthesis. A conserved motif of 13 amino acids in the first exon is required for posttranscriptional autoregulation. This enzyme shares the same substrate as threonine synthase (TS) and its absence transcriptionally affects 8 genes in the genome.
AT5G49810	Arabidopsis thaliana methionine S-methyltransferase, an enzyme that catalyzes S -methylmethionine formation. The mRNA is cell-to-cell mobile.
AT4G21830	methionine sulfoxide reductase B7;(source:Araport11)
AT4G21850	methionine sulfoxide reductase B9;(source:Araport11)
AT3G03780	Encodes a cytosolic methionine synthase, involved in methionine regeneration via the activated methyl cycle (or SAM cycle)
AT5G17920	Encodes a cytosolic cobalamin-independent methionine synthase, involved in methionine regeneration via the activated methyl cycle (SAM cycle). The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile.
AT1G33990	Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro.
AT1G69240	Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein.
AT3G10870	Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem.
AT4G22745	Protein containing methyl-CpG-binding domain.
AT3G15790	Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT4G00416	Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins.
AT3G02790	zinc finger (C2H2 type) family protein;(source:Araport11)
AT3G59970	methylenetetrahydrofolate reductase MTHFR1 mRNA, complete
AT2G44160	methylenetetrahydrofolate reductase MTHFR2 mRNA, complete The mRNA is cell-to-cell mobile.
AT1G18500	Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). The mRNA is cell-to-cell mobile.
AT5G49160	Encodes a cytosine methyltransferase MET1. Required for silencing of FWA paternal allele in endosperm. Two lines with RNAi constructs directed against DMT1 have reduced agrobacterium-mediated tumor formation. The mRNA is cell-to-cell mobile.
AT2G38700	Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer.
AT5G10945	Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC
AT1G66783	Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC
AT2G39175	Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160a (converted to TAIR10 based on PMID19304749): Chr2: 16339853-16341886 (forward), length: 2034 bp; exon coordinates: exon 1: 16339853 to 16340469, exon 2: 16341621 to 16341886; mature miRNA and miRNA* are located on exon 1.
AT4G17788	Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160b (converted to TAIR10 based on PMID19304749): Chr4: 9888799-9889176 (forward), length: 378 bp; exon coordinates: exon 1: 9888799-9889176; mature miRNA and miRNA* are located on exon 1.The miR160b pri-mRNA also encodes a regulatory peptide miPEP160b (AT4G17787) that regulates accumulation of its own miRNA
AT5G08185	Encodes a microRNA that targets DCL1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGAUAAACCUCUGCAUCCAG
AT1G01183	Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC. Accumulation of the pri-miRNA165a transcript is increased by the activity of the miPEP165 peptide which is encoded within the pri-miRNA165a transcript.
AT2G46685	Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1.
AT3G61897	Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166b (converted to TAIR10 based on PMID19304749): Chr3: 22921936-22923122 (forward), length: 1187 bp; exon coordinates: exon 1: 22921936 to 22922389, exon 2: 22922485 to 22922566, exon 3: 22922653 to 22923122; mature miRNA and miRNA* are located on exon 1.
AT5G41905	Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC
AT5G43603	Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC
AT3G22886	Encodes a microRNA that targets ARF family members ARF6 and ARF8. Essential for fertility of both ovules and anthers. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAAGCUGCCAGCAUGAUCUA. Pri-mRNA coordinates for MIR167a (converted to TAIR10 based on PMID19304749): Chr3: 8108021-8108622 (forward), length: 602 bp; exon coordinates: exon 1: 8108021 to 8108622; mature miRNA and miRNA* are located on exon 1.
AT4G19395	Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions.
AT1G53687	Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAGCCAAGGAUGACUUGCCG
AT1G19371	Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG
AT3G26812	Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG
AT3G23125	Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC
AT4G23713	Encodes a microRNA that targets several TCP family members controlling leaf development. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGACUGAAGGGAGCUCCCU. The miR319a pri-mRNA also encodes a regulatory peptide miPEP319a (AT4G23712) that regulates accumulation of its own miRNA.
AT1G76135	Encodes a microRNA that targets one member of the F-box family. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGCAUUCUGUCCACCUCC. It targets F-box protein AT1g27340. It is involved in the regulation of leaf morphology.
AT5G35407	Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes.
AT4G05105	Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG
AT2G34208	Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. Also modulates plant responses to salt, ABA, and drought. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAUUUGCCCGG
AT1G32582	Encodes a microRNA of unknown function that is predicted to target PPR family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAUGAGAGUAUUAUAAGUCAC
AT2G32698	Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TTTAAATCATATACTTTTGGT
AT4G03455	Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG
AT1G35501	Encodes a microRNA that targets MET2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUGCUUCCAGCUUUUGUCUC
AT2G41616	Encodes a microRNA that targets several SET domain-containing genes including SUVH6. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGCUUGGUUUAUGUACACCG
AT4G14811	Encodes a microRNA that targets CHX18. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCUUCGUGAAUAUCUGGCA
AT3G59884	Encodes a microRNA that targets several SPX C3HC4 RING zinc finger family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUAGAUGACCAUCAACAAACU
AT1G32713	Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CAAAUUAAAGCUUCAAGGUAG
AT1G67481	Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UACCAACCUUUCAUCGUUCCC
AT4G23387	Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CGGCUCUGAUACCAAUUGAUG
AT1G71002	Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection.
AT4G13494	Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU
AT5G39693	Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUGGUGUUGAGAUAGUUGAC
AT2G35630	Member of the MAP215 family of microtubule-associated proteins required to establish interphase arrays of cortical microtubules.Mutants have defects in cytokinesis during pollen development. Vegetative phenotypes observed in temperature sensitive mutants include left-handed organ twisting, isotropic cell expansion and impairment of root hair polarity. The mRNA is cell-to-cell mobile.
AT2G38720	microtubule-associated protein 65-5;(source:Araport11)
AT2G01750	Encodes a microtubule associated protein (MAP70-3). Expressed in all tissues.
AT1G14840	Encodes a microtubule associated protein (MAP70-4). Expressed in all tissues.
AT2G17780	Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region.
AT3G51660	Chemokine-like MDL protein; modulate flowering time and innate immunity in plants.
AT2G39200	A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G26700	A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT2G44110	A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G11310	A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2.
AT3G45290	A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO3 belongs to the clade IV, with AtMLO2, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in primary root and lateral root primordia, in fruit abscission zone, in vascular system of cotyledons and in trichomes of young leaves,; it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G11000	A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO4 belongs to the clade I, with AtMLO11 and AtMLO14. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of root, cotyledons and young leaves, it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G61560	A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT2G17430	A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. Controls pollen tube reception in synergids. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO7 belongs to the clade III, with AtMLO5, AtMLO8, AtMLO9, and AtMLO10. The gene is expressed in vegetative organs (RT-PCR experiments)and in pollen grains, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s).
AT1G74660	Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene.
AT3G14395	Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones.
AT1G65290	Encodes a member of the mitochondrial acyl carrier protein (ACP) family that forms part of the membrane arm of mitochondrial complex and contributes to the mitochondrial respiratory chain. The mRNA is cell-to-cell mobile. The designations of mtACP-1 and mtACP-2 in Klusch et al. 2021 (DOI:10.1093/plcell/koab092)are flipped with respect to the nomenclature published by Meyer et al. 2007 (DOI:10.1007/s11103-007-9156-9).
AT4G37910	mitochondrial heat shock protein 70-1;(source:Araport11)
AT1G66345	Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I.
AT5G64710	Putative endonuclease or glycosyl hydrolase;(source:Araport11)
AT5G20090	MPC1 negatively regulates ABA enhanced slow anion channel function during stomatal closure.
AT3G13930	Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex.
AT4G35490	mitochondrial ribosomal protein L11;(source:Araport11)
AT1G74120	Encodes a mitochondrial transcription termination factor mTERF15. Required for mitochondrial nad2 intron 3 splicing and functional complex I activity.
AT1G59580	encodes a mitogen-activated kinase involved in innate immunity The mRNA is cell-to-cell mobile.
AT5G40440	Encodes a mitogen-activated protein kinase kinase. Activates MPK8 and is a target of MPKKK20. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization.
AT1G07150	Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580.
AT2G30040	Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580.
AT5G55090	member of MEKK subfamily
AT4G26890	Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580.
AT5G66850	Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens.
AT3G55270	Encodes MAP kinase phosphatase 1 (MKP1). Loss of MKP1 results in hypersensitivity to acute UV-B stress, but without impairing UV-B acclimation.
AT1G01453	HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals.
AT2G01520	Encodes a cis-cinnamic acid responsive gene that is a member of the major latex protein-like gene family and plays a role in promoting vegetative growth and delaying ﬂowering. The mRNA is cell-to-cell mobile.
AT1G70850	MLP-like protein 34;(source:Araport11)
AT1G70660	MMZ2/UEV1B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1A can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. However, a combination of MMZ2/UEV1B and UBC13A do not do a good job of rescuing an mms2 ubc13 double mutant in yeast. MMZ2/UEV1B transcripts are found in most plant organs, but not in the pollen or in seedlings 6 hours or 2 days post-germination. The transcript levels do not appear to be stress-inducible. The mRNA is cell-to-cell mobile.
AT5G45550	Encodes a gene product involved in both sporogenesis and gametogenesis and is required for the normal progression of megasporogenesis and microsporogenesis. Additional alleles were isolated in a screen for enhancers of PID and genetic analysis indicates a role for MOB1A in auxin mediated signaling.
AT1G54030	Encodes a vacuolar protein. Mutation causes organizational defects in the endoplasmic reticulum and aberrant protein trafficking in the plant secretory pathway. The mRNA is cell-to-cell mobile.
AT4G24680	Encodes MOS1 (MODIFIER OF snc1). MOS1 contains a BAT2 domain that is conserved in plants and animals. MOS1 associates with the promoter of SNC1 and regulates its expression.
AT5G02770	Encodes a conserved eukaryotic protein with homology to the human RNA binding protein CIP29 that localizes to the nucleus. Mutants accumulate more poly(A) mRNAs in the nucleus, likely resulting from reduced mRNA export activity.
AT5G05680	Encodes MOS7 (Modifier of snc1,7), homologous to human and Drosophila melanogaster nucleoporin Nup88. Resides at the nuclear envelope. Modulates the nuclear concentrations of certain defense proteins regulates defense outputs.
AT5G62600	Encodes a nuclear importer of serine-arginine rich (SR) proteins and is involved in the regulation of splicing of R genes by regulating the import of the SR proteins into the nucleus.
AT1G31720	chitin synthase, putative (DUF1218);(source:Araport11)
AT4G19370	chitin synthase, putative (DUF1218);(source:Araport11)
AT2G25680	Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium.
AT1G80310	MOT2 encodes a molybdate transporter which locates to the vacuolar membrane. Loss-of-function (knock out) mutants show elevated molydate levels in rosette leaves and in fully senescent leaves, but decreased MoO4 levels in seeds. Under conditions of molybdate deficiency leaves from mot2::tDNA mutants show strongly reduced nitrate reductase activity. The mot2 gene is slightly expressed in young and mature leaves, but strongly in senescing leaves. This observation points to a function of MOT2 in molybdate transfer from leaves to seeds during plant senescence.
AT3G09940	Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica.
AT1G63940	monodehydroascorbate reductase 6;(source:Araport11)
AT4G15760	Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA).
AT4G15670	Encodes a member of the CC-type glutaredoxin (ROXY) family.
AT1G02740	MRG1 and MRG2 proteins act as readers of H3K4me3/H3K36me3 marked chromatin. They interact with each other as well as several other protein classes, to modulate the activity of flowering genes.
AT1G21920	MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT1G08060	Encodes a transcriptional silencer that is required for proper expression of PRR/NLR immune receptor genes.
AT3G54870	Armadillo-repeat containing kinesin-related protein. Plays a role during transition to root-hair tip growth.Mutants have short, branched root hairs and an excess of endoplasmic microtubles. Phenotype suggests ARK1 plays a role in modulating microtubule depolymerization during root hair tip growth.An HKT2.4 (CS76404) - ARK1 variant causes root hair branching.
AT1G07360	Encodes MAC5A, a component of the MOS4-associated complex (MAC) that contributes to snc1- mediated autoimmunity. MAC is a highly conserved nuclear protein complex associated with the spliceosome. Homologues include AT1G07360 (MAC5A), AT2G29580 (MAC5B) and AT5G07060 (MAC5C).
AT1G37113	hypothetical protein;(source:Araport11)
AT2G33780	VQ motif-containing protein;(source:Araport11)
AT5G53830	VQ motif-containing protein;(source:Araport11)
AT5G63800	Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35
AT3G61300	C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11)
AT5G03435	Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11)
AT3G03680	Member of a family of Multiple C2 Domain and Transmembrane Region Proteins.
AT4G00700	C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11)
AT5G44780	Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing.
AT3G51160	Catalyzes the first step in the de novo synthesis of GDP-L-fucose. Loss of function mutations result in reduced levels of fucosylation and decreased freezing tolerance.
AT1G30620	encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans.
AT1G75640	Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores.
AT3G24320	Encodes a DNA binding protein that promotes re-arrangements of mitochondrial genome. Mutations affects mitochondrial gene expression, and impairs mitochondrial function. Dual targeting of the protein to mitochondria and chloroplasts caused by alternative translation initiation. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity.
AT4G02070	encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex.
AT3G09230	member of MYB3R- and R2R3- type MYB- encoding genes
AT3G12820	Member of the R2R3 factor gene family.
AT1G63910	member of MYB3R- and R2R3- type MYB- encoding genes
AT2G26950	Member of the R2R3 factor gene family.
AT3G02940	Encodes a putative transcription factor (MYB107).
AT3G55730	putative transcription factor MYB109 (MYB109) mRNA,
AT1G25340	putative transcription factor (MYB116)
AT5G58850	Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119).
AT5G55020	Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120).
AT3G30210	Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB121).
AT1G06180	member of MYB3R- and R2R3- type MYB- encoding genes
AT3G23250	Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity
AT5G15310	Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation.
AT3G61250	LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family.
AT2G47190	Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin.
AT3G27810	Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression.
AT5G40330	Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1.
AT2G39880	Encodes a putative transcription factor (MYB25).
AT3G53200	Member of the R2R3 factor gene family.
AT5G07690	Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses.
AT1G22640	MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression
AT3G28910	Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways.
AT3G24310	snapdragon myb protein 305 homolog (myb)
AT5G23000	Putative homolog of the Blind gene in tomato. Together with RAX2 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB37, regulates axillary meristem formation. RAX1 is expressed in a small central domain within the boundary zone separating SAM and leaf primordia during early leaf primordium development and is currently the earliest spatial marker for future axillary meristems. Member of the R2R3 factor gene family.
AT4G17785	Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes.
AT3G09370	C-myb-like transcription factor (MYB3R3) mRNA. It is a target of CDK phosphorylation and blocks cell division in response to DNA damage.
AT4G38620	Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile.
AT4G28110	Member of the R2R3 factor gene family. Expression is induced in response to desiccation, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion.
AT4G12350	Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation.
AT5G16600	Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation.
AT3G48920	Member of the R2R3 factor gene family.
AT5G12870	Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea.
AT1G18710	Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347).
AT3G18100	Member of the R2R3 transcription factor gene family.
AT1G57560	Member of the R2R3 factor gene family.
AT1G18570	Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile.
AT5G65230	Member of the R2R3 factor gene family.
AT4G01680	Encodes a putative transcription factor (MYB55).
AT3G01530	Member of the R2R3 factor gene family.MYB57 interacts with JAZ proteins, and functions redundantly with MYB21 and MYB24 to regulate stamen development. Promote flavonol biosynthesis through regulation of FLS1 gene expression.
AT1G16490	Member of the R2R3 factor gene family.
AT1G09540	Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size.
AT1G68320	putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis.
AT1G79180	Member of the R2R3 factor gene family.
AT5G11050	Member of R2R3-MYB transcription factor gene family.
AT5G14750	Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC).
AT5G65790	Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development.
AT2G23290	Member of the R2R3 factor gene family.
AT4G37260	Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile.
AT5G49620	Member of the R2R3 factor gene family.
AT4G13480	Member of the R2R3 factor gene family.
AT3G49690	Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation.
AT5G26660	myb domain protein 86;(source:Araport11)
AT4G37780	encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family.
AT5G16770	Member of the R2R3 factor gene family.
