37 senescence-associated transcription factors (Sen-TFs) ChIP-seq or DAP-seq data
| ANAC092 Targets | Description |
| AT1G55430 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G51920 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT2G28580 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G02180 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT2G15640 | F-box family protein;(source:Araport11) |
| AT2G43460 | Ribosomal L38e protein family;(source:Araport11) |
| AT4G09090 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
| AT1G58040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-28 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G28412 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 4.3e-08 P-value blast match to GB:AAC34906 reverse transcriptase (LINE-element) (Forficula auricularia);(source:TAIR10) |
| AT2G22650 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
| AT1G20520 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
| AT5G09430 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
| AT2G35380 | Peroxidase superfamily protein;(source:Araport11) |
| AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
| AT1G80540 | envelope glycoprotein B;(source:Araport11) |
| AT3G30280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G63710 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G04390 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT3G46170 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G17260 | Lactate/malate dehydrogenase family protein;(source:Araport11) |
| AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT3G22340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.2e-60 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT5G24879 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT1G29475 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-91 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT2G34020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G21260 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
| AT1G75050 | Pathogenesis-related thaumatin superfamily protein;(source:Araport11) |
| AT4G21890 | zinc finger MYND domain protein;(source:Araport11) |
| AT3G46385 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G17590 | Putative membrane lipoprotein;(source:Araport11) |
| AT2G29300 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G17713 | Encodes a defensin-like (DEFL) family protein. |
| AT5G57080 | transmembrane protein;(source:Araport11) |
| AT1G78990 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G20970 | lipid-binding protein;(source:Araport11) |
| AT1G18960 | myb-like HTH transcriptional regulator family protein;(source:Araport11) |
| AT3G28790 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT4G31020 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT4G36610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G58830 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G32930 | hypothetical protein;(source:Araport11) |
| AT3G24580 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G28996 | pseudogene of phosphoenolpyruvate carboxykinase 1;(source:Araport11) |
| AT3G44605 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-38 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT2G31560 | signal transducer/transcription protein, putative (DUF1685);(source:Araport11) |
| AT3G11500 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
| AT4G34555 | Ribosomal protein S25 family protein;(source:Araport11) |
| AT3G20850 | proline-rich family protein;(source:Araport11) |
| AT1G10385 | Vps51/Vps67 family (components of vesicular transport) protein;(source:Araport11) |
| AT4G05540 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G62730 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G16950 | transmembrane protein;(source:Araport11) |
| AT3G53490 | valine-tRNA ligase;(source:Araport11) |
| AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G54800 | Pleckstrin homology (PH) and lipid-binding START domains-containing protein;(source:Araport11) |
| AT2G31050 | Cupredoxin superfamily protein;(source:Araport11) |
| AT1G09640 | Translation elongation factor EF1B, gamma chain;(source:Araport11) |
| AT5G27140 | NOP56-like pre RNA processing ribonucleoprotein;(source:Araport11) |
| AT5G52690 | Copper transport protein family;(source:Araport11) |
| AT5G13181 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT3G11405 | hypothetical protein;(source:Araport11) |
| AT5G46530 | AWPM-19-like family protein;(source:Araport11) |
| AT4G15450 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
| AT1G28700 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT5G37710 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT3G09550 | Ankyrin repeat family protein;(source:Araport11) |
| AT3G16850 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G37750 | hypothetical protein;(source:Araport11) |
| AT3G44810 | F-box family protein;(source:Araport11) |
| AT5G11070 | hypothetical protein;(source:Araport11) |
| AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G70820 | phosphoglucomutase, putative / glucose phosphomutase;(source:Araport11) |
| AT1G19160 | F-box family protein;(source:Araport11) |
| AT1G76892 | Natural antisense transcript overlaps with AT1G76890;(source:Araport11) |
| AT1G27710 | Glycine-rich protein family;(source:Araport11) |
| AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G43180 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
| AT1G61600 | DUF1262 family protein (DUF1262);(source:Araport11) |
| AT3G26782 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G34360 | MATE efflux family protein;(source:Araport11) |
| AT1G80150 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G47530 | Auxin-responsive family protein;(source:Araport11) |
| AT1G08040 | trimethylguanosine synthase (DUF707);(source:Araport11) |
| AT5G37650 | hypothetical protein (DUF577);(source:Araport11) |
| AT2G01554 | hypothetical protein;(source:Araport11) |
| AT3G06780 | glycine-rich protein;(source:Araport11) |
| AT5G46105 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT3G11773 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G47030 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT5G05320 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT1G20990 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G21528 | hypothetical protein;(source:Araport11) |
| AT4G30240 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT2G20670 | sugar phosphate exchanger, putative (DUF506);(source:Araport11) |
| AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT2G23680 | Cold acclimation protein WCOR413 family;(source:Araport11) |
| AT1G78450 | SOUL heme-binding family protein;(source:Araport11) |
| AT1G13755 | Encodes a defensin-like (DEFL) family protein. |
| AT5G04980 | DNAse I-like superfamily protein;(source:Araport11) |
| AT2G40925 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G20790 | F-box family protein;(source:Araport11) |
| AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G17580 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT3G24490 | Alcohol dehydrogenase transcription factor Myb/SANT-like family protein;(source:Araport11) |
| AT1G80530 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G49250 | ATP-dependent DNA ligase;(source:Araport11) |
| AT3G42800 | AF-like protein;(source:Araport11) |
| AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
| AT1G66820 | glycine-rich protein;(source:Araport11) |
| AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G17845 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT2G38646 | hypothetical protein;(source:Araport11) |
| AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
| AT4G16720 | Ribosomal protein L23/L15e family protein;(source:Araport11) |
| AT4G16050 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
| AT1G26140 | hypothetical protein;(source:Araport11) |
| AT4G04972 | hypothetical protein;(source:Araport11) |
| AT5G59770 | Protein-tyrosine phosphatase-like, PTPLA;(source:Araport11) |
| AT1G04350 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
| AT1G21350 | Thioredoxin superfamily protein;(source:Araport11) |
| AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT1G78820 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
| AT5G37550 | hypothetical protein;(source:Araport11) |
| AT2G44930 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT5G31821 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G45545 | WEAK CHLOROPLAST MOVEMENT UNDER BLUE LIGHT-like protein (DUF827);(source:Araport11) |
| AT5G37210 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT5G45850 | hypothetical protein (DUF688);(source:Araport11) |
| AT2G42990 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G14225 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT1G27860 | hypothetical protein (DUF626);(source:Araport11) |
| AT1G23830 | transmembrane protein;(source:Araport11) |
| AT5G19870 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT1G56400 | F-box family protein;(source:Araport11) |
| AT1G29140 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
| AT5G18910 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G18630 | hypothetical protein (DUF688);(source:Araport11) |
| AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT3G03405 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT3G42430 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G37045.1);(source:TAIR10) |
| AT1G59453 | B-block-binding subunit of TFIIIC protein;(source:Araport11) |
| AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT2G29370 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT4G12690 | DUF868 family protein (DUF868);(source:Araport11) |
| AT1G09176 | transmembrane protein;(source:Araport11) |
| AT2G42860 | hypothetical protein;(source:Araport11) |
| AT3G05545 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G01320 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
| AT4G09455 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
| AT5G35960 | Protein kinase family protein;(source:Araport11) |
| AT4G24480 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G12855 | F-box family protein;(source:Araport11) |
| AT3G50180 | transmembrane protein, putative (DUF247);(source:Araport11) |
| AT3G51870 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT1G49470 | transmembrane epididymal protein (DUF716);(source:Araport11) |
| AT5G14990 | WPP domain associated protein;(source:Araport11) |
| AT1G08790 | 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilon-1, putative (DUF1685);(source:Araport11) |
| AT2G18860 | Syntaxin/t-SNARE family protein;(source:Araport11) |
| AT1G32385 | snoRNA;(source:Araport11) |
| AT3G56880 | VQ motif-containing protein;(source:Araport11) |
| AT2G02400 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G64020 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G80060 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G51500 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
| AT1G18191 | Pseudogene of AT1G18200; AtRABA6b (Arabidopsis Rab GTPase homolog A6b); GTP binding |
| AT1G33290 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G39530 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G43590 | Acyl transferase/acyl hydrolase/lysophospholipase superfamily protein;(source:Araport11) |
| AT1G30080 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G21791 | Pseudogene of AT3G21790; UDP-glucoronosyl/UDP-glucosyl transferase family protein |
| AT1G28260 | Telomerase activating protein Est1;(source:Araport11) |
| AT2G39490 | F-box family protein;(source:Araport11) |
| AT1G25300 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT1G02540 | hypothetical protein;(source:Araport11) |
| AT5G43520 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G37705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G63690 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
| AT2G34270 | hypothetical protein;(source:Araport11) |
| AT1G34490 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT2G14690 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT1G69030 | BSD domain-containing protein;(source:Araport11) |
| AT3G30841 | Cofactor-independent phosphoglycerate mutase;(source:Araport11) |
| AT1G33530 | F-box family protein;(source:Araport11) |
| AT1G66940 | kinase-like protein;(source:Araport11) |
| AT5G66220 | Chalcone-flavanone isomerase family protein;(source:Araport11) |
| AT3G10030 | aspartate/glutamate/uridylate kinase family protein;(source:Araport11) |
| AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
| AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT1G09680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT1G34100 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT2G44780 | Encodes a Uclacyanin/Basic blue family protein [pseudogene] |
| AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G14890 | potassium transporter;(source:Araport11) |
| AT2G40990 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT3G50295 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G17170 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G16190 | Papain family cysteine protease;(source:Araport11) |
| AT1G64270 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.0e-06 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
| AT4G36790 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G22160 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT4G23030 | MATE efflux family protein;(source:Araport11) |
| AT2G05330 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G52480 | RNI-like superfamily protein;(source:Araport11) |
| AT3G42090 | transposable_element_gene;(source:Araport11);contains domain LIN-9 RELATED (PTHR21689);(source:TAIR10) |
| AT3G55890 | Yippee family putative zinc-binding protein;(source:Araport11) |
| AT3G51130 | transmembrane protein;(source:Araport11) |
| AT4G10070 | KH domain-containing protein;(source:Araport11) |
| AT4G19450 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G02670 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G18407 | Encodes a defensin-like (DEFL) family protein. |
| AT5G50290 | wall-associated receptor kinase galacturonan-binding protein;(source:Araport11) |
| AT2G30560 | Needs to be reannotated and split into two genes, AtEAL2 and AtEAL3, both encoding maize Ebb apparatus 1-like proteins. The current predicted structure is not well supported (T8, one *). The predicted proteins can be found in doi.org/10.1007/s00425-005-0174-z |
| AT3G25550 | F-box family protein;(source:Araport11) |
| AT5G58820 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
| AT5G60090 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G50050 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT5G64230 | 1,8-cineole synthase;(source:Araport11) |
| AT5G25400 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G67856 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
| AT1G63530 | hypothetical protein;(source:Araport11) |
| AT3G58877 | hypothetical protein;(source:Araport11) |
| AT3G01085 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G61440 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT2G22890 | Kua-ubiquitin conjugating enzyme hybrid localization domain-containing protein;(source:Araport11) |
| AT3G32925 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G12540 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
| AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT4G00236 | pseudogene of Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT2G14550 | pseudogene of RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
| AT5G42490 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT2G16310 | pseudogene of endoplasmatic reticulum retrieval protein 1B;(source:Araport11) |
| AT4G09540 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-43 P-value blast match to GB:AAC64917 gag-pol polyprotein (Ty1_Copia-element) (Glycine max);(source:TAIR10) |
| AT2G19220 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
| AT4G25070 | caldesmon-like protein;(source:Araport11) |
| AT5G39470 | F-box family protein;(source:Araport11) |
| AT5G20700 | senescence-associated family protein, putative (DUF581);(source:Araport11) |
| AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G56080 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
| AT2G42370 | hypothetical protein;(source:Araport11) |
| AT2G13116 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G30310 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
| AT4G33860 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT3G18120 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G48130 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G33710 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT4G18340 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
| AT5G53680 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G32350 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT4G18930 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
| AT1G20360 | F-box family protein;(source:Araport11) |
| AT3G21210 | zinc ion binding protein;(source:Araport11) |
| AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G61500 | BPS1-like protein;(source:Araport11) |
| AT4G09450 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
| AT2G34290 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G02460 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT4G35820 | 2-oxoglutarate-dependent dioxygenase |
| AT1G23510 | OBP32pep protein;(source:Araport11) |
| AT3G14710 | RNI-like superfamily protein;(source:Araport11) |
| AT1G23520 | hypothetical protein (DUF220);(source:Araport11) |
| AT1G63170 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
| AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G60240 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT3G61290 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT1G16560 | Per1-like family protein;(source:Araport11) |
| AT1G34520 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G59675 | F-box family protein;(source:Araport11) |
| AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G16410 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G03510 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT4G24170 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT3G48450 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT5G54145 | hypothetical protein;(source:Araport11) |
| AT4G38540 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
| AT2G46940 | fold protein;(source:Araport11) |
| AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G33300 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT4G12370 | F-box/kelch-repeat protein;(source:Araport11) |
| AT5G45085 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 1.2e-148 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
| AT1G67855 | hypothetical protein;(source:Araport11) |
| AT3G27965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.5e-26 P-value blast match to GB:AAB82754 retrofit (TY1_Copia-element) (Oryza longistaminata);(source:TAIR10) |
| AT1G61060 | F-box family protein;(source:Araport11) |
| AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
| AT2G15760 | calmodulin-binding protein (DUF1645);(source:Araport11) |
| AT5G59190 | subtilase family protein;(source:Araport11) |
| AT3G28420 | Putative membrane lipoprotein;(source:Araport11) |
| AT4G31470 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
| AT1G67000 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G11040 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT4G04170 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.3e-87 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G44345 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT1G65875 | pseudogene of AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT4G05495 | pseudogene of temperature sensing protein-like protein;(source:Araport11) |
| AT3G60060 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
| AT1G55240 | proteinase inhibitor I4, serpin (DUF716);(source:Araport11) |
| AT5G02090 | hypothetical protein;(source:Araport11) |
| AT4G35850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G44255 | Natural antisense transcript overlaps with AT2G44260;(source:Araport11) |
| AT1G11410 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G02870 | B3 domain protein;(source:Araport11) |
| AT3G59240 | RNI-like superfamily protein;(source:Araport11) |
| AT4G05240 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G37450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G11700 | hypothetical protein (DUF626);(source:Araport11) |
| AT5G27230 | Frigida-like protein;(source:Araport11) |
| AT5G44760 | C2 domain-containing protein;(source:Araport11) |
| AT3G58020 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
| AT5G09770 | Ribosomal protein L17 family protein;(source:Araport11) |
| AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
| AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G34930 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT2G31990 | Exostosin family protein;(source:Araport11) |
| AT1G45063 | copper ion binding / electron carrier protein;(source:Araport11) |
| AT1G36880 | pseudogene of FAR1-related sequence 5;(source:Araport11) |
| AT5G35640 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
| AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
| AT2G27270 | transmembrane protein;(source:Araport11) |
| AT5G33441 | pseudogene of cytochrome P450;(source:Araport11) |
| AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
| AT4G14530 | agamous-like MADS-box protein;(source:Araport11) |
| AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G27052 | unknown pseudogene |
| AT2G34030 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G37320 | hypothetical protein (DUF674);(source:Araport11) |
| AT2G01580 | transmembrane protein;(source:Araport11) |
| AT5G22310 | trichohyalin-like protein;(source:Araport11) |
| AT3G53550 | FBD-like domain family protein;(source:Araport11) |
| AT2G19890 | hypothetical protein;(source:Araport11) |
| AT1G31300 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
| AT4G06565 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT1G06340 | Plant Tudor-like protein;(source:Araport11) |
| AT3G44980 | hypothetical protein;(source:Araport11) |
| AT1G61575 | Serine/Threonine kinase;(source:Araport11) |
| AT3G46050 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G44400 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT5G49920 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
| AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
| AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G14602 | methyltransferase-like protein;(source:Araport11) |
| AT1G07850 | transferring glycosyl group transferase (DUF604);(source:Araport11) |
| AT4G28780 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT4G20190 | hypothetical protein;(source:Araport11) |
| AT3G59260 | pirin;(source:Araport11) |
| AT3G57850 | transmembrane protein;(source:Araport11) |
| AT2G36325 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G21050 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-18 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT2G25605 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT5G54585 | hypothetical protein;(source:Araport11) |
| AT2G16520 | RING/U-box protein with C6HC-type zinc finger protein;(source:Araport11) |
| AT1G73490 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT4G32080 | hypothetical protein;(source:Araport11) |
| AT5G04680 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G09560 | RNA-binding KH domain-containing protein;(source:Araport11) |
| AT4G30662 | hypothetical protein;(source:Araport11) |
| AT4G19580 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT1G29090 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G07850 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G34280 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT4G08596 | transposable_element_gene;(source:Araport11);pseudogene, FAR1 -related protein, temporary automated functional assignment;(source:TAIR10) |
| AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
| AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
| AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
| AT5G16920 | Fasciclin-like arabinogalactan family protein;(source:Araport11) |
| AT3G15770 | hypothetical protein;(source:Araport11) |
| AT2G16230 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G38386 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
| AT2G31410 | coiled-coil protein;(source:Araport11) |
| AT4G09965 | hypothetical protein;(source:Araport11) |
| AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G33855 | transmembrane protein;(source:Araport11) |
| AT5G63520 | F-box/LRR protein;(source:Araport11) |
| AT3G04200 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G21950 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G28295 | hypothetical protein;(source:Araport11) |
| AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
| AT3G58210 | TRAF-like family protein;(source:Araport11) |
| AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G64290 | F-box protein-like protein;(source:Araport11) |
| AT2G32050 | cell cycle control-like protein (DUF572);(source:Araport11) |
| AT5G38250 | Protein kinase family protein;(source:Araport11) |
| AT3G02670 | Glycine-rich protein family;(source:Araport11) |
| AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G48060 | F-box/associated interaction domain protein;(source:Araport11) |
| AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT3G29153 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.3e-238 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT2G18540 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G10507 | other_RNA;(source:Araport11) |
| AT5G28637 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.1e-23 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
| AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G23420 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
| AT5G45275 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT3G22723 | hypothetical protein;(source:Araport11) |
| AT4G35030 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G57580 | F-box family protein;(source:Araport11) |
| AT4G00467 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT5G24790 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT1G28720 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