AT5G10280	Encodes a putative transcription factor (MYB92).
AT1G34670	Encodes a member of the R2R3 transcription factor gene family that is a negative regulator of lateral root (LR) development. It has been proposed that this transcription factor is part of a novel negative feedback loop stimulated specifically in the endodermis upon LR initiation to ensure that LRs are formed only in the correct place.
AT3G47600	Encodes a putative transcription factor (MYB94).
AT5G62470	Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response.
AT4G18770	MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects.
AT5G62320	Encodes a putative transcription factor (MYB99).
AT4G21440	Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family.
AT1G71030	Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves.
AT5G18650	Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. The mRNA is cell-to-cell mobile.
AT3G61950	MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance.
AT2G19800	Encodes a myo-inositol oxygenase family gene.
AT5G10170	myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization.
AT3G19960	member of Myosin-like proteins
AT1G17580	Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development.
AT5G54280	Type VII myosin gene
AT5G43900	Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner.
AT1G04600	member of Myosin-like proteins
AT5G04540	Myotubularin-like phosphatases II superfamily;(source:Araport11)
AT5G66900	RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.2. Exhibits autoimmunity.
AT5G66910	RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.1.
AT5G16800	Plasma membrane-anchored post-translationally acting N-acetyltransferase involved in high salt stress response.
AT5G11790	Plays a role in dehydration stress response.
AT5G11340	Encodes an N-terminal acetyltransferase involved in plant development and the suppression of stress responses, potentially through the regulation of ER stress.
AT4G17830	NAOD encodes a functional acetylornithine deacetylase. Silenced lines plants flower early but have reduced fertility (siliques do not develop) as well as reduced ornithine levels.NAOD mediates a linear pathway for ornithine biosynthesis.
AT3G15510	Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2.
AT5G39610	Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510.
AT1G01010	NAC domain containing protein 1;(source:Araport11)
AT1G56010	Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination.
AT5G63790	Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components.
AT1G52890	encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro.
AT5G04410	NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile.
AT1G61110	NAC transcription regulator. Regulates endosperm cell expansion during germination.
AT1G77450	NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30.
AT3G01600	NAC domain containing protein 44;(source:Araport11)
AT3G04070	NAC domain containing protein 47;(source:Araport11)
AT3G04420	NAC domain containing protein 48;(source:Araport11)
AT3G10490	Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control.
AT3G10500	Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile.
AT3G44350	NAC domain containing protein 61;(source:Araport11)
AT3G49530	Transcription factor that serves as a molecular link between cold signals and pathogen resistance responses. Undergoes proteolytic processing triggered by cold-induced changes in membrane fluidity.It relocates from the plasma membrane to the nucleus in response to ER stress. NAC062 is phosphorylated by SnRK2.8 at Thr-142.
AT4G01520	NAC domain containing protein 67;(source:Araport11)
AT4G10350	NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root.
AT4G28530	Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue.
AT5G13180	Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation.
AT5G17260	NAC domain containing protein 86;(source:Araport11)
AT5G22380	NAC domain containing protein 90;(source:Araport11)
AT5G39820	NAC domain containing protein 94;(source:Araport11)
AT3G12977	NAC transcription regulator. Regulates endosperm cell expansion during germination.
AT3G21070	Encodes a protein with NAD(H) kinase activity.
AT4G28220	Encodes an external type II NADPH dehydrogenase in the plant mitochondrial electron transport chain that modulates NADP(H) reduction levels, which in turn affect central metabolism and growth, and interact with defense signaling.
AT2G47490	Encodes a chloroplast-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro.
AT2G13560	Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the alpha family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the beta-type NAD-ME2 (At4g00570). NAD-ME1 transcript and protein levels are higher during the night than during the day. The mRNA is cell-to-cell mobile.
AT4G00570	Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day.
AT5G21430	Chaperone DnaJ-domain superfamily protein;(source:Araport11)
AT5G11670	The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis.
AT1G79750	The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed.
AT4G15545	NAI1 interacting protein, involved in ER body formation.
AT1G16520	NAI1 interacting protein, involved in ER body and vesicle formation.
AT1G56080	NAI1 interacting protein, involved in ER body formation.
AT4G37590	A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis.
AT3G12700	Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression.
AT3G17850	Protein kinase which together with IRE3 plays an important role in controlling root skewing and maintaining the microtubule network.
AT2G27080	Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11)
AT3G11650	Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus and spermine. Overexpression of the gene induces the expression of PR-1 gene and shows light-dependent 'speck disease-like' symptom on leaves. The gene product is localized to the chloroplast
AT5G36970	NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway
AT5G06320	encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane.
AT1G65690	Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development.
AT1G28380	This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile.
AT4G05590	Encodes NRGA1, a putative mitochondrial pyruvate carrier that mediates ABA regulation of guard cell ion channels and drought stress responses.
AT1G74360	NILR1 encodes a serine/threonine kinase involved in defense response to nematodes.
AT1G53430	Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy.
AT2G17750	Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane.
AT4G14760	kinase interacting (KIP1-like) family protein;(source:Araport11)
AT4G02710	Kinase interacting (KIP1-like) family protein;(source:Araport11)
AT1G09720	Member of NET domain family of actin binding proteins. Paralog of At3g22790 (NET2A).
AT1G07380	Encodes a neutral ceramidase that is involved in sphingolipid homeostasis and responses to oxidative stress.
AT2G38010	Neutral/alkaline non-lysosomal ceramidase;(source:Araport11)
AT4G24690	Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile.
AT3G11580	SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture.
AT2G46870	Member of the RAV family of DNA binding proteins. Contains B3 domain. Recognizes 5'-CACCTG-'3 motif.
AT3G61970	AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT1G01030	AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT4G01500	AP2/B3-like transcriptional factor family protein;(source:Araport11)
AT5G04950	Encodes a nicotianamide synthase.
AT5G56080	Encodes a protein with nicotianamine synthase activity. Its transcript levels rise in roots in response to zinc deficiency and rise in leaves in response to elevated levels of zinc.
AT1G56430	Encodes a protein with nicotianamine synthase activity.
AT3G13050	Encodes a plant nicotinate transporter than can also transport trigonelline (N-methylnicotinate).
AT5G64170	LNK1 is a member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex.Functions as a transcriptional coactivator.
AT1G02450	NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression.
AT3G25882	encodes a kinase that physically interacts with NPR1/NIM1
AT3G44200	Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules.
AT5G28290	Encodes AtNek3, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.
AT3G20860	Encodes a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.
AT3G12200	Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.
AT4G24020	Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile.
AT1G20640	Plant regulator RWP-RK family protein;(source:Araport11)
AT1G76350	Plant regulator RWP-RK family protein;(source:Araport11)
AT4G18350	Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition.
AT3G14440	Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane.
AT1G30100	Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition.
AT3G24220	A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition.
AT1G77760	Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin.
AT1G37130	Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940. The mRNA is cell-to-cell mobile.
AT1G08100	Encodes a high-affinity nitrate transporter.
AT5G60780	member of High affinity nitrate transporter family
AT1G08090	High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake.
AT3G44300	Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile.
AT3G44320	This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways.
AT3G16410	Encodes a nitrile-specifier protein NSP4. NSP4 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile.
AT1G02860	Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2.
AT2G43040	encodes a calmodulin-binding protein that is expressed specifically in pollen and is required for pollen development.
AT4G13750	Encodes NO VEIN (NOV), a plant-specific nuclear factor required for leaf vascular development, cellular patterning and stem cell maintenance in the root meristem, as well as for cotyledon outgrowth and separation. nov mutations affect many aspects of auxin-dependent development without directly affecting auxin perception.
AT4G18910	Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells.
AT1G31885	NOD26-like intrinsic protein 3;(source:Araport11)
AT5G37820	NOD26-like intrinsic protein 4;(source:Araport11)
AT4G10380	Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells.
AT3G53180	Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis.
AT4G25030	Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection.
AT3G20600	Required for non-race specific resistance to bacterial and fungal pathogens.Mediates systemic acquired resistance (SAR) response. The mRNA is cell-to-cell mobile.
AT1G07230	non-specific phospholipase C1;(source:Araport11)
AT3G03540	Encodes a nonspecific phospholipase C. Located in the cytosol. Involved in the conversion of phospholipids to glycolipids under phosphate deprivation conditions.
AT1G80460	Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1.
AT5G18110	Putative cap-binding protein;(source:Araport11)
AT1G48240	member of NPSN Gene Family
AT3G17440	member of NPSN Gene Family
AT1G09000	NPK1-related protein kinase 1S
AT1G54960	member of MEKK subfamily
AT5G45110	Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile.
AT4G19660	Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid.
AT3G47960	Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds.
AT5G62680	Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds.
AT1G69870	Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile.
AT3G45650	Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots.
AT1G59740	Major facilitator superfamily protein;(source:Araport11)
AT1G33440	Major facilitator superfamily protein;(source:Araport11)
AT1G69850	Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems.
AT1G72125	Major facilitator superfamily protein;(source:Araport11)
AT1G72120	Major facilitator superfamily protein;(source:Araport11)
AT5G46050	Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies.
AT2G26690	Major facilitator superfamily protein;(source:Araport11)
AT1G12110	Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT.
AT4G21680	Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance.
AT3G54140	Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source
AT2G02040	Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. Expression of the transcripts for this gene can be detected in the embryo through in situ hybridization. This protein does not have nitrate transporter activity based on oocyte transport assays. Enhances water uptake during early seed germination.
AT2G02020	Major facilitator superfamily protein;(source:Araport11)
AT4G13350	Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection.
AT1G13400	Along with JAG, it is involved in stamen and carpel development. Expression is limited to the adaxial side of lateral organs. Activated by AGAMOUS in a cal-1, ap1-1 background.
AT4G33080	AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11)
AT1G30640	Protein kinase family protein;(source:Araport11)
AT5G06510	nuclear factor Y, subunit A10;(source:Araport11)
AT3G05690	Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues.
AT1G72830	Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant.
AT1G17590	Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s.
AT5G58740	Member of the family of NudC proteins. Over-expression improves free radical sacenving activity and antioxidant status, promotes root growth and branching under abiotic stress.
AT4G32850	Encodes a nuclear poly(A) polymerase. Located in the nucleus. The mRNA is cell-to-cell mobile.
AT3G57660	Encodes a subunit of RNA polymerase I (aka RNA polymerase A). The mRNA is cell-to-cell mobile.
AT1G29940	Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A).
AT1G06790	Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III.
AT5G45140	Encodes a subunit of RNA polymerase III (aka RNA polymerase C).
AT3G18090	Encodes a subunit of RNA polymerase IV (aka RNA polymerase D). NRPD2b is closely related to NRPD2a, but has lower levels of transcription and does not affect endogenous siRNA when mutated.
AT1G32070	Encodes a acetyltransferase (NSI) that is localized in the nucleus and chloroplast. It interacts with the geminivirus movement protein NSP. This interaction is required for viral infection and systemic spread. Acetylates the viral coat protein (CP) in vitro, but not NSP. NSP inhibits NSI activity in vitro. In the chloroplast NSI functions in the dynamic reorganization thylakoid membrane complexes. NSI is highly transcribed in phloem and in xylem parenchyma cells, and in the apical meristem and guard cells, within young tissues in Arabidopsis, and its expression is turned off as tissues mature.Mutants have reduced melatonin and anthocyanin levels and do not accumulate the PSI-LHCII state transition complex.The protein has distinct lysine acetylation and relaxed N-terminal acetylation specificities on chloroplast proteins as determined by in vitro as well as in vivo analyses using quantitative protein mass spectrometry (PMID:32633465).
AT1G74350	Encodes nMAT4, a maturase factor required for nad1 pre-mRNA processing and maturation. Essential for holocomplex I biogenesis in Arabidopsis mitochondria.
AT2G05760	Xanthine/uracil permease family protein;(source:Araport11)
AT5G03555	Encodes PLUTO (plastidic nucleobase transporter), a member of the Nucleobase:Cation-Symporter1 protein family, capable of transporting purine and pyrimidine nucleobases.
AT1G60030	nucleobase-ascorbate transporter 7;(source:Araport11)
AT1G79150	binding protein;(source:Araport11)
AT1G48920	Encodes ATNUC-L1 (NUCLEOLIN LIKE 1), the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. The mRNA is cell-to-cell mobile.
AT5G20200	Atypical nuceloporin-like protein.
AT1G60420	Reduce transmission through pollen. The mRNA is cell-to-cell mobile.
AT5G18870	Similar to N terminal region of NSH1 nucleoside hydrolase.
AT5G56950	Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination.
AT4G39390	Encodes a golgi localized nucleotide sugar transporter.
AT1G63000	nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11)
AT1G12880	nudix hydrolase homolog 12;(source:Araport11)
AT3G26690	Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates.
AT1G14860	nudix hydrolase homolog 18;(source:Araport11)
AT5G20070	nudix hydrolase homolog 19;(source:Araport11)
AT2G33980	nudix hydrolase homolog 22;(source:Araport11)
AT1G30110	Encodes a ppGpp pyrophosphohydrolase.
AT3G10620	Encodes a ppGpp pyrophosphohydrolase.
AT5G06340	nudix hydrolase homolog 27;(source:Araport11)
AT1G79690	Encodes a dual activity enzyme which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase.
AT1G18300	nudix hydrolase homolog 4;(source:Araport11)
AT2G04430	nudix hydrolase homolog 5;(source:Araport11)
AT2G04450	Encodes a protein with NADH pyrophosphatase activity. Although this protein was also shown to have ADP-ribose diphosphatase activity in vitro, mutant analyses suggest that NUDX6 is involved in NADH metabolism in vivo.
AT5G44160	NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis.
AT5G04900	Encodes a chlorophyll b reducatase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II).
AT4G14880	Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi-dominant mutations exhibit early senescence. Required for pollen tube growth and/or fertilization.
AT3G22460	Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity.
AT2G43750	Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasB, the key enzyme for fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Required for pollen tube growth and/or fertilization.
AT3G59760	Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization.
AT3G05320	Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary.
AT3G07780	Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile.
AT5G48160	Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems.
AT5G60850	Encodes a zinc finger protein.
AT5G06960	Encodes a basic leucine zipper (B-ZIP) containing protein that interacts with NPR1 to promote expression of salicylic acid induced genes. Binds the ocs-element.
AT1G06160	encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
AT3G46990	DUF740 family protein, putative (DUF740);(source:Araport11)
AT3G14360	Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes.
AT1G05510	Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds.
AT4G33760	Aminoacyl tRNA synthetase functions in SAM maintenance.
AT5G51210	Encodes oleosin3, a protein found in oil bodies, involved in seed lipid accumulation.
AT5G55920	Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development.
AT5G55930	oligopeptide transporter
AT5G64410	oligopeptide transporter
AT4G10770	oligopeptide transporter
AT5G53520	Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1.
AT3G21140	Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11)
AT1G20510	OPC-8:0 CoA ligase1;(source:Araport11)
AT4G33950	Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network.
AT1G31040	ORE15 is a nuclear localized member of the PLATZ family of transcription factors. Based on over expression and loss of function phenotypes, ORE15 functions in regulation of leaf cell proliferation and senescence.
AT2G41225	Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance.
AT5G65620	Zincin-like metalloproteases family protein;(source:Araport11)
AT5G44785	Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates.
AT3G13880	Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria.
AT5G59200	Encodes a chloroplast RNA editing factor.
AT1G79360	organic cation/carnitine transporter 2;(source:Araport11)
AT1G16370	organic cation/carnitine transporter 6;(source:Araport11)
AT2G35720	Encodes OWL1, a J-domain protein involved in perception of very low light fluences.
AT4G12620	Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime.
AT5G46180	Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism.
AT5G59420	OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11)
AT4G25860	OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11)
AT5G19620	AtOEP80 is paralog to the chloroplastic protein translocation channel Toc75. Mutations in this locus result in embryo lethality.
AT2G28900	Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment.
AT1G05420	ovate family protein 12;(source:Araport11)
AT5G04820	ovate family protein 13;(source:Araport11)
AT2G36050	ovate family protein 15;(source:Araport11)
AT2G32100	ovate family protein 16;(source:Araport11)
AT3G52540	ovate family protein 18;(source:Araport11)
AT5G19650	Transcriptional repressor of KNOX family transcription factors. Encodes pluripotency and stemness, upregulated in LRP cells.
AT5G52520	Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase.