| AT4G21437 | unknown pseudogene |
| AT3G60270 | Cupredoxin superfamily protein;(source:Araport11) |
| AT5G07640 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G18090 | hypothetical protein;(source:Araport11) |
| AT4G29700 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT5G55420 | Encodes a Protease inhibitor/seed storage/LTP family protein [pseudogene] |
| AT1G19200 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT1G49110 | hypothetical protein;(source:Araport11) |
| AT1G28685 | Natural antisense transcript overlaps with AT1G28680;(source:Araport11) |
| AT2G06908 | hypothetical protein;(source:Araport11) |
| AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
| AT5G57700 | BNR/Asp-box repeat family protein;(source:Araport11) |
| AT5G18450 | encodes a member of the DREB subfamily A-2 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are eight members in this subfamily including DREB2A AND DREB2B that are involved in response to drought. |
| AT3G01430 | NHL domain protein;(source:Araport11) |
| AT4G08160 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
| AT4G10510 | Subtilase family protein;(source:Araport11) |
| AT3G24093 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
| AT1G15560 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.8e-130 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT5G58412 | Encodes a Plant thionin family protein |
| AT3G15330 | pseudogene of the NLI interacting factor (NIF) protein family |
| AT3G51325 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G38100 | SABATH family methyltransferase. |
| AT1G11070 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
| AT1G78720 | SecY protein transport family protein;(source:Araport11) |
| AT2G06060 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.7e-05 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G43960 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
| AT1G21290 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-25 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT2G35585 | cystic fibrosis transmembrane conductance regulator;(source:Araport11) |
| AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
| AT1G24420 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G07687 | Cytochrome c oxidase, subunit III;(source:Araport11) |
| AT1G31093 | pseudogene of calcium-dependant protein kinase |
| AT5G45200 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT4G36420 | Ribosomal protein L12 family protein;(source:Araport11) |
| AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
| AT1G71015 | PADRE protein. |
| AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G08125 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G22545 | pseudogene of expressed protein;(source:Araport11) |
| AT3G53065 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
| AT4G11730 | Cation transporter/ E1-E2 ATPase family protein;(source:Araport11) |
| AT4G28100 | transmembrane protein;(source:Araport11) |
| AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT5G67640 | hypothetical protein;(source:Araport11) |
| AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
| AT3G30714 | Pseudogene of AT3G26870; self-incompatibility protein-related |
| AT4G34920 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
| AT1G54640 | F-box family protein-like protein;(source:Araport11) |
| AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
| AT3G50270 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
| AT4G38552 | Natural antisense transcript overlaps with AT4G38550;(source:Araport11) |
| AT2G37660 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G05670 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
| AT1G16770 | hypothetical protein;(source:Araport11) |
| AT3G20980 | Gag-Pol-related retrotransposon family protein;(source:Araport11) |
| AT2G45720 | ARM repeat superfamily protein;(source:Araport11) |
| AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G04000 | hypothetical protein;(source:Araport11) |
| AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G44310 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT4G37420 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT5G61570 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G43175 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G24230 | Pectate lyase family protein;(source:Araport11) |
| AT3G51220 | WEB family protein (DUF827);(source:Araport11) |
| AT3G14855 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
| AT5G45240 | Disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
| AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
| AT1G15772 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
| AT5G60070 | ankyrin repeat family protein;(source:Araport11) |
| AT2G35945 | Natural antisense transcript overlaps with AT2G35940;(source:Araport11) |
| AT4G26095 | Natural antisense transcript overlaps with AT4G26090;(source:Araport11) |
| AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G57510 | cotton fiber protein;(source:Araport11) |
| AT3G49070 | transmembrane protein, putative (DUF677);(source:Araport11) |
| AT4G30030 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G33090 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
| AT5G56390 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G55650 | Pyruvate kinase family protein;(source:Araport11) |
| AT5G45120 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT5G53960 | Mid-1-related chloride channel domain-containing protein;(source:Araport11) |
| AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT1G66990 | pseudogene of suppressor of npr1-1 constitutive 4;(source:Araport11) |
| AT3G49520 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G35430 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
| AT4G16200 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
| AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
| AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT1G35420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G41170 | F-box family protein;(source:Araport11) |
| AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT5G28210 | mRNA capping enzyme family protein;(source:Araport11) |
| AT3G60710 | F-box family protein. |
| AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT5G64190 | neuronal PAS domain protein;(source:Araport11) |
| AT1G14450 | NADH dehydrogenase (ubiquinone)s;(source:Araport11) |
| AT5G37140 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G28570 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT4G24320 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT3G46360 | transmembrane protein;(source:Araport11) |
| AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
| AT4G19820 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G41310 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
| AT2G17160 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
| AT5G11620 | SWIM zinc finger family protein / mitogen-activated protein kinase kinase kinase (MAPKKK)-like protein;(source:Araport11) |
| AT5G64790 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT1G16320 | plant/protein (DUF2358);(source:Araport11) |
| AT1G04380 | encodes a protein similar to a 2-oxoglutarate-dependent dioxygenase |
| AT3G10986 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT2G38790 | hypothetical protein;(source:Araport11) |
| AT3G13825 | pseudogene of F-box family protein |
| AT4G22900 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT4G19720 | Glycosyl hydrolase family protein with chitinase insertion domain-containing protein;(source:Araport11) |
| AT1G30190 | cotton fiber protein;(source:Araport11) |
| AT2G19210 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
| AT3G43710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
| AT1G61880 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT3G46800 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G42980 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
| AT4G01000 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G56850 | hypothetical protein;(source:Araport11) |
| AT3G05460 | sporozoite surface protein-like protein;(source:Araport11) |
| AT5G67411 | GRAS family transcription factor;(source:Araport11) |
| AT2G45300 | encodes 3-phosphoshikimate 1-carboxyvinyltransferase / 5-enolpyruvylshikimate-3-phosphate / EPSP synthase involved in chorismate biosynthesis The mRNA is cell-to-cell mobile. |
| AT3G18050 | GPI-anchored protein;(source:Araport11) |
| AT4G37850 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G54130 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
| AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT4G00872 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
| AT4G35360 | pantothenate kinase;(source:Araport11) |
| AT5G11730 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
| AT5G38310 | hypothetical protein;(source:Araport11) |
| AT2G42550 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
| AT5G39863 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT2G44230 | hypothetical protein (DUF946);(source:Araport11) |
| AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
| AT3G48346 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G31550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G59110 | subtilisin-like serine protease-like protein;(source:Araport11) |
| AT1G66060 | hypothetical protein (DUF577);(source:Araport11) |
| AT3G15350 | G14 enzyme |
| AT2G29040 | Exostosin family protein;(source:Araport11) |
| AT2G29180 | transmembrane protein;(source:Araport11) |
| AT5G05050 | Cysteine proteinases superfamily protein;(source:Araport11) |
| AT5G38960 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT1G13640 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
| AT1G23040 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
| AT5G61720 | hypothetical protein (DUF1216);(source:Araport11) |
| AT5G26300 | TRAF-like family protein;(source:Araport11) |
| AT2G29280 | pseudogene of tropinone reductase;(source:Araport11) |
| AT1G61050 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT1G52660 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G25560 | CHY-type/CTCHY-type/RING-type Zinc finger protein;(source:Araport11) |
| AT5G43535 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
| AT4G35655 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
| AT5G12900 | DNA double-strand break repair RAD50 ATPase;(source:Araport11) |
| AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
| AT5G64110 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G10400 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G52270 | SNARE-like superfamily protein;(source:Araport11) |
| AT4G10530 | Subtilase family protein;(source:Araport11) |
| AT3G21570 | proline-rich nuclear receptor coactivator;(source:Araport11) |
| AT3G14760 | transmembrane protein;(source:Araport11) |
| AT2G44390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT1G51410 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), apple tree, PIR:T16995; NOT a cinnamyl-alcohol dehydrogenase |
| AT1G64065 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G35660 | Glycine-rich protein family;(source:Araport11) |
| AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
| AT5G56880 | hypothetical protein;(source:Araport11) |
| AT1G53625 | hypothetical protein;(source:Araport11) |
| AT1G67270 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
| AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
| AT3G18670 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G29620 | dentin sialophosphoprotein;(source:Araport11) |
| AT1G64035 | pseudogene of serpin 2;(source:Araport11) |
| AT3G60560 | hypothetical protein;(source:Araport11) |
| AT2G07550 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-313 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT4G00750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT2G04050 | MATE efflux family protein;(source:Araport11) |
| AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT5G42680 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
| AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
| AT1G10640 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT3G59840 | allyl alcohol dehydrogenase-like protein;(source:Araport11) |
| AT2G04480 | hypothetical protein;(source:Araport11) |
| AT3G42890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-10 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
| AT2G26030 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G21040 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.7e-20 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT1G69730 | Wall-associated kinase family protein;(source:Araport11) |
| AT1G44160 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
| AT4G29710 | Alkaline-phosphatase-like family protein;(source:Araport11) |
| AT4G14060 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G14480 | glycine/proline-rich protein;(source:Araport11) |
| AT5G10590 | hypothetical protein;(source:Araport11) |
| AT5G36270 | Annotated as pseudogene of dehydroascorbate reductase. Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT4G03290 | EF hand calcium-binding protein family;(source:Araport11) |
| AT2G19920 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT4G06479 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
| AT2G11190 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-90 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
| AT5G22080 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT4G19980 | hypothetical protein;(source:Araport11) |
| AT3G13010 | hAT transposon superfamily protein;(source:Araport11) |
| AT3G33163 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
| AT3G58820 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT3G06280 | F-box associated ubiquitination effector family protein;(source:Araport11) |
| AT4G16155 | dihydrolipoamide dehydrogenase;(source:Araport11) |
| AT4G19633 | pseudogene of heat shock factor related protein |
| AT4G30180 | hypothetical protein;(source:Araport11) |
| AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT3G22133 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase GB:AAC33226.1 from (Arabidopsis thaliana);(source:TAIR10) |
| AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
| AT3G13700 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT1G80960 | F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
| AT1G23150 | hypothetical protein;(source:Araport11) |
| AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT5G42850 | Thioredoxin superfamily protein;(source:Araport11) |
| AT5G62065 | Encodes a Protease inhibitor/seed storage/LTP family protein. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT4G00840 | DHHC-type zinc finger family protein;(source:Araport11) |
| AT1G60590 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT4G25235 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
| AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
| AT3G05130 | paramyosin-like protein;(source:Araport11) |
| AT1G34530 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 7.8e-116 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G68620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G28650 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G49770 | Leucine rich receptor kinase. |
| AT2G29360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G50210 | pseudogene of NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G16180 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
| AT5G47060 | hypothetical protein (DUF581);(source:Araport11) |
| AT3G51120 | zinc finger CCCH domain-containing protein 44;(source:Araport11) |
| AT5G13380 | Auxin-responsive GH3 family protein;(source:Araport11) |
| AT5G39861 | pseudogene of receptor kinase 3;(source:Araport11) |
| AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
| AT2G40450 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT3G20200 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT4G17670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT2G30060 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
| AT5G35926 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
| AT4G29450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G26717 | Encodes a Plant thionin family protein |
| AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
| AT3G46570 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT1G50870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT1G71000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
| AT3G14452 | transmembrane protein;(source:Araport11) |
| AT3G51760 | hypothetical protein (DUF688);(source:Araport11) |
| AT1G75090 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT4G15430 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT5G62627 | Encodes a defensin-like (DEFL) family protein. |
| AT2G44670 | senescence-associated family protein (DUF581);(source:Araport11) |
| AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT5G03858 | Pseudogene of AT5G03960; IQD12 (IQ-domain 12); calmodulin binding protein |
| AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G62320 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
| AT5G48690 | ubiquitin-associated (UBA)/TS-N domain protein;(source:Araport11) |
| AT1G49610 | F-box family protein;(source:Araport11) |
| AT1G55604 | Pseudogene of AT1G26762 |
| AT1G29025 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G80320 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G23460 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT3G58250 | TRAF-like family protein;(source:Araport11) |
| AT4G01960 | transmembrane protein;(source:Araport11) |
| AT1G48870 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G52085 | pseudogene of Mannose-binding lectin superfamily protein;(source:Araport11) |
| AT3G23360 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
| AT1G20320 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G41415 | Encodes a Maternally expressed gene (MEG) family protein |
| AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
| AT3G56360 | hypothetical protein;(source:Araport11) |
| AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G22795 | hypothetical protein;(source:Araport11) |
| AT5G48510 | BTB/POZ domain-containing protein;(source:Araport11) |
| AT5G03452 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT5G18130 | transmembrane protein;(source:Araport11) |
| AT5G61710 | cotton fiber protein;(source:Araport11) |
| AT1G28020 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT1G17744 | hypothetical protein;(source:Araport11) |
| AT2G24140 | myosin-J heavy chain-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT2G32140 | transmembrane receptor;(source:Araport11) |
| AT2G29930 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G01130 | CBL-interacting Serine/Threonine-kinase;(source:Araport11) |
| AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
| AT2G35470 | ribosome maturation factor;(source:Araport11) |
| AT4G12160 | pseudogene of Ribosomal protein S4;(source:Araport11) |
| AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
| AT3G28780 | transmembrane protein, putative (DUF1216);(source:Araport11) |
| AT5G13940 | aminopeptidase;(source:Araport11) |
| AT2G39690 | ternary complex factor MIP1 leucine-zipper protein (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G26080 | proline-rich family protein;(source:Araport11) |
| AT5G54375 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
| AT3G15280 | hypothetical protein;(source:Araport11) |
| AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G21340 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
| AT5G60520 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
| AT4G04410 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-176 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
| AT3G10585 | Homeodomain-like superfamily protein;(source:Araport11) |
| AT3G28510 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G40382 | Cytochrome c oxidase subunit Vc family protein;(source:Araport11) |
| AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
| AT3G43760 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
| AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT5G16090 | RAD23 UV excision repair family protein;(source:Araport11) |
| AT3G41761 | other_RNA;(source:Araport11) |
| AT4G10660 | CDC68-like protein;(source:Araport11) |
| AT3G45120 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G17900.1);(source:TAIR10) |
| AT2G29430 | coiled-coil protein (DUF572);(source:Araport11) |
| AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
| AT3G49305 | transmembrane protein;(source:Araport11) |
| AT3G05770 | hypothetical protein;(source:Araport11) |
| AT1G21220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-26 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G46840 | Subtilase family protein;(source:Araport11) |
| AT1G33320 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
| AT1G11440 | hypothetical protein;(source:Araport11) |
| AT3G15040 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT1G29020 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G77020 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
| AT5G15110 | Pectate lyase family protein;(source:Araport11) |
| AT4G07720 | pseudogene of myosin heavy chain-like protein;(source:Araport11) |
| AT1G28610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT5G55520 | kinesin-like protein;(source:Araport11) |
| AT1G29640 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT4G00780 | TRAF-like family protein;(source:Araport11) |
| AT1G53330 | encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes. |
| AT3G03880 | sterol O-acyltransferase, putative (DUF1639);(source:Araport11) |
| AT4G17765 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G36390 | Methylthiotransferase;(source:Araport11) |
| AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT5G16350 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
| AT1G29715 | pseudogene of Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
| AT1G02470 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
| AT3G28610 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G14250 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G74940 | cyclin-dependent kinase, putative (DUF581);(source:Araport11) |
| AT4G14368 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT2G41150 | plant/protein;(source:Araport11) |
| AT2G29870 | Aquaporin-like superfamily protein;(source:Araport11) |
| AT2G27670 | hypothetical protein (Domain of unknown function DUF220);(source:Araport11) |
| AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G08740 | hypothetical protein;(source:Araport11) |
| AT3G11300 | hypothetical protein;(source:Araport11) |
| AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
| AT3G42316 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 1.9e-38 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT3G22560 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
| AT1G69630 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT4G35680 | selection/upkeep of intraepithelial T-cells protein;(source:Araport11) |
| AT3G28590 | transmembrane protein;(source:Araport11) |
| AT3G53940 | Mitochondrial substrate carrier family protein;(source:Araport11) |
| AT3G05155 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G56520 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
| AT4G04980 | hypothetical protein;(source:Araport11) |
| AT1G34500 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
| AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
| AT4G22066 | Pseudogene of AT5G66830; F-box family protein |
| AT5G17720 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G72620 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G21400 | Thiamin diphosphate-binding fold (THDP-binding) superfamily protein;(source:Araport11) |
| AT5G18850 | Low-density receptor-like protein;(source:Araport11) |
| AT5G26150 | protein kinase family protein;(source:Araport11) |
| AT1G62420 | DUF506 family protein (DUF506);(source:Araport11) |
| AT3G09162 | hypothetical protein;(source:Araport11) |
| AT1G24212 | pseudogene of paired amphipathic helix repeat-containing protein |
| AT1G27050 | Encodes a protein with a RNA recognition motif. Previously annotated as ATHB54, a homeodomain leucine zipper (HD-Zip) family protein. In the TAIR10 genome release (2010), this locus was split into two loci: AT1G27045 (containing homeodomain and leucine zipper domains) and AT1G27050 (containing a RNA recognition motif). AT1G27045 is now named ATHB54. Note that Affymetrix ATH1 Probe Set linked to symbol ATHB54 is in fact directed against the product of the AT1G27050 locus (the mRNA coding for the RNA-recognition-motif protein). |
| AT1G50330 | pseudogene of methylesterase PCR A;(source:Araport11) |
| AT2G16960 | ARM repeat superfamily protein;(source:Araport11) |
| AT5G61620 | myb-like transcription factor family protein;(source:Araport11) |
| AT1G24485 | ER protein carbohydrate-binding protein;(source:Araport11) |
| AT5G03620 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT3G11385 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT3G29800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT2G02900 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
| AT1G66130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT1G24430 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G01023 | hypothetical protein;(source:Araport11) |
| AT2G14110 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G49301 | Pseudogene of AT5G49310; importin alpha-1 subunit, putative |
| AT1G19540 | NmrA-like negative transcriptional regulator family protein;(source:Araport11) |
| AT3G23172 | hypothetical protein;(source:Araport11) |
| AT3G28193 | transmembrane protein;(source:Araport11) |
| AT5G28190 | transmembrane protein;(source:Araport11) |
| AT5G03795 | Exostosin family protein;(source:Araport11) |
| AT2G43745 | jacalin lectin-like protein;(source:Araport11) |
| AT1G10610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT1G25400 | transmembrane protein;(source:Araport11) |
| AT3G22436 | hypothetical protein;(source:Araport11) |
| AT3G14060 | hypothetical protein;(source:Araport11) |
| AT1G49960 | Xanthine/uracil permease family protein;(source:Araport11) |
| AT3G07620 | glycosyltransferase;(source:Araport11) |
| AT1G67020 | transmembrane protein;(source:Araport11) |
| AT3G18720 | F-box family protein;(source:Araport11) |
| AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
| AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
| AT3G15534 | hypothetical protein;(source:Araport11) |
| AT1G07190 | Lon protease;(source:Araport11) |
| AT3G44840 | SABATH methyltransferase |
| AT1G47610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G80450 | VQ motif-containing protein;(source:Araport11) |
| AT5G46200 | carboxyl-terminal proteinase-like protein (DUF239);(source:Araport11) |
| AT4G28330 | pyrroline-5-carboxylate reductase;(source:Araport11) |
| AT5G32072 | pseudogene of Glucose-6-phosphate isomerase |
| AT1G62170 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
| AT2G15325 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT2G36650 | CHUP1-like protein;(source:Araport11) |
| AT2G27980 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain-containing protein;(source:Araport11) |
| AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
| AT3G05620 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G35382 | snoRNA;(source:Araport11) |
| AT2G40680 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G52065.1);(source:TAIR10) |
| AT5G07600 | Oleosin family protein;(source:Araport11) |
| AT1G70120 | transmembrane protein, putative (DUF1163);(source:Araport11) |
| AT4G19730 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
| AT1G20820 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT4G14650 | hypothetical protein;(source:Araport11) |
| AT2G34820 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
| AT4G33810 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT5G44960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G57950 | cotton fiber protein;(source:Araport11) |
| AT3G63290 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT4G05260 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT1G32250 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G50630 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
| AT4G21970 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
| AT2G18780 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G05060 | Protein kinase superfamily protein;(source:Araport11) |
| AT3G19595 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT2G26750 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G70380 | F-box and associated interaction domains-containing protein;(source:Araport11) |
| AT2G31550 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
| AT3G28560 | BCS1 AAA-type ATPase;(source:Araport11) |
| AT4G20040 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G70030 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT1G62870 | hypothetical protein;(source:Araport11) |
| AT5G37160 | P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
| AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G73610 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT2G36200 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G01250 | alpha 1,4-glycosyltransferase family protein;(source:Araport11) |
| AT1G03670 | Ankyrin repeat containing protein |
| AT5G47430 | DWNN domain, a CCHC-type zinc finger;(source:Araport11) |
| AT2G42900 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
| AT2G19910 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
| AT1G65170 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT5G05025 | Encodes a Pollen Ole e I allergen and extensin family protein [pseudogene] |
| AT5G22180 | hypothetical protein;(source:Araport11) |
| AT3G50900 | hypothetical protein;(source:Araport11) |
| AT1G22230 | nucleolar GTP-binding protein;(source:Araport11) |
| AT2G28490 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
| AT1G08890 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G41780 | hypothetical protein;(source:Araport11) |
| AT3G50230 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G11280 | Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
| AT4G27190 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT3G42886 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-89 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT5G54300 | cotton fiber-like protein (DUF761);(source:Araport11) |
| AT1G50070 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
| AT3G01190 | Peroxidase superfamily protein;(source:Araport11) |
| AT3G28570 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT5G28776 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.6e-199 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT1G60750 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
| AT1G72100 | late embryogenesis abundant domain-containing protein / LEA domain-containing protein;(source:Araport11) |
| AT1G48405 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
| AT4G18540 | transmembrane protein;(source:Araport11) |
| AT4G14240 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
| AT1G22660 | Polynucleotide adenylyltransferase family protein;(source:Araport11) |
| AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
| AT1G65140 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
| AT1G76250 | transmembrane protein;(source:Araport11) |
| AT5G28690 | carboxylate clamp-TPR protein (DUF1685);(source:Araport11) |
| AT4G24140 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT1G53930 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G44820 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
| AT2G29780 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
| AT3G07570 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT4G30250 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G32510 | HCO3- transporter family;(source:Araport11) |
| AT1G57565 | SWI-SNF-related chromatin binding protein;(source:Araport11) |
| AT1G66190 | hypothetical protein;(source:Araport11) |
| AT3G46070 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G32390 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
| AT1G61610 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT1G52490 | F-box/associated interaction domain protein;(source:Araport11) |
| AT2G39850 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
| AT4G39140 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G14535 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-19 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT2G19420 | hypothetical protein;(source:Araport11) |
| AT1G03390 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT3G07250 | RNA-binding (RRM-RBD-RNP motif) domain nuclear transport factor 2 family protein;(source:Araport11) |
| AT1G30925 | F-box/associated interaction domain protein;(source:Araport11) |
| AT1G53560 | Ribosomal protein L18ae family;(source:Araport11) |
| AT3G20990 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.9e-07 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
| AT1G66110 | hypothetical protein (DUF577);(source:Araport11) |
| AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
| AT3G09850 | D111/G-patch domain-containing protein;(source:Araport11) |
| AT1G54230 | Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
| AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
| AT1G49975 | photosystem I reaction center subunit N;(source:Araport11) |
| AT3G59340 | solute carrier family 35 protein (DUF914);(source:Araport11) |
| AT5G49525 | transmembrane protein;(source:Araport11) |
| AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
| AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
| AT1G49750 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G21680 | hypothetical protein;(source:Araport11) |
| AT4G18920 | histone acetyltransferase (DUF1264);(source:Araport11) |
| AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G22730 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT3G59170 | F-box/RNI-like superfamily protein;(source:Araport11) |
| AT1G43020 | electron protein, putative (Protein of unknown function, DUF547);(source:Araport11) |
| AT5G54990 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G49350 | Glycine-rich protein family;(source:Araport11) |
| AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
| AT5G02385 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
| AT3G25290 | Auxin-responsive family protein;(source:Araport11) |
| AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
| AT3G58430 | MATH domain/coiled-coil protein;(source:Araport11) |
| AT1G22350 | pseudogene of UDP-glucosyl transferase 85A5;(source:Araport11) |
| AT3G15115 | serine/arginine repetitive matrix protein;(source:Araport11) |
| AT3G07280 | None;(source:Araport11) |
| AT3G20360 | TRAF-like family protein;(source:Araport11) |
| AT3G10470 | C2H2-type zinc finger family protein;(source:Araport11) |
| AT1G66920 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G32910 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT5G56369 | Encodes a defensin-like (DEFL) family protein. |
| AT3G57840 | Plant self-incompatibility protein S1 family;(source:Araport11) |
| AT3G62529 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
| AT5G52882 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G58120 | hypothetical protein;(source:Araport11) |
| AT1G03010 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT4G31330 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
| AT1G15850 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G53592 | FBD-like domain family protein;(source:Araport11) |
| AT1G76280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT3G23770 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
| AT5G20885 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G36770 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
| AT2G40270 | Protein kinase family protein;(source:Araport11) |
| AT1G10330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT2G46850 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G62520 | sulfated surface-like glycoprotein;(source:Araport11) |
| AT3G04150 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT4G33230 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT4G24440 | transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S);(source:Araport11) |
| AT4G18110 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G08270 | C5orf35;(source:Araport11) |
| AT4G29030 | Putative membrane lipoprotein;(source:Araport11) |
| AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
| AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
| AT1G27260 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
| AT4G35025 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
| AT5G26100 | hypothetical protein;(source:Araport11) |
| AT5G23180 | mediator-associated-like protein;(source:Araport11) |
| AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
| AT3G46710 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
| AT1G36110 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-59 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G53635 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
| AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT3G26140 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
| AT2G45840 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
| AT5G37220 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G24800 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G33670 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G47660 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
| AT3G12420 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
| AT3G23350 | ENTH/VHS family protein;(source:Araport11) |
| AT1G67430 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT3G59070 | Cytochrome b561/ferric reductase transmembrane with DOMON related domain-containing protein;(source:Araport11) |
| AT1G68220 | aerobic coproporphyrinogen-III oxidase (DUF1218);(source:Araport11) |
| AT1G49280 | pre-tRNA tRNA-Thr (anticodon: AGT);(source:Araport11, TAIR10) |
| AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
| AT2G30505 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT3G19320 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT2G28770 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
| AT1G52210 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-186 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT4G19910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
| AT4G30872 | other_RNA;(source:Araport11) |
| AT5G61750 | RmlC-like cupins superfamily protein;(source:Araport11) |
| AT5G34870 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
| AT3G62070 | hypothetical protein;(source:Araport11) |
| AT3G05327 | Cyclin family protein;(source:Araport11) |
| AT3G45850 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
| AT3G46280 | kinase-like protein;(source:Araport11) |
| AT1G11520 | pliceosome associated protein-like protein;(source:Araport11) |
| AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
| AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
| AT5G28620 | kinase C-like protein;(source:Araport11) |
| AT2G12320 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32169.1);(source:TAIR10) |
| AT3G24250 | glycine-rich protein;(source:Araport11) |
| AT5G46040 | Major facilitator superfamily protein;(source:Araport11) |
| AT2G34610 | cotton fiber protein;(source:Araport11) |
| AT4G17210 | weak chloroplast movement under blue light protein (DUF827);(source:Araport11) |
| AT1G75260 | oxidoreductases, acting on NADH or NADPH;(source:Araport11) |
| AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
| AT1G29080 | Papain family cysteine protease;(source:Araport11) |
| AT1G03620 | ELMO/CED-12 family protein;(source:Araport11) |
| AT2G37870 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT4G36052 | Natural antisense transcript overlaps with AT4G36050;(source:Araport11) |
| AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G34545 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-112 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
| AT5G25430 | HCO3- transporter family;(source:Araport11) |
| AT4G16745 | Exostosin family protein;(source:Araport11) |
| AT3G51410 | hypothetical protein (DUF241);(source:Araport11) |
| AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G30250 | hypothetical protein;(source:Araport11) |
| AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
| AT2G18193 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT3G46890 | maternal effect embryo arrest protein;(source:Araport11) |
| AT1G80970 | XH domain-containing protein;(source:Araport11) |
| AT5G60080 | Protein kinase superfamily protein;(source:Araport11) |
| AT4G29310 | DUF1005 family protein (DUF1005);(source:Araport11) |
| AT3G02750 | Protein phosphatase 2C family protein;(source:Araport11) |
| AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
| AT1G16905 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
| AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
| AT3G56260 | hypothetical protein;(source:Araport11) |
| AT2G16050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
| AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
| AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
| AT5G23413 | pseudogene of HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
| AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
| AT3G44380 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
| AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
| AT3G54390 | sequence-specific DNA binding transcription factor;(source:Araport11) |
| AT5G63410 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT3G44005 | pseudogene of Mitochondrial transcription termination factor family protein;(source:Araport11) |
| AT1G52370 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
| AT4G06494 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam domain PF03778: Protein of unknown function (DUF321);(source:TAIR10) |
| AT4G31680 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT1G20740 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
| AT5G58840 | Subtilase family protein;(source:Araport11) |
| AT1G78940 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
| AT5G59540 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT1G55030 | RNI-like superfamily protein;(source:Araport11) |
| AT5G67550 | transmembrane protein;(source:Araport11) |
| AT5G44690 | RING finger PFF0165c-like protein;(source:Araport11) |
| AT3G44620 | protein-tyrosine phosphatase;(source:Araport11) |
| AT1G06148 | hypothetical protein;(source:Araport11) |
| AT3G44960 | shugoshin;(source:Araport11) |
| AT3G18900 | ternary complex factor MIP1 leucine-zipper protein;(source:Araport11) |
| AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
| AT1G11640 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
| AT5G04690 | Ankyrin repeat family protein;(source:Araport11) |
| AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
| AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
| AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
| AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
| AT3G26470 | Powdery mildew resistance protein, RPW8 domain-containing protein;(source:Araport11) |
| AT3G45253 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.0e-48 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
| AT5G45990 | crooked neck protein, putative / cell cycle protein;(source:Araport11) |
| AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G03990 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
| AT3G56280 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
| AT1G63600 | Receptor-like protein kinase-related family protein;(source:Araport11) |
| AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
| AT3G01880 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
| AT2G37910 | cation/hydrogen exchanger, putative (CHX21);(source:Araport11) |
| AT5G44660 | hypothetical protein;(source:Araport11) |
| AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
| AT1G68526 | hypothetical protein;(source:Araport11) |
| AT2G17060 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT2G14200 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.0e-133 P-value blast match to gb|AAO73523.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
| AT5G10340 | F-box family protein;(source:Araport11) |
| AT1G66860 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT3G60238 | other_RNA;(source:Araport11) |
| AT3G15720 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT1G69710 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
| AT1G16760 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
| AT4G21770 | Pseudouridine synthase family protein;(source:Araport11) |
| AT3G45577 | tRNA-intron endonuclease;(source:Araport11) |
| AT5G48740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G06470 | Glutaredoxin family protein;(source:Araport11) |
| AT4G30050 | transmembrane protein;(source:Araport11) |
| AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
| AT3G56350 | Iron/manganese superoxide dismutase family protein;(source:Araport11) |
| AT1G27990 | transmembrane protein;(source:Araport11) |
| AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
| AT1G62981 | transmembrane protein, putative (DUF1191);(source:Araport11) |
| AT1G77660 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT1G32890 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-37 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
| AT5G23970 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT4G26770 | Phosphatidate cytidylyltransferase family protein;(source:Araport11) |
| AT1G02630 | Nucleoside transporter family protein;(source:Araport11) |
| AT1G24110 | Peroxidase superfamily protein;(source:Araport11) |
| AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
| AT3G09330 | Transmembrane amino acid transporter family protein;(source:Araport11) |
| AT1G60520 | pseudogene of Dynamin related protein 4A;(source:Araport11) |
| AT5G54210 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT4G28740 | LOW PSII ACCUMULATION-like protein;(source:Araport11) |
| AT1G28323 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-140 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
| AT4G02715 | flocculation FLO11-like protein;(source:Araport11) |
| AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
| AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
| AT4G19740 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
| AT4G25570 | Encodes cytochrome b561. |
| AT4G33890 | Component of SAGA complex, SPT module subunit, interacts with HAG1. |
| AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
| AT4G32660 | Encodes protein kinase AME3. |
| AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
| AT2G26530 | Pheromone receptor-like protein involved in the early elicitor signaling events which occur within minutes and include ion fluxes across the plasma membrane, activation of MPKs and the formation of ROS related to PGPS1 and WRKY33. |
| AT1G28670 | Arabidopsis thaliana lipase |
| AT4G16640 | Matrix metalloprotease. |
| AT1G14420 | Pectate lyase family protein;(source:Araport11) |
| AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
| AT1G34575 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
| AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G11770 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
| AT4G20860 | involved in the generation of H2O2 from reduced compounds |
| AT5G44360 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26390 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26400 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G26420 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G30710 | FAD-binding Berberine family protein;(source:Araport11) |
| AT1G12240 | Encodes a vacuolar invertase betaFruct4. betaFruct4 is transported from the endoplasmic reticulum through the intermediate compartments as a membrane protein. The N-terminal cytoplasmic domain contains multiple sequence motifs that are involved at various stages in the trafficking of betaFruct4 from the ER to the central vacuole. The mRNA is cell-to-cell mobile. |
| AT3G13790 | Encodes a protein with invertase activity. |
| AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
| AT1G66810 | Encodes a tandem CCCH zinc finger (TZF) protein that can bind DNA and RNA, function as a transcriptional activator, and is involved in secondary wall biosynthesis. |
| AT1G16380 | member of Putative Na+/H+ antiporter family |
| AT2G30240 | Encodes a plasma membrane localized potassium transporter. |
| AT4G13410 | encodes a gene similar to cellulose synthase |
| AT3G08030 | The mRNA of this gene is expressed in viable seeds. Its detection in a dry seed lot has potential for use as a molecular marker for germination performance as absence of expression correlates with decreased germination. Encodes DUF642 cell wall protein. |
| AT1G17780 | ATG8A/F interacting protein containing a WxxL LIR motif at the C terminus which is essential for interaction with ATG8. Stress (abiotic or biotic) results in the formation of ATG8- and ATI3-labeled punctate structures, likely reflecting increased formation of ATG8-labeled phagophores or autophagosomes. ATI3 proteins probably act as selective autophagy receptors that target specific cellular components during the plant stress response. ATI3 proteins are delivered to the vacuole under ER stress in an autophagy-dependent manner. |
| AT1G53530 | Mitochondrial ATP-independent protease |
| AT1G32361 | Putative RING-H2 finger protein ATL1F precursor. |
| AT4G00480 | MYC-related protein with a basic helix-loop-helix motif at the C-terminus and a region similar to the maize B/R family at the N-terminus |
| AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
| AT5G57345 | OXR is a single copy gene in Arabidopsis. It is localized to the ER. It is expressed throughout the plant and expression is induced in response to abiotic stress. While the function of OXR is unknown, overexpression results in increased abiotic stress tolerance and increased ascorbic acid content. |
| AT4G04640 | One of two genes (with ATPC2) encoding the gamma subunit of Arabidopsis chloroplast ATP synthase. |
| AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
| AT2G02270 | pseudogene of phloem protein 2-B2;(source:Araport11) |
| AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
| AT4G01810 | Sec23 homolog , forms a distinct clade with SEC23D.Mutants have defects in pollen exine patterning, tapetal development and pollen intine formation. |
| AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
| AT5G04150 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. |
| AT4G00870 | bHLH14 interacts with JAZ proteins, and functions redundantly with bHLH3, bHLH13 and bHLH17 to negatively regulate jasmonate responses. |
| AT2G29720 | Encodes CTF2B. |
| AT1G73760 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G47180 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
| AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
| AT1G31450 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT2G35615 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
| AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
| AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
| AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
| AT1G69572 | Circadian regulated lncRNA, natural antisense gene of CDF5 (AT1G69570). Displays antiphasic expression pattern in relation to CDF5 expression (PMID:28758689). |
| AT5G62980 | Encodes an enzyme that can act as a aldolase or an epimerase for 7,8-dihydroneopterin and 7,8-dihydromonapterin in vitro. It is likely to act in folate biosynthesis as a homooctamer in vivo. |
| AT1G32470 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
| AT5G06270 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations |
| AT1G11860 | T-protein is the aminomethyltransferase of the glycine cleavage multienzyme system GCS. |
| AT5G57440 | A member of haloacid dehalogenase-like hydrolase family, HAD-type phosphosugar phosphatase. |
| AT1G76890 | encodes a plant trihelix DNA-binding protein |
| AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
| AT3G25900 | Homocysteine S-methyltransferase family protein;(source:Araport11) |
| AT1G59860 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT1G52560 | HSP20-like chaperones superfamily protein;(source:Araport11) |
| AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
| AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
| AT3G19230 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
| AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
| AT1G30050 | tropomyosin;(source:Araport11) |
| AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT2G41930 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G18420 | CCR4-NOT transcription complex subunit;(source:Araport11) |
| AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
| AT2G15400 | Non-catalytic subunit of Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, At2g15430 can substitute for At2g15400 in the context of Pol V and encodes the equivalent subunit of Pol II and Pol IV. |
| AT1G76940 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
| AT3G45760 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT3G22640 | cupin family protein;(source:Araport11) |
| AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
| AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
| AT5G61120 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
| AT1G68740 | Encodes PHO1;H1, a member of the PHO1 family. Involved in inorganic phosphate (Pi) transport and homeostasis. Complements pho1 mutation. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
| AT4G25940 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT1G25240 | ENTH/VHS/GAT family protein;(source:Araport11) |
| AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
| AT3G28210 | Encodes a putative zinc finger protein (PMZ). |
| AT3G13720 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
| AT1G72460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G22885 | transmembrane protein;(source:Araport11) |
| AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G19410 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT3G61390 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT1G56030 | RING/U-box protein;(source:Araport11) |
| AT1G56040 | HEAT/U-box protein;(source:Araport11) |
| AT2G40640 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G23830 | PapD-like superfamily protein;(source:Araport11) |
| AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
| AT2G24700 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT4G31630 | Transcriptional factor B3 family protein;(source:Araport11) |
| AT3G24240 | RGFR1 is a leucine--rich repeat receptor kinase that, together with RGFR2 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT5G48940 | RGFR2 is a leucine--rich repeat receptor kinase that, together with RGFR1 and RGFR3, binds ROOT GROWTH FACTORS and is required for establishing the gradient of PLETHORA1 and PLETHORA2 essential for proper root growth and development. |
| AT4G19700 | Encodes BOI (Botrytis Susceptible 1 Interactor). Has E3 ubiquitin ligase activity. Interacts with and ubiquitinates BOS1 (Botrytis Susceptible 1). It prevents caspase activation and attenuates cell death. |
| AT2G47870 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT1G58370 | Encodes a protein with xylanase activity. |
| AT5G64000 | 3'(2'),5'-bisphosphate nucleotidase |
| AT3G19508 | complex 1 protein, LYR family protein;(source:Araport11) |
| AT3G17520 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
| AT5G48710 | Ubiquitin-like superfamily protein;(source:Araport11) |
| AT5G65300 | Gene of unknown function. Expression is induced by a variety of biotic (P. syringae) and abiotic stresses (salt, ABA,IAA, and more.)Member of a small family that includes AT1G35210, AT1G72240, and AT1G22470.Mutants have no obvious loss of function phenotype but overexpressors are early flowering. |
| AT5G15570 | Bromodomain transcription factor;(source:Araport11) |
| AT5G62240 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
| AT5G16280 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
| AT4G27570 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
| AT4G15490 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G15500 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
| AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
| AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
| AT5G28080 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
| AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
| AT4G01720 | member of WRKY Transcription Factor; Group II-b |
| AT1G62300 | Encodes a transcription factor WRKY6. Regulates Phosphate1 (Pho1) expression in response to low phosphate (Pi) stress. |
| AT1G54560 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
| AT5G58060 | Constitutively expressed SNARE protein of the YKT6 family. |
| AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
| AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
| AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
| AT4G03205 | Coproporphyrinogen III oxidase;(source:Araport11) |
| AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
| AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
| AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
| AT2G22810 | key regulatory enzyme in the biosynthesis of the plant hormone ethylene. ACS4 is specifically induced by indoleacetic acid (IAA). |
| AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
| AT3G21500 | Encodes a protein postulated to have 1-deoxy-D-xylulose 5-phosphate synthase activity. |
| AT5G04510 | Encodes 3-phosphoinositide-dependent protein kinase that contains pleckstrin homology domain and binds 3-phosphoinositides. It activates the protein kinase AGC2-1 in a phosphatidic acid dependent manner. Phosphorylates S6K1. Interacts with PID, and transphosphorylation by PDK1 increases PID autophosphorylation. The mRNA is cell-to-cell mobile. |
| AT2G17370 | Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds. |
| AT4G14440 | encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
| AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
| AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
| AT1G47290 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
| AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
| AT5G11920 | Encodes a protein with fructan exohydrolase (FEH) activity acting on both inulin and levan-type fructans (1- and 6-FEH). The enzyme does not have invertase activity. |
| AT4G23450 | AtAIRP1 gene encodes a C3H2C3-type RING E3 Ub ligase. It has been shown to be a positive regulator in the Arabidopsis ABA-dependent drought response. |
| AT5G01520 | Encodes a cytosolic RING-type E3 ubiquitin (Ub) ligase that is critical for ABA and high salinity responses during germination. AtAIRP2 and SDIR1 likely play a combinatory role in ABA signaling and the response to high salt in Arabidopsis. |
| AT4G11690 | Encodes ABO8, a pentatricopeptide repeat (PPR) protein responsible for the splicing of NAD4 intron 3 in mitochondrial complex I. Abo8 mutants accumulate more reactive oxygen species (ROS) in root tips than the wild type. |
| AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT1G49450 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
| AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
| AT1G73340 | ADTO1 is required for the activation of systemic acquired resistance. |
| AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
| AT3G03480 | acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase;(source:Araport11) |
| AT2G26400 | Encodes a protein predicted to belong to the acireductone dioxygenase (ARD/ARD?)family. |
| AT1G76990 | ACT domain repeat 3;(source:Araport11) |
| AT1G12420 | ACT domain repeat 8;(source:Araport11) |
| AT5G59370 | Encodes one of eight Arabidopsis actins. ACT4 belongs to the reproductive actin subclass which is predominantly expressed in developing and reproductive tissues, such as pollen, pollen tubes, ovules, and developing seeds. Expression of the ACT4/GUS fusion was restricted to young vascular tissues, tapetum, and developing and mature pollen. |
| AT3G46520 | Member of actin subclass composed of ACT12 and ACT4. RNA is expressed at very low levels in vegetative organs, low levels in flowers and very high levels in pollen. Expression of an ACT12/GUS fusion was found in vascular tissues, tapetum, developing and mature pollen, the root cap and in a ring of pericycle tissues during lateral root initiation and early development. |
| AT1G65890 | acyl activating enzyme 12;(source:Araport11) |
| AT5G11160 | adenine phosphoribosyltransferase 5;(source:Araport11) |
| AT1G05610 | Encodes the small subunit of ADP-glucose pyrophosphorylase. The small subunit is the catalytic isoform responsible for ADP-glucose pyrophosphorylase activity. The presence of the small subunit is required for large subunit stability. Two isoforms of the small subunit (ApS1 and ApS2) have been described. ApS2 is a minor small subunit isoform present in all plant tissues tested. |
| AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
| AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
| AT5G58890 | AGAMOUS-like 82;(source:Araport11) |
| AT5G49490 | AGAMOUS-like 83;(source:Araport11) |
| AT1G31630 | AGAMOUS-like 86;(source:Araport11) |
| AT2G15660 | AGAMOUS-like 95;(source:Araport11) |
| AT5G04640 | AGAMOUS-like 99;(source:Araport11) |
| AT1G60880 | Root Specific |
| AT2G13360 | Encodes a peroxisomal photorespiratory enzyme that catalyzes transamination reactions with multiple substrates. It is involved in photorespiration. |
| AT3G48000 | Encodes a putative (NAD+) aldehyde dehydrogenase. |
| AT4G36250 | Encodes a putative aldehyde dehydrogenase. The gene is not responsive to osmotic stress and is expressed constitutively at a low level in plantlets and root cultures. |
| AT1G44170 | Encodes an aldehyde dehydrogenase induced by ABA and dehydration that can oxidize saturated aliphatic aldehydes. It is also able to oxidize beta-unsaturated aldehydes, but not aromatic aldehydes. Activity of ALDH3H1 is NAD +-dependent. |
| AT5G20960 | Encodes aldehyde oxidase AA01. |
| AT1G14510 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
| AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
| AT1G76130 | alpha-amylase, putative / 1,4-alpha-D-glucan glucanohydrolase, putative, strong similarity to alpha-amylase GI:7532799 from (Malus x domestica);contains Pfam profile PF00128: Alpha amylase, catalytic domain. Predicted to be secreted based on SignalP analysis. |
| AT5G08370 | Member of Glycoside Hydrolase Family 27 (GH27)that functions as an α-galactosidase. |
| AT3G56450 | member of alpha-SNAP Gene Family |
| AT2G29990 | alternative NAD(P)H dehydrogenase 2;(source:Araport11) |
| AT3G22360 | encodes an alternative oxidase whose expression is limited to flowers and floral buds. |
| AT1G77380 | Amino acid permease which transports basic amino acids. |
| AT4G28700 | ammonium transporter 1;(source:Araport11) |
| AT2G38290 | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
| AT2G38750 | Annexins are a family of calcium dependent membrane binding proteins though to be involved in Golgi mediated secretion. This is one of four annexins identified in Arabidopsis. |
| AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
| AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
| AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
| AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
| AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
| AT5G66080 | Type 2C protein phosphatase located in the plasma membrane. Functions in heat shock response memory mantainance. |
| AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G30400 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53010 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G28040 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G09100 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
| AT4G28890 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G17600 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G53820 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G47560 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G46494 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
| AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
| AT5G24330 | Encodes a SET-domain protein, a H3K27 monomethyltransferases required for chromatin structure and gene silencing. Regulates heterochromatic DNA replication. Contains a PCNA-binding domain. ATXR6 accumulates preferentially during the late G1 or S phase, suggesting that it plays a role in cell-cycle regulation or progression. |
| AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
| AT3G06360 | Encodes an arabinogalactan-protein (AGP27). |
| AT5G24105 | Encodes a putative arabinogalactan-protein (AGP41). |
| AT4G34710 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. ADC2 is stress-inducible (osmotic stress). Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Overexpression causes phenotypes similar to GA-deficient plants and these plants show reduced levels of GA due to lower expression levels of AtGA20ox1, AtGA3ox3 and AtGA3ox1. |
| AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
| AT1G05880 | Encodes ARI12 (ARIADNE 12). ARI12 belongs to a family of `RING between RING fingers' (RBR) domain proteins with E3 ligase activity. Expression of ARI12 is induced by UV-B exposure. |
| AT4G34940 | Armadillo repeat protein. One of a family of four in Arabidopsis. Located in the nucleus and cytoplasm of pollen vegetative cells, and in the cytoplasm of egg cells. Involved in the signaling network controlling tip growth and actin organization in the pollen tube. |
| AT2G16220 | Stress induced gene. Mutants show increased sensitivity to arsenate. |
| AT4G35000 | Encodes a microsomal ascorbate peroxidase APX3. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. The APX3 protein interacts with AKR2 (ankyrin-containing protein that interacts with AFT1) and AFT1, a 14-3-3 protein. |
| AT5G10240 | Encodes asparagine synthetase (ASN3). |
| AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
| AT3G02020 | encodes a monofunctional aspartate kinase |
| AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
| AT5G66870 | Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination. |
| AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
| AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
| AT3G28270 | AFL1 was first identified by immunoscreening an Arabidopsis expression library with antisera recognizing mammalian β1-integrin. It is a peripheral membrane protein associated with endomembranes and plasmamembrane. Based on overexpression and knockdown phenotypes, AFL1 is postulated to function in regulation of growth and proline accumulation in response to drought. AFL1 protein co-localizes with clatharin coated vesicles and has been shown to interact with itself and several endomembrane associated proteins. |
| AT1G48980 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G09550 | Encodes a gamma-tubulin complex protein that plays a role in gamma-tubulin complex localization, spindle stability and chromosomal segregation. |
| AT3G47740 | member of ATH subfamily |
| AT3G47750 | member of ATH subfamily |
| AT3G47760 | ABC2 homolog 4;(source:Araport11) |
| AT3G47770 | ABC2 homolog 5;(source:Araport11) |
| AT3G47780 | member of ATH subfamily The mRNA is cell-to-cell mobile. |
| AT3G47790 | ABC2 homolog 7;(source:Araport11) |
| AT1G28010 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT3G28380 | P-glycoprotein 17;(source:Araport11) |
| AT4G25960 | P-glycoprotein 2;(source:Araport11) |
| AT4G01820 | member of MDR subfamily |
| AT5G46540 | P-glycoprotein 7;(source:Araport11) |
| AT3G59140 | member of MRP subfamily |
| AT1G30410 | member of MRP subfamily |
| AT3G62700 | member of MRP subfamily |
| AT2G47800 | Encodes a plasma membrane localized ATPase transporter involved in multidrug transport. The expression of this gene is upregulated by herbicide safeners such as benoxacor, fluxofenim and fenclorim. The mRNA is cell-to-cell mobile. |
| AT4G39850 | Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. |
| AT4G30300 | member of NAP subfamily |
| AT1G17840 | Encodes a plasma membrane-localized ATP-binding cassette transporter, that is required for cutin transport to the extracellular matrix. The mRNA is cell-to-cell mobile. |
| AT3G55100 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55110 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G55130 | Encodes a vacuole localized protein of the ABC transporter White-Brown Complex (WBC) family. When overexpressed in planta, confers resistance to kanamycin. |
| AT5G19410 | ABC-2 type transporter family protein;(source:Araport11) |
| AT3G13220 | Encodes a ATP-binding cassette transporter G26 (ABCG26) involved in tapetal cell and pollen development. Required for male fertility and pollen exine formation. |
| AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
| AT2G29940 | pleiotropic drug resistance 3;(source:Araport11) |
| AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
| AT1G15210 | pleiotropic drug resistance 7;(source:Araport11) |
| AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
| AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
| AT4G15233 | ABC-2 and Plant PDR ABC-type transporter family protein;(source:Araport11) |
| AT5G52860 | ABC-2 type transporter family protein;(source:Araport11) |
| AT2G37300 | transmembrane protein;(source:Araport11) |
| AT5G44316 | Stabilizer of iron transporter SufD superfamily protein;(source:Araport11) |
| AT2G03200 | Atypical aspartic protease which modulates lateral root development. |
| AT2G33270 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. |
| AT3G61710 | Encodes autophagy protein 6 (ATG6), required for pollen germination and plant development. |
| AT3G06420 | Autophagy protein. |
| AT5G49980 | auxin F-box protein 5;(source:Araport11) |
| AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
| AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
| AT1G33960 | Identified as a gene that is induced by avirulence gene avrRpt2 and RPS2 after infection with Pseudomonas syringae pv maculicola strain ES4326 carrying avrRpt2 |
| AT3G21880 | Encodes a substrate of the COP1/SPA E3 ubiquitin ligase. It is degraded in darkness and stabilized by white, red and blue light. Overexpression results in decreased apical dominance, increased branching and delayed flowering in long days. The latter phenotype is due to reduced levels of FT and dependent on the presence of CO (PMID:29187570). |
| AT2G33500 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT4G15248 | B-box type zinc finger family protein;(source:Araport11) |
| AT4G15250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
| AT2G31220 | Encodes a bHLH transcription factor that together with bHLH089 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. |
| AT3G56970 | Encodes a member of the basic helix-loop-helix transcription factor family protein. |
| AT3G56980 | Encodes a member of the basic helix-loop-helix transcription factor protein. |
| AT2G41240 | Encodes a member of the basic helix-loop-helix transcription factor family protein. Functions as a key regulator of iron-deficiency responses independent of the master regulator FIT. Likely regulates genes involved in the distribution of iron within the plant. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
| AT3G54620 | bZIP transcription factor-like protein mRNA |
| AT1G27850 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
| AT3G08670 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
| AT3G56660 | basic region/leucine zipper motif protein 49;(source:Araport11) |
| AT4G26400 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G13430 | RING/U-box superfamily protein;(source:Araport11) |
| AT3G15690 | Single hybrid motif superfamily protein;(source:Araport11) |
| AT5G62100 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
| AT4G08540 | One of a pair of paralogs (the other is AT1G77890)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex,but is not essential for PI3P biosynthesis. |
| AT1G75430 | BEL1-like homeodomain 11;(source:Araport11) |
| AT2G23760 | Encodes a member of the BEL family of homeodomain proteins. Plants doubly mutant for saw1/saw2 (blh2/blh4) have serrated leaves. BP is expressed in the serrated leaves, therefore saw2 and saw1 may act redundantly to repress BP in leaves. Regulates together with BLH2 demethylesterification of homogalacturonan in seed mucilage. |
| AT5G41410 | Homeodomain protein required for ovule identity.Loss of function mutations show homeotic conversion of integuments to carpels.Forms heterodimers with STM and KNAT1. Interacts with AG-SEP heterodimers is thought to restrict WUS expression. BEL interacts with MADS box dimers composed of SEP1(or SEP3) and AG, SHP1, SHP2 and STK. The interaction of BEL1 with AG-SEP3 is required for proper integument development and specification of integument identity. |
| AT1G65880 | Encodes a benzoate-CoA ligase. Involved in the biosynthesis of benzoyloxyglucosinolate in Arabidopsis seeds. |
| AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
| AT3G60130 | beta glucosidase 16;(source:Araport11) |
| AT5G16580 | beta glucosidase 2;(source:Araport11) |
| AT1G61820 | beta glucosidase 46;(source:Araport11) |
| AT1G60260 | beta glucosidase 5;(source:Araport11) |
| AT3G62740 | beta glucosidase 7;(source:Araport11) |
| AT5G46690 | beta HLH protein 71;(source:Araport11) |
| AT3G57240 | encodes a member of glycosyl hydrolase family 17 |
| AT3G23920 | Encodes a chloroplast beta-amylase. Is necessary for leaf starch breakdown in the absence of BAM3.Activity of BAM1 increases 4 days after osmotic stress. BAM1 has a higher temperature optimum than BAM3 (PMID:25293962). |
| AT4G00490 | Encodes a chloroplast beta-amylase. The enzyme activity is very weak compared to BAM1 and BAM3. It forms a tetramer whose activity requires K+ and exhibits sigmoidal kinetics Mutants of BAM2 have no visible phenotype. |
| AT2G32290 | beta-amylase 6;(source:Araport11) |
| AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
| AT2G16730 | putative beta-galactosidase (BGAL13 gene) |
| AT4G38590 | putative beta-galactosidase (BGAL14 gene) |
| AT1G72990 | beta-galactosidase 17;(source:Araport11) |
| AT5G56870 | beta-galactosidase 4;(source:Araport11) |
| AT4G21760 | beta-glucosidase 47;(source:Araport11) |
| AT1G02640 | encodes a protein similar to a beta-xylosidase located in the extracellular matrix. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
| AT1G69160 | suppressor;(source:Araport11) |
| AT4G12030 | Required for the biosynthesis of methionine-derived glucosinolates. Involved in the transport of 2-keto acids between chloroplasts and the cytosol. |
| AT1G09080 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
| AT5G15530 | biotin carboxyl carrier protein isoform 2 (BCCP2) mRNA, |
| AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
| AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
| AT4G36540 | Encodes the brassinosteroid signaling component BEE2 (BR-ENHANCED EXPRESSION 2). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
| AT4G31910 | Encodes an acyltransferase that can modify brassinosteroids (BRs) by acylation and may modulate endogenous BR levels. |
| AT3G18550 | Encodes a TCP transcription factor, closely related to teosinte branched1, arrests axillary bud development and prevents axillary bud outgrowth. Role in flowering control. |
| AT5G38970 | Encodes a polypeptide involved in the C-6 oxidation of brassinosteroids. Heterologous expression of the protein in yeast conferred the ability to catalyze multiple reactions in which the C-6 position of 6-deoxocastasterone, 6-deoxotyphasterol, 3-dehydro-6-deoxoteasterone and 6-deoxoteasterone are oxidized. |
| AT3G30180 | Encodes a cytochrome p450 enzyme that catalyzes the last reaction in the production of brassinolide. It is capable of converting 6-deoxocastasterone into castasterone, a C-6 oxidation, as well as the further conversion of castasterone into brassinolide by a Baeyer-Villinger oxidation reaction at C-6, resulting in the formation of an unusual seven-membered lactone ring. The enzyme possesses high affinity for both C28- and C27-Brassinosteroids. The expression of the gene using a CYP85A2 promoter:LUC fusion construct was shown to be under circadian and light control. |
| AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
| AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
| AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
| AT2G01950 | Encodes a leucine rich repeat receptor kinase and associated with provascular/procambial cells. Similar to BRI, brassinosteroid receptor protein. |
| AT1G76380 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
| AT5G59570 | Encodes BOA (BROTHER OF LUX ARRHYTHMO), a component of the circadian clock. The mRNA is cell-to-cell mobile. |
| AT5G67480 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
| AT5G19000 | Encodes a member of the MATH-BTB domain proteins (BPMs) that directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6. Known members include AT5G19000 (BPM1), AT3G06190 (BPM2), AT2G39760 (BPM3), AT3G03740 (BPM4), AT5G21010 (BPM5) and AT3G43700 (BPM6). |
| AT1G50280 | BTB/POZ protein that forms a complex with CUL3a. Involved in repression of ABA responses. |
| AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
| AT4G17470 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
| AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
| AT4G22120 | Calcium-permeable stretch activated cation channel. |
| AT2G41860 | member of Calcium Dependent Protein Kinase |
| AT4G36070 | member of Calcium Dependent Protein Kinase |
| AT2G35890 | member of Calcium Dependent Protein Kinase |
| AT1G76040 | member of Calcium Dependent Protein Kinase |
| AT3G25600 | Calmodulin like protein. Paralog of CML15. |
| AT3G05010 | Encodes a candidate G-protein Coupled Receptor that is involved in the regulation of root growth by bacterial N-acyl-homoserine lactones (AHLs) and plays a role in mediating interactions between plants and microbes. |
| AT5G27210 | Protein of unknown function, transmembrane-40;(source:Araport11) |
| AT2G44990 | More Axillary Branching; carotenoid cleavage dioxygenases. |
| AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
| AT1G04440 | Member of CKL gene family (CKL-C group). |
| AT1G14160 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G44550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15610 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G06390 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT4G15630 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT5G62820 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT3G11550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