AT1G25350	glutamine-tRNA ligase, putative / glutaminyl-tRNA synthetase, putative / GlnRS;(source:Araport11)
AT5G57780	Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors.
AT4G24520	Encodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism.
AT4G30210	Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. The mRNA is cell-to-cell mobile.
AT3G28857	Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors.
AT4G32180	Encodes a protein with pantothenate kinase activity.
AT1G80190	Similar to the PSF1 component of GINS complex, which in other organism was shown to be involved in the initiation of DNA replication.
AT4G37060	Patatin-related phospholipase A. Expressed weakly in roots, cotyledons, and leaves but is transcriptionally induced by auxin. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity.
AT2G39220	Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus.
AT3G54950	Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition.
AT4G29940	Homeodomain protein (PRHA). Expression of the gene differs in various vegetative and floral plant tissues and is positively influenced by the phytohormone auxin. It is often associated with regions of developing vascular tissue. The prha promoter is highly responsive to the synthetic auxin, naphthalene acetic acid, in transient assays using tobacco protoplasts. The PRHA protein has the capacity to bind to TAATTG core sequence elements but requires additional adjacent bases for high-affinity binding.
AT2G14610	PR1 gene expression is induced in response to a variety of pathogens. It is a useful molecular marker for the SAR response. Though the Genbank record for the cDNA associated to this gene is called 'PR-1-like', the sequence actually corresponds to PR1. Expression of this gene is salicylic-acid responsive.
AT2G19990	Encodes a PR-1-like protein homolog that is differentially expressed in resistant compared to susceptible cultivars by powdery mildew infection. The deduced amino acid sequence has 24 amino acids comprising the signal peptide and 140 amino acids of the mature peptide (15 kDa). Northern blot analysis showed accumulation of the corresponding mRNA 12 h after inoculation of resistant barley cultivars with Erysiphe graminis. Though the Genbank record for the cDNA associated to this gene model is called 'PR-1', the sequence actually corresponds to PR-1-like. Expression of this gene is not salicylic-acid responsive.
AT3G09830	Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae.
AT5G03320	Protein kinase superfamily protein;(source:Araport11)
AT5G06370	PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway.
AT3G55450	PBS1-like 1;(source:Araport11)
AT2G07180	Protein kinase superfamily protein;(source:Araport11)
AT1G69790	Protein kinase superfamily protein;(source:Araport11)
AT5G47070	Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens.
AT4G17660	Protein kinase superfamily protein;(source:Araport11)
AT1G76370	Protein kinase superfamily protein;(source:Araport11)
AT3G20530	Protein kinase superfamily protein, expressed in the peroxisome.
AT2G28940	Protein kinase superfamily protein;(source:Araport11)
AT2G28590	Protein kinase superfamily protein;(source:Araport11)
AT5G56460	Protein kinase superfamily protein;(source:Araport11)
AT1G77510	Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner.
AT3G16110	Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin).
AT1G04980	Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response.
AT4G27080	putative protein
AT4G14720	PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth.
AT5G04310	Pectin lyase-like superfamily protein;(source:Araport11)
AT3G09405	Pectinacetylesterase family protein;(source:Araport11)
AT3G09410	Pectinacetylesterase family protein;(source:Araport11)
AT5G45280	Pectin acetylesterase involved in pectin remodelling.
AT2G45220	Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea.
AT3G14310	encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism.
AT3G29090	Encodes an atypical pectin methylesterase that does not require salt for its activity and has a blockwise mode of pectin demethylesterification.
AT4G12390	pectin methylesterase inhibitor 1;(source:Araport11)
AT3G17220	Pectin methylesterase inhibitor AtPMEI2. Inactivates AtPPME1 in vitro. Localized to Brefeldin A-induced compartments, and was found in FYVE-induced endosomal aggregates.
AT2G44490	Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile.
AT1G59870	ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile.
AT4G15340	Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast.
AT5G04810	Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation.
AT5G07460	ubiquitous enzyme that repairs oxidatively damaged proteins. Methionine sulfoxide reductase activity. Mutant lacking reductase activity showed increased protein oxidation, nitration and glycation of specific amino acid residues during darkness.
AT1G31050	Together with PFA2 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation.
AT3G20640	Governs the competence of pericycle cells to initiate lateral root primordium formation.
AT3G32980	Peroxidase superfamily protein;(source:Araport11)
AT3G50990	Encodes a class III peroxidase family protein that functions as a mucilage extrusion factor. Its polarized and developmental stage-dependent secretion plays a role in cell wall modification of the cells in the second layer of the outer integument.
AT4G08770	Encodes a putative apoplastic peroxidase Prx37. Primarily expressed in the vascular bundles. Overexpression renders a dwarf phenotype with smaller plants and delayed development. Plants overexpressing Prx37 also shows an increase in the amount of esterified phenolic material associated with their walls.
AT4G11290	Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification.
AT1G14540	Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination.
AT4G33420	Peroxidase superfamily protein;(source:Araport11)
AT5G05340	Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes.
AT5G42180	Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification.
AT5G64120	Encodes a cell wall bound peroxidase that is induced by hypo-osmolarity and is involved in the lignification of cell walls. Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination.
AT5G66390	Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification.
AT3G49110	Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile.
AT1G47750	member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT1G01820	member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation.
AT2G45740	member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile.
AT5G56290	Encodes the peroxisomal targeting signal type 1 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS1 consensus sequence (tripeptide SKL or a conserved variant) at the extreme C terminus. The protein has several domains, including C-terminal tetratricopeptide repeat motifs which act in binding the C-terminal "SKL" targeting signal. The mechanism of transport has been worked out in other organisms: The receptor recognizes and binds cytosolic PTS1-containing proteins. The PEX5-PTS1 complex binds a PEX14/PEX13 receptor complex at the peroxisome membrane and is translocated into the peroxisome matrix in a process dependent on PEX2,PEX10, and PEX12. In the peroxisome matrix, PEX5 releases its cargo and is recycled to the cytosol in a process dependent on PEX1, PEX4, PEX6 and PEX22. It is also involved, in conjunction with PEX7, in PTS1- and PTS2-dependent peroxisomal protein import. RNAi experiments suggest that PEX5 is necessary for the maintenance of both glyoxysomal and leaf peroxisomal functions.
AT3G52960	Thioredoxin superfamily protein;(source:Araport11)
AT2G33150	Encodes an organellar (peroxisome, glyoxysome) 3-ketoacyl-CoA thiolase, involved in fatty acid b-oxidation during germination and subsequent seedling growth. Mutants have defects in glyoxysomal fatty acid beta-oxidation. EC2.3.1.16 thiolase.
AT1G06530	Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR2. Involved in mitochondrial morphogenesis.
AT5G14520	Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression.
AT1G71440	Encodes tubulin-folding cofactor E. Mutant embryos consist of one or a few grossly enlarged cells, surrounded by an endosperm that fails to cellularize and contains a few big nuclei.
AT2G34710	Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA.
AT1G30490	Dominant PHV mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Has overlapping functions with PHABULOSA, REVOLUTA and CORONA/ATHB15 in patterning the apical portion of the embryo. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain.
AT2G37040	Encodes PAL1, a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4).
AT5G39050	Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification.
AT5G04230	Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4).
AT4G39230	encodes a protein whose sequence is similar to phenylcoumaran benzylic ether reductase (PCBER), which catalyzes NADPH-dependent reduction of 8-5' linked lignans such as dehydrodiconiferyl alcohol to give isodihydrodehydrodiconiferyl alcohol.
AT1G65390	Phloem Protein2 family gene encoding a two-domain protein containing predicted lectin and Toll/Interleukin-1 receptor domains, which is induced upon spider mite attack and improves the ability to defend against T. urticae by participating in the tight regulation of hormonal cross talk upon mite feeding.
AT3G61060	phloem protein 2-A13;(source:Araport11)
AT5G52120	phloem protein 2-A14;(source:Araport11)
AT2G26820	phloem protein 2-A3;(source:Araport11)
AT5G45080	phloem protein 2-A6;(source:Araport11)
AT5G45090	phloem protein 2-A7;(source:Araport11)
AT5G45070	phloem protein 2-A8;(source:Araport11)
AT2G02230	phloem protein 2-B1;(source:Araport11)
AT1G56240	phloem protein 2-B13;(source:Araport11)
AT1G56250	Encodes an F-box protein that can functionally replace VirF, regulating levels of the VirE2 and VIP1 proteins via a VBF-containing SCF complex. It is thought to be involved in DNA integration and T-DNA degradation.
AT2G02250	phloem protein 2-B2;(source:Araport11)
AT2G02300	phloem protein 2-B5;(source:Araport11)
AT2G02310	phloem protein 2-B6;(source:Araport11)
AT2G40180	Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression.
AT3G23430	Encodes a protein with the mainly hydrophilic N-terminal and the C-terminal containing 6 potential membrane-spanning domains. The mutant is deficient in the transfer of phosphate from root epidermal and cortical cells to the xylem. Its expression is repressed by phosphate (Pi) in shoots, and transiently induced by phosphite (Phi) in roots and shoots. PHO is expressed in developing ovules and plays a role in the transfer of Ph from maternal tissues to filial tissues.
AT2G33770	Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile.
AT5G43350	Encodes an inorganic phosphate transporter Pht1;1. Mutants display enhanced arsenic accumulation. Under high arsenate concentrations, PHT1;1 levels are reduced and it is delocalized from the plasma membrane. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).PHT1;1 expression is transcriptionally regulated by WRKY6 and by PHR1.
AT5G43360	Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).
AT2G38940	Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile.
AT1G76430	Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).
AT5G43370	Encodes a phosphate transporter Pht1;2. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341) The mRNA is cell-to-cell mobile.
AT2G29650	Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane.
AT3G52190	Encodes a plant specific protein structurally related to the SEC12 proteins of the early secretory pathway. Mutation of PHF1 impairs Pi transport. Expression was detected in all tissues, and was induced by Pi starvation. Localized in endoplasmic reticulum (ER), and mutation of PHF1 resulted in ER retention and reduced accumulation of the plasma membrane PHT1;1 transporter. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots.
AT2G01180	Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves.
AT5G42870	The PAH2 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi.
AT3G09920	Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants
AT2G39290	Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria.
AT5G09350	Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta2. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta2 is 83% identical to PI-4kbeta1 encoded by At5g64070. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta1, leads to the formation of abnormal root hairs.
AT4G02650	Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane.
AT3G47290	phosphatidylinositol-speciwc phospholipase C8;(source:Araport11)
AT4G16700	Encodes a mitochondrial phosphatidylserine decarboxylase. Expressed mainly in roots and flowers.
AT5G65690	Encodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent). The mRNA is cell-to-cell mobile.
AT1G53310	Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism.
AT2G42600	Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism.
AT1G12580	phosphoenolpyruvate carboxylase-related kinase 1;(source:Araport11)
AT1G12680	phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11)
AT1G48600	Encodes a phosphoethanolamine N-methyltransferase that catalyses the last two methylation steps of the three sequential methylations of phosphoethanolamine (PEA) that are required for the synthesis of phosphocholine (PCho) in plants.
AT4G29220	phosphofructokinase 1;(source:Araport11)
AT4G26270	phosphofructokinase 3;(source:Araport11)
AT4G16820	Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols.
AT3G55940	Phospholipase C family member. Double mutants with PLC5 show defects in seed coat mucilage, leaf serration and over-expression improves drought tolerance.
AT1G13680	Encodes a phospholipase C-like protein that serves as a convergence point for fumonisin B1 and extracellular ATP signalling, and functions in Arabidopsis stress response to fumonisin B1.
AT1G52570	member of C2-PLD subfamily
AT4G35790	Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death.
AT4G11840	member of C2-PLD subfamily
AT4G39670	Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes.
AT4G35110	phospholipase-like protein (PEARLI 4) family protein;(source:Araport11)
AT1G04010	phospholipid sterol acyl transferase 1;(source:Araport11)
AT1G10700	Encodes a P-independent phosphoribosyl pyrophosphate (PRPP) synthase.
AT1G32060	phosphoribulokinase;(source:Araport11)
AT2G32260	phosphorylcholine cytidylyltransferase;(source:Araport11)
AT1G12370	encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele
AT3G12810	Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile.
AT3G47390	Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant.
AT1G68650	Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types.
AT2G46820	Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure.
AT1G03130	Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2)
AT3G16140	Encodes subunit H of photosystem I reaction center subunit VI.
AT4G12800	Encodes subunit L of photosystem I reaction center.
AT1G67740	PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts where it is processed into two integral membrane proteins with identical topology (PsbY-1 and PsbY-2). The protein appears to bind manganese. Important for the redox control of cytochrome b559.
AT2G30170	Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens.
AT2G05070	Encodes Lhcb2.2. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus.
AT2G20890	Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile.
AT2G30570	Encodes PsbW, a protein similar to photosystem II reaction center subunit W. Loss of PsbW destabilizes the supramolecular organization of PSII.
AT2G06520	Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX.
AT5G29000	MYB-CC family member. PHL1 acts redundantly with PHR1 to regulate responses to Pi starvation.
AT2G20400	MYB-CC transcription factor. PHL4 is related to PHR1 (which regulates plant Pi starvation response) but it does not seem to have a significant role in Pi starvation.
AT4G14150	Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast.
AT1G68890	Homologous to the four eubacterial men genes involved in menanoquinone biosynthesis. Studies of mutants defective in this gene demonstrated its involvement in phylloquinone biosynthesis in Arabidopsis. The mRNA is cell-to-cell mobile.
AT1G03980	Encodes a protein with phytochelatin synthase activity which binds Cd2+ and Cd-glutathione complexes with high affinity. The protein has been postulated to be involved in Cd2+ tolerance. AtPCS2 expression appears to be less than that of AtPCS1, explaining the inability of endogenous AtPCS2 to substitute for AtPCS1 in the cad1-3 mutant (AtPCS1 null).
AT5G48150	Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway.
AT5G35840	Encodes the apoprotein of phytochrome;one of a family of photoreceptors that modulate plant growth and development. The mRNA is cell-to-cell mobile.
AT2G46970	encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family.
AT2G43010	Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner.
AT3G16500	phytochrome-associated protein 1 (PAP1)
AT1G22280	Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus.
AT2G31980	PHYTOCYSTATIN 2;(source:Araport11)
AT4G16500	Cystatin/monellin superfamily protein;(source:Araport11)
AT1G13590	Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus.
AT2G22860	Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. The mRNA is cell-to-cell mobile.
AT3G44735	Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor.
AT3G49780	Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype.
AT4G37720	Probable phytosulfokines 6 precursor, coding for a unique plant peptide growth factor.
AT5G53890	Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation.
AT3G26840	Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.
AT4G31900	chromatin remodeling factor;(source:Araport11)
AT2G39210	Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides.
AT5G12130	integral membrane TerC family protein;(source:Araport11)
AT4G30720	Encodes a putative oxidoreductase/electron carrier detected in the chloroplast stroma that is essential to ensure a correct electron flow through the photosynthetic chain and, hence, photosynthesis efficiency and normal growth. Mutations in the Col-0 allele result in pale green pigmentation and defective growth.
AT1G68450	VQ motif-containing protein;(source:Araport11)
AT1G76620	Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11)
AT1G77110	Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux.
AT1G23080	Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux.
AT1G71090	Auxin efflux carrier family protein;(source:Araport11)
AT1G76520	Auxin efflux carrier family protein;(source:Araport11)
AT1G76530	Auxin efflux carrier family protein;(source:Araport11)
AT5G65980	Auxin efflux carrier family protein;(source:Araport11)
AT2G34650	Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID.
AT3G59220	encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development.
AT5G18410	distorted trichomes and exhibits a diffuse actin cytoskeleton
AT4G02075	RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11)
AT5G15930	Encodes a putative plant adhesion molecule.
AT2G32960	Encodes an atypical dual-speciﬁcity phosphatase.
AT1G14870	PCR2 encodes a membrane protein involved in zinc transport and detoxification.
AT1G18490	2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11)
AT1G55010	Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2.
AT3G18660	Plants expressing an RNAi construct specifically targeting PGSIP1 was shown to have a dramatically reduced amount of starch. Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition.
AT1G77130	Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition.
AT2G35710	Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11)
AT5G05850	Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen.
AT3G26500	Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction.
AT1G12970	Encodes PIRL3, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction.