| AT1G31530 | Deadenylase. |
| AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
| AT1G55720 | member of Low affinity calcium antiporter CAX2 family |
| AT5G22910 | member of Putative Na+/H+ antiporter family |
| AT3G44930 | member of Putative Na+/H+ antiporter family |
| AT3G44920 | member of Putative Na+/H+ antiporter family |
| AT3G44910 | member of Putative Na+/H+ antiporter family |
| AT4G23700 | member of Putative Na+/H+ antiporter family |
| AT1G79400 | member of Putative Na+/H+ antiporter family |
| AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
| AT5G58460 | member of Putative Na+/H+ antiporter family |
| AT5G01690 | member of Putative Na+/H+ antiporter family |
| AT1G08140 | member of Putative Na+/H+ antiporter family |
| AT1G08135 | cation/H+ exchanger 6B;(source:Araport11) |
| AT1G06970 | member of Putative Na+/H+ antiporter family |
| AT1G48260 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.21), which has also been reported as a member of the CBL-interacting protein kinases (CIPK17). |
| AT5G45820 | Encodes a CBL-interacting serine/threonine protein kinase comprised of an N-terminal kinase catalytic domain similar to SNF1/AMPK and a unique C-terminal regulatory domain. |
| AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
| AT4G14580 | CBL-interacting protein kinase |
| AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile. |
| AT5G10860 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. |
| AT3G26740 | transcripts are differentially regulated at the level of mRNA stability at different times of day controlled by the circadian clock. mRNAs are targets of the mRNA degradation pathway mediated by the downstream (DST) instability determinant. |
| AT2G32070 | Deadenylase. |
| AT5G39420 | CDC2C;(source:Araport11) |
| AT3G13784 | cell wall invertase 5;(source:Araport11) |
| AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
| AT4G38190 | encodes a gene similar to cellulose synthase |
| AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
| AT4G24000 | encodes a protein similar to cellulose synthase |
| AT2G32610 | encodes a gene similar to cellulose synthase |
| AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
| AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
| AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
| AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
| AT2G43570 | chitinase;(source:Araport11) |
| AT5G40890 | Encodes a member of the voltage-dependent chloride channel. Also functions as a NO3-/H+ exchanger that serves to accumulate nitrate nutrient in vacuoles. Mutants homozygous for the T-DNA insertion mutation have reduced nitrate uptake capacity in high nitrate environment and exhibit hypersensitivity to chlorate. Role in cytosolic pH homeostasis. |
| AT1G29920 | Encodes lhcb1.1 a component of the LHCIIb light harvesting complex associated with photosystem II. |
| AT4G25990 | chloroplast import apparatus CIA2-like. CIA2 is a transcription factor which upregulates chloroplast translocon genes |
| AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
| AT4G34230 | Encodes a catalytically active cinnamyl alcohol dehydrogenase which uses p-coumaryl aldehyde as a preferred substrate. It can also use sinapyl, caffeyl, coniferyl and d-hydroxyconiferyl aldehydes as substrates. |
| AT4G39330 | cinnamyl alcohol dehydrogenase 9;(source:Araport11) |
| AT2G23400 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT5G60510 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
| AT3G58740 | Encodes a peroxisomal citrate synthase that is expressed in siliques and developing seeds. |
| AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
| AT1G69320 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
| AT1G26600 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
| AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
| AT4G17040 | HON5 (At4g17040) encodes the ClpR4 subunit of the chloroplast-localized Clp protease complex. hon mutations disturb plastid protein homeostasis, thereby activating plastid signaling and inducing stress acclimatization. |
| AT5G50920 | Encodes a protein that is similar to ATP-dependent Clp protease ATP-binding subunit / ClpC. Involved in protein import into the chloroplast. May provide ATP source that drives the TIC (Translocon at the Inner envelope membrane of Chloroplasts) translocation machinery. Association of Hsp93 with the inner envelope membrane through its N domain is important for the functions of Hsp93 in vivo. |
| AT3G20580 | COBRA-like protein 10 precursor;(source:Araport11) |
| AT5G57660 | CONSTANS-like 5;(source:Araport11) |
| AT1G29690 | Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity. |
| AT1G61620 | Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile. |
| AT1G62810 | Encodes COPPER AMINE OXIDASE1 (CuAO1). Contributes to abscisic acid- and polyamine-induced nitric oxide biosynthesis and abscisic acid signal transduction. |
| AT3G56940 | Encodes a putative ZIP protein with varying mRNA accumulation in leaves, stems and roots. Has a consensus carboxylate-bridged di-iron binding site. The mRNA is cell-to-cell mobile. |
| AT2G39180 | CRINKLY4 related 2;(source:Araport11) |
| AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
| AT1G30820 | Cytidine triphosphate synthase. |
| AT2G34890 | Cytidine triphosphate synthase. |
| AT4G01150 | Integral thylakoid membrane protein required for proper grana stack curvature. |
| AT1G52220 | Thylakoid membrane localized protein that interacts with other CURT family proteins. Oligomerization is associated with grana thylakoid curavature. |
| AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
| AT5G33370 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. Mutants are defective in cuticle formation with reduced sepal cuticle ridge formation. |
| AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
| AT2G28260 | member of Cyclic nucleotide gated channel family |
| AT3G48010 | member of Cyclic nucleotide gated channel family |
| AT1G47220 | Cyclin A3;(source:Araport11) |
| AT5G10270 | Encodes CDKC;1, part of a CDKC kinase complex that is targeted by Cauliflower mosaic virus (CaMV) for transcriptional activation of viral genes. Also regulates plant growth and development. |
| AT3G01480 | Encodes a chloroplast cyclophilin functioning in the assembly and maintenance of photosystem II (PSII) supercomplexes. The mRNA is cell-to-cell mobile. |
| AT1G66160 | CYS, MET, PRO, and GLY protein 1;(source:Araport11) |
| AT2G40880 | Encodes a protein with cysteine proteinase inhibitor activity. Overexpression increases tolerance to abiotic stressors (i.e.salt,osmotic, cold stress). The mRNA is cell-to-cell mobile. |
| AT4G36880 | cysteine proteinase1;(source:Araport11) |
| AT4G09545 | Encodes a ECA1 gametogenesis related family protein |
| AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
| AT4G23240 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G11480 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04500 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT4G04570 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
| AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
| AT1G05340 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT2G19570 | Encodes a cytidine deaminase that deaminates cytidine and deoxycytidine and is competitively inhibited by cytosine-containing compounds. |
| AT3G50930 | Encodes a protein that is present in a homo-multimeric protein complex on the outer mitochondrial membrane and plays a role in cell death and amplifying salicylic acid signalling. The mRNA is cell-to-cell mobile. |
| AT1G69500 | Encodes a cytochrome P450, designated CYP704B1. Expressed in the developing anthers. Essential for pollen exine development. Mutations in CYP704B1 result in impaired pollen walls that lack a normal exine layer and exhibit a characteristic striped surface, termed zebra phenotype. Heterologous expression of CYP704B1 in yeast cells demonstrated that it catalyzes omega-hydroxylation of long-chain fatty acids, implicating these molecules in sporopollenin synthesis. |
| AT4G15380 | member of CYP705A |
| AT2G27000 | member of CYP705A |
| AT4G22710 | member of CYP706A |
| AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
| AT1G55940 | cytochrome P450 family protein;(source:Araport11) |
| AT2G46960 | member of CYP709B |
| AT5G57260 | putative cytochrome P450 |
| AT3G26180 | putative cytochrome P450 |
| AT3G26190 | putative cytochrome P450 |
| AT3G26290 | putative cytochrome P450 |
| AT1G13070 | putative cytochrome P450 |
| AT3G26295 | putative cytochrome P450. |
| AT3G26330 | putative cytochrome P450 |
| AT2G02580 | member of CYP71B |
| AT2G34500 | Encodes a protein with C22-sterol desaturase activity. The enzyme was shown to catalyze in the presence of NADPH the conversion of β-sitosterol to stigmasterol, but not that of 24-epi-campesterol to brassicasterol (unlike CYP710A2). |
| AT2G26170 | Encodes a protein with similarity to thromboxane-A synthase, member of the CYP711A cytochrome P450 family. MAX1 is a specific repressor of vegetative axillary buds generated by the axillary meristem. Expressed in vascular traces in the rosette stem and axillary buds throughout plant development. Mutants have increased axillary branches. Along with MAX3,4 thought to mediate control of shoot branching via synthesis of a signal molecule which is transported over long distance mediated by MAX2. cDNA supports the existence of the longer transcript predicted for this locus, no cDNA isolated for shorter transcript. MAX1 downregulates 11 genes involved in flavonoid pathway (CHS, CHI, F3H, F3'H, FLS, DFR, ANS, UFGT, RT, AAC and GST). |
| AT5G06905 | member of CYP712A |
| AT5G24910 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
| AT5G36110 | Encodes a member of the CYP716A subfamily of cytochrome P450 monooxygenases with triterpene oxidizing activity catalyzing C-28 hydroxylation of alpha-amyrin, beta-amyrin, and lupeol, producing uvaol, erythrodiol, and betulin, respectively. Additionally, it shows carboxylation activity for the C-28 position of alpha- and beta-amyrin. |
| AT2G42850 | cytochrome P450, family 718;(source:Araport11) |
| AT3G14610 | putative cytochrome P450 |
| AT2G45560 | cytochrome P450 monooxygenase |
| AT2G45570 | member of CYP76C |
| AT1G33730 | cytochrome P450, family 76, subfamily C, polypeptide 5;(source:Araport11) |
| AT1G33720 | cytochrome P450, family 76, subfamily C, polypeptide 6;(source:Araport11) |
| AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
| AT3G28740 | Encodes a member of the cytochrome p450 family. Expression is upregulated in response to cis-jasmonate treatment. Overexpression induces synthesis of volatile compounds that affect chemical ecology and insect interactions. |
| AT4G37330 | member of CYP81D |
| AT5G67310 | member of CYP81G |
| AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
| AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
| AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
| AT1G24540 | member of CYP86C |
| AT3G26125 | encodes a protein with cytochrome P450 domain |
| AT1G13140 | member of CYP86C |
| AT1G13150 | member of CYP86C |
| AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
| AT3G01900 | member of CYP94B |
| AT2G27690 | Encodes a CYP94C1. Has highest omega-hydroxylase activity with 9,10-epoxystearic acid, while also metabolized lauric acid (C12:0) and C18 unsaturated fatty acids. Gene expression is induced in response to wounding and jasmonic acid treatment. |
| AT1G34540 | member of CYP94D |
| AT4G39490 | member of CYP96A |
| AT1G57750 | Encodes a CYP96A15, midchain alkane hydroxylase, involved in cuticular wax biosynthesis. |
| AT1G65340 | member of CYP96A |
| AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
| AT2G21910 | member of CYP96A |
| AT1G68550 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
| AT1G49120 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
| AT2G47430 | Encodes a putative plasma membrane-bound hybrid histidine kinase and cytokinin sensor that is expressed within the female gametophyte. |
| AT2G43230 | Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA. |
| AT3G04620 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
| AT1G51440 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
| AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
| AT3G10910 | RING/U-box superfamily protein;(source:Araport11) |
| AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
| AT4G31770 | Encodes a RNA lariat debranching enzyme required for embryogenesis. |
| AT5G05280 | Encodes a RING-finger E3 ligase protein that controls anther dehiscence by positively regulating the expression of DAD1 in the jasmonic acid biosynthesis pathway. |
| AT1G65630 | Encodes a putative DegP protease. |
| AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
| AT5G57690 | Involved in nitric oxide-dependent pollen tube guidance and fertilization. |
| AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
| AT5G64860 | Encodes a maltotriose-metabolizing enzyme with chloroplastic α-1,4-glucanotransferase activity. Mutant has altered starch degradation. |
| AT4G10500 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT4G10490 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
| AT3G45610 | PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
| AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
| AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
| AT4G25930 | DUF295 domain containing protein. |
| AT1G80240 | DUF642 gene |
| AT4G18425 | transmembrane protein, putative (DUF679);(source:Araport11) |
| AT1G64110 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT4G35280 | Target promoter of the male germline-specific transcription factor DUO1. |
| AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
| AT1G60530 | Dynamin related protein 4A;(source:Araport11) |
| AT2G03500 | Encodes a nuclear localized member of the MYB family of transcriptional regulators that is involved in negative regulation of flowering. It is expressed in vascular tissues and at low levels in the shoot apex during the transition to flowering. Loss of function mutations are early flowering.EFM is involved in the autonomous, thermosensory and GA pathways and expression is directly regulated by SVP. EFM interacts with JMJD5 to repress FT expression. |
| AT2G17840 | Identified as drought-inducible gene by differential hybridization. Upregulated by high light, drought, cold and salt stress determined by microarray analysis. |
| AT1G02205 | Expression of the CER1 gene associated with production of stem epicuticular wax and pollen fertility. Biochemical studies showed that cer1 mutants are blocked in the conversion of stem wax C30 aldehydes to C29 alkanes, and they also lack the secondary alcohols and ketones. These suggested the CER1 protein is an aldehyde decarbonylase, but the exact molecular function of this protein remains to be determined. |
| AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
| AT4G13840 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
| AT2G21750 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
| AT3G48470 | embryo defective 2423;(source:Araport11) |
| AT5G55940 | Uncharacterized protein family (UPF0172);(source:Araport11) |
| AT4G33990 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G13010 | Encodes a nuclear localized DEAH-box containing protein that is involved in miRNA biogenesis. Loss of function mutants are embryo lethal. Gene silencing experiments demonstrated its role in the localization of DCL-1 and HYL1 to the nuclear D-body. In silenced lines, miRNA production is suppressed and plants have developmental abnormalities and are hypersensitive to fungal pathogens. |
| AT2G18080 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
| AT3G03650 | Exostosin family protein;(source:Araport11) |
| AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
| AT5G11530 | Involved in regulating reproductive development |
| AT1G16900 | Encodes the Arabidopsis ortholog of the yeast/human ALG9 catalyzing the luminal addition of two alpha-1,2 Man residues in assembling Glc3Man9GlcNAc2. |
| AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
| AT3G14210 | A semidominant QTL which has an epistatic effect on the Epithiospecifier gene. Represses nitrile formation and favors isothiocyanate production during glucosinolate hydrolysis. The functional allele deters the insect herbivory T. ni. |
| AT3G05600 | Encodes a cytosolic epoxide hydrolase capable of acting on 9,10-epoxystearic acid and on 12,13- epoxyoctadec-9-enoic acid that is involved in the synthesis of poly-hydroxylated cutin monomers. |
| AT1G08920 | Encodes ESL1, a transporter for monosaccharides. |
| AT5G62230 | Encodes a receptor-like kinase that, together with ER and ERL2 governs the initial decision of protodermal cells to either divide proliferatively to produce pavement cells or divide asymmetrically to generate stomatal complexes. It is important for maintaining stomatal stem cell activity and preventing terminal differentiation of the meristemoid into the guard mother cell. Along with erl2 functionally compensates for loss of erecta during integument development. Its transcript levels change after inducing MUTE expression in a mute background. |
| AT3G23150 | Involved in ethylene perception in Arabidopsis The mRNA is cell-to-cell mobile. |
| AT3G25730 | ethylene response DNA binding factor 3;(source:Araport11) |
| AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
| AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT1G50640 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-3). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
| AT4G28140 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. Regulated by heat shock. |
| AT5G05740 | S2P-like putative metalloprotease, also contain transmembrane helices near their C-termini and many of them, five of seven, contain a conserved zinc-binding motif HEXXH. Homolog of EGY1. Each of the EGY1 and EGY-like proteins share two additional highly conserved motifs, the previously reported NPDG motif (aa 442?454 in EGY1, Rudner et al., 1999) and a newly defined GNLR motif (aa 171?179 in EGY1). The GNLR motif is a novel signature motif unique to EGY1 and EGY-like proteins as well as other EGY1 orthologs found in cyanobacteria. |
| AT2G39820 | Translation initiation factor IF6;(source:Araport11) |
| AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
| AT3G56640 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. |
| AT5G52340 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT3G09530 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
| AT5G64260 | EXORDIUM like 2;(source:Araport11) |
| AT1G69530 | Member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT1G26770 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
| AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
| AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
| AT5G60060 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
| AT2G14500 | F-box family protein;(source:Araport11) |
| AT2G33190 | F-box only protein (DUF295);(source:Araport11) |
| AT4G10820 | F-box family protein;(source:Araport11) |
| AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
| AT2G03610 | F-box family protein;(source:Araport11) |
| AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
| AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
| AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
| AT5G06920 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
| AT5G60490 | Encodes a member of fasciclin-like arabinogalactan proteins (FLAs) containing a cell adhesion fasciclin (FAS) domain. Mutations result in altered stem biomechanics with reduced tensile strength and reduced tensile modulus of elasticity, as well as altered cell wall architecture and composition, with increased cellulose microfibril angle, reduced arabinose, galactose and cellulose content. Possibly involved in embryogenesis and seed development. |
| AT3G12120 | Major enzyme responsible for the synthesis of 18:2 fatty acids in the endoplasmic reticulum. Contains His-rich motifs, which contribute to the interaction with the electron donor cytochrome b5. Mutations in this gene suppress the low temperature-induced phenotype of Arabidopsis tocopherol-deficient mutant vte2. |
| AT1G57790 | F-box family protein;(source:Araport11) |
| AT2G35620 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots.Mucilage is easily detached from fei2 mutants seeds, and forms a capsule that is >50% smaller relative to wild-type. |
| AT5G66190 | Encodes a leaf-type ferredoxin:NADP(H) oxidoreductase. It is present in both chloroplast stroma and thylakoid membranes but is more abundant in the thylakoid. The affinity of this enzyme for ferredoxin is slightly, but significantly, higher than AtLFNR2, an isoform of the same enzyme. AtLFNR1 forms a heterodimer with AtFNR2 and is also a prerequisite to attach AtFNR2 to the thylakoid membrane. |
| AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
| AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
| AT1G26870 | NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
| AT1G07050 | FITNESS encodes a protein with a single CCT domain and belongs to the CCT motif family genes (CMF). FITNESS acts upstream JUB1 thereby controlling H2O2 levels. FITNESS has a role in cellular redox homeostasis controlling H2O2 levels, due to changes in enzymes, metabolites and transcripts related to ROS detoxification. |
| AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
| AT5G28470 | Encodes a member of the nitrate/peptide NTR/PTR family of transporters is required for accumulation and transport of pollen-specific flavonol 3-O-sophorosides, characterized by a glycosidic β-1,2-linkage, to the pollen surface of Arabidopsis. |
| AT5G63590 | flavonol synthase 3;(source:Araport11) |
| AT5G63600 | encodes a protein whose sequence is similar to flavonol synthase |
| AT1G50370 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
| AT4G14740 | FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT5G57770 | FORKED-LIKE family member, part of Group 2 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
| AT4G15200 | Actin nucleation factor that directs the formation of actin cables in pollen tubes. Involved in cytoplasmic streaming and polarized growth in pollen tubes. |
| AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
| AT5G01100 | O-fucosyltransferase family protein;(source:Araport11) |
| AT4G38970 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
| AT5G06850 | Encodes an endoplasmic reticulum protein that is involved in the transport of the florigen FT from companion cells to sieve elements, thus affecting FT transport through the phloem to the SAM. |
| AT4G05120 | Encodes an equilibrative nucleoside transporter AtENT3. Mutations of this locus allow mutants to grow on uridine analogue fluorouridine. |
| AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
| AT5G44670 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT4G20170 | glycosyltransferase family protein (DUF23);(source:Araport11) |
| AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
| AT4G30550 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
| AT4G39650 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in the apoplast of young siliques (within the ovules of the carpel) and is involved in the degradation of glutathione. The encoded enzyme also acts as part of a GSH pumping gamma-glutamyl cycle in this tissue and may also be involved in gamma-glutamyl amino acid formation. |
| AT1G69820 | Note that conflicting nomenclature exists in the literature: At1g69820 is named as GGT4 in Plant J. 2007 Mar 49(5):878-88; and as GGT3 in Plant Physiol. 2007 Aug 144(4):1715-32. |
| AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
| AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
| AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
| AT4G36620 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G18380 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT5G26930 | Encodes a member of the GATA factor family of zinc finger transcription factors. Controls lateral root founder cell specification. |
| AT3G60530 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
| AT2G20770 | Encodes a protein with reported similarity to GCR2 a putative G protein coupled receptor thought to be an ABA receptor.GCL2 also has similarity to LANCL1 and LANCL2, human homologs of bacterial lanthionine synthetase. |
| AT1G71120 | Contains lipase signature motif and GDSL domain. |
| AT3G14550 | Encodes a protein with geranylgeranyl pyrophosphate synthase activity involved in isoprenoid biosynthesis. The enzyme appears to be targeted to the chloroplast in epidermal cells and guard cells of leaves, and in etioplasts in roots. |
| AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
| AT5G58660 | Encodes a class III gibberellin 2-oxidase that oxidizes GA12 to GA110 and GA9 to GA40. |
| AT1G79840 | Glabra 2, a homeodomain protein affects epidermal cell identity including trichomes, root hairs, and seed coat. It also down-regulates seed oil content. Expressed in atrichoblasts and required to suppress root hair development. Also expressed abundantly during early seed development. Directly regulated by WER. |
| AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
| AT4G10060 | Glucosylceramidase that preferentially hydrolyzes long acyl chain glucosylceramides. |
| AT4G38880 | GLN PHOSPHORIBOSYL PYROPHOSPHATE AMIDOTRANSFERASE 2 |
| AT1G48520 | Encodes Glu-tRNA(Gln) amidotransferase subunit B (from Genbank record AF239836). |
| AT5G15770 | Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum. |
| AT3G27300 | glucose-6-phosphate dehydrogenase 5;(source:Araport11) |
| AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
| AT4G09990 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
| AT3G17760 | glutamate decarboxylase 5;(source:Araport11) |
| AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
| AT2G24710 | member of Putative ligand-gated ion channel subunit family |
| AT2G29100 | member of Putative ligand-gated ion channel subunit family |
| AT5G16570 | Encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