AT2G19330	Encodes PIRL6, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction.
AT4G26050	Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile.
AT5G58650	Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK).
AT5G62190	Encodes a ATP-dependent RNA unwinding protein targeted to the nucleolus and presumably involved in translation by assisting ribosome maturation. DEAD/DEAH box RNA helicase PRH75
AT2G28830	Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor.
AT3G46510	Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. Can be phosphorylated in vitro by MLPK, ARK1, and ARK2 but not by SD1-29. Involved in ubiquitination of pattern recognition receptor FLS2.
AT3G54850	Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro. Regulator of flowering time.
AT1G29340	Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile.
AT1G10560	Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.
AT3G52450	Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity.
AT2G35930	Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity.
AT3G11840	Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity.
AT3G19380	PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation.
AT1G49780	PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation.
AT3G18710	Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays.
AT3G54790	ARM repeat superfamily protein;(source:Araport11)
AT3G47820	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G62560	Plant U-box type E3 ubiquitin ligase (PUB).
AT1G76390	Plant U-box type E3 ubiquitin ligase (PUB).
AT5G18320	One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment.
AT1G01680	Plant U-box type E3 ubiquitin ligase (PUB).
AT4G21350	Encodes a U-box/ARM repeat protein required fore self-incompatibility.
AT2G01650	encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo.
AT3G17750	Encodes a member of a plant-specific subgroup in the DYRK (dual-specificity tyrosine phosphorylation-regulated kinase) family.
AT1G24560	Effector molecule of the plant-unique RAB5, ARA6. Acts in the vacuolar/endocytic trafficking pathway with canonical RAB5 and SYP. Promotes recruitment of VSP9a onto the endosome, which is required for efficient RAB5 activation. Colocalizes with RAB5 on endosomes, where it coordinates transport with canonical RAB5.
AT5G60660	A member of the plasma membrane intrinsic protein subfamily PIP2.When expressed in yeast cells can conduct hydrogen peroxide into those cells. Mutants exhibit longer root hairs.
AT3G53420	a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev. When expressed in yeast cells can conduct hydrogen peroxide into those cells.
AT4G20260	Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile.
AT1G69295	Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose.
AT1G04520	Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata.
AT5G53280	An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile.
AT2G24090	Ribosomal protein L35;(source:Araport11)
AT5G65220	Ribosomal L29 family protein;(source:Araport11)
AT3G02150	a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation.
AT2G34640	Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression.
AT3G46780	plastid transcriptionally active 16;(source:Araport11)
AT2G32180	plastid transcriptionally active 18;(source:Araport11)
AT1G68590	Ribosomal protein PSRP-3/Ycf65;(source:Araport11)
AT1G32440	encodes a chloroplast pyruvate kinase beta subunit. The enzyme is less active than the other chloroplast pyruvate kinase beta subunit encoded by AT5G52920. Involved in seed oil biosynthesis. Can partially complement the AT5G52920 mutant.
AT5G16150	Encodes a putative plastidic glucose transporter.
AT5G52920	encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. The mRNA is cell-to-cell mobile.
AT5G39570	Protein of unknown function. Binds phosphatidic acid and acts downstream of PLDalpha.
AT2G29700	Encodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension The mRNA is cell-to-cell mobile.
AT1G22780	S18 ribosomal protein involved in the binding of f-Met tRNA during initiation of mRNA translation. Expression restricted to meristems. Mutant phenotype-pointed first leaves,reduced fresh weight, growth retardation.
AT1G71270	Encodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network.
AT5G02400	Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background.
AT3G09400	Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed.
AT1G07630	Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves.
AT2G29790	Encodes a Maternally expressed gene (MEG) family protein [pseudogene]
AT2G16535	Encodes a Maternally expressed gene (MEG) family protein
AT2G35350	Encodes a protein most similar to the POLTERGEIST locus. Double mutant analysis of loss of function alleles indicate PLL1 functions redundantly with POL to regulate meristem size and pedicel length. Acts in a dose dependent manner with POL to suppress the clv1, clv2 and clv3 phenotypes.
AT2G28890	Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves.
AT4G34110	Putative poly-A binding protein. Member of a gene family .Expressed in stele and root meristem and post-fertilization ovules.Member of the class II family of PABP proteins. The mRNA is cell-to-cell mobile.
AT2G25850	Encodes a poly(A) polymerase. Located in the nucleus.
AT3G06560	Encodes a poly(A) polymerase. Located in the cytoplasm.
AT2G31865	poly(ADP-ribose) glycohydrolase 2;(source:Araport11)
AT4G02390	Encodes a DNA dependent nuclear poly (ADP-ribose) polymerase (E.C.2.4.2.30), thought to be involved in post-translational modification .
AT4G29720	polyamine oxidase 5;(source:Araport11)
AT1G31830	Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein.
AT1G60390	polygalacturonase 1;(source:Araport11)
AT1G70370	Polygalacturonase involved in cell wall modification.
AT2G41850	ADPG2.
AT5G06860	Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium.
AT3G26610	Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development.
AT1G78400	PGX2 is a cell wall protein that codes for a polygalacturonase.
AT1G48100	Pectin lyase-like superfamily protein;(source:Araport11)
AT2G16120	polyol/monosaccharide transporter 1;(source:Araport11)
AT3G18830	This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily.
AT2G16530	Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal
AT3G20160	Terpenoid synthases superfamily protein;(source:Araport11)
AT3G01150	Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination.
AT1G10710	Computational predictions suggested the presence of a small cysteine-rich protein beginning in intron 9 (Silverstein 2007), but subsequent analysis revealed that this region contains a tenth exon for the At1g10710 gene. PHS1 regulates recombination and pairing of homologous chromosomes during meiotic prophase by controlling transport of RAD50 from cytoplasm to the nucleus.
AT5G46240	Encodes a potassium channel protein (KAT1). ABA triggers KAT1 endocytosis both in epidermal cells as well as guard cells. Upon removal of ABA, KAT1 is recycled back to the plasma membrane. KAT1 is localized within 0.5?0.6 μm diameter microdomains at the plasma membrane surface. KAT1 belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500).
AT4G32650	Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500).
AT4G22200	Encodes AKT2, a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential. AKT2 belongs to the Shaker family K+ channels which include the following groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500).
AT3G52250	Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile.
AT5G51700	Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation.
AT1G44910	Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries.
AT3G19670	Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. Ubiquitously expressed and localize to the nucleus.
AT1G15480	PPR motif containing protein. Found in mitochondria. Mutants flower early and have reduced levels of the ABI5, a regulator of FLC expression.
AT2G23270	Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. Finetuning role in modulation of immunity through the regulation of SA and JA biosynthesis and signalling pathways.
AT5G43066	Homolog of prePIP1.
AT5G44585	Precursor of serine-rich endogenous peptide which regulates defense response and root elongation. Has properties of phytocytokines, activates the phospholipid signaling pathway, regulates reactive oxygen species response, and is perceived in a BAK1 co-receptor-dependent manner.
AT5G49510	prefoldin 3;(source:Araport11)
AT5G56230	prenylated RAB acceptor 1.G2;(source:Araport11)
AT3G19170	Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers
AT1G49630	Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed in flower, leaf and root. Not expressed in silique and shoot.
AT1G29850	Encodes a protein that by its interaction with HAM acetyltransferases plays an important role during DNA damage responses induced by UV-B radiation and participates in programmed cell death programs.
AT5G40770	prohibitin 3
AT4G02060	Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin.
AT2G39890	Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem.
AT3G55740	Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots.
AT1G26150	Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT1G52290	Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT3G24400	Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT3G24540	Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT3G18810	Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT1G68690	Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807).
AT4G38770	Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant.
AT3G06300	Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. The mRNA is cell-to-cell mobile.
AT2G17720	Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells.
AT3G62120	Encodes a cytosolic prolyl-tRNA synthetase.
AT3G13330	Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor.
AT1G16470	Encodes 20S proteasome subunit PAB1 (PAB1).
AT5G49020	Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts.
AT5G47420	PAWH2 along with PAWH1 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway.
AT5G38900	Thioredoxin superfamily protein;(source:Araport11)
AT1G08910	Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response.
AT5G41580	Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response.
AT1G14370	Encodes protein kinase APK2a. Protein is N-myristoylated.
AT1G51690	55 kDa B regulatory subunit of phosphatase 2A mRNA,
AT5G36250	Encodes a myristoylated 2C-type protein phosphatase that interacts with the catalytic subunit of SnRK1. The mRNA is cell-to-cell mobile.
AT5G55260	Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase.
AT2G33640	DHHC-type zinc finger family protein that encodes a functional s-acyl transferase.
AT5G39790	Encodes a chloroplast localized protein that is involved in protein translocation and starch metabolism. PTST helps localize GBSS to the starch granules where GBSS functions in amylose biosynthesis.
AT2G35680	Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem.
AT1G03630	Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent.
AT4G04890	Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression.
AT5G06970	PATROL1 is a Munc13-like protein involved in mediating H[+]-ATPase translocation. It interacts with AHA1and is responsible for its translocation during stomatal movement.
AT3G15340	Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1.
AT5G49240	member of Response Regulator: Pseudo
AT5G24470	Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions.
AT1G68210	Similar to ARR response regulator proteins that function in two-component signal transduction but lacking a conserved D-D-K motif in the receiver domain
AT5G02810	PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR9 to regulate hypocotyl growth under photoperiodic conditions.
AT4G21370	The Col-0 pseudoSRKA allele contains a frameshift mutation that introduces a premature stop codon within the fourth of seven exons found in SRK genes. Its SCR sequences consist of several truncated pseudoSCR sequences, the longest of which is designated pseudoSCR1.
AT3G13175	transmembrane protein;(source:Araport11)
AT1G34320	Ikzf5 (DUF668);(source:Araport11)
AT1G30755	elongation factor G, putative (DUF668);(source:Araport11)
AT1G72300	Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion.
AT3G50110	Encodes a phosphatase with low in vitro tyrosine phosphatase activity that is NOT capable of dephosphorylating in vitro the 3'phosphate group of PI3P, PI(3,4)P2.
AT4G08840	Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT5G43090	Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT5G60180	Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT4G25880	Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts.
AT2G32080	similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication
AT1G28230	Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation.
AT1G19770	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile.
AT1G75470	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G57990	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G47603	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT2G33750	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT4G18205	Nucleotide-sugar transporter family protein;(source:Araport11)
AT1G30840	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT4G18197	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile.
AT4G18195	Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane.
AT1G13750	Encodes a purple acid phosphatase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots.
AT2G46880	purple acid phosphatase 14;(source:Araport11)
AT1G14700	purple acid phosphatase 3;(source:Araport11)
AT1G52940	Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea.
AT2G03450	purple acid phosphatase 9;(source:Araport11)
AT1G62290	Saposin-like aspartyl protease family protein;(source:Araport11)
AT2G47750	Encodes GH3.9, a member of the GH3 family auxin-responsive genes. gh3.9-1 mutants had greater primary root length, increased sensitivity to indole-3-acetic acid (IAA)-mediated root growth inhibition, but no obvious effects on apical dominance or leaf morphology.
AT5G36150	putative pentacyclic triterpene synthase 3;(source:Araport11)
AT1G77720	Encodes a predicted protein kinase based on sequence similarity.
AT3G17410	Positively regulates ABA-mediated physiological responses via phosphorylation on RCAR3/ RCAR11.
AT5G27650	PWWP domain protein involved in regulation of FLC and flowering time.
AT3G16420	The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. The mRNA is cell-to-cell mobile.
AT4G22930	Encodes dihydroorotase (PYR4).
AT3G17810	Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid.
AT5G12200	Encodes a protein with dihydropyrimidine amidohydrolase activity. It localizes to the secretory system and plays a role in uracil metabolism.
AT4G01480	Encodes a protein that might have inorganic pyrophosphatase activity.
AT5G01330	pyruvate decarboxylase
AT1G59900	encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile.
AT3G06483	Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily.
AT3G07970	Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation.
AT1G15020	Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain.
AT1G49890	Together with QWRF1 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility.
AT5G43160	QWRF motif protein (DUF566);(source:Araport11)
AT3G06540	Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro.
AT5G41820	RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11)
AT1G16920	small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking.
AT4G18430	RAB GTPase homolog A1E;(source:Araport11)
AT3G46830	RAB GTPase homolog A2C;(source:Araport11)
AT5G59150	RAB GTPase homolog A2D;(source:Araport11)
AT2G22390	Encodes an unusual RabA family member as it has a Lysine the position of the highly conserved Glu of the WDTAGQE motif and has the sequence CVAA! at its C-ter rather than the conventional CCXX(X) or CXC motifs that promote geranylgeranylation and membrane anchoring.
AT1G18200	Rab GTPase-like A1I protein;(source:Araport11)
AT4G17160	RAB GTPase homolog B1A;(source:Araport11)
AT3G09910	RAB GTPase homolog C2B;(source:Araport11)
AT5G53570	Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11)
AT5G45130	small GTP binding protein The mRNA is cell-to-cell mobile.
AT5G06070	Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus.
AT4G35950	A member of ROP GTPases gene family-like. GTP binding protein Arac6.
AT1G71100	Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis.
AT1G32230	Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile.
AT3G46930	Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses.
AT3G04735	Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT3G05490	Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT4G13075	Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT4G13950	Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT4G14010	Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide.
AT4G15800	Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile.
AT5G67070	Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile.
AT1G28270	Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF4 and RALF19 act redundantly in the pollen tube to regulate pollen tube growth.
AT5G01770	Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutations in this gene have no visible effects on embryo or plant development.
AT1G02130	Belongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation.
AT5G55080	A member of RAN GTPase gene family.
AT3G24560	novel gene involved in embryogenesis
AT4G34730	ribosome-binding factor A family protein;(source:Araport11)
AT5G08710	Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT5G66160	Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2.
AT1G65790	An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain.
AT1G65800	Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile.
AT4G21380	encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels.
AT1G71390	receptor like protein 11;(source:Araport11)
AT1G74170	receptor like protein 13;(source:Araport11)
AT1G74180	receptor like protein 14;(source:Araport11)
AT1G74190	receptor like protein 15;(source:Araport11)
AT1G74200	receptor like protein 16;(source:Araport11)
AT2G15040	pseudogene of receptor like protein 53;(source:Araport11)
AT2G15080	receptor like protein 19;(source:Araport11)
AT1G17240	Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter.
AT2G25440	receptor like protein 20;(source:Araport11)
AT2G25470	receptor like protein 21;(source:Araport11)
AT2G32680	NLP20 LRR receptor protein involved in PAMP mediated immunity.
AT3G05360	receptor like protein 30;(source:Araport11)
AT3G05370	receptor like protein 31;(source:Araport11)
AT3G05650	receptor like protein 32;(source:Araport11)
AT3G05660	receptor like protein 33;(source:Araport11)
AT3G11080	receptor like protein 35;(source:Araport11)
AT3G23010	receptor like protein 36;(source:Araport11)
AT3G23120	receptor like protein 38;(source:Araport11)
AT1G28340	receptor like protein 4;(source:Araport11)
AT3G49750	receptor like protein 44;(source:Araport11)
AT4G04220	receptor like protein 46;(source:Araport11)
AT4G13880	receptor like protein 48;(source:Araport11)
AT1G34290	receptor like protein 5;(source:Araport11)
AT4G13920	receptor like protein 50;(source:Araport11)
AT5G25910	putative disease resistance protein induced by chitin oligomers.
AT5G27060	receptor like protein 53;(source:Araport11)
AT1G45616	receptor like protein 6;(source:Araport11)
AT1G47890	receptor like protein 7;(source:Araport11)
AT1G58190	receptor like protein 9;(source:Araport11)
AT1G29750	Receptor-like serine/threonine kinase (RKF1). The putative extracellular domain of the RKF1 protein contains 13 tandem repeats of leucine-rich sequences. Expressed in early flower primordial, stamen, and pollen grains.
AT5G60900	Encodes a receptor-like protein kinase.
AT4G00340	Encodes a receptor-like protein kinase that is expressed in roots.
AT3G46530	Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile.
AT4G16860	Confers resistance to Peronospora parasitica. RPP4 is coordinately regulated by transcriptional activation and RNA silencing.
AT4G16950	Contains a putative nucleotide binding site and leucine-rich repeats. Similar to the plant resistance genes N and L6, and to the toll and interleukin-1 receptors. Confers resistance to Peronospora parasitica.Redundant function together with SIKIC1 and 3 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2.
AT5G43470	Confers resistance to Peronospora parasitica. In arabidopsis ecotype Dijon-17, HRT-mediated signaling is dependent on light for the induction of hypersensitive response and resistance to turnip crinkle virus.
AT1G67500	Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS).
AT1G60930	AtRECQ4B mutant showed no sensitivity to DNA damaging agents.Involved in homologous recombination.
AT4G34410	Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress.
AT4G28080	Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment.
AT4G04340	Encodes a plasma membrane localized hyperosmolality gated calcium channel that is expressed in guard cells and roots.
AT5G41040	Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol.
AT1G19360	Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells.
AT3G18990	Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3
AT3G23590	Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex.
AT3G17170	Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11)
AT4G29040	RPT2a encodes the 26S proteasome subunit. It is required for root meristem maintenance, and regulates gametogenesis. RPT2a is also shown to regulate gene silencing via DNA methylation.
AT4G02260	Displays guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity but not guanosine-3',5'-bis(diphosphate) 3'-diphosphate synthase activity. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness.
AT1G54130	This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness.
AT1G68840	Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile.
AT4G36900	Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1.
AT3G14230	encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12.
AT1G22190	The gene encodes a putative transcription factor belongings to the abiotic stress-associated DREB A-6 clade. The mRNA is cell-to-cell mobile.
AT5G13330	encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily.
AT4G06746	encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.9). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1 and RAP2.10.
AT2G28550	AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity.
AT2G22010	Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein.
AT1G49480	Encodes a nuclear-localized DNA-binding protein that interacts with ITN1 at the PM and nuclei in vivo and may regulate ITN's subcellular localization.
AT2G45820	Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality.
AT3G57540	Remorin family protein;(source:Araport11)
AT1G77470	Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent.
AT2G01570	Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development.
AT5G52250	Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling.
AT5G23730	Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling.
AT5G67630	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT4G15720	Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11)
AT4G11170	Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1.
AT1G79670	Encodes a receptor-like kinase that does not contain an extracellular leucine-rich repeat domain. A novel type of dominant disease-resistance protein that confers resistance to a broad spectrum of Fusarium races.
AT3G07040	Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1.
AT1G11330	S-locus lectin protein kinase family protein;(source:Araport11)
AT3G03710	Encodes a chloroplast polynucleotide phosphorylase (PNPase). Involved in response to phosphorus (P) starvation. Mutants impaired in the expression of this gene have been selected through their resistance to fosmidomycin, a strong inhibitor of DXR, an enzyme of the methylerythritol-dependent IPP biosynthesis pathway. The pathway enzymes were upregulated in the mutant seedlings.
AT5G05630	Encodes POLYAMINE UPTAKE TRANSPORTER 3, an amino acid permease family protein.
AT4G26090	Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile.
AT5G45250	RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames.
AT1G12220	Resistance gene, mediates resistance against the bacterial pathogen Pseudomonas syringae. Contains a putative nucleotide binding site composed of kinase-1a (or P-loop), kinase-2a, and putative kinase-3a domains, 13 imperfect leucine-rich repeats, a potential leucine zipper, and two uncharacterized motifs that are well conserved in products of previously isolated R genes. Confers resistance to Pseudomonas syringae strains that express avrPphB.
AT5G46470	Encodes RPS6 (RESISTANT TO P. SYRINGAE 6), a member of the TIR-NBS-LRR class resistance protein. The mRNA is cell-to-cell mobile.
AT5G45260	Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2.
AT5G07390	respiratory burst oxidase homolog A;(source:Araport11)
AT5G60010	ferric reductase-like transmembrane component family protein;(source:Araport11)
AT5G47910	NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile.
AT1G64060	Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site.
AT4G31920	Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem.
AT1G67710	Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Affects ABA-JA crosstalk.
AT2G25180	Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem.
AT3G62670	member of Response Regulator: B- Type
AT5G07210	member of Response Regulator: B- Type
AT5G26594	Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family . It appears to be expressed in floral buds, mature flowers, and pollen. But, unlike the related ARR22 protein, it does not appear to be expressed at the seed:funiculus junction.
AT1G59940	Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner.
AT2G41310	Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT1G10470	Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner.
AT5G62920	Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin.
AT3G57040	response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2
AT3G49580	response to low sulfur 1;(source:Araport11)
AT5G24660	response to low sulfur 2;(source:Araport11)
AT5G24655	response to low sulfur 4;(source:Araport11)
AT1G47128	Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture.
AT5G25610	responsive to dehydration 22 (RD22) mediated by ABA
AT5G44790	ATP dependent copper transporter vital for ethylene response pathway
AT3G27670	A novel protein, did not show high similarity to any protein of known function; reveals a novel genetic connection between lipid synthesis and embryo development. Expressed in all tissues examined including leaves, flowers, roots, stems, and siliques, but accumulation levels were not correlated with the degree to which different organs appeared affected by the mutation. Mutant plants showed alterations in the cuticular wax profiles and embryo development. The mRNA is cell-to-cell mobile.
AT2G41945	Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture.
AT5G22790	reticulata-related 1;(source:Araport11)
AT5G58000	Reticulon family protein;(source:Araport11)
AT3G10260	Reticulon family protein;(source:Araport11)
AT3G61560	Reticulon family protein;(source:Araport11)
AT3G09600	Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response.
AT3G02230	RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile.
AT3G08900	RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development.
AT5G60690	REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile.
AT2G22620	Rhamnogalacturonate lyase family protein;(source:Araport11)
AT1G56550	Encodes a rhamnogalacturonan II specific xylosyltransferase.
AT4G01750	Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT2 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. The mRNA is cell-to-cell mobile.
AT1G78570	Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli.
AT3G14790	rhamnose biosynthesis 3;(source:Araport11)
AT5G45160	Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11)
AT4G28950	A member of ROP GTPase gene family.
AT2G29050	RHOMBOID-like 1;(source:Araport11)
AT1G12750	RHOMBOID-like protein 6;(source:Araport11)
AT4G23070	RHOMBOID-like protein 7;(source:Araport11)
AT1G17160	RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis.
AT2G21790	encodes large subunit of ribonucleotide reductase involved in the production of deoxyribonucleoside triphosphates (dNTPs) for DNA replication and repair
AT4G36680	Ribosomal pentatricopeptide repeat protein
AT3G11940	One of two genes encoding the ribosomal protein S5. Mutants have semi-dominant developmental phenotypes. Most cell-division processes are delayed or disturbed in the heterozygous mutant, and development is completely arrested at an early embryonic stage in the homozygous mutant.
AT2G39460	Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB.
AT3G55280	60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it.
AT2G36620	RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020).
AT4G31700	Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis.
AT3G07750	3-5-exoribonuclease family protein;(source:Araport11)
AT3G46620	Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants.
AT1G79380	Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli.
AT5G14420	Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity.
AT4G28270	Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro.
AT4G11360	Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile.
AT4G35480	Encodes a putative RING-H2 finger protein RHA3b.
AT4G14220	encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond. The mRNA is cell-to-cell mobile.
AT5G22000	encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses.
AT3G58510	DEA(D/H)-box RNA helicase family protein;(source:Araport11)
AT3G61240	DEA(D/H)-box RNA helicase family protein;(source:Araport11)
AT5G05450	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT2G42520	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT1G74230	encodes a glycine-rich RNA binding protein. The mRNA is cell-to-cell mobile.
AT1G60650	Encodes one of the zinc finger-containing glycine-rich RNA-binding proteins involved in cold tolerance: AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b), AT5G04280 (AtRZ-1c). It also, along with AtRZ-1c, plays important roles in plant development, pre- mRNA splicing, and general gene expression.
AT1G17640	Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily.
AT5G54900	RNA-binding protein 45A;(source:Araport11)
AT1G49600	RNA-binding protein 47A;(source:Araport11)
AT1G47490	RNA-binding protein 47C;(source:Araport11)
AT1G47500	RNA-binding protein 47C;(source:Araport11)
AT4G03110	Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity.
AT1G07910	Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains, an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo.
AT4G15417	RNAse II-like 1;(source:Araport11)
AT1G80650	RNAse THREE-like protein 1;(source:Araport11)
AT3G20420	double-stranded RNA binding / ribonuclease III. Required for 3' external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo. Localizes in the nucleus and cytoplasm.
AT3G54280	ROOT GROWTH DEFECTIVE 3;(source:Araport11)
AT4G22080	root hair specific 14;(source:Araport11)
AT5G67400	root hair specific 19;(source:Araport11)
AT1G30850	root hair specific 4;(source:Araport11)
AT1G63450	Encodes a xyloglucan-specific galacturonosyltransferase (XUT1) that forms the beta-d-galactosyluronic acid-(1->2)-alpha-d-xylosyl linkage.
AT5G45710	member of Heat Stress Transcription Factor (Hsf) family
AT3G49180	Transducin/WD40 repeat-like superfamily protein;(source:Araport11)
AT5G60810	Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). Controls root meristem size through ROS signalling.
AT1G13620	Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9).
AT3G02240	Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9).
AT2G03830	Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9).
AT2G26290	root-specific kinase 1;(source:Araport11)
AT4G38430	Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects.
AT1G52240	Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily .
AT1G79860	Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth Growth.
AT1G31650	Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT1G01700	Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT2G45890	Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits
AT5G05940	Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT3G55660	Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily.
AT3G05140	ROP binding protein kinases 2;(source:Araport11)
AT2G46710	ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits.
AT1G78430	Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants).
AT4G04900	encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings.
AT4G38740	Encodes cytosolic cyclophilin ROC1.
AT4G36380	Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates).
AT1G17235	This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation.
AT4G13395	ROTUNDIFOLIA like 12;(source:Araport11)
AT3G46613	Encodes a small is a member of an angiosperm specific gene family.
AT2G39705	ROTUNDIFOLIA like 8;(source:Araport11)
AT5G05780	Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. The mRNA is cell-to-cell mobile.
AT5G26760	Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation.
AT3G23390	Zinc-binding ribosomal protein family protein;(source:Araport11)
AT2G20310	Encodes RPM1 Interacting Protein 13 (RIN13), a resistance protein interactor shown to positively enhance resistance function of RPM1.
AT5G51450	Encodes RING-finger type ubiquitin ligases.
AT3G25070	Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile.
AT2G05940	Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1.
AT5G35910	Encodes a nuclear-localized RRP6-like protein whose mutation leads to accumulation of an rRNA maturation by-product.
AT3G04550	Encodes an ancillary chaperone protein that functions in Rubisco biogenesis. RAF1 dimers function in the assembly of the large subunit of Rubisco. Co-expression of RAF1 and rbcL in tobacco cells results in increased photosynthesis and plant growth. The mRNA is cell-to-cell mobile.
AT5G53040	Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates.
AT4G01850	S-adenosylmethionine synthetase 2;(source:Araport11)
AT4G32300	S-domain-2 5;(source:Araport11)
AT1G58250	SABRE, putative gene of unknown function, homologous to maize apt1 gene. Required for normal cell expansion in the root cortex. The sabre mutation results in abnormal cell expansion. Encodes a rare message; very low level of expression was detected in roots and shoots.
AT5G27927	Member of Sadhu non-coding retrotransposon family
AT5G14260	Suppresses singlet oxygen-induced stress responses by protecting grana margins.
AT5G02020	Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich).
AT5G35410	encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition
AT1G06040	Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT.
AT1G27730	Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress.
AT5G22270	hypothetical protein;(source:Araport11)
AT3G55980	salt-inducible zinc finger 1;(source:Araport11)
AT2G31870	The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin.
AT5G60410	Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. Regulates leaf cell division and expansion through salicylic acid accumulation. signaling
AT5G52810	SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936).
AT4G17230	Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family. Regulated by heat shock.
AT1G50420	Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay).
AT5G13300	Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin.
AT3G54990	Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering.
AT3G12900	S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.
AT5G46410	Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile.
AT3G23727	Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT3G27503	Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT4G10767	Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT2G05117	Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein).
AT3G04240	Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570).
AT4G39180	encodes a protein that complements the function of a sec14(ts) mutant of S. cerevisiae
AT1G61250	Encodes a putative secretory carrier membrane protein (SC3). The mRNA is cell-to-cell mobile.
AT5G40390	Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis.
AT3G10420	P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11)
AT5G13030	Chloroplast localized homolog of SELO. Loss of function mutants have reduced production of reactive oxygen species (ROS) and higher ROS scavenging.
AT3G47300	SELT-like protein precursor;(source:Araport11)
AT3G10985	A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile.
AT1G66580	senescence associated gene 24;(source:Araport11)
AT1G20780	Encodes a protein containing a U-box and an ARM domain. Homozygous mutant seedlings have a seedling lethal phenotype with widespread cell death lesions throughout the cotyledons and roots.
AT5G14930	encodes an acyl hydrolase involved in senescence .
AT4G02380	Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses.
AT3G02040	Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. The mRNA is cell-to-cell mobile.
AT1G27060	Regulator of chromosome condensation (RCC1) family protein;(source:Araport11)
AT4G04920	Encodes a nuclear targeted protein that plays a role in the CBF pathway -downstream of CBF translation. Mutants have impaired cold responses, reduced levels of cold induced RNA transcripts, are sensitive to osmotic stress. Required for expression of CBF-controlled cold-upregulated genes and some, but not all, other cold up-regulated genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes. Required for expression of some dark-upregulated genes. SFR6 was isolated as a suppressor of cell wall defects in cob6 mutant background.
AT3G26680	involved in a SNM-dependent recombinational repair process of oxidatively induced DNA damage.
AT1G34370	Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile.
AT1G55920	Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile.
AT2G22970	serine carboxypeptidase-like 11;(source:Araport11)
AT3G12230	serine carboxypeptidase-like 14;(source:Araport11)
AT3G12240	serine carboxypeptidase-like 15;(source:Araport11)
AT3G12220	serine carboxypeptidase-like 16;(source:Araport11)
AT1G33540	serine carboxypeptidase-like 18;(source:Araport11)
AT5G09640	encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase.
AT4G12910	serine carboxypeptidase-like 20;(source:Araport11)
AT3G25420	serine carboxypeptidase-like 21;(source:Araport11)
AT2G35780	serine carboxypeptidase-like 26;(source:Araport11)
AT2G35770	serine carboxypeptidase-like 28;(source:Araport11)
AT1G43780	serine carboxypeptidase-like 44;(source:Araport11)
AT1G15000	serine carboxypeptidase-like 50;(source:Araport11)
AT2G27920	serine carboxypeptidase-like 51;(source:Araport11)
AT5G26780	Encodes a protein with serine hydroxymethyltransferase activity which is thought to be localized in the mitochondrial matrix. SHM2 expression fails to rescue the conditional lethal phenotype of the shm1-1 mutant, defective in SHM1.
AT3G08720	Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins.
AT5G08160	Encodes a serine/threonine protein kinase.
AT4G35780	ACT-like protein tyrosine kinase family protein;(source:Araport11)
AT2G14540	serpin 2;(source:Araport11)
AT5G37055	Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes.
AT5G53430	Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation.
AT3G61740	Encodes SET domain containing protein that acts redundantly with ATX4/5 to regulate histone H3-K4 methylation. Involved in bolting/flowering time together with ATX1 and ATX4.
AT4G27910	Encodes a SET domain containing protein, putative H3K4 methyltransferase. Involved in bolting/flowering time together with ATX1 and ATX3.
AT1G43850	Encodes a transcriptional co-regulator of AGAMOUS, that functions with LEUNIG to repress AG in the outer floral whorls.
AT4G25520	SEUSS-like 1;(source:Araport11)
AT1G78540	Encodes a protein that contains an SH2 domain. It can pull down a 120-kD tyrosine-phosphorylated protein in vitro. It is predicted to act as a transcription factor.
AT4G00720	Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway.
AT5G26751	Encodes a SHAGGY-related kinase involved in meristem organization. It regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase 6.Functions as a positive regulator of salt stress tolerance. Phosphorylates and enhances G6PD6 (At5g40760) activity
AT2G30980	Encodes a GSK3-like protein kinase. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts.
AT3G58780	One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells.
AT5G49270	Involved in successfully establishing tip growth in root hairs.
AT4G26690	Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development.
AT1G75520	A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis.
AT1G19790	A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.
AT2G21400	A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.
AT5G11190	Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11.
AT5G02750	Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing.