| AT1G03850 | Encodes glutaredoxin ATGRXS13, required to facilitate Botrytis cinerea infection of Arabidopsis thaliana plants. Sylvain La Camera et al (2011, PMID:21756272) reported a third splice variant in addition to the two annotated in TAIR10. It is a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
| AT1G02920 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT5G17220 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). Mutants display no pigments on leaves and stems. Likely to function as a carrier to transport anthocyanin from the cytosol to tonoplasts. |
| AT1G27140 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT2G29480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78370 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT1G78340 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
| AT4G25220 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT1G30560 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
| AT1G06520 | sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile. |
| AT2G38110 | bifunctional sn-glycerol-3-phosphate 2-O-acyltransferase/phosphatase. Involved in cutin assembly. |
| AT2G16260 | pseudogene of glycine-rich RNA-binding protein |
| AT2G33470 | glycolipid transfer protein 1;(source:Araport11) |
| AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
| AT1G64390 | glycosyl hydrolase 9C2;(source:Araport11) |
| AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
| AT2G27130 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
| AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
| AT1G31140 | Encodes a B-sister MADS-box protein, GORDITA which is specific to the Brassicaceae. GOA is the most closely related paralog of ABS. GOA represses fruit growth and contributes to integument development. Over-expression of GOA results in disorganized floral structure and addition of carpel-like features to sepals. |
| AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
| AT4G34460 | Encodes the heterotrimeric G-protein beta subunit and is involved in organ shape. A significant fraction of the protein is found in the ER. Mutants carrying null alleles express similar fruit phenotypes, as seen in er plants, but differ from er in that the stem is only slightly shorter than that in the wild type, the pedicel is slightly longer than that in the wild type, and the leaves are rounder than those in er mutants. Gene is expressed in all tissues examined, with highest expression level found in siliques. It is involved in resistance to Plectosphaerella cucumerina. The predicted protein has two DWD motifs. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. It seems to be involved in the calcium-mediated response to extracellular ATP. |
| AT5G48650 | Negative regulator of defense response to Pseudomonas syringae pv. tomato through altered stomatal and apoplastic immunity. |
| AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
| AT3G10350 | One of 3 GET paralogs in Arabidopsis. GET3b is a chloroplast localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
| AT3G42640 | H[+]-ATPase 8;(source:Araport11) |
| AT3G10520 | Encodes a class 2 non-symbiotic hemoglobin. Over-expression of AHb2 in seeds led to a 40% increase in the total fatty acid content of developing and mature seeds in three subsequent generations. This was mainly due to an increase in the poly-unsaturated C18:2 (omega-6) linoleic and C18:3 (omega-3) alpha-linolenic acids. |
| AT3G19700 | Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments. |
| AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
| AT5G43840 | member of Heat Stress Transcription Factor (Hsf) family |
| AT1G29100 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
| AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
| AT5G20270 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
| AT4G37840 | Encodes a putative hexokinase. |
| AT1G16720 | Encodes HCF173, a protein with weak similarities to the superfamily of the short-chain dehydrogenases/reductases. HCF173 is involved in the initiation of translation of the psbA mRNA and binds a specific site in the 5' UTR of psbA mRNA. Mutants shows a high chlorophyll fluorescence phenotype (hcf) and are severely affected in the accumulation of PSII subunits. The protein HCF173 is localized in the chloroplast, where it is mainly associated with the membrane system and is part of a higher molecular weight complex with psbA mRNA as a component of this complex. |
| AT1G23200 | ProPME pectin methyl esterase involved in embryo development. |
| AT2G46680 | encodes a putative transcription factor that contains a homeodomain closely linked to a leucine zipper motif. Transcript is detected in all tissues examined. Is transcriptionally regulated in an ABA-dependent manner and may act in a signal transduction pathway which mediates a drought response. |
| AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
| AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
| AT4G17710 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G52170 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
| AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
| AT3G50480 | Homolog of RPW8 |
| AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
| AT3G16090 | Encodes one of the Arabidopsis homologs of the yeast/human Hrd1 protein: AT3G16090 (Hrd1A), AT1G65040 (Hrd1B). Involved in ERAD (Endoplasmic reticulum-associated degradation). |
| AT4G37580 | involved in apical hook development. putative N-acetyltransferase |
| AT5G62490 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. |
| AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
| AT4G10020 | Encodes a putative hydroxysteroid dehydrogenase (HSD). Genes that encode HSD include: At5g50600 and At5g50700 (HSD1), At3g47350(HSD2), At3g47360(HSD3), At5g50590 and At5g50690(HSD4), At5g50770(HSD6) (Plant Cell Physiology 50:1463). Two copies of HSD1 and HSD4 exist due to a gene duplication event. In Plant Physiology 145:87, At5g50690 is HSD7, At4g10020 is HSD5. |
| AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
| AT1G51780 | encodes a member of the six Arabidopsis IAA-amino acid conjugate hydrolase subfamily and conjugates and is very similar to IAR3. |
| AT4G09940 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
| AT2G02080 | C2H2 BIRD transcription factor family. |
| AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
| AT4G15550 | UDP-glucose:indole-3-acetate beta-D-glucosyltransferase |
| AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
| AT3G23030 | auxin inducible gene expressed in the nucleus |
| AT4G32280 | indole-3-acetic acid inducible 29;(source:Araport11) |
| AT5G65670 | auxin (indole-3-acetic acid) induced gene The mRNA is cell-to-cell mobile. |
| AT4G05530 | Encodes a peroxisomal member of the short-chain dehydrogenase/reductase (SDR) family of enzymes. Loss of IBR1 function causes increased resistance to indole-3-butyric acid without affecting plant responses to IAA, NAA, and 2,4-D. This enzyme may be responsible for catalyzing a dehydrogenation step in the beta-oxidation-like conversion of IBA to IAA. The mRNA is cell-to-cell mobile. |
| AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
| AT2G43900 | Encodes a 5-inositol-phosphate phosphatase, that, in vitro, shows activity against IP(1,4,5). |
| AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
| AT1G19870 | Encodes a microtubule-associated protein.Member of IQ67 (CaM binding) domain containing family. |
| AT5G03570 | Encodes FPN2, a tonoplast localized nickel transport protein. FPN2 is one of the Arabidopsis orthologs (AT2G38460/IREG1/FPN1 and AT5G03570/IREG2/FPN2) the iron efflux transporter ferroportin (FPN) identified in animals. |
| AT4G18780 | Encodes a member of the cellulose synthase family involved in secondary cell wall biosynthesis. Mutants have abnormal xylem formation, reduced cellulose content, and enhanced drought and osmotic stress tolerance. Mediates resistance towards bacterial pathogens via ABA. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. |
| AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
| AT5G17420 | Encodes a xylem-specific cellulose synthase that is phosphorylated on one or more serine residues (on either S185 or one of S180 or S181). |
| AT1G26640 | Encodes a cytosolic isopentenyl phosphate kinase that plays an important role in regulating the formation of both MVA (mevalonic acid) and MEP (methylerythritol phosphate) pathway-derived terpenoid compounds by controlling the ratio of IP/DMAP to IPP/DMAPP. IPP and DMAPP are the universal C5 building blocks of all natural terpenoids. IPK enhances terpenoid formation by returning IP/DMAP to the terpenoid biosynthetic network. |
| AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
| AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
| AT2G39330 | jacalin-related lectin 23;(source:Araport11) |
| AT2G26490 | JGB contains seven WD40 repeats and is highly conserved in flowering plants. Overexpression inhibits pollen germination. suggesting JGB is a negative regulator of pollen germination |
| AT1G60160 | Member of the KT/KUP/HAK family of proton-coupled potassium transporters which have potential effect on cellular expansion. |
| AT4G32500 | Encodes AKT5, a member of the Shaker family potassium ion (K+) channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
| AT1G23390 | A kelch domain-containing F-box protein. Its N terminus contains a typical F-box motif but its C-terminal domain only consists of one predicted kelch motif. Predicted to be stu Interacts with chalcone synthase CHS to mediate CHS ubiquitination and degradation. |
| AT4G10840 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT3G27960 | CMU1 and CMU2 along with FRA1 contributes to lateral stability of cortical microtubules. |
| AT5G11060 | A member of Class II KN1-like homeodomain transcription factors (together with KNAT3 and KNAT5), with greatest homology to the maize knox1 homeobox protein. Expression regulated by light. Detected in all tissues examined, but most prominent in leaves and young siliques. Transient expression of GFP translational fusion protein suggests bipartite localization in nucleus and cytoplasm. KNAT4 promoter activity showed cell-type specific pattern along longitudinal root axis; GUS expression pattern started at the elongation zone, predominantly in the phloem and pericycle cells, extending to endodermis toward the base of the root. |
| AT5G63720 | Encodes KOKOPELLI (KPL). kokopelli (kpl) mutants display frequent single-fertilization events indicating that KPL is involved in double fertilization. KPL and an inversely transcribed gene, ARIADNE14 (ARI14), which encodes a putative ubiquitin E3 ligase, generate a sperm-specific natural cis-antisense siRNA pair. In the absence of KPL, ARI14 RNA levels in sperm are increased and fertilization is impaired. |
| AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
| AT1G60370 | KUK F-box domain protein. Natural variants are associated with GWAS trait for root meristem and cell length. Polymorphisms in the coding sequence are the major causes of KUK allele? dependent natural variation in root development. |
| AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
| AT2G29220 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G29250 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G32800 | protein kinase family protein;(source:Araport11) |
| AT3G55550 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
| AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
| AT3G19090 | RNA-binding protein;(source:Araport11) |
| AT5G58910 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT2G30210 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
| AT1G13580 | Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
| AT2G42560 | Late embryogenesis protein. Based on in vitro studies, likely plays a role in stablizing membranes in response to freezing stress. |
| AT2G46140 | Late embryogenesis abundant protein;(source:Araport11) |
| AT5G06760 | Encodes LEA4-5, a member of the Late Embryogenesis Abundant (LEA) proteins which typically accumulate in response to low water availability conditions imposed during development or by the environment. Most of the diverse set of LEA proteins can be grouped according to properties such as high hydrophilicity and high content of glycine or other small amino acids in what has been termed hydrophilins. LEA4-5 protects enzyme activities from the adverse effects induced by freeze-thaw cycles in vitro. |
| AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
| AT5G48890 | Encodes a C(2) H(2) -type zinc-finger transcriptional regulator and is expressed in the leaf vasculature and the vegetative shoot apical meristem and controls the transition to flowering. |
| AT1G18390 | Serine/Threonine kinase family catalytic domain protein;(source:Araport11) |
| AT5G38210 | Protein kinase family protein;(source:Araport11) |
| AT1G28300 | Transcription factor that contains a B3 domain, a DNA-binding motif unique to plants and characteristic of several transcription factors. Plays critical roles both early and late during embryo development. LEC2 RNA accumulates primarily during seed development. LEC2 is required for the maintenance of suspensor morphology, specification of cotyledon identity, progression through the maturation phase, and suppression of premature germination. It establishes a cellular environment sufficient to initiate embryo development - ectopic, postembryonic expression of LEC2 in transgenic plants induces the formation of somatic embryos and other organ-like structures and often confers embryonic characteristics to seedlings and to reproductive and vegetative organs of mature plants. |
| AT4G33970 | Pollen expressed protein required for pollen tube growth.Along with other members of the LRX family, itnteracts with RALF4 to control pollen tube growth and integrity. Loss of function results in premature pollen tube rupture and reduced fertility. |
| AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
| AT5G58500 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
| AT2G18460 | like COV 3;(source:Araport11) |
| AT1G67560 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
| AT5G67420 | Encodes a LOB-domain protein involved in nitrogen metabolism and affecting leaf morphogenesis. |
| AT3G49940 | LOB domain-containing protein 38;(source:Araport11) |
| AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
| AT3G05780 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
| AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
| AT2G02450 | NAC domain containing protein 35;(source:Araport11) |
| AT1G49430 | Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation. |
| AT1G23010 | Encodes a protein with multicopper oxidase activity. Located in ER. Function together with LPR2 (AT1G71040) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
| AT4G11485 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G14935 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G33233 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G61182 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G31953 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
| AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
| AT4G31080 | Encodes one of two LUNAPARK proteins in Arabidopsis. Both LNPA and LNPB are predominantly distributed throughout the ER, but not preferentially localized at the three-way junctions. Mutation of both LNPA and LNPB together caused the cortical ER to develop poor ER cisternae and a less dense tubular network. E3 ligase involved in degradation of RHD3 to maintain a tubular ER network. |
| AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
| AT5G45840 | Encodes a leucine-rich-repeat RLK that is localized to the plasma membrane of pollen tubes and functions with MIK1/2 as the male receptor of the pollen tube chemo-attractant LURE1.MDIS1 forms a complex with MIK1/2 and binds LURE1. |
| AT1G32320 | member of MAP Kinase Kinase |
| AT1G18350 | MAP kinase kinase7. Member of plant mitogen-activated protein kinase kinase group D. Negative regulator of polar auxin transport. Overexpression leads to activation of basal and systemic acquired resistance. |
| AT3G06230 | member of MAP Kinase Kinase |
| AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
| AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
| AT2G02240 | F-box family protein;(source:Araport11) |
| AT1G53470 | mechanosensitive channel of small conductance-like 4;(source:Araport11) |
| AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
| AT4G27860 | vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
| AT2G39370 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
| AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
| AT1G79330 | Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
| AT3G59990 | Encodes a MAP2 like methionine aminopeptidase |
| AT1G64660 | Encodes a functional methionine gamma-lyase, a cytosolic enzyme catalyzes the degradation of methionine into methanethiol, alpha-ketobutyrate and ammonia. The catabolism of excess methionine is important to methionine homeostasis. The mRNA is cell-to-cell mobile. |
| AT4G04830 | methionine sulfoxide reductase B5;(source:Araport11) |
| AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
| AT4G37150 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES9 appears to be involved in MeSA hydrolysis in planta. Expression of MES9 can restore systemic acquired resistance in SAR-deficient tobacco plants. This protein does not act on MeGA4, or MEGA9 in vitro. |
| AT4G00416 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G59800 | Encodes a protein containing a methyl-CpG-binding domain that acts as an anti-silencing factor that prevent gene repression and DNA hypermethylation by tethering other anti-silencing factors to methylated DNA, which enables the function of DNA demethylases that in turn limit DNA methylation and prevent transcriptional gene silencing. |
| AT1G22310 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
| AT5G55835 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAAAGAGAGCAC |
| AT2G47585 | Encodes a microRNA that targets several genes containing NAC domains including NAC1 and ORE1. Overexpression leads to decreased NAC1 mRNA and reduced lateral roots. Loss of function mutants have increased NAC1 and increased number of lateral roots. Also targets CUC2 and modulates the extent of leaf margin serration. Also targets ORE1 to negatively regulate the timing of leaf senescence. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA. The miR164a pri-mRNA also encodes a regulatory peptide miPEP164a (AT2G47584) that regulates accumulation of its own miRNA. |
| AT3G55512 | Encodes a microRNA that targets several genes containing AP2 domains including AP2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: AGAAUCUUGAUGAUGCUGCAG |
| AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
| AT1G52185 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TAGAATGCTATTGTAATCCAG |
| AT5G03552 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGCGGGAAGCAUUUGCACAUG |
| AT1G18879 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: AUCAGUUUCUUGUUCGUUUCA |
| AT1G71002 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection. |
| AT3G18827 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CUUCUUAAGUGCUGAUAAUGC |
| AT1G23060 | hypothetical protein;(source:Araport11) |
| AT5G62250 | microtubule-associated protein 65-9;(source:Araport11) |
| AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
| AT4G24250 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO13 belongs to the clade II, with ATMLO1 and ATMLO15. The gene is expressed during early seedling growth, in root and cotyledon vascular system, in pollen and also in placenta of developing siliques, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G42560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO9 belongs to the clade III, with AtMLO5, AtMLO7, AtMLO8, and AtMLO10. The gene is expressed during early seedling growth, in cotyledon vascular system, in flowers (with strong expression in anthers) in siliques and fruit abscission zone; not expressed in roots, or in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
| AT1G18835 | Encodes a small zinc finger protein whose overexpression induces ectopic meristem formation on leaf margins. |
| AT2G04540 | Encodes a mitochondrial beta-ketoacyl-ACP synthase. |
| AT1G57610 | calcium uniporter (DUF607);(source:Araport11) |
| AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
| AT2G32510 | Member of MEKK subfamily involved in wound and JA induced signaling.Interacts with At5g40440, and activates At1g59580. |
| AT3G50310 | Encodes a member of MEKK subfamily. Target promoter of the male germline-specific transcription factor DUO1. Involved in osmotic stress response via regulation of MPK6 activity. It also plays an important role in regulating cell division and cell elongation in the primary root meristematic and elongation areas. Mutants show defects in root microtubule organization.It phosphorylates MPK18 and MKK3.It is a positive regulator of ABA-induced stomatal closure that acts by phosphorylating MKK5. |
| AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
| AT2G41660 | Essential for hydrotropism in roots. Mutant roots are defective in hydrotropism, and have slightly reduced phototropism and modified wavy growth response. Has normal gravitropism and root elongation. |
| AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
| AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
| AT4G18640 | Required for root hair elongation during tip growth. The mRNA is cell-to-cell mobile. |
| AT2G03720 | Involved in root hair development |
| AT2G33780 | VQ motif-containing protein;(source:Araport11) |
| AT2G17010 | MSL8 encodes a protein with similarity to mechano-sensitive channel proteins. MSL8 is expressed specifically in pollen and germinating pollen tubes.It regulates pollen germination and is needed to maintain cellular integrity during pollen hydration and germination. |
| AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
| AT3G10320 | MUCI21 is a GT61 protein required for the production of highly branched xylan in seed coat mucilage. MUCI21 likely decorates xylan with xylose side chains that seem to be necessary for pectin attachment to the seed surface. |
| AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT4G20080 | Calcium-dependent lipid-binding (CaLB domain) plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G61720 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
| AT3G24500 | One of three genes in A. thaliana encoding multiprotein bridging factor 1, a highly conserved transcriptional coactivator. May serve as a bridging factor between a bZIP factor and TBP. Its expression is specifically elevated in response to pathogen infection, salinity, drought, heat, hydrogen peroxide, and application of abscisic acid or salicylic acid. Constitutive expression enhances the tolerance of transgenic plants to various biotic and abiotic stresses. |
| AT4G02070 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. |
| AT3G02940 | Encodes a putative transcription factor (MYB107). |
| AT1G48000 | Encodes a putative transcription factor (MYB112). |
| AT1G26780 | Encodes LOF1 (LATERAL ORGAN FUSION1), a MYB-domain transcription factor expressed in organ boundaries. Functions in boundary specification, meristem initiation and maintenance, and organ patterning. Also see LOF2 (At1g69560). |
| AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
| AT2G31180 | Member of the R2R3 factor gene family. |
| AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
| AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
| AT5G52260 | Member of the R2R3 factor gene family. |
| AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
| AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
| AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
| AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
| AT1G56160 | Encodes a member of the R2R3 transcription factor gene family that is involved in mediating induced systemic resistance. Genetic analysis of loss of function mutants and overexpressor lines indicates MYB72 is necessary but not sufficient for ISR.Interacts in vivo with EIL3. |
| AT4G13480 | Member of the R2R3 factor gene family. |
| AT3G08500 | Encodes a putative R2R3-type MYB transcription factor (MYB83). |
| AT4G22680 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
| AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
| AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
| AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
| AT4G26260 | Encodes a myo-inositol oxygenase, which is the first enzyme in the inositol route to ascorbate (L‐ascorbic acid, AsA, vitamin C). Overexpression results in enhanced biomass and abiotic stress tolerance. |
| AT5G56640 | Myo-Inositol Oxygenase gene family |
| AT1G70750 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G16720 | caldesmon-like protein (Protein of unknown function, DUF593);(source:Araport11) |
| AT5G57020 | Arabidopsis thaliana myristoyl-CoA:protein N-myristoyltransferase. |
| AT1G31070 | Encodes a protein that functions as an N-acetylglucosamine-1-phosphate uridylyltransferase that catalyzes the formation of UDP-N-acetylglucosamine (UDP-GlcNAc). This is an essential precursor for glycolipid and glycoprotein synthesis and is also used for regulatory protein modification in signaling pathways. The enzyme can also catalyze the reverse reaction using both UDP-GlcNAc and the less common UDP-N-acetylgalactosamine as substrates. |
| AT4G35160 | Encodes a cytosolic N-acetylserotonin O-methyltransferase that can convert N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine in the process of melatonin synthesis. It does not have caffeic acid O- methyltransferase activity. |
| AT1G79610 | Encodes an endosomal Na(+)/H(+) antiporter: AT1G54370 (NHX5), AT1G79610 (NHX6). Double knockout nhx5 nhx6 showed reduced growth, with smaller and fewer cells and increased sensitivity to salinity. |
| AT1G12260 | Encodes a NAC-domain transcription factor that is expressed in developing xylem. Over expression of this protein causes ectopic secondary cell wall growth. Complements some of the cell wall defects seen in SND1/NST1 double mutants. |
| AT1G01010 | NAC domain containing protein 1;(source:Araport11) |
| AT1G28470 | NAC domain containing protein 10;(source:Araport11) |
| AT5G61430 | NAC domain containing protein 100;(source:Araport11) |
| AT1G34180 | NAC domain containing protein 16;(source:Araport11) |
| AT1G60280 | NAC domain containing protein 23;(source:Araport11) |
| AT1G60350 | NAC domain containing protein 24;(source:Araport11) |
| AT3G15500 | Encodes an ATAF-like NAC-domain transcription factor that doesn't contain C-terminal sequences shared by CUC1, CUC2 and NAM. Note: this protein (AtNAC3) is not to be confused with the protein encoded by locus AT3G29035, which, on occasion, has also been referred to as AtNAC3. The mRNA is cell-to-cell mobile. |
| AT2G17040 | Member of the NAC transcription factor family and more specifically, the ONAC022 subfamily. Involved in leaf and inflorescence stem morphogenesis. The mRNA is cell-to-cell mobile. |
| AT3G03200 | NAC domain containing protein 45;(source:Araport11) |
| AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
| AT5G04400 | NAC domain protein;(source:Araport11) |
| AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
| AT1G69490 | Encodes a member of the NAC transcription factor gene family. It is expressed in floral primordia and upregulated by AP3 and PI. Its expression is associated with leaf senescence. The mRNA is cell-to-cell mobile. |
| AT4G21490 | NAD(P)H dehydrogenase B3;(source:Araport11) |
| AT2G20800 | NAD(P)H dehydrogenase B4;(source:Araport11) |
| AT2G41680 | Encodes a NADPH thioredoxin reductase involved in chloroplast protection against oxidative damage. |
| AT3G11660 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus. Localization of the gene product is similar to that of NHL3 (plasma membrane) but it is yet inconclusive. |
| AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
| AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
| AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
| AT4G25910 | Encodes a protein containing the NFU domain that may be involved in iron-sulfur cluster assembly. Part of a five member gene family, more closely related to NFU1 and 2 than to NFU4 and 5. Targeted to the chloroplast. The mRNA is cell-to-cell mobile. |
| AT5G23230 | nicotinamidase 2;(source:Araport11) |
| AT5G23220 | nicotinamidase 3;(source:Araport11) |
| AT3G53140 | Nicotinate N-methyltransferase involved in N-methylnicotinate formation. |
| AT2G23420 | nicotinate phosphoribosyltransferase 2;(source:Araport11) |
| AT5G55810 | encodes a bi-functional enzyme that expresses both nicotinamide-nucleotide adenylyltransferase (2.7.7.1) and nicotinate-nucleotide adenylyltransferase (2.7.7.18)activity. |
| AT2G33160 | Gene structure annotation for AT2G33160.1 is inaccurate in TAIR10, see PMID:23709666 and Comments field on the locus page for updated annotation. |
| AT3G16180 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G08100 | Encodes a high-affinity nitrate transporter. |
| AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
| AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
| AT3G16350 | MYB-like transcription factor involved in nitrate signaling trough regulation of CHL1. |
| AT5G13390 | Required for normal pollen development and lipid accumulation within the tapetum |
| AT2G37010 | member of NAP subfamily |
| AT5G64330 | Involved in blue light response signaling pathway; interacts with the blue light photoreceptor NPH1. Null mutations abolish phototrophic responses of etiolated seedlings to low fluence blue light. Protein contains multiple protein-protein interaction domains. |
| AT1G44575 | Encoding PSII-S (CP22), a ubiquitous pigment-binding protein associated with photosystem II (PSII) of higher plants. Involved in nonphotochemical quenching rather than in photosynthesis. Mutant has a normal violaxanthin cycle but has a limited capacity of quenching singlet excited chlorophylls and is tolerant to lipid peroxidation. |
| AT4G11910 | Acts antagonistically with SGR1 to balance chlorophyll catabolism in chloroplasts with the dismantling and remobilizing of other cellular components in senescing leaf cells. |
| AT1G52190 | Encodes a low affinity nitrate transporter that is expressed in the plasma membrane and found in the phloem of the major veins of leaves. It is responsible for nitrate redistribution to young leaves. |
| AT1G27080 | Encodes a protein with low-affinity nitrate transporter activity that is expressed in the vascular tissue of the funiculus and the silique. This plasma membrane-localized enzyme is predicted to have 12 transmembrane domains. Plants lacking NRT1.6 have reduced levels of nitrate in their seeds and have increased levels of early embryonic developmental defects and seed abortion. |
| AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
| AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
| AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
| AT5G01180 | Encodes a dipeptide transporter expressed in pollen and ovules during early seed development. GFP-tagged PTR5 localizes to the plasma membrane. |
| AT3G25560 | NSP-interacting kinase 2;(source:Araport11) |
| AT1G11570 | NTF2-like protein;(source:Araport11) |
| AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT2G47810 | nuclear factor Y, subunit B5;(source:Araport11) |
| AT1G63020 | Encodes one of two alternative largest subunits of a putative plant-specific RNA polymerase IV (aka RNA polymerase D). Required for posttranscriptional gene silencing. |
| AT1G60030 | nucleobase-ascorbate transporter 7;(source:Araport11) |
| AT5G18860 | Encodes a purine nucleoside hydrolase active in the apoplast. It might play a role in salvaging extracellular ATP. NSH3 transcript levels rise in response to jasmonic acid and wounding. |
| AT5G50960 | Highly similar to Saccharomyces cerevisiae NBP35, locus YGL091C. Cytosolic protein that homodimerizes and can assemble both 4Fe-4S - type and 2Fe-2S - type clusters on its amino terminal and carboxy therminal respectively. Null mutants are embryo lethal. |
| AT4G25434 | nudix hydrolase homolog 10;(source:Araport11) |
| AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
| AT5G60850 | Encodes a zinc finger protein. |
| AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
| AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
| AT4G26590 | oligopeptide transporter |
| AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
| AT2G15820 | Encodes a protein that promotes splicing of type II introns. otp51 mutants fail to splice intron 2 of plastid ycf3 transcripts, a factor required for the assembly of Photosystem I. Therefore, homozygous otp51 mutants have profound photosynthetic defects and can only survive in sucrose-supplemented in vitro cultures under low light conditions. OTP51 may also be involved in splicing several other transcripts and precursor forms of the trnL, trnG, trnI, and trnA transcripts also accumulate in otp51 mutants. Although OTP51 shares some homology with DNA endonucleases, it lacks key catalytic residues suggesting that it does not participate in DNA cleavage. |
| AT2G02980 | Encodes a chloroplast RNA editing factor. |
| AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
| AT1G73220 | Encodes Organic Cation Transporter 1 (OCT1), likely to be involved in polyamine transport. |
| AT1G79410 | organic cation/carnitine transporter5;(source:Araport11) |
| AT4G29910 | Origin Recognition Complex subunit 5. Involved in the initiation of DNA replication. Interacts strongly with all ORC subunits. |
| AT2G31020 | OSBP(oxysterol binding protein)-related protein 1A;(source:Araport11) |
| AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
| AT2G30395 | Member of the plant specific ovate protein family of unknown function. |
| AT2G30400 | ovate family protein 2;(source:Araport11) |
| AT1G10680 | P-glycoprotein 10;(source:Araport11) |
| AT3G07680 | Encodes an Golgi-localized p24 protein. Interacts with p24delta5 at ER export sites for ER exit and coupled transport to the Golgi apparatus. The mRNA is cell-to-cell mobile. |
| AT1G21900 | Encodes an ER-localized p24 protein. Interacts with p24beta2 at ER export sites for ER exit and coupled transport to the Golgi apparatus. Once in the Golgi, p24delta5 interacts very efficiently with the COPI machinery for retrograde transport back to the ER. |
| AT5G52780 | Chloroplast NAD(P)H dehydrogenase complex assembly factor. |
| AT1G19300 | The PARVUS/GLZ1 gene encodes a putative family 8 glycosyl transferase that contributes to xylan biosynthesis. Its gene expression shows good co-variance with the IRX3 gene involved in secondary cell wall synthesis. PARVUS/GLZ1 is predicted to have galacturonosyltransferase activity and may be involved in the formation of the complex oligosaccharide sequence present at the reducing end of xylan. PARVUS is expressed in cells undergoing secondary wall thickening, and parvus mutants have thinner cell walls. |
| AT4G37050 | Patatin-related phospholipase A. Expressed in the floral gynaecium and is induced by abscisic acid (ABA) or phosphate deficiency in roots. |
| AT3G63200 | PATATIN-like protein 9;(source:Araport11) |
| AT1G72150 | novel cell-plate-associated protein that is related in sequence to proteins involved in membrane trafficking in other eukaryotes The mRNA is cell-to-cell mobile. |
| AT3G57260 | beta 1,3-glucanase |
| AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
| AT2G39110 | Protein kinase superfamily protein;(source:Araport11) |
| AT1G26970 | Protein kinase superfamily protein;(source:Araport11) |
| AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
| AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
| AT3G59010 | Encodes PME35, a pectin methylesterase. PME35-mediated demethylesterification of the primary cell wall regulates the mechanical strength of the supporting tissue. |
| AT3G58390 | Represses the RNA the non-stop decay (NSD) and no-go decay (NGD) quality control systems that act during translation. Impairs NSD likely by sequestering the HBS1 components of the NSD complex. |
| AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
| AT4G25130 | Encodes a chloroplast-localized methionine sulfoxide reductase that is a member of the MSRA family. Involved in protection of chloroplasts from oxidative stress. |
| AT5G49570 | Encodes a protein that has peptide:N-glycanase activity in enzymatic assay in heterologous systems (although the activity was not detected in wild-type plants). |
| AT5G61640 | ubiquitous enzyme that repairs oxidatively damaged proteins |
| AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
| AT3G49120 | Class III peroxidase Perx34. Expressed in roots, leaves and stems. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
| AT2G22780 | encodes an peroxisomal NAD-malate dehydrogenase that is involved in fatty acid beta-oxidation through providing NAD to the process of converting fatty acyl CoA to acetyl CoA. |
| AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
| AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
| AT3G29670 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. The mRNA is cell-to-cell mobile. |
| AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
| AT5G13800 | Encodes a pheophytinase that is involved in chlorophyll breakdown. Its transcript levels increase during senescence and pph-1 mutants have a stay-green phenotype. |
| AT5G45070 | phloem protein 2-A8;(source:Araport11) |
| AT1G09155 | phloem protein 2-B15;(source:Araport11) |
| AT2G02250 | phloem protein 2-B2;(source:Araport11) |
| AT2G02300 | phloem protein 2-B5;(source:Araport11) |
| AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
| AT5G39400 | Calcium/lipid-binding (CaLB) phosphatase;(source:Araport11) |
| AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
| AT3G48850 | Encodes a mitochondrial phosphate transporter. Modulates plant responses to salt stress. |
| AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
| AT5G57190 | Encodes the minor form of the two non-mitochondrail phosphatidylserine decarboxylase. The gene expression level is very low. Located at the tonoplast. |
| AT4G25970 | Encodes the major form of the two non-mitochondrail phosphatidylserine decarboxylase. Located at the ER. The mRNA is cell-to-cell mobile. |
| AT1G68750 | Encodes one of four Arabidopsis phosphoenolpyruvate (PEP) carboxylase proteins. But, it is more similar to bacterial PEP carboxylase than plant PEP carboxylase. Efforts to express this enzyme and to demonstrate its enzymatic activity in E.coli failed. |
| AT5G26570 | chloroplastidic phosphoglucan, water dikinase (PWD) which is required for normal degradation of leaf starch in Arabidopsis. NMR analysis of the mutants, suggests that the gene is specifically involved in the phosphorylation of the glucosyl residues of starch at the C3 position. |
| AT5G58670 | phosphatidylinositol-specific phospholipase C is induced to a significant extent under various environmental stresses, such as dehydration, salinity, and low temperature. May play a role in secondary ABA response. There are two genes called ATPLC1, one corresponding to AT4g38530 and one corresponding ot AT5g58670 (this one). |
| AT5G25370 | member of C2-PLD subfamily. Analyses on the gene structures/sequences, overall amino acid sequences, and domain structures indicate that PLDalpha3 is most closely related to other two PLDalphas than to other PLDs. Phylogenetic analysis has not identified a true ortholog for PLDalpha3. Involved in hyperosmotic response. |
| AT4G00240 | member of C2-PLD subfamily |
| AT3G05630 | Encodes a member of the PXPH-PLD subfamily of phospholipase D proteins. Regulates vesicle trafficking. Required for auxin transport and distribution and hence auxin responses. This subfamily is novel structurally different from the majority of plant PLDs by having phox homology (PX) and pleckstrin homology (PH) domains. Involved regulating root development in response to nutrient limitation. Plays a major role in phosphatidic acid production during phosphate deprivation. Induced upon Pi starvation in both shoots and roots. Involved in hydrolyzing phosphatidylcholine and phosphatidylethanolamine to produce diacylglycerol for digalactosyldiacylglycerol synthesis and free Pi to sustain other Pi-requiring processes. Does not appear to be involved in root hair patterning. Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. |
| AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
| AT5G13640 | arabidopsis phospholipid:diacylglycerol acyltransferase (PDAT) |
| AT1G32060 | phosphoribulokinase;(source:Araport11) |
| AT4G03280 | Encodes the Rieske FeS center of cytochrome b6f complex. Gene is expressed in shoot but not in root. Mutant has reduced electron transport at saturating light intensities and Q-cycle activity is hypersensitive to acidification of the thylakoid lumen. The mRNA is cell-to-cell mobile. |
| AT5G43750 | NAD(P)H dehydrogenase 18;(source:Araport11) |
| AT1G55670 | Encodes subunit G of photosystem I, an 11-kDa membrane protein that plays an important role in electron transport between plastocyanin and PSI and is involved in the stability of the PSI complex. PSI-G subunit is bound to PSI-B and is in contact with Lhca1. The protein inserts into thylakoids by a direct or "spontaneous" pathway that does not involve the activities of any known chloroplast protein-targeting machinery. PSI-G appears to be directly or indirectly involved in the interaction between Photosystem I and plastocyanin. |
| AT3G50820 | Encodes a protein which is an extrinsic subunit of photosystem II and which has been proposed to play a central role in stabilization of the catalytic manganese cluster. In Arabidopsis thaliana the PsbO proteins are encoded by two genes: psbO1 and psbO2. PsbO2 is the minor isoform in the wild-type. Mutants defective in this gene have been shown to be affected in the dephosphorylation of the D1 protein of PSII. |
| AT3G45780 | Blue-light photoreceptor. Contains a light activated serine-threonine kinase domain and LOV1 and LOV2 repeats. Mutants are defective in blue-light response. Mediates blue light-induced growth enhancements. PHOT1 and PHOT2 mediate blue light-dependent activation of the plasma membrane H+-ATPase in guard cell protoplasts. PHOT1 undergoes blue-light-dependent autophosphorylation. At least eight phosphorylation sites have been identified in PHOT1. Phosphorylation of serine851 in the activation loop of PHOT1 appears to be required for stomatal opening, chloroplast accumulation, leaf flattening, and phototropism, and phosphorylation of serine849 may also contribute to the regulation of these responses. Phosphorylation-dependent binding of 14-3-3 proteins to the Hinge1 region of PHOT1 appears to require serine350 and serine376. |
| AT3G26830 | Mutations in pad3 are defective in biosynthesis of the indole derived phytoalexin camalexin. Encodes a cytochrome P450 enzyme that catalyzes the conversion of dihydrocamalexic acid to camalexin. The mRNA is cell-to-cell mobile. |
| AT3G16500 | phytochrome-associated protein 1 (PAP1) |
| AT3G59640 | Plasma membrane localized. glycine rich protein of unknown function. Involved in non host resistance. |
| AT1G68450 | VQ motif-containing protein;(source:Araport11) |
| AT5G15100 | Encodes an auxin transporter with a strong expression in a male gametophyte. Mutant studies reveal a role for auxin transport in regulating pollen development and function. It acts together with PIN5. |
| AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
| AT2G43120 | Encodes a member of the functionally diverse cupin protein superfamily that is involved in susceptibility to the bacterial plant pathogen Ralstonia solanacearum. It stabilizes the papain-like cysteine protease XCP2. The mRNA is cell-to-cell mobile. |
| AT5G15120 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
| AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
| AT4G33330 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
| AT1G54940 | Encodes a xylan glucuronosyltransferase. |
| AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
| AT5G42340 | Plant U-box type E3 ubiquitin ligase (PUB). |
| AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
| AT1G23030 | Encodes a plant U-Box protein that is capable of binding and ubiquitinating a variety of targets including MYC2,LRR1,KIN and acting as an E3 ligase. Regulates a number of physiological hormonal and environment al responses via selective degradation of targets.Unlike PUB10, its closest homolog in Arabidopsis, it does not appear to play a major role in the MeJA-mediated response. |
| AT3G04370 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
| AT3G61680 | PLIP1 encodes a plastid localized phospholipase A1 involved in seed oil biosynthesis. |
| AT1G42550 | Encodes a plant-specific protein of unknown function that appears to be conserved among angiosperms. The mRNA is cell-to-cell mobile. |
| AT3G09210 | plastid transcriptionally active 13;(source:Araport11) |
| AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
| AT1G76100 | One of two Arabidopsis plastocyanin genes. Expressed at 1/10th level of PETE2. Does not respond to increased copper levels and is thought to be the isoform that participates in electron transport under copper-limiting conditions. Mutation of this gene does not have obvious effect on photosynthesis. |
| AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
| AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
| AT3G42880 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT1G50610 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
| AT5G20690 | PRK6 is pollen specific receptor kinase that functions as a receptor for the pollen attractant LURE1 in pollen tube guidance. It is localized to the tip the pollen tube and becomes asymmetrically distributed towards the source of the LURE1 signal prior to pollen tube growth reorientation. |
| AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
| AT1G34140 | polyadenylate-binding protein, putative / PABP, putative, non-consensus splice donor TA at exon 1; similar to polyadenylate-binding protein (poly(A)-binding protein) from (Triticum aestivum) GI:1737492, (Nicotiana tabacum) GI:7673355, {Arabidopsis thaliana} SP:P42731; contains InterPro entry IPR000504: RNA-binding region RNP-1 (RNA recognition motif) (RRM). Only member of the class IV PABP family. |
| AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
| AT5G22470 | PARP3 is one of three canonical PARPs in Arabidopsis. |
| AT2G43020 | Encodes a polyamine oxidase. |
| AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
| AT1G56710 | Pectin lyase-like superfamily protein;(source:Araport11) |
| AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
| AT4G36670 | Major facilitator superfamily protein;(source:Araport11) |
| AT3G47640 | Encodes POPEYE (PYE), a bHLH transcription factor regulating response to iron deficiency in Arabidopsis roots. |
| AT4G28460 | Activates immune responses through RECEPTOR-LIKE KINASE7 (RLK7). Induces stomatal closure is dependent on RLK7 and the transcription of genes involved in SA production and SA-dependent stomatal closure. SA promotes the flg22-induced expression of PIP1 preligand, prePIP1. |
| AT1G17700 | prenylated RAB acceptor 1.F1;(source:Araport11) |
| AT5G58750 | Putative PRISE (progesterone 5β-reductase and/or iridoid synthase-like 1,4-enone reductases). |
| AT5G14300 | prohibitin 5;(source:Araport11) |
| AT1G10620 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT4G32710 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G49270 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
| AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
| AT2G44830 | AGCVIII kinase involved in the pulse-induced first positive phototropism. Plasma-membrane-associated element of a molecular rheostat that modulates auxin flux through developing protophloem sieve elements (PPSEs) while interacting with BRX, thereby timing PPSE differentiation. Activates PIN-mediated auxin efflux. |
| AT5G54190 | light-dependent NADPH:protochlorophyllide oxidoreductase A |
| AT4G27440 | light-dependent NADPH:protochlorophyllide oxidoreductase B The mRNA is cell-to-cell mobile. |
| AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
| AT5G52420 | transmembrane protein;(source:Araport11) |
| AT1G30755 | elongation factor G, putative (DUF668);(source:Araport11) |
| AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G43110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT5G60110 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G01410 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT1G78160 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
| AT4G18190 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
| AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
| AT5G57140 | purple acid phosphatase 28;(source:Araport11) |
| AT1G56360 | purple acid phosphatase 6;(source:Araport11) |
| AT2G01880 | PEP complex component. |
| AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
| AT3G27860 | Tudor/PWWP/MBT superfamily protein;(source:Araport11) |
| AT3G08860 | Encodes a protein that is predicted to have beta-alanine aminotransferase activity. |
| AT4G15530 | Encodes a dual-targeted protein believed to act as a pyruvate, orthophosphate dikinase. These enzymes are normally associated with C4 photosynthesis which does not occur in Arabidopsis. However, PPDK may play a role in remobilizing nitrogen during leaf senescence in Arabidopsis. The product of the long transcript (.1 gene model) was shown to be targeted to the chloroplast, whereas the shorter transcript (no targeting sequence) accumulates in the cytosol. The two proteins were also found to be expressed in slightly different tissues. |
| AT3G25140 | Quasimodo1, encodes a glycosyltransferase, involved in homogalacturonan biosynthesis; mutant shows cell adhesion defect and lower wall uronic acid content. The mRNA is cell-to-cell mobile. |
| AT2G01350 | At2g01350 encodes quinolinate phosphoribosyl transferase involved in NAD biosynthesis as shown by heterologous expression in E. coli. |
| AT2G24070 | QWRF motif protein (DUF566);(source:Araport11) |
| AT5G09550 | GDP dissociation inhibitor family protein / Rab GTPase activator family protein;(source:Araport11) |
| AT2G21880 | RAB GTPase homolog 7A;(source:Araport11) |
| AT2G33775 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
| AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
| AT3G16570 | Encodes RALF23, a member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF23 is significantly downregulated by brassinolide treatment of seedlings. Overexpression of AtRALF23 impairs brassinolide-induced hypocotyls elongation, and mature overexpressing plants are shorter and bushier. RALF23 overexpression produces slower growing seedlings with roots that have reduced capacity to acidify the rhizosphere. |
| AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
| AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
| AT1G17240 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. |
| AT2G25440 | receptor like protein 20;(source:Araport11) |
| AT2G25470 | receptor like protein 21;(source:Araport11) |
| AT2G32660 | receptor like protein 22;(source:Araport11) |
| AT3G23010 | receptor like protein 36;(source:Araport11) |
| AT4G13900 | pseudogene of receptor like protein 47;(source:Araport11) |
| AT4G13920 | receptor like protein 50;(source:Araport11) |
| AT5G45770 | receptor like protein 55;(source:Araport11) |
| AT1G48480 | Arabidopsis thaliana receptor-like protein kinase (RKL1) gene |
| AT5G60900 | Encodes a receptor-like protein kinase. |
| AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
| AT5G46340 | Encodes a homolog of the protein Cas1p known to be involved in polysaccharide O-acetylation in Cryptococcus neoformans. Has high similarity to RWA2 whose mutant displays reduced acetylation. The protein is expressed in the Golgi and is involved in the acetylation of xylan during secondary wall biosynthesis. |
| AT1G20920 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G01360 | Encodes RCAR1 (regulatory components of ABA receptor). Interacts with and regulates the type 2C protein phosphatases (PP2Cs) ABI1 and ABI2. Functions as abscisic acid sensor. The mRNA is cell-to-cell mobile. |
| AT5G22010 | Encodes RFC1, the largest subunit of replication factor C. Mediates genomic stability and transcriptional gene silencing. |
| AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
| AT4G31620 | Encodes a member of the REM (Reproductive Meristem) gene family, a part of the B3 DNA-binding domain superfamily. |
| AT1G74810 | HCO3- transporter family;(source:Araport11) |
| AT1G64070 | Encodes a TIR-NBS-LRR class of disease resistance protein effective against Leptosphaeria maculans. |
| AT5G54640 | Isolated from T-DNA insertion line, the rat5 mutant is deficient in T-DNA integration. Encodes histone2A protein. |
| AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
| AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT3G45810 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
| AT3G62670 | member of Response Regulator: B- Type |
| AT4G39090 | Similar to cysteine proteinases, induced by desiccation but not abscisic acid. Required for RRS1-R mediated resistance against Ralstonia solanacearum. Interacts with the R. solanacearum type III effector PopP2. RD19 associates with PopP2 to form a nuclear complex that is required for activation of the RRS1-R?mediated resistance response. |
| AT4G28430 | Reticulon family protein;(source:Araport11) |
| AT2G46170 | Reticulon family protein;(source:Araport11) |
| AT4G01230 | Reticulon family protein. Mutants are resistant to agrobacterium infection. |
| AT1G19530 | Direct target of RGA, plays an essential role in GA-mediated tapetum and pollen development. |
| AT5G17490 | Encodes a DELLA subfamily member that acts as a negative regulator of GA signaling and as a coactivator of ABI3 to promote seed storage protein biosynthesis during the seed maturation stage. |
| AT1G79850 | nuclear-encoded 30S chloroplast ribosomal protein S17 |
| AT1G67090 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT3G43750 | E3 ubiquitin ligases, member of the RING between RING fingers (RBR)-type RSL1/RFA family, are key regulators of ABA receptor stability in root and leaf tissues, targeting ABA receptors for degradation in different subcellular locations. |
| AT3G45480 | RING/U-box protein with C6HC-type zinc finger;(source:Araport11) |
| AT1G29720 | Encodes one of three RECEPTOR-LIKE KINASE IN FLOWERS 1 (RKF1) paralogues that is required in the stigmatic papillae and the female reproductive tract to promote compatible pollen grain hydration and pollen tube growth. |
| AT2G42520 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
| AT1G58470 | Encodes an mRNA-binding protein that contains two RNA recognition motifs (RRMs) and is expressed in proliferating tissues. Preferentially binds UUAGG, GUAGG and/or UUAGU. Loss of function of RBP1 causes decreased root length. |
| AT4G00660 | RNAhelicase-like 8;(source:Araport11) |
| AT3G10710 | root hair specific 12;(source:Araport11) |
| AT4G38390 | root hair specific 17;(source:Araport11) |
| AT5G22410 | root hair specific 18;(source:Araport11) |
| AT1G05990 | EF hand calcium-binding protein family;(source:Araport11) |
| AT3G16130 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
| AT3G24620 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT4G13240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
| AT5G10520 | ROP binding protein kinases 1;(source:Araport11) |
| AT3G11490 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
| AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT5G60210 | Encodes RIP5 (ROP interactive partner 5), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
| AT1G04450 | Encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). It interacts with Rop1 and is involved in pollen tube growth and function, and exocytosis in the pollen tube tip. The protein most similar to RIC1 (family subgroup III). Gene is expressed predominantly in inflorescence and flower tissue. Interacts with ROP1 to modulate calcium ion influxes required to generate tip-focused calcium gradients.It |
| AT3G23380 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Interacts with Rop1 and is involved in pollen tube growth and function. Gene is expressed predominantly in inflorescence and flower tissue. |
| AT1G68825 | ROTUNDIFOLIA like 15;(source:Araport11) |
| AT5G38410 | Encodes a member of the Rubisco small subunit (RBCS) multigene family: RBCS1A (At1g67090), RBCS1B (At5g38430), RBCS2B (At5g38420), and RBCS3B (At5g38410). Functions to yield sufficient Rubisco content for leaf photosynthetic capacity. |
| AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
| AT4G32300 | S-domain-2 5;(source:Araport11) |
| AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
| AT5G24270 | encodes a calcium sensor that is essential for K+ nutrition, K+/Na+ selectivity, and salt tolerance. The protein is similar to calcineurin B. Lines carrying recessive mutations are hypersensitive to Na+ and Li+ stresses and is unable to grow in low K+. The growth defect is rescued by extracellular calcium. |
| AT1G15215 | Encodes SHH1, a homeodomain protein required for DNA methylation. It is an atypical RNA-directed DNA methylation component, and functions in transcriptional silencing through both DNA methylation-dependent and -independent pathways. |
| AT1G07530 | Encodes a member of the GRAS family of transcription factors. The protein interacts with the TGA2 transcription factor and affects the transcription of stress-responsive genes. The protein is found in the nucleus and is also exported to the cytoplasm. |
| AT1G63100 | Transcription factor belonging to the GRAS family which controls the mitotic cell cycle and division plane orientation. |
| AT5G51110 | Encodes a protein involved in Rubisco assembly that also mediates Abscisic acid-dependent stress response. It is a ubiquitination target of the intracellular E3 ligase SDIR1. It selectively regulates the expression of the downstream basic region/leucine zipper motif transcription factor gene ABA-INSENSITIVE5, rather than ABA-RESPONSIVE ELEMENTS BINDING FACTOR3 (ABF3) or ABF4, to regulate ABA-mediated seed germination and the plant salt response. |
| AT2G34380 | Membrane protein involved in lipid droplet biogenesis primarily in pollen. The interaction between VAP27-1 and SEIPIN3 requires the N-terminal 25 amino acids of SEIPIN3 that contain an FFAT motif. |
| AT3G23800 | selenium-binding protein 3;(source:Araport11) |
| AT2G29350 | Encodes a senescence associated protein required for resistance against fungal pathogens. Negative regulator of defense against bacterial pathogens. Induced by ROS. Required for defense against ROS and fungal pathogens most likely by activating anthocyanin biosynthesis. |
| AT5G56760 | Encodes a cytosolic serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. |
| AT2G23000 | serine carboxypeptidase-like 10;(source:Araport11) |
| AT2G24010 | serine carboxypeptidase-like 23;(source:Araport11) |
| AT4G30810 | serine carboxypeptidase-like 29;(source:Araport11) |
| AT2G33530 | serine carboxypeptidase-like 46;(source:Araport11) |
| AT5G22980 | serine carboxypeptidase-like 47;(source:Araport11) |
| AT2G14540 | serpin 2;(source:Araport11) |
| AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
| AT5G14640 | shaggy-like kinase 13;(source:Araport11) |
| AT1G57870 | shaggy-like kinase 42;(source:Araport11) |
| AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
| AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
| AT1G31480 | encodes a novel protein that may be part of a gene family represented by bovine phosphatidic acid-preferring phospholipase A1 (PA-PLA1)containing a putative transmembrane domain. SGR2 is involved in the formation and function of the vacuole. |
| AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
| AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
| AT2G18330 | AAA-type ATPase family protein;(source:Araport11) |
| AT5G58170 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
| AT5G04470 | Encodes a novel nuclear 14-kD protein containing a cyclin binding motif and a motif found in ICK/KRP cell cycle inhibitor proteins. It is required for coordinating cell division and cell differentiation during the development of Arabidopsis trichomes, playing a key role in the mitosis-to-endoreduplication transition. It interacts with D-type cyclins in vivo. |
| AT3G01670 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT3G01680 | Encodes a protein localized to phloem filaments that is required for phloem filament formation. The mRNA is cell-to-cell mobile. |
| AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
| AT5G15020 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). |
| AT5G57900 | F-box protein, interacts with SKP1/ASK1 subunit of SCF ubiquitin ligase in a glucose-dependent manner |
| AT2G03160 | SKP1-like 19;(source:Araport11) |
| AT3G61415 | SKP1-like 21;(source:Araport11) |
| AT2G23630 | SKU5 similar 16;(source:Araport11) |
| AT4G22010 | SKU5 similar 4;(source:Araport11) |
| AT1G21850 | SKU5 similar 8;(source:Araport11) |
| AT4G27970 | Encodes a protein with ten predicted transmembrane helices. The SLAH2 protein has similarity to the SLAC1 protein involved in ion homeostasis in guard cells. But, it is not expressed in guard cells and cannot complement a slac1-2 mutant suggesting that it performs a different function. SLAH2:GFP localizes to the plasma membrane. |
| AT5G08490 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
| AT5G18010 | Encodes SAUR19 (small auxin up RNA 19). Note that TAIR nomenclature is based on Plant Mol Biol. 2002, 49:373-85 (PMID:12036261). In Planta (2011) 233:1223?1235 (PMID:21327815), At5g18010 is SAUR24. |
| AT5G18030 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT4G38860 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT5G42410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT3G20220 | SAUR-like auxin-responsive protein family;(source:Araport11) |
| AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
| AT2G29970 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. The mRNA is cell-to-cell mobile. |
| AT2G40130 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
| AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
| AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
| AT2G19070 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091). BAHD acyltransferase. Uses hydroxycinnamoyl CoAs, including caffeoyl/feruoyl/p-coumaroyl/sinapoyl-CoA as acyl donors to fully substitute the N1, N5, and N10 positions of spermidine. |
| AT4G37760 | squalene epoxidase 3;(source:Araport11) |
| AT1G02065 | Encodes an SBP-box gene, a member of the SPL gene family. Mutants are affected in micro- and megasporogenesis, trichome formation on sepals, and stamen filament elongation. |
| AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
| AT4G12040 | A20/AN1-like zinc finger family protein;(source:Araport11) |
| AT2G41290 | Although this enzyme is predicted to encode a strictosidine synthase (SS), it lacks a conserved catalytic glutamate residue found in active SS enzymes and it is not expected to have SS activity. |
| AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
| AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
| AT3G51060 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. STY1/STY2 double mutants showed defective style, stigma as well as serrated leaves. Binds to the promoter of YUC4 and YUC8 (binding site ACTCTAC) |
| AT4G36260 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Encodes protein with a single zinc finger motif and a members of a small gene family of putative transcription factors in which the SHORT INTERNODES (SHI) gene is found. STY2/STY1 double mutants showed defective style, stigma as well as serrated leaves. |
| AT4G13460 | Encodes a SU(VAR)3-9 homolog, a SET domain protein. Known SET domain proteins are involved in epigenetic control of gene expression and act as histone methyltransferases. There are 10 SUVH genes in Arabidopsis and members of this subfamily of the SET proteins have an additional conserved SRA domain. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
| AT4G21650 | Subtilase family protein;(source:Araport11) |
| AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
| AT5G59090 | subtilase 4.12;(source:Araport11) |
| AT5G67090 | Encodes a subtilisin-like serine protease with in vitro protease activity. |
| AT4G02280 | Encodes a protein with sucrose synthase activity (SUS3). It appears to be important for sucrose metabolism in developing seeds, especially during the late maturation phase, about 18 days after flowering. |
| AT5G26250 | Sugar transporter expressed strongly in pollen and pollen tubes. |
| AT3G05960 | Encodes a hexose sugar transporter that is expressed in pollen. STP6 may play a role in providing sugars during late pollen maturation or pollen tube germination. |
| AT3G10370 | mitochondrial FAD-dependent glycerol-3-phosphate dehydrogenase. possibly involved in storage lipid catabolism and glycerol assimilation, and in glycerol-3-phosphate shuttle which transports reducing power from cytosol to mitochondrion. |
| AT1G22150 | sulfate transporter Sultr1;3 |
| AT3G55880 | A gain-of-function mutant of SUE4 exhibited improved low sulphur tolerance. |
| AT3G23130 | Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants. |
| AT1G48510 | Encodes one of two Arabidopsis mitochondrial proteins similar to human SURF1 which is known to be involved in cytochrome c oxidase assembly. Mutations result in defects in hypocotyl elongation and changes in GA homeostasis. |
| AT2G18260 | member of SYP11 Gene Family |
| AT1G11250 | member of SYP12 Gene Family |
| AT3G03800 | member of SYP13 Gene Family |
| AT5G05760 | A SNARE protein (ortholog of syntaxin 5), a membrane fusion machine component involved in cytokinesis |
| AT5G44260 | Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs). |
| AT4G20280 | Encodes TAF11, a putative TBP-associated factor (TBP: TATA binding protein). |
| AT5G23960 | Encodes a sesquiterpene synthase involved in generating all of the group A sesquiterpenes found in the Arabidopsis floral volatile blend. Strongly expressed in the stigma. |
| AT2G01960 | Member of TETRASPANIN family |
| AT3G17880 | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
| AT1G78120 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G10090 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT5G65160 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
| AT1G53300 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
| AT5G06839 | bZIP transcription factor family protein;(source:Araport11) |
| AT1G75030 | encodes a PR5-like protein |
| AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
| AT5G23070 | Encodes a thymidine kinase that salvages DNA precursors. The pyrimidine salvage pathway is crucial for chloroplast development and genome replication, as well as for the maintenance of its integrity. |
| AT3G54670 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
| AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
| AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
| AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
| AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
| AT1G20350 | mitochondrial inner membrane translocase |
| AT1G55130 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. |
| AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
| AT5G13930 | Encodes chalcone synthase (CHS), a key enzyme involved in the biosynthesis of flavonoids. Required for the accumulation of purple anthocyanins in leaves and stems. Also involved in the regulation of auxin transport and the modulation of root gravitropism. The mRNA is cell-to-cell mobile. |
| AT2G37260 | Encodes a protein similar to WRKY transcription factors that is expressed in the seed integument and endosperm. Mutants are defective in proanthocyanidin synthesis and seed mucilate deposition. Seeds are yellow colored. Seed size is also affected; seeds are reduced in size but only when the mutant allele is transmitted through the female parent.Loss of function alleles are associated with a reduction in interploidy lethality. |
| AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
| AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
| AT5G53770 | Nucleotidyltransferase family protein;(source:Araport11) |
| AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT3G28150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. A putative xyloglucan O-acetyltransferase. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G01080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. Functions as a mannan O-acetyltransferase, catalyzing the 2-O and 3-O-monoacetylation of mannosyl residues A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT5G01360 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The dwarf phenotype can only be seen in tbl3 tbl31 esk1 triple mutant. tbl3 and tbl31 are specifically involved in 3-O-monoacetylation of xylan. |
| AT5G49340 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
| AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
| AT5G23860 | beta-tubulin, preferentially expressed in endodermal and phloem cells of primary roots and in the vascular tissues of leaves, stems, and flowers. The mRNA is cell-to-cell mobile. |
| AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
| AT5G53970 | Encodes a cytosolic tyrosine aminotransferase which is strongly induced upon aging and coronatine treatment. AtTAT1 prefers Tyr as an amino donor but can also use Phe, Trp, His, Met, and Leu. The mRNA is cell-to-cell mobile. |
| AT3G57765 | encodes a small nuclear RNA, which is a part of small nuclear ribonuclear particle (snRNP) and is involved in RNA processing such as splicing and polyadenylation. |
| AT5G46315 | U6-29;(source:Araport11) |
| AT5G53300 | Encodes a ubiquitin conjugating enzyme. |
| AT1G75440 | ubiquitin-conjugating enzyme 16;(source:Araport11) |
| AT4G31670 | ubiquitin-specific protease 18;(source:Araport11) |
| AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
| AT3G60280 | Encodes blue copper-binding protein III. |
| AT3G23820 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. The mRNA is cell-to-cell mobile. |
| AT5G54060 | Encodes a anthocyanin 3-O-glucoside: 2"-O-xylosyl-transferase involved in anthocyanin modification that converts cyanidin 3-O-glucoside to cyanidin 3-O-xylosyl(1->2)glucoside. Its preferred sugar donor is UDP-xylose. |
| AT3G21800 | UDP-glucosyl transferase 71B8;(source:Araport11) |
| AT3G53150 | UDP-glucosyl transferase 73D1;(source:Araport11) |
| AT5G05870 | UDP-glucosyl transferase 76C1;(source:Araport11) |
| AT5G05880 | Encodes a nicotinate-N-glycosyltransferase. |
| AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
| AT3G46660 | UDP-glucosyl transferase 76E12;(source:Araport11) |
| AT5G17030 | UDP-glucosyl transferase 78D3;(source:Araport11) |
| AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
| AT5G59290 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. This enzyme produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
| AT2G43840 | UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside), benzoic acid, quercetin, and athranilate in vitro. UGT74F1 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. The true biological substrate(s) of UGT74F1 are not known, but mutant plants lacking UGT74F1 have a decreased level of salicylate glucoside. |
| AT5G54010 | Encodes a flavonoid 3-O-glucoside:2″-O-glucosyltransferase that determines pollen-specific flavonol structure. |
| AT1G06890 | UXT3 is a member of the NST-KT subfamily of nucleotide/sugar transporters. It is localized to the golgi and functions as a UDP-Xyl transporter. |
| AT4G12860 | EF hand calcium-binding protein family;(source:Araport11) |
| AT1G51170 | Encodes an active AGC VIII protein kinase that interacts with the putative transcription factor ATS and regulates planar growth during integument development in the ovule. Mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. |
| AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
| AT1G30950 | Required for the proper identity of the floral meristem. Involved in establishing the whorled pattern of floral organs, in the control of specification of the floral meristem, and in the activation of APETALA3 and PISTILLATA. UFO is found at the AP3 promoter in a LFY-dependent manner, suggesting that it works with LFY to regulate AP3 expression. UFO may also promote the ubiquitylation of LFY. |
| AT3G53900 | Encodes UPP, a plastidial uracil phosphoribosyltransferase (UPRT) involved in uracil salvage. Loss-of-function mutation causes dramatic growth retardation, a pale-green to albino phenotype, abnormal root morphology and chloroplastic disorders. |
| AT1G05680 | Encodes a UDP-glucosyltransferase, UGT74E2, that acts on IBA (indole-3-butyric acid) and affects auxin homeostasis. The transcript and protein levels of this enzyme are strongly induced by H2O2 and may allow integration of ROS (reactive oxygen species) and auxin signaling. This enzyme can also transfer glycosyl groups to several compounds related to the explosive TNT when this synthetic compound is taken up from the environment. |
| AT2G37450 | nodulin MtN21-like transporter family protein |
| AT1G09380 | nodulin MtN21-like transporter family protein |
| AT4G30420 | nodulin MtN21-like transporter family protein |
| AT1G60050 | nodulin MtN21-like transporter family protein |
| AT4G16620 | nodulin MtN21-like transporter family protein |
| AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
| AT2G01770 | Encodes an iron transporter required for iron sequestration into vacuoles. Expressed in developing embryo and seed. Localized in the vacuolar membrane. |
| AT1G21140 | The gene encodes nodulin-like1 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
| AT1G76800 | The gene encodes nodulin-like2 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
| AT4G21560 | vacuolar protein sorting-associated protein-like protein;(source:Araport11) |
| AT2G30290 | VACUOLAR SORTING RECEPTOR 2;(source:Araport11) |
| AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
| AT2G17740 | VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development. |
| AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
| AT1G79620 | VRLK1 is a LRR kinase involved in switching between cell elongation and secondary cell wall thickening.VRLK1 is a member of a gene family that includes a small number of recently duplicated paralogs. |
| AT3G21710 | transmembrane protein;(source:Araport11) |
| AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
| AT2G18880 | vernalization5/VIN3-like protein;(source:Araport11) |
| AT4G37710 | VQ motif-containing protein;(source:Araport11) |
| AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
| AT1G21240 | encodes a wall-associated kinase The mRNA is cell-to-cell mobile. |
| AT1G21210 | cell wall-associated ser/thr kinase involved in cell elongation and lateral root development |
| AT2G22680 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
| AT5G28646 | Encodes a novel protein. The wvd2 gain-of-function mutant has impaired cell expansion and root waving, and changed root skewing. |
| AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
| AT1G55600 | member of WRKY Transcription Factor; Group I. It has WRKY domain at its N terminal end and zinc-finger like motif. |
| AT4G22070 | member of WRKY Transcription Factor; Group II-b |
| AT3G01080 | member of WRKY Transcription Factor; Group I |
| AT1G18860 | member of WRKY Transcription Factor; Group II-b |
| AT1G29280 | member of WRKY Transcription Factor; Group II-e The mRNA is cell-to-cell mobile. |
| AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
| AT1G68150 | member of WRKY Transcription Factor; Group II-b The mRNA is cell-to-cell mobile. |
| AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
| AT1G20700 | Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
| AT5G49660 | The gene encodes receptorlike kinase (RLK). Involved in the maintenance organization of cell files or cell morphology in conductive elements. Functions as a receptor for CEP1 peptide. Mediates nitrate uptake signaling. |
| AT5G57530 | xyloglucan endotransglucosylase/hydrolase 12;(source:Araport11) |
| AT4G30270 | encodes a protein similar to endo xyloglucan transferase in sequence. It is also very similar to BRU1 in soybean, which is involved in brassinosteroid response. |
| AT4G24120 | Member of a small family of oligopeptide transporters similar to the yellow stripe locus of maize (ZmYS1). |
| AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
| AT4G06634 | Encodes an ABA responsive C2H2-type zinc finger transcription factor with both transcriptional repression and activation domains, that binds a G-rich, 11-bp DNA-binding motif. YY1 binds to the promoter of ABR1 and disruption represses ABA- and salt-induced ABR1 expression. |
| AT4G30260 | Encodes one of the two YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b (formerly YIP2), which form a TGN-localized complex with ECHIDNA (ECH). This complex is required for the secretion of cell wall polysaccharides. |
| AT1G48910 | A paternally expressed imprinted gene. |
| AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
| AT1G04180 | YUCCA 9;(source:Araport11) |
| AT2G32930 | Encodes a zinc finger protein. |
| AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
| AT1G66140 | Encodes a zinc finger protein containing only a single zinc finger. |
| AT1G31260 | member of Fe(II) transporter isolog family |
| AT2G32270 | A member of Zrt- and Irt-related protein (ZIP) family. transcript is induced in response to zinc deficiency in the root. also response to iron deficiency. |
| AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
| AT5G61350 | Encodes a membrane-localized receptor-like kinase that regulates root hair tip growth by maintaining cytoplasmic Ca2+ gradients. Knockouts of CAP1 produced more cytoplasmic NH4+ and ceased growth of root hairs on MS medium except when NH4+ was depleted; NH4+ depletion reestablished the Ca2+ gradient necessary for normal growth. The lower net NH4+ influx across the vacuolar membrane and relatively alkaline cytosolic pH of root hairs in cap1-1 relative to wild type implied that mutation of CAP1 results in more NH4+ accumulation in the cytoplasm. Furthermore, CAP1 functionally complemented npr1 kinase yeast mutant defective in high-affinity NH4+ uptake via MEP2, distinguishing CAP1 as a cytosolic modulator of NH4+ level that participates in NH4+ homeostasis-regulated root hair growth by modulating tip-focused cytoplasmic Ca2+ gradients. |