AT5G39510	Encodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12. The mRNA is cell-to-cell mobile.
AT1G28560	Encodes a protein similar to human SNAP50. Mutants display different temperature sensitivities in the dedifferentiation of cells from different organs. Mutation inhibits the dedifferentiation-associated accumulation of U-snRNAs and some other small RNA species encoded by independent-type genes carrying the USE and TATA box. Required for the elevation of cell proliferation competence in hypocotyl dedifferentiation.
AT1G69935	Encodes a nuclear localized serine-arginine-aspartate-rich protein that acts as a negative regulator of photomorphogenesis.
AT4G25350	SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development.
AT5G66350	A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Shi mutant is dominant, has dwarf phenotype. Loss of function mutations have no observable phenotype. Putative zinc finger protein. Involved in the response to gibberellic acid.
AT1G11185	Has been identified as a translated small open reading frame by ribosome profiling.
AT3G06125	Unknown gene The mRNA is cell-to-cell mobile.
AT3G29644	Natural antisense transcript overlaps with AT3G29642. Has been identified as a translated small open reading frame by ribosome profiling.
AT5G10278	Has been identified as a translated small open reading frame by ribosome profiling.
AT5G24735	Has been identified as a translated small open reading frame by ribosome profiling.
AT3G52748	Has been identified as a translated small open reading frame by ribosome profiling.
AT4G37650	Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker.
AT2G47140	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT3G51680	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT2G47130	Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria.
AT3G08800	Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning.
AT1G66970	Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family.
AT5G02220	cyclin-dependent kinase inhibitor;(source:Araport11)
AT4G16960	Redundant function together with SIKIC1 and 2 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2.
AT3G56710	Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts.
AT1G73990	Encodes a putative protease SppA (SppA).
AT2G43070	SIGNAL PEPTIDE PEPTIDASE-LIKE 3;(source:Araport11)
AT1G01650	SIGNAL PEPTIDE PEPTIDASE-LIKE 4;(source:Araport11)
AT1G05820	SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11)
AT2G22300	Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes.
AT3G15390	Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing.
AT2G35510	Encodes a WWE domain-containing protein with 76% similarity to RCD1. The protein also contains a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation.
AT1G23550	Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress).
AT3G47720	Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation.
AT5G62520	Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response.
AT1G70060	Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). The mRNA is cell-to-cell mobile.
AT5G16270	Encodes a SCC1/REC8 ortholog that may be involved in mitosis and may represent a mitotic cohesin. Plays a role in somatic DNA double strand break damage repair. The mRNA is cell-to-cell mobile.
AT2G47310	Functions in an antagonistic manner to its close homolog FCA. The SSF414N protein variant interacts more strongly with CUL1, a component of the E3 ubiquitination complex, than the SSF414D form, mediating differences in SSF protein degradation and FLC expression.
AT3G25650	SKP1-like 15;(source:Araport11)
AT2G03190	one of SKP1 homologs. Gene is expressed specifically in the silique.
AT1G10230	Involved in protein degradation. One target is PHR1.
AT1G06110	SKP1/ASK-interacting protein 16;(source:Araport11)
AT3G54480	Encodes an SKP1 interacting partner (SKIP5).
AT5G48450	Encodes a protein with two DUF26 domains and a signal peptide for secretion. The protein is transported to the apoplast when it is expressed as a GFP fusion protein.
AT4G22010	SKU5 similar 4;(source:Araport11)
AT1G21860	SKU5 similar 7;(source:Araport11)
AT1G21850	SKU5 similar 8;(source:Araport11)
AT1G41830	SKU5-similar 6;(source:Araport11)
AT1G62262	Predicted to encode a protein with similarity to the SLAC1 protein involved in ion homeostasis in guard cells.
AT5G48170	encodes an F-box protein whose protein sequence is similar to SLY1, which belongs to SCF-SLY1 E3 ligase complex. SCF-SLY1 E3 ligase degrades DELLA proteins that are involved in promoting growth. Overexpression of SLY2 can partially compensate sly1-10 mutant phenotype of dwarfism.
AT1G55040	SED1 is a protein of unknown function that is located in the mitochondrion. sed1 mutants are embryo lethal.
AT3G59810	Small nuclear ribonucleoprotein family protein;(source:Araport11)
AT2G43810	Small nuclear ribonucleoprotein family protein;(source:Araport11)
AT4G13520	Encodes a small acid protein (SMAP1) that mediates responses Arabidopsis root to the synthetic auxin 2,4-Dichlorophenoxyacetic acid. The mRNA is cell-to-cell mobile.
AT3G04090	Belongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER.
AT3G56950	One of the Major Intrinsic Proteins(MIPs) which facilitate the passive transport of small molecules across membranes.Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER. Probably involved in the alleviation of ER stress; the lack of SIP2;1 reduces both pollen germination and pollen tube elongation.
AT1G55270	SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis.
AT2G45210	SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G79130	SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G16510	Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport.
AT2G18010	SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G66260	SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G09530	SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G53590	SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G00880	SAUR-like auxin-responsive protein family;(source:Araport11)
AT2G46690	Regulates ABA-mediated responses to drought stress.
AT4G12410	SAUR-like auxin-responsive protein family;(source:Araport11)
AT2G28085	SAUR-like auxin-responsive protein family;(source:Araport11)
AT2G36210	SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G34810	SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G75590	SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G19840	SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G50760	SAUR-like auxin-responsive protein family;(source:Araport11)
AT3G53250	SAUR-like auxin-responsive protein family;(source:Araport11)
AT5G20820	SAUR-like auxin-responsive protein family;(source:Araport11)
AT4G36110	SAUR-like auxin-responsive protein family;(source:Araport11)
AT1G19020	Modulates defense against bacterial pathogens and tolerance to oxidative stress.
AT4G20440	small nuclear ribonucleoprotein associated protein B;(source:Araport11)
AT4G30220	small nuclear ribonucleoprotein F;(source:Araport11)
AT5G55170	Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets.
AT1G56580	Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator.
AT4G30350	Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling.
AT3G52490	Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance.
AT1G07200	Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance.
AT3G48880	Encodes an F-box protein, SNIPER4, that regulates the turnover of MUSE13 and MUSE14, redundant TRAF proteins serving as adaptors in the SCFCRP1 complex to facilitate the turnover of nucleotide-binding domain and leucine-rich repeats (NLR) immune receptors.
AT3G50500	encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth.
AT2G23030	encodes a member of SNF1-related protein kinases (SnRK2)
AT3G48530	SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11)
AT1G50410	Encodes a member of the SNF2 family of helicase-like proteins and is involved in RNA-directed DNA methylation. It is functionally redundant with FRG1.
AT5G60750	Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities.
AT1G26470	chromatin modification-like protein;(source:Araport11)
AT1G26210	AtSOFL1 acts redundantly with AtSOFL2 as positive regulator of cytokinin levels.
AT4G32400	Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol.
AT2G37390	Chloroplast-targeted copper chaperone protein;(source:Araport11)
AT1G17050	Encodes one of the two paralogous solanesyl diphosphate synthases - SPS1 (At1g78510) and SPS2 (At1g17050) - that assemble the side-chain of plastoquinone-9 in plastids.
AT2G26740	Encodes a soluble epoxide hydrolase whose expression is induced by auxin and water stress.
AT5G61210	membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation The mRNA is cell-to-cell mobile.
AT2G13790	somatic embryogenesis receptor-like kinase 4;(source:Araport11)
AT2G13800	somatic embryogenesis receptor-like kinase 5;(source:Araport11)
AT3G48195	Encodes a member of the Arabidopsis sorting nexin family.
AT4G30960	Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile.
AT1G05577	SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes.
AT5G10150	SOK2 is a DUF966 domain containing protein of unknown function. Expressed in discrete domains of the PM. In root endodermis and embryo, expression is in inner basal edges and in basal
AT3G46110	DUF966 domain containing protein, expressed during embryogenesis.
AT5G59790	SOK5 is a DUF966 domain containing protein expressed in early embryos.
AT1G09070	SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. The mRNA is cell-to-cell mobile.
AT3G15354	Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants.
AT5G53120	encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency.
AT3G61580	Fatty acid/sphingolipid desaturase;(source:Araport11)
AT4G21534	Diacylglycerol kinase family protein;(source:Araport11)
AT3G02180	SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion.
AT5G15600	SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion.
AT1G03060	Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity.
AT1G17070	Encodes a homologue of spliceosome disassembly factor NTR1. Required for correct expression and splicing of DOG1, a regulator of seed dormancy. The mRNA is cell-to-cell mobile.
AT3G45590	Encodes a catalytic subunit of tRNA splicing endonuclease.
AT4G27330	Encodes a putative transcription factor that is required for the initiation of both micro- and megagametogenesis and is expressed in the sporogenous tissue of the anther and the ovule. SPL is a chalaza identity gene that share overlapping functions in establishing the prospective chalaza of the ovule. It also plays a central role in patterning both the proximal-distal and the adaxial-abaxial axes in the ovule and generally interacts with YABBY proteins in vitro. Mutant is defective in the differentiation of primary sporogenous cells into microsporocytes, and does not properly form the anther wall. Regulator of anther cell differenctiation. Interacts with TPL and TCP proteins.
AT5G63670	Transcription elongation factor SPT4 homolog 2. T-DNA mutant is more susceptible to the biotroph Hpa.
AT5G15330	Encodes a protein with a single SYG1/Pho81/XPR1 (SPX) domain that localizes to both the cytosol and nucleus, acting as a dose-dependent modulator of PHR1-dependent and PHR1-independent phosphate-starvation responses in shoots. SPX4 prevents translocation of PHR1 (AT4G28610) to the nucleus in a dose- and Pi-dependent manner. In contrast to SPX1, SPX4 modulates rather than suppresses phosphate-starvation response (PSR) gene expression.
AT4G37760	squalene epoxidase 3;(source:Araport11)
AT2G47070	member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA.
AT1G20980	Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile.
AT5G43270	Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis.
AT3G60030	squamosa promoter-binding protein-like 12;(source:Araport11)
AT4G01970	Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity.
AT5G03650	Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves.
AT1G11720	Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD).
AT5G19690	encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile.
AT5G35770	A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development.
AT5G42890	sterol carrier protein 2;(source:Araport11)
AT3G07020	encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. ugt80a2 mutant plants have reduced steryl glycoside and acyl steryl glycoside levels and reduced seed size. ugt80a2/b1 double mutants have normal levels of celluose and normal cold stress tolerance.
AT1G20330	Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression.
AT1G76090	Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway.
AT2G02480	STICHEL mutant shows trichomes with fewer than normal branches.
AT1G79200	Encodes a nuclear localized protein involved in auxin-dependent control of cell proliferation in pistil development. Loss of function mutations have increased cell proliferation in the stigma.
AT2G26770	Encodes a plant-specific actin binding protein SCAB1 (STOMATAL CLOSURE-RELATED ACTIN BINDING PROTEIN1). SCAB1 stabilizes actin filaments and regulates stomatal movement.
AT3G48860	coiled-coil protein;(source:Araport11)
AT3G57480	SAP1 is a protein of unknown function whose expression is responsive to abiotic stressors including metals, salt, and ABA. Over expression confers increased tolerance to a variety of abiotic stressors.
AT1G51850	Malectin-like receptor-like kinase involved in MAMP mediated stomatal immunity. Interacts with BAK1/FLS2 signaling complex and subsequently phosphorylates and activates SLAC1.
AT1G51805	Leucine-rich repeat protein kinase family protein;(source:Araport11)
AT4G25380	stress-associated protein 10;(source:Araport11)
AT4G12040	A20/AN1-like zinc finger family protein;(source:Araport11)
AT1G74000	encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis.
AT1G11130	Encodes an atypical receptor-like kinase protein with a predicted extracellular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain expressed throughout the developing root but whose kinase activity is not essential for its function in vivo. Regulates expression of GLABRA2, CAPRICE, WEREWOLF, and ENHANCER OF GLABRA3. Required for floral organ shape, the development of the outer integument of ovules, and stem development. Regulates cell shape and cell division planes in the L2 layer of floral meristems and the L1-derived outer integument of ovules. Controls specification of epidermal root hairs. Participates in the coordination of cell morphogenesis between cell layers during floral development.
AT1G78980	STRUBBELIG-receptor family 5;(source:Araport11)
AT5G48600	member of SMC subfamily
AT1G68830	STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions.
AT2G22740	Encodes a SU(VAR)3-9 homolog, a methyltransferase involved in histone methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs but has a preference for the latter two. This is a member of a subfamily of SET proteins that shares a conserved SRA domain.
AT4G10540	Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD.
AT5G59090	subtilase 4.12;(source:Araport11)
AT5G59120	SBT4.13 subtilase. Activity is inhibited by SPI-1.
AT1G71950	SPI-1 is a member of the I9 inhibitor family. It is an inhibitor of SBT4.13 subtilase.
AT3G10380	Subunit of the Putative Arabidopsis Exocyst Complex
AT2G18450	Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex .
AT5G66880	encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile.
AT5G20280	Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform.
AT5G20830	Encodes a protein with sucrose synthase activity (SUS1).
AT3G52340	sucrose-phosphatase (SPP2)
AT1G71880	Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile.
AT1G22710	Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage.
AT2G14670	sucrose-proton symporter 8;(source:Araport11)
AT1G11260	Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile.
AT3G19930	Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile.
AT1G78000	Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes.
AT4G02700	sulfate transporter 3;(source:Araport11)
AT3G15990	Vascular cambium-localized sulfate transporter, mediates xylem-to-phloem transfer of phosphorus. 2 for its preferential distribution
AT5G19600	Encodes sulfate transporter Sultr3;5.
AT5G13550	Encodes a sulfate transporter.
AT3G01910	Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite.
AT5G01220	Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots.
AT3G45070	Encodes a sulfotransferase with sulfating activity toward flavonoids.
AT4G08620	Encodes a high-af?nity sulfate transporter. Contains STAS domain. Expressed in roots and guard cells. Up-regulated by sulfur deficiency.
AT2G03760	Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens.
AT5G48850	Homologous to the wheat sulphate deficiency-induced gene sdi1. Expression in root and leaf is induced by sulfur starvation. Knockout mutants retained higher root and leaf sulfate concentrations, indicating a role in regulation of stored sulfate pools.
AT3G57870	Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name.
AT4G33620	Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis.
AT2G21470	Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein.
AT4G23950	Encodes a member of the mid-SUN subfamily of SUN-domain proteins. It is involved in early seed development and nuclear morphology.
AT3G23130	Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants.
AT5G48870	SAD1 encodes a polypeptide similar to multifunctional Sm-like snRNP proteins that are required for mRNA splicing, export, and degradation. Mutation in this gene increases plant sensitivity to drought stress and ABA in seed germination, root growth, and the expression of some stress-responsive genes.
AT1G14320	Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself.
AT5G66020	Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13.
AT3G43220	Phosphoinositide phosphatase family protein;(source:Araport11)
AT1G17340	Phosphoinositide phosphatase family protein;(source:Araport11)
AT3G59770	Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses.
AT4G22305	Encodes SOBER1, a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis. SOBER1 was formerly linked to AT4G22300 but this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. AT4G22300 is now known as TIPSY1 and AT4G22305 corresponds to SOBER1.
AT2G31880	Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity.
AT1G25580	Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage.
AT5G57710	SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile.
AT1G56500	Encodes a thylakoid membrane protein with thioredoxin-like and beta-propeller domains located in the lumen and a haloacid-dehalogenase domain exposed to the chloroplast stroma. The protein's role may be to prevent formation of a slowly reversible form of antenna quenching, thereby maintaining the efficiency of light harvesting. The mRNA is cell-to-cell mobile.
AT4G37460	Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity.
AT5G11310	The SOAR1 gene encodes a pentatricopeptide repeat (PPR) protein which localizes to both the cytosol and nucleus. Down-regulation of SOAR1 strongly enhances, but up-regulation of SOAR1 almost completely impairs, ABA responses, revealing that SOAR1 is a critical, negative, regulator of ABA signalling. Further genetic evidence supports that SOAR1 functions downstream of ABAR and probably upstream of an ABA-responsive transcription factor ABI5. Changes in the SOAR1 expression alter expression of a subset of ABA-responsive genes including ABI5. These findings provide important information to elucidate further the functional mechanism of PPR proteins and the complicated ABA signalling network.
AT5G46580	pentatricopeptide (PPR) repeat-containing protein;(source:Araport11)
AT5G25440	Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain.
AT5G63020	Nucleotide binding leucine rich repeat protein of the C-NB-LRR (CNL) type. Involved in TOPP4 mediated immune response.
AT1G67140	HEAT repeat-containing protein;(source:Araport11)
AT1G31760	SWIB/MDM2 domain superfamily protein;(source:Araport11)
AT2G33610	Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Interacts with BSH, AtSWI3A, SWI3C and FCA. Expressed ubiquitously.
AT1G21700	a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003).
AT5G07880	member of mammalian SNAP25 Gene Family, a type of SNARE proteins with two chains. There are three members in Arabidopsis: SNAP30, SNAP29, and SNAP33.
AT1G08560	member of SYP11 syntaxin Gene Family
AT3G24350	member of Glycoside Hydrolase Family 17
AT2G18260	member of SYP11 Gene Family
AT3G11820	Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment.
AT1G11250	member of SYP12 Gene Family
AT3G03800	member of SYP13 Gene Family
AT4G02195	Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP43, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen.
AT3G61450	syntaxin of plants 73 (SYP73)
AT5G12850	CCCH-type zinc finger protein with ARM repeat domain-containing protein;(source:Araport11)
AT5G43630	Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile.
AT4G34270	TOR signaling pathway protein.
AT4G24972	Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1.
AT5G60120	AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY1 and CRY2 during flowering as part of a regulatory circuit including FT and CO. TOE1/TOE2 are also targets of MiR172b repression and functions in regulation of innate immunity via repression of FLS.
AT4G34400	B3-type transcription factor, which promotes floral transition and is repressed by FLC/SVP and promoted by SOC1.
AT1G50030	Related to TOR proteins from yeast and mammals, regulators of cell growth in response to nutrient availability. TOR proteins belong to the family of phosphatidylinositol 3-kinase and are targets of the antiproliferative drug rapamycin. AtTOR binds the yeast FKBP12 protein in the presence of Rapamycin, is involved in embryogenesis and is expressed in embryos, endosperm and meristems. Participates in negatively modulating ethylene signals and the molecular mechanism is likely involved in the regulation of ethylene biosynthesis by affecting ACSs in transcription and protein levels
AT2G20562	Encodes a putative signalling peptide with similarity to TAX1. No known function has been demonstrated yet.
AT1G54360	Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6.
AT3G45150	TCP domain protein 16;(source:Araport11)
AT1G72010	Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters.
AT1G58100	Encodes TCP8, belongs to the TCP transcription factor family known to bind site II elements in promoter regions. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters.
AT1G29010	verprolin;(source:Araport11)
AT5G13820	Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member.
AT1G30210	TCP family protein involved in heterochronic regulation of leaf differentiation.
AT3G27010	Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes.
AT1G67770	Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined.
AT5G03840	Controls inflorescence meristem identity. Involved in the floral initiation process. Ortholog of the Antirrhinum gene CENTRORADIALIS (CEN). Involved in protein trafficking to the protein storage vacuole. TFL1 plays an antagonistic role to FT/TSF in the determination of inflorescence meristem identity.
AT1G61120	Encodes a geranyllinalool synthase that produces a precursor to TMTT, a volatile plant defense C16-homoterpene. GES transcript levels rise in response to alamethicin, a fungal peptide mixture that damages membranes. This transcriptional response is blocked in JA biosynthetic and JA signaling mutants, but GES transcript levels still rise in response to alamethicin in mutants with salicylic acid and ethylene biosynthetic and/or signaling defects. GES transcripts also accumulate in response to a larval infestation. This enzyme does not localize to the plastids, and it may be present in the cytosol or endoplasmic reticulum. The mRNA is cell-to-cell mobile.
AT4G14770	Regulates fate transition and cell Divisions in the stomatal lineage.
AT1G62080	Encodes a member of a mucilage protein family. Predicted in silico to be glycosylated.
AT5G23030	Member of TETRASPANIN family
AT2G03840	TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development.
AT2G01960	Member of TETRASPANIN family
AT5G60220	Member of TETRASPANIN family
AT3G17880	Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX.
AT3G04710	Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT5G10090	Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT2G41520	Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT1G04190	Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT2G42580	Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile.
AT3G58620	Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis.
AT1G08320	bZIP transcription factor family protein;(source:Araport11)
AT3G12250	basic leucine zipper transcription factor involved in the activation of SA-responsive genes.
AT5G65210	Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated.
AT5G54380	Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth.
AT1G02880	Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine.
AT1G22940	Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media.
AT5G39950	encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells.
AT1G59730	Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1.
AT1G69880	thioredoxin H-type 8;(source:Araport11)
AT3G08710	Associated to plasma membrane. Moves cell to cell, suggesting a role in intercellular communication. The redox reaction between oxidized AtGPX3 and reduced AtTRXh9 is realized through the forming and breaking of disulfide bonds via the active sites of Cys4 and Cys57 in AtTRXh9.
AT1G31020	thioredoxin O2;(source:Araport11)
AT1G76760	Encodes a y-type thioredoxin (Trx-y1) localized in chloroplast stroma.
AT1G43560	thioredoxin Y2;(source:Araport11)
AT2G30440	Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile.
AT3G55160	THADA is an orphan gene in Arabidopsis thaliana. It is the only DUF2428 domain containing protein in the genome.
AT4G32570	TIFY domain protein 8;(source:Araport11)
AT3G22380	Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis.
AT5G20350	Encodes a protein containing ankyrin and DHHC-CRD domain. Acts to restrict the size of the swelling that forms at the beginning of root hair cell growth, possibly by a mechanism that requires RHD1. Mutant displays defects in both root hair and pollen tube growth. The mRNA is cell-to-cell mobile.
AT5G44920	Encodes a KASH domain protein that localizes to the nuclear envelope and affects nuclear morphology.
AT1G72950	Disease resistance protein (TIR-NBS class);(source:Araport11)
AT4G09420	Disease resistance protein (TIR-NBS class);(source:Araport11)
AT4G23440	Disease resistance protein (TIR-NBS class);(source:Araport11)
AT5G48780	disease resistance protein (TIR-NBS class);(source:Araport11)
AT1G66090	Disease resistance protein (TIR-NBS class);(source:Araport11)
AT1G72870	TIR-NBS gene.
AT1G72890	NBS TIR protein.
AT2G27170	Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment.
AT1G14740	Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation.
AT1G14530	tobamovirus multiplication-like protein (DUF1084);(source:Araport11)
AT5G16880	Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses.
AT1G21380	Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses.
AT1G76970	Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses.
AT5G05570	transducin family protein / WD-40 repeat family protein;(source:Araport11)
AT3G61380	Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11)
AT5G43880	methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11)
AT4G25430	hypothetical protein;(source:Araport11)
AT2G36420	nucleolin-like protein;(source:Araport11)
AT1G18620	Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation.
AT1G74160	Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation.
AT5G26910	Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division.
AT4G00770	DUF4378 domain protein;(source:Araport11)
AT4G01470	Encodes AtTIP1;3, functions as water and urea channels in pollen.
AT2G25810	tonoplast intrinsic protein 4;(source:Araport11)
AT5G46700	Encodes a transmembrane protein of the tetraspanin (TET) family, one of 17 members found in Arabidopsis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. Required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis.
AT3G16720	RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile.
AT4G11990	TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity.
AT3G18280	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT2G39675	Trans-acting siRNA1c primary transcript (TAS1c). Gb: AY922999
AT3G17185	Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling.
AT5G49615	trans-acting siRNA (tasi-RNA)
AT2G38560	Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy.
AT3G10330	Cyclin-like family protein;(source:Araport11)
AT3G23230	encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5.
AT1G10840	Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1).
AT4G18270	Encodes protein similar to similar to bacterial translocase I (mra Y). Expressed during flower bud development.
AT5G43970	Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.
AT1G06950	Encodes a protein thought to be a part of the translocon at the chloroplast inner envelope. Involved in protein import into the chloroplast and chloroplast biogenesis. C-terminal half of Tic110 functions as scaffolds for protein-protein interactions.
AT4G23430	NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
AT5G16620	chloroplast protein import (Tic40)
AT5G05000	Outer membrane GTPase protein that may function in import of nuclear encoded proteins into the chloroplast. Phosphorylation of the G-domains regulate translocon assembly.
AT3G17970	Integral chloroplast outer membrane protein. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT5G09420	Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
AT1G36060	encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2.
AT3G24660	member of Receptor kinase-like protein family
AT3G13772	Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. Overexpression of this protein in yeast alters copper and zinc homeostasis.
AT5G48100	Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds.
AT3G59030	Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds.
AT5G35550	TT2 encodes a R2R3 MYB domain putative transcription factor that acts as a key determinant in the proanthocyanidin accumulation of developing seed. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium.
AT5G07990	Required for flavonoid 3' hydroxylase activity. Enzyme abundance relative to CHS determines Quercetin/Kaempferol metabolite ratio. The mRNA is cell-to-cell mobile.
AT4G09820	TT8 is a regulation factor that acts in a concerted action with TT1, PAP1 and TTG1 on the regulation of flavonoid pathways, namely proanthocyanidin and anthocyanin biosynthesis. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Also important for important for marginal trichome development. It binds the promoter of both AT3G26790 and AT1G28300.TT8 interacts with JAZ proteins to regulate anthocyanin accumulation. TT8 acts maternally to affect seed FA biosynthesis and inhibits seed FA accumulation by down-regulating a group of genes either critical to embryonic development or important in the FA biosynthesis pathway. TT8 represses the activities of LEAFY COTYLEDON1, LEAFY COTYLEDON2, and FUSCA3, the critical transcriptional factors important for seed development.
AT3G28430	Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown.
AT3G62980	Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis.
AT4G24040	Encodes a trehalase, member of Glycoside Hydrolase Family 37.
AT1G60140	Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain.
AT1G70290	Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants.
AT1G78090	homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases
AT4G22590	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT5G65140	Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11)
AT1G78580	Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain but no trehalose phosphatase (TPP)-like domain. ATTPS1 is able to complement yeast tps1 mutants in vivo. The gene product modulates cell growth but not cell differentiation by determining cell wall deposition and cell division. The N-terminal domain of TPS1 has a nuclear localization signal and an autoinhibitory function. The C-terminal domain is important for catalytic fidality of TPS1 and for appropriate signaling of the sucrose status by trehalose 6-phosphate levels in the plant (10.1105/tpc.19.00837).
AT3G46590	Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers.
AT5G03780	Encodes a protein whose sequence is similar to human telomere proteins. This belongs to TRFL family 2, which do not show DNA binding in vitro.
AT2G19450	Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA).
AT5G06700	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes.
AT3G06080	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT2G37720	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT1G60790	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT5G15890	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT2G40150	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT3G11030	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1.
AT1G78710	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT1G48880	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT3G11570	Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT1G19835	TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly.
AT1G27695	TGD5 encodes a small glycine rich protein that is localized to the chloroplast envelope and is a component of the ER to plastid lipid trafficking pathway. TGD5 interacts with other components of this pathway including TGD1, TGD2, TGD3, and TGD4.
AT1G45231	Encodes a trimethylguanosine synthase that is required for chilling tolerance. tgs1 mutant have a striking chilling sensitive phenotype in which leaf and flower development are dramatically disrupted after long-term chilling treatment.
AT2G21170	Encodes a plastidic triose phosphate isomerase. Mutants with reduced pdTPI levels have difficulty transitioning from heterotrophic to autotrophic growth. The related phenotypes, such as chlorosis in light-grown seedlings may result from an accumulation of dihydroxyacetone phosphate (DHAP) and methylglyoxal (MG) in these mutants. Both splice variants appear to be expressed, but the At2g21170.2 variant appears to have a much narrower expression range limited to roots.
AT4G20850	Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant.
AT5G53200	Encodes a R3MYB transcription inhibitor that regulates trichome patterning. Mutants produce trichome clusters whereas other transcriptional inhibitors involved in this patterning are involved in trichome density regulation. Natural hypofunctional alleles producing trichome development in fruits have been found.
AT1G05830	Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1.
AT1G68720	Encodes the chloroplastic A-to-I tRNA editing enzyme.
AT1G78190	Trm112p-like protein;(source:Araport11)
AT3G21300	RNA methyltransferase family protein;(source:Araport11)
AT4G04670	Met-10+ like family protein / kelch repeat-containing protein;(source:Araport11)
AT1G52160	Encodes a tRNase Z.
AT2G43510	Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory.
AT4G24670	Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions.
AT5G38530	TSBtype2 encodes a type 2 tryptophan synthase beta subunit that catalyzes a condensation reaction between serine and indole to generate tryptophan.It appears to form a homodimer. Its biological role has not yet been determined, but it has a very high affinity for indole which may be involved in allowing TSBtype2 to carefully limit free indole build-up. But, to date no overall change in plant morphology or seedling root growth have been observed in tsbtype2 mutants, indicating that this gene is not essential under optimum conditions. n most organs, TSBtype2 is transcripts are expressed at a lower level than TSB1 but in dry seeds they are expressed at comparable levels.
AT2G36960	Arabidopsis thaliana myb/SANT domain protein
AT1G76900	Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM.
AT1G25280	Member of TLP family
AT1G61940	Member of TLP family
AT1G53320	Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain.
AT3G06380	Member of plant TLP family which differs in having an F box domain. Interacts with ASK proteins.Plasma membrane tethering is mediated by PIP2 binding domain. Mutants are insensitive to ABA. May act redundantly with its paralog TPL3.
AT1G04820	Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers.
AT5G07350	RNA binding protein with nuclease activity essential for stress response. Involved in mechanisms acting on mRNAs entering the secretory pathway. Functionally redundant with TSN2.
AT1G78240	Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development.
AT1G14610	Required for proper proliferation of basal cells.
AT3G02140	Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation.
AT4G03560	Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress.
AT3G62260	Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress.
AT2G29400	Type 1 protein phosphatase, expressed in roots, rosettes and flowers
AT3G05580	Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with TOPP8 (AT5G27840).
AT1G08030	Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine).
AT3G49810	Encodes a protein with E3 ubiquitin ligase activity that is involved in negative regulation of salt stress tolerance during germination.
AT3G57645	U2-2;(source:Araport11)
AT5G09585	U2;(source:Araport11)
AT3G14735	U6;(source:Araport11)
AT3G06910	Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. In vitro assays suggest that this enzyme is active against SUMO1 and SUMO2. It has weak activity with SUMO3 and cannot act on SUMO5. The N-terminal regulatory region of this protein is required for full activity. Suppresses growth during salt stress.
AT5G06460	Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. The mRNA is cell-to-cell mobile.
AT3G17205	ubiquitin protein ligase 6;(source:Araport11)
AT5G53300	Encodes a ubiquitin conjugating enzyme.
AT1G50490	Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells.
AT3G15355	ubiquitin-conjugating enzyme 25;(source:Araport11)
AT1G53020	Cognate nuclear E2 enzyme that interacts with the RFA4 E3 ligase and forms UBC26-RFA4-Receptor complexes in nuclear speckles.
AT5G50430	ubiquitin-conjugating enzyme 33;(source:Araport11)
AT1G63800	ubiquitin-conjugating enzyme 5;(source:Araport11)
AT3G45180	Ubiquitin like protein that appears to play a role in pre-mRNA splicing.
AT2G32780	ubiquitin-specific protease 1;(source:Araport11)
AT1G32850	ubiquitin-specific protease 11;(source:Araport11)
AT1G17110	Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. Together with CUC2/CUC3-DA1 part of a regulatory module controls the initiation of axillary meristems, thereby determining plant architecture. As a direct substrate of DA1 peptidase, it represses the initiation of axillary meristems.
AT4G24560	Encodes a ubiquitin-specific protease. There is no evidence for a phenotype in ubp16-1 mutants, however, double mutant analysis with ubp15 mutants reveals a role for UBP16 in plant development and cell proliferation.
AT5G46740	Encodes a ubiquitin-specific protease.
AT2G22310	Encodes a ubiquitin-specific protease.
AT2G44790	Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods.
AT3G60280	Encodes blue copper-binding protein III.
AT5G03490	Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms.
AT1G63180	Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development.
AT4G30440	Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria.
AT3G11340	Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid.
AT4G23010	UDP-galactose transporter 2;(source:Araport11)
AT1G14360	UDP-galactose transporter 3;(source:Araport11)
AT4G31600	Encodes a Golgi-localized UDP?glucose/UDP?galactose transporter that affects lateral root emergence.
AT3G29360	Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides.
AT3G03250	Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding.
AT5G17310	UDP-glucose pyrophosphorylase 2;(source:Araport11)
AT4G15280	UDP-glucosyl transferase 71B5;(source:Araport11)
AT2G29750	UDP-glucosyl transferase 71C1;(source:Araport11)
AT2G29730	UDP-glucosyl transferase 71D1;(source:Araport11)
AT1G01420	Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member.
AT3G50740	UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism.
AT2G15480	UDP-glucosyl transferase 73B5;(source:Araport11)
AT2G26480	UDP-glucosyl transferase 76D1;(source:Araport11)
AT5G59590	UDP-glucosyl transferase 76E2;(source:Araport11)
AT5G17050	The At5g17050 encodes a anthocyanidin 3-O-glucosyltransferase which specifically glucosylates the 3-position of the flavonoid C-ring. Anthocyanidins such as cyanidin and pelargonidin as well as flavonols such as kaempferol and quercetin are accepted substrates.
AT3G21560	Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi.
AT1G22360	UDP-glucosyl transferase 85A2;(source:Araport11)
AT2G43820	Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques.
AT1G05560	A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques.
AT2G43840	UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside), benzoic acid, quercetin, and athranilate in vitro. UGT74F1 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. The true biological substrate(s) of UGT74F1 are not known, but mutant plants lacking UGT74F1 have a decreased level of salicylate glucoside.
AT3G55700	UDP-Glycosyltransferase superfamily protein;(source:Araport11)
AT5G42420	Nucleotide-sugar transporter family protein;(source:Araport11)
AT3G46440	Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.
AT2G28760	Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase.
AT2G47650	Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes.
AT4G02500	Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile.
AT4G37180	UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen.
AT5G41150	Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins
AT3G28030	Required for repair of pyrimidine-pyrimidinone (6-4) dimers. The mRNA is cell-to-cell mobile.
AT2G22500	Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470).
AT1G33430	UPEX1 is arabinogalactan b-(1,3)-galactosyltransferase involved in the formation of pollen exine. Belongs to GT31 family. Mutants have reduced levels of AGPs. GALT8 has some but not complete functional overlap with KNS4/UPEX1.
AT3G20830	AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11)
AT1G49320	Encodes USPL1, a BURP domain protein targeted to the protein storage vacuoles. Overexpression of USPL1 affects seed development, protein storage vacuoles and lipid vesicles morphology and function.
AT2G20100	Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation.
AT5G43580	Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860.
AT2G47270	Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression.
AT2G26230	Encodes a urate oxidase that is involved in peroxisome maintenance.
AT2G35035	Encodes a urease accessory protein which is essential for the activation of plant urease.
AT2G03590	Encodes a member of a class of allantoin transporters.
AT2G03600	Encodes UPS3 (ureide permease 3), similar to UPS1, an allantoin transporter.
AT1G26440	Encodes a ureide permease, uptake assays in yeast mutants indicated the longer splice variant is a cellular importer for allantoin, uracil and xanthine. Encodes 2 splice variants, UPS5L and UPS5S, which under nonstress conditions may function in allantoin degradation for nutrient recycling, whereas under stress, both genes may be involved in vesicular export allowing allantoin translocation from roots to shoots.
AT2G36310	Encodes a cytoplasmic nucleoside hydrolase. It has the highest levels of activity with uridine followed by xanthosine. It shows little activity with inosine and none with cytidine. Mutant analyses indicate that it plays a role in purine and pyrimidine catabolism.
AT3G56620	nodulin MtN21-like transporter family protein
AT2G37450	nodulin MtN21-like transporter family protein
AT1G25270	nodulin MtN21-like transporter family protein
AT1G60050	nodulin MtN21-like transporter family protein
AT5G40230	nodulin MtN21-like transporter family protein
AT5G40212	Pseudogene of AT5G40240; nodulin MtN21 family protein
AT5G40210	nodulin MtN21-like transporter family protein
AT3G28100	nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile.
AT3G28070	nodulin MtN21-like transporter family protein
AT3G15620	Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana.
AT5G63860	UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2.
AT1G78900	Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. The mRNA is cell-to-cell mobile.
AT1G75630	vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile.
AT1G62660	Glycosyl hydrolases family 32 protein;(source:Araport11)
AT1G76800	The gene encodes nodulin-like2 whose transcript abundance was repressed under conditions of Fe-deficient growth.
AT3G01390	Subunit G of the vacuolar membrane ATPAse complex
AT5G53530	Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport.
AT3G61770	Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11)
AT1G08190	Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile.
AT2G28520	Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network. The mRNA is cell-to-cell mobile.
AT2G21410	Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation.
AT4G39080	Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile.
AT2G32760	Homolog of yeast VPS38P. Interacts with PI3K.Mutants have defects in late endosome morphology and retromer function.
AT2G34940	VACUOLAR SORTING RECEPTOR 5;(source:Araport11)
AT1G30900	VACUOLAR SORTING RECEPTOR 6;(source:Araport11)
AT4G20110	VACUOLAR SORTING RECEPTOR 7;(source:Araport11)
AT2G38020	necessary for proper vacuole formation and morphogenesis in Arabidopsis
AT2G17740	VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development.
AT5G16290	Encodes a regulatory subunit of acetohydroxy acid synthase (AHAS), the ﬁrst committed enzyme in the branched chain amino acid biosynthesis pathway.
AT3G60600	Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2.
AT5G46510	Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11)
AT1G71930	Encodes a NAC-domain transcription factor with transcriptional activation activity that is involved in xylem formation. Induces transdifferentiation of various cells into protoxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids.
AT5G54790	CTD small phosphatase-like protein;(source:Araport11)
AT5G24780	encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid.
AT4G29260	VSP3 is a secreted acid phosphatase.
AT5G40270	VEN4 is homologous to human SAMHD1 and functions in chloroplast biogenesis.
AT3G24440	Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM.
AT4G29830	VIP3 protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin. Also known as SKI8, a component of the SKI complex involved in exosome mediated RNA degredation. Member of PAF-C complex.
AT5G61150	Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. Member of PAF-C complex.
AT4G30200	Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus.
AT1G77580	filament-like protein (DUF869);(source:Araport11)
AT4G32150	AtVAMP711 is a member of Synaptobrevin-like AtVAMP7C, v-SNARE (soluble N-ethyl-maleimide sensitive factor attachment protein receptors) protein family. SNAREs have been divided into four subgroups: Qa-, Qb-, Qc- and R-SNAREs. R-SNAREs are classified into three groups, the Sec22-, YKT6- and VAMP7-like R-SNAREs. One R-SNARE and three Q-SNAREs (one of each subgroup) form the trans-SNARE complex, which governs specific membrane fusions. VAMP7 proteins consist of three distinct domain, the N-terminal longin-domain (LD), the SNARE motif (SNM) and a transmembrane domain. In spite of the high similarities among the VAMP7 proteins, they show different subcellular localizations. VAMP7C is vacuolar-localized and its LD is essential for the correct localization. Generally, it is suggested that the complete LD is the determinant of subcellular sorting in both animal and plant R-SNAREs.
AT2G33110	member of VAMP72 Gene Family
AT2G32670	member of Synaptobrevin -like protein family
AT3G54300	Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal.
AT1G14000	Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. The mRNA is cell-to-cell mobile.
AT3G50080	Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes.
AT5G55120	Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2.
AT3G01280	Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile.
AT1G75850	VPS35 homolog B;(source:Araport11)
AT3G51310	Homolog of yeast retromer subunit VPS35. Part of a retromer-like protein complex involved in endosome to lysosome protein transport.
AT4G37710	VQ motif-containing protein;(source:Araport11)
AT1G78310	VQ motif-containing protein;(source:Araport11)
AT2G44340	VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development.
AT3G60090	VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development.
AT1G53700	The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons.
AT1G79680	Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP.
AT1G16120	Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats.
AT1G16130	Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats.
AT1G16150	Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile.
AT1G16160	WAK-like kinase The mRNA is cell-to-cell mobile.
AT1G16110	Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall.
AT1G21270	cytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase.
AT1G75500	An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family.
AT5G65683	Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11)
AT3G23090	Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark,
AT5G06690	Encodes a thioredoxin (WCRKC1) localized in chloroplast stroma. Contains a WCRKC motif. Functions in redox cascade with 2CPA and 2CPB via the ferredoxin-thioredoxin reductase (FTR)/thioredoxin (Trx) pathway to mediate the light-responsive reductive control of target proteins. Oxidizes redox-regulated proteins.
AT3G07760	Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. However in Arabidopsis no morphological branching defect has been observed in mutant lines.
AT1G56510	TIR-NB-LRR protein that confers resistance to four races of Albugo candida. The mRNA is cell-to-cell mobile.
AT5G53080	WTG1 is a chloroplast localized TPR protein required for chloroplast biogenesis. Mutants are delayed in greening and defective in splicing petL and ndhG. WTG1 does not itself bind RNA but it does bind known editing factors MORF8 and MORF9.
AT2G41420	proline-rich family protein;(source:Araport11)
AT3G49845	cysteine-rich TM module stress tolerance protein;(source:Araport11)
AT1G11060	Encodes one of two redundant proteins (the other is WAPL2) that are involved in prophase removal of cohesion during meiosis. Double mutants with wapl2 exhibit reduced fertility due to defects in meiosis and also some abnormal embryo development in rare cases where embryos are formed.
AT1G08290	WIP domain protein 3;(source:Araport11)
AT3G20880	WIP4 is a paralog of NTT and along with WIP5,acts redundantly in cell fate determination during primary root development. MP binds to AuxRE motifs within the WIP4 gene and likely regulates its expression.
AT2G34150	Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments.
AT3G22420	Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.
AT3G48260	Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases.
AT5G58350	Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms.
AT3G55770	Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization.
AT2G01830	Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane
AT5G50200	Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction.
AT4G26455	Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells.
AT5G11390	Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells.
AT4G31550	member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae.
AT1G30650	member of WRKY Transcription Factor; Group II-e
AT2G23320	Encodes WRKY DNA-binding protein 15 (WRKY15).
AT2G24570	member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae.
AT2G47260	Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin.
AT5G07100	Encodes WRKY DNA-binding protein 26 (WRKY26).
AT5G52830	Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum.
AT2G03340	Encodes WRKY DNA-binding protein 3 (WRKY3).
AT5G24110	member of WRKY Transcription Factor; Group III
AT4G22070	member of WRKY Transcription Factor; Group II-b
AT2G38470	Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance.
AT2G34830	member of WRKY Transcription Factor; Group II-e
AT1G69810	member of WRKY Transcription Factor; Group II-b
AT1G13960	Encodes WRKY DNA-binding protein 4 (WRKY4).
AT1G80840	Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile.
AT5G49520	Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile.
AT5G43290	member of WRKY Transcription Factor; Group II-c
AT5G26170	member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses.
AT5G64810	member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses.
AT2G40750	member of WRKY Transcription Factor; Group III. Together with WRKY70 positively regulates SARD1 and CBP60g expression in plant immunity.
AT2G40740	member of WRKY Transcription Factor; Group III
AT3G01080	member of WRKY Transcription Factor; Group I
AT4G24240	Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family.
AT1G29860	member of WRKY Transcription Factor; Group II-c
AT5G15130	member of WRKY Transcription Factor; Group II-b; contribute to basal immunity. The mRNA is cell-to-cell mobile.
AT5G13080	WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation.
AT5G46350	member of WRKY Transcription Factor; Group II-c
AT1G68150	member of WRKY Transcription Factor; Group II-b The mRNA is cell-to-cell mobile.
AT3G49210	WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis.
AT5G12420	WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis.
AT3G18010	Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages.
AT1G20710	Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
AT4G35550	Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
AT1G20700	Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation.
AT1G46480	Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation.
AT5G05770	Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box.
AT5G48720	Encodes XRI1 (X-ray induced 1). Required for post-meiotic stages of pollen development and male and female meiosis. Maybe required for meiotic DNA repair. Inducible by X-ray. Homozygous xri1 mutants are sterile due to extensive chromosome fragmentation.
AT4G34890	Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance.
AT2G28840	Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3.
AT4G14365	hypothetical protein;(source:Araport11)
AT1G15470	WD40 nucleoplasmic shuttling protein that positively regulates the Abscisic acid (ABA) response by interacting with and maintaining the stability of ABI5 in the nucleus. Nuclear export of XIW1 is XPO1-dependent. Involved in regulating seed germination, primary root growth, and drought stress resistance.
AT5G64530	xylem NAC domain 1;(source:Araport11)
AT5G33290	Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis.
AT2G13820	Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11)
AT4G30280	Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs.
AT4G13090	xyloglucan endotransglucosylase/hydrolase 2;(source:Araport11)
AT5G48070	putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems.
AT4G18990	xyloglucan endotransglucosylase/hydrolase 29;(source:Araport11)
AT1G32170	xyloglucan endotransglycosylase-related protein (XTR4) The mRNA is cell-to-cell mobile.
AT3G44990	Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1).Enzyme kinetic analysis indicates predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207).
AT1G10550	Encodes a membrane-localized protein that is predicted to function during cell wall modification.Overexpression of XTH33 results in abnormal cell morphology. It's expression is under epigenetic control by ATX1.
AT2G35610	Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells.
AT2G26580	plant-specific transcription factor YABBY family protein;(source:Araport11)
AT3G54380	SAC3/GANP/Nin1/mts3/eIF-3 p25 family;(source:Araport11)
AT3G22690	YS1 is a PPR protein involved in RNA editing of plastid encoded genes. Natural variation in this locus is associated with increased photosynthetic acclimation.
AT5G24380	closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1
AT5G53550	YELLOW STRIPE like 3;(source:Araport11)
AT5G51640	Encodes leaf-senescence-related protein. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).
AT1G63700	Member of MEKK subfamily, a component of the stomatal development regulatory pathway. Mutations in this locus result in embryo lethality.
AT4G32540	Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis
AT1G04610	Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root.
AT4G28720	Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype.
AT4G13260	Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway.
AT5G43890	Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype
AT5G57360	Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1.
AT1G64760	ZERZAUST is an atypical β-1,3 glucanase. The protein is localized to punctate regions of the apoplast, near cellular junctions. Mutants in Ler background display aberrant floral morphology and twisted siliques and stems. Biochemcial analysis of mutant cell wall composition indicates cell wall defects. However, in Col background, there is no phenotype due to compensatory effect of ZETH gene expression.
AT2G19440	Homolog of ZET, an atypical β-1,3 glucanase. Differentially expressed in Ler (very low) vs Col (very high) backgrounds.
AT5G59440	Encodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition.
AT1G69600	Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid.
AT2G32930	Encodes a zinc finger protein.
AT2G37430	Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile.
AT5G04340	Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance.
AT3G02830	Encodes a zinc finger protein that binds to PORA mRNA in vivo and recruits the Pfr form of phytochrome to the 5′-UTR of PORA mRNA to regulate translation of the mRNA.
AT1G10480	Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling.
AT2G41940	Encodes a zinc finger protein containing only a single zinc finger.
AT5G13740	Encodes ZIF1 (ZINC-INDUCED FACILITATOR1), a member of the Major Facilitator Superfamily (MFS) of membrane proteins which are found in all organisms and transport a wide range of small, organic molecules. Involved in a mechanism of Zn sequestration, possibly by transport of a Zn ligand or Zn-ligand complex into vacuoles. The mRNA is cell-to-cell mobile.
AT1G55910	member of Putative zinc transporter ZIP2 - like family
AT1G05300	member of Fe(II) transporter isolog family
AT2G04032	zinc transporter 7 precursor;(source:Araport11)
AT5G45105	zinc transporter 8 precursor;(source:Araport11)
AT1G49590	Encodes a novel nucleic acid-binding protein that is required for both RdDM (RNA-directed DNA methylation) and pre-mRNA splicing.
AT5G67450	Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor.
AT1G80730	Encodes a zinc finger protein and is expressed at high levels in the shoot apex, including the apical meristem, developing leaves and the developing vascular system. expression induced three days post germination. T-DNA insertion mutant has a dominant phenotype in leaf initiation.
AT3G19580	Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor.
AT5G59520	encodes a metal ion transporter whose expression is regulated by copper.
AT5G65930	encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches.