AT1G44760 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT3G14280 | LL-diaminopimelate aminotransferase;(source:Araport11) |
AT5G33415 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 40%25 identity and 1.9e-148 P-value to GP|14140286|gb|AAK54292.1|AC034258_10|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT5G35240 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative transposable element, blastp match of 47%25 identity and 9.3e-52 P-value to GP|13122426|dbj|BAB32907.1||AP003047 putative transposable element {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G15640 | F-box family protein;(source:Araport11) |
AT2G42140 | VQ motif-containing protein;(source:Araport11) |
AT3G55840 | Hs1pro-1 protein;(source:Araport11) |
AT5G52850 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G11330 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 5.3e-78 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G48640 | transmembrane protein;(source:Araport11) |
AT4G09090 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT5G38020 | encodes a protein whose sequence is similar to SAM:salicylic acid carboxyl methyltransferase (SAMT) (GI:6002712)(Clarkia breweri) and to SAM:benzoic acid carboxyl methyltransferase (BAMT)(GI:9789277)(Antirrhinum majus). SABATH family methyltransferase. |
AT3G15630 | plant/protein;(source:Araport11) |
AT2G15650 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.0e-227 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT4G00300 | AT4G00300 has been split into two loci based on new cDNA evidence provided by Aleksander Riise Hansen of University of Copenhagen: AT4G00300.2 becomes AT4G00300.1; a new locus AT4G00295 is created. See comments field for AT4G00295 annotation. |
AT4G08406 | transmembrane protein;(source:Araport11) |
AT4G03020 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT3G02500 | mental retardation GTPase activating protein;(source:Araport11) |
AT3G42780 | hypothetical protein;(source:Araport11) |
AT1G09980 | Putative serine esterase family protein;(source:Araport11) |
AT1G74820 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT1G03370 | C2 calcium/lipid-binding and GRAM domain containing protein;(source:Araport11) |
AT4G03420 | hypothetical protein (DUF789);(source:Araport11) |
AT1G67060 | peptidase M50B-like protein;(source:Araport11) |
AT3G58330 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT3G32917 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.0e-114 P-value blast match to GB:AAD27547 polyprotein (Gypsy_Ty3-element) (Oryza sativa subsp. indica);(source:TAIR10) |
AT3G46170 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G07580 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT3G17070 | Peroxidase family protein;(source:Araport11) |
AT1G51270 | vesicle-associated protein 1-4;(source:Araport11) |
AT3G14025 | pseudogene of scarecrow transcription factor family protein |
AT3G48235 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
AT3G60940 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT3G47800 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT1G31355 | pseudogene of Translation protein SH3-like family protein;(source:Araport11) |
AT4G31875 | hypothetical protein;(source:Araport11) |
AT3G58090 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT5G51400 | PLAC8 family protein;(source:Araport11) |
AT1G70780 | hypothetical protein;(source:Araport11) |
AT2G44600 | hypothetical protein;(source:Araport11) |
AT5G18590 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G40920 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G33200 | transposable_element_gene;(source:Araport11);pseudogene, similar to SAE1-S9-protein, blastp match of 28%25 identity and 4.2e-16 P-value to GP|4760708|dbj|BAA77394.1||AB012866 SAE1-S9-protein {Brassica rapa};(source:TAIR10) |
AT4G03460 | Ankyrin repeat family protein;(source:Araport11) |
AT5G53910 | RING/U-box superfamily protein;(source:Araport11) |
AT3G13500 | hypothetical protein;(source:Araport11) |
AT1G30550 | S-adenosyl-L-methionine-dependent methyltransferase superfamily protein;(source:Araport11) |
AT3G24518 | Natural antisense transcript overlaps with AT3G24520;(source:Araport11) |
AT1G17300 | hypothetical protein;(source:Araport11) |
AT3G04470 | Ankyrin repeat family protein;(source:Araport11) |
AT1G43005 | F-box/associated interaction domain protein;(source:Araport11) |
AT3G03828 | transmembrane protein;(source:Araport11) |
AT3G27845 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G56140 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT5G11220 | hypothetical protein;(source:Araport11) |
AT3G20650 | mRNA capping enzyme family protein;(source:Araport11) |
AT1G55365 | hypothetical protein;(source:Araport11) |
AT3G14470 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT1G47480 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G42930 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G02440 | transmembrane protein;(source:Araport11) |
AT3G63240 | DNAse I-like superfamily protein;(source:Araport11) |
AT3G43200 | pseudogene of target of trans acting-siR480/255 protein;(source:Araport11) |
AT3G46690 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G21840 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G11490 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT2G42020 | pre-tRNA tRNA-Ser (anticodon: GCT);(source:Araport11, TAIR10) |
AT1G04680 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G55350 | MBOAT (membrane bound O-acyl transferase) family protein;(source:Araport11) |
AT5G44090 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G54680 | proteophosphoglycan-like protein;(source:Araport11) |
AT4G10730 | Protein kinase superfamily protein |
AT4G35500 | Protein kinase superfamily protein;(source:Araport11) |
AT1G31840 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G31540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G04645 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G19050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G40020 | Myosin heavy chain-related protein;(source:Araport11) |
AT2G27420 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT1G52130 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G09670 | loricrin-like protein;(source:Araport11) |
AT2G33900 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G51620 | Protein kinase superfamily protein;(source:Araport11) |
AT3G11405 | hypothetical protein;(source:Araport11) |
AT2G17490 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.3e-199 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G61710 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G70720 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G13250 | RING finger protein;(source:Araport11) |
AT1G61730 | DNA-binding storekeeper protein-related transcriptional regulator;(source:Araport11) |
AT2G24480 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT2G29010 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G15700 | Nucleus encoded plastid RNA polymerase. Localized in mitochondria and chloroplast. |
AT3G22845 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G35210 | hypothetical protein;(source:Araport11) |
AT5G63700 | zinc ion binding / DNA binding protein;(source:Araport11) |
AT3G43420 | hypothetical protein;(source:Araport11) |
AT3G16900 | LURP-one-like protein (DUF567);(source:Araport11) |
AT1G05170 | Galactosyltransferase family protein;(source:Araport11) |
AT3G55672 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G28980 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G05010 | clathrin adaptor complexes medium subunit family protein;(source:Araport11) |
AT2G28710 | C2H2-type zinc finger family protein;(source:Araport11) |
AT3G54460 | SNF2 domain-containing protein / helicase domain-containing protein / F-box family protein;(source:Araport11) |
AT1G10310 | encodes a NADPH-dependent pterin aldehyde reductase that accepts pterin aldehyde as well as dihydropterin aldehyde as substrates involved in metabolism and salvage of folate and its derivatives. |
AT5G02920 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G15750 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G06845.1);(source:TAIR10) |
AT1G34044 | pseudogene of 50S ribosomal protein L34;(source:Araport11) |
AT5G54460 | wound-responsive protein-like protein;(source:Araport11) |
AT1G61900 | hypothetical protein;(source:Araport11) |
AT1G07476 | transmembrane protein;(source:Araport11) |
AT5G60760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G08010 | hypothetical protein;(source:Araport11) |
AT1G34570 | Essential protein Yae1, N-terminal;(source:Araport11) |
AT3G31909 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.0e-54 P-value blast match to Q9S9L1 /206-367 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G53050 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
AT5G35860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G38037.1);(source:TAIR10) |
AT5G50140 | Ankyrin repeat family protein;(source:Araport11) |
AT4G20470 | transmembrane protein;(source:Araport11) |
AT3G44805 | TRAF-like superfamily protein;(source:Araport11) |
AT2G43210 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT5G03775 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT1G58410 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT3G30390 | Encodes a putative amino acid transporter. |
AT3G54520 | hypothetical protein;(source:Araport11) |
AT3G56230 | BTB/POZ domain-containing protein;(source:Araport11) |
AT2G16660 | Major facilitator superfamily protein;(source:Araport11) |
AT1G37037 | transposable_element_gene;(source:Araport11) |
AT3G62630 | stress response NST1-like protein (DUF1645);(source:Araport11) |
AT4G17650 | Polyketide cyclase / dehydrase and lipid transport protein;(source:Araport11) |
AT2G40745 | hypothetical protein;(source:Araport11) |
AT5G35460 | membrane protein;(source:Araport11) |
AT5G27925 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.0e-249 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G07260 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT4G23970 | hypothetical protein;(source:Araport11) |
AT3G58630 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT1G24320 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
AT1G10350 | DNAJ heat shock family protein;(source:Araport11) |
AT5G58150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G33910 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G44850 | Protein kinase superfamily protein;(source:Araport11) |
AT5G41100 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G01200 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G03580 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G32435 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase GI:4335720 from (Arabidopsis thaliana);(source:TAIR10) |
AT2G36700 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G07483 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 7.6e-13 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT4G38370 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT5G10830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G20135 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G64550 | loricrin-like protein;(source:Araport11) |
AT4G01210 | glycosyl transferase family 1 protein;(source:Araport11) |
AT3G57120 | Protein kinase superfamily protein;(source:Araport11) |
AT5G08680 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
AT3G45790 | Protein kinase superfamily protein;(source:Araport11) |
AT4G15030 | folate-sensitive fragile site protein;(source:Araport11) |
AT1G23270 | hypothetical protein;(source:Araport11) |
AT3G01980 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G03920 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.1e-40 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G04972 | hypothetical protein;(source:Araport11) |
AT4G38950 | ATP binding microtubule motor family protein;(source:Araport11) |
AT3G24460 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT2G42110 | hypothetical protein;(source:Araport11) |
AT5G55100 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
AT4G13615 | Uncharacterized protein family SERF;(source:Araport11) |
AT5G37210 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G46900 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G24600 | Ankyrin repeat family protein;(source:Araport11) |
AT5G23380 | hypothetical protein (DUF789);(source:Araport11) |
AT2G24240 | BTB/POZ domain with WD40/YVTN repeat-like protein;(source:Araport11) |
AT1G22060 | sporulation-specific protein;(source:Araport11) |
AT1G23830 | transmembrane protein;(source:Araport11) |
AT5G16110 | hypothetical protein;(source:Araport11) |
AT4G39060 | LOW protein: coatomer subunit alpha-1-like protein;(source:Araport11) |
AT1G35745 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.5e-62 P-value blast match to GB:CAA38906 Tam3-transposase (hAT-element) (Antirrhinum majus);(source:TAIR10) |
AT4G27740 | Yippee family putative zinc-binding protein;(source:Araport11) |
AT5G02710 | zinc/iron-chelating domain protein;(source:Araport11) |
AT4G01670 | hypothetical protein;(source:Araport11) |
AT1G21300 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-15 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G60380 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT2G32340 | TraB family protein;(source:Araport11) |
AT4G01270 | RING/U-box superfamily protein;(source:Araport11) |
AT5G16990 | molecular function has not been defined, was shown involved in oxidative stress tolerance. The mRNA is cell-to-cell mobile. |
AT4G34480 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G44330 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G23500 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G23470 | PLAC8 family protein;(source:Araport11) |
AT1G57670 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT3G55258 | pseudogene similar to self-incompatibility |
AT2G39960 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
AT3G55252 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G40690 | histone-lysine N-methyltransferase trithorax-like protein;(source:Araport11) |
AT4G34330 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT3G47670 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G78530 | Protein kinase superfamily protein;(source:Araport11) |
AT1G18170 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT4G31460 | Ribosomal L28 family;(source:Araport11) |
AT4G01460 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G19190 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT5G36930 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G62350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G14820 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT4G26660 | kinesin-like protein;(source:Araport11) |
AT5G01320 | Thiamine pyrophosphate dependent pyruvate decarboxylase family protein;(source:Araport11) |
AT1G16170 | ephrin-A3 protein;(source:Araport11) |
AT2G45920 | U-box domain-containing protein;(source:Araport11) |
AT3G18450 | PLAC8 family protein;(source:Araport11) |
AT5G58720 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
AT3G30300 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G61840 | auxin response factor, putative (DUF688);(source:Araport11) |
AT2G15060 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 1.8e-63 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT4G16195 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT4G13820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G65870 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT5G59050 | G patch domain protein;(source:Araport11) |
AT2G14910 | MAR-binding filament-like protein;(source:Araport11) |
AT1G74610 | pre-tRNA tRNA-Leu (anticodon: CAG);(source:Araport11, TAIR10) |
AT4G34170 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G38212 | Natural antisense transcript overlaps with AT5G38210;(source:Araport11) |
AT4G16162 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G13800 | Metallo-hydrolase/oxidoreductase superfamily protein;(source:Araport11) |
AT2G13431 | transposable_element_gene;(source:Araport11) |
AT3G28350 | Pseudogene of AT3G28350; unknown protein |
AT2G19130 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G43580 | Sphingomyelin synthetase family protein;(source:Araport11) |
AT4G30910 | Cytosol aminopeptidase family protein;(source:Araport11) |
AT3G56880 | VQ motif-containing protein;(source:Araport11) |
AT2G01818 | PLATZ transcription factor family protein;(source:Araport11) |
AT1G72720 | hypothetical protein (DUF3511);(source:Araport11) |
AT5G45700 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G54620 | Ankyrin repeat family protein;(source:Araport11) |
AT3G01513 | hypothetical protein;(source:Araport11) |
AT2G41000 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G57650 | ATP binding protein;(source:Araport11) |
AT3G55690 | hypothetical protein;(source:Araport11) |
AT2G27315 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
AT5G41290 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT1G10140 | Uncharacterized conserved protein UCP031279;(source:Araport11) |
AT4G30010 | ATP-dependent RNA helicase;(source:Araport11) |
AT1G28510 | Optic atrophy 3 protein (OPA3);(source:Araport11) |
AT5G57150 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G09644 | Encodes a defensin-like (DEFL) family protein. |
AT5G29613 | hypothetical protein;(source:Araport11) |
AT5G54720 | Ankyrin repeat family protein;(source:Araport11) |
AT4G16400 | transmembrane protein;(source:Araport11) |
AT5G35339 | pseudogene of Polynucleotidyl transferase;(source:Araport11) |
AT3G14740 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT1G51645 | Natural antisense transcript overlaps with AT1G51640;(source:Araport11) |
AT3G58180 | ARM repeat superfamily protein;(source:Araport11) |
AT1G21550 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G54365 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT3G59455 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT5G01950 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G18840 | Major facilitator superfamily protein;(source:Araport11) |
AT3G01325 | Expressed protein;(source:Araport11) |
AT5G05965 | cell wall RBR3-like protein;(source:Araport11) |
AT5G60615 | Encodes a defensin-like (DEFL) family protein. |
AT1G49790 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G45660 | adenine phosphoribosyltransferase;(source:Araport11) |
AT4G20000 | VQ motif-containing protein;(source:Araport11) |
AT3G49930 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT1G66460 | Protein kinase superfamily protein;(source:Araport11) |
AT5G37610 | Eukaryotic porin family protein;(source:Araport11) |
AT3G47590 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G31710 | Vacuolar ATPase assembly integral membrane protein VMA21-like domain-containing protein;(source:Araport11) |
AT5G25615 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.0e-122 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT5G25754 | RNA polymerase I-associated factor PAF67;(source:Araport11) |
AT4G37705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.5e-203 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT1G05085 | hypothetical protein;(source:Araport11) |
AT2G34315 | avirulence induced family protein;(source:Araport11) |
AT5G38340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G33555 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to hypothetical protein GB:AAD26889 (Arabidopsis thaliana);(source:TAIR10) |
AT4G06632 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 3.9e-05 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G38035 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.9e-71 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G25720 | hypothetical protein;(source:Araport11) |
AT1G69030 | BSD domain-containing protein;(source:Araport11) |
AT1G28920 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT2G39415 | F-box family protein;(source:Araport11) |
AT2G34450 | HMG-box (high mobility group) DNA-binding family protein;(source:Araport11) |
AT2G35742 | snoRNA;(source:Araport11) |
AT5G19172 | Encodes a defensin-like (DEFL) family protein. |
AT2G40008 | Natural antisense transcript overlaps with AT2G40010;(source:Araport11) |
AT3G27410 | transmembrane protein;(source:Araport11) |
AT2G31420 | B3 domain protein (DUF313);(source:Araport11) |
AT1G09390 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G44180 | syntaxin-related family protein;(source:Araport11) |
AT1G02575 | transmembrane protein;(source:Araport11) |
AT1G03590 | Protein phosphatase 2C family protein;(source:Araport11) |
AT2G41830 | Uncharacterized protein;(source:Araport11) |
AT3G11310 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT1G09370 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G59110 | Protein kinase superfamily protein;(source:Araport11) |
AT3G12910 | NAC (No Apical Meristem) domain transcriptional regulator superfamily protein;(source:Araport11) |
AT2G23530 | Zinc-finger domain of monoamine-oxidase A repressor R1;(source:Araport11) |
AT3G01202 | Natural antisense transcript overlaps with AT3G01200;(source:Araport11) |
AT4G39280 | phenylalanyl-tRNA synthetase, putative / phenylalanine-tRNA ligase;(source:Araport11) |
AT1G11125 | hypothetical protein;(source:Araport11) |
AT5G53720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G27180 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT1G09260 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G31090 | F-box family protein;(source:Araport11) |
AT1G78070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G52200 | PLAC8 family protein;(source:Araport11) |
AT1G75900 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G01890 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G32730 | electron carrier/iron ion-binding protein;(source:Araport11) |
AT5G57035 | U-box domain-containing protein kinase family protein;(source:Araport11) |
AT1G31983 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G55055 | pre-tRNA tRNA-Phe (anticodon: GAA);(source:Araport11, TAIR10) |
AT5G52480 | RNI-like superfamily protein;(source:Araport11) |
AT3G57100 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT1G69070 | nucleolar-like protein;(source:Araport11) |
AT5G52840 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
AT3G27950 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G38260 | transport/golgi organization-like protein (DUF833);(source:Araport11) |
AT4G13500 | transmembrane protein;(source:Araport11) |
AT3G16432 | hypothetical protein;(source:Araport11) |
AT3G15935 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G08820 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G50280 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G06360 | Ribosomal protein S8e family protein;(source:Araport11) |
AT4G30990 | ARM repeat superfamily protein;(source:Araport11) |
AT1G52191 | Thioesterase superfamily protein;(source:Araport11) |
AT4G33100 | protein phosphatase;(source:Araport11) |
AT2G43590 | Chitinase family protein;(source:Araport11) |
AT4G06474 | transposable_element_gene;(source:Araport11);retroelement pol polyprotein;(source:TAIR10) |
AT3G26360 | Ribosomal protein S21 family protein;(source:Araport11) |
AT3G14830 | epstein-barr nuclear antigen;(source:Araport11) |
AT4G17690 | Peroxidase superfamily protein;(source:Araport11) |
AT5G33432 | similar to En/Spm-like transposon |
AT1G50730 | hypothetical protein;(source:Araport11) |
AT3G46850 | Subtilase family protein;(source:Araport11) |
AT3G19900 | hypothetical protein;(source:Araport11) |
AT3G15518 | hypothetical protein;(source:Araport11) |
AT1G22580 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, blastp match of 32%25 identity and 1.1e-13 P-value to GP|21952510|gb|AAM82604.1|AF525305_2|AF525305 putative AP endonuclease/reverse transcriptase {Brassica napus};(source:TAIR10) |
AT1G68400 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT1G05785 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT4G18840 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT1G32120 | serine/threonine-protein phosphatase 7 long form-like protein;(source:Araport11) |
AT5G13890 | plant viral-response family protein (DUF716);(source:Araport11) |
AT2G14635 | ARABIDILLO protein;(source:Araport11) |
AT4G15165 | N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein;(source:Araport11) |
AT1G66780 | MATE efflux family protein;(source:Araport11) |
AT4G08360 | KOW domain-containing protein;(source:Araport11) |
AT5G25420 | Xanthine/uracil/vitamin C permease;(source:Araport11) |
AT4G20770 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G55180 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G76610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT1G49032 | hypothetical protein;(source:Araport11) |
AT5G29635 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 7.7e-111 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT1G03260 | SNARE associated Golgi protein family;(source:Araport11) |
AT5G40910 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G47150 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G42792 | transposable_element_gene;(source:Araport11);Mutator-related transposase, temporary automated functional assignment;(source:TAIR10) |
AT4G21920 | hypothetical protein;(source:Araport11) |
AT2G16592 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT4G24265 | homeobox protein;(source:Araport11) |
AT2G21860 | violaxanthin de-epoxidase-like protein;(source:Araport11) |
AT3G20975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-08 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G72740 | Single Myb Histone (SMH) gene family member. Contains terminal acidic SANT domain. |
AT3G52170 | DNA binding protein;(source:Araport11) |
AT1G69828 | Encodes a defensin-like (DEFL) family protein. |
AT3G05810 | IGR motif protein;(source:Araport11) |
AT5G60350 | hypothetical protein;(source:Araport11) |
AT1G74150 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G60095 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G63740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G60110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT3G11590 | golgin family A protein;(source:Araport11) |
AT4G36430 | Peroxidase superfamily protein;(source:Araport11) |
AT5G51260 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT5G24600 | TRP-like ion channel protein (Protein of unknown function, DUF599);(source:Araport11) |
AT1G24600 | hypothetical protein;(source:Araport11) |
AT1G50830 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
AT1G53380 | hypothetical protein (DUF641);(source:Araport11) |
AT3G01740 | Mitochondrial ribosomal protein L37;(source:Araport11) |
AT2G28010 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G02420 | dihydroflavonol 4-reductase/flavanone protein;(source:Araport11) |
AT1G60010 | PADRE protein down-regulated after infection by S. sclerotiorun. |
AT3G19250 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT4G10220 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT4G39840 | cell wall integrity/stress response component-like protein;(source:Araport11) |
AT1G64385 | transmembrane protein;(source:Araport11) |
AT4G31210 | DNA topoisomerase, type IA, core;(source:Araport11) |
AT2G05780 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.5e-37 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G09830 | nuclear receptor family 2 group C protein;(source:Araport11) |
AT3G59880 | hypothetical protein;(source:Araport11) |
AT2G42100 | Actin-like ATPase superfamily protein;(source:Araport11) |
AT2G20835 | hypothetical protein;(source:Araport11) |
AT3G48080 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G03850 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT2G34330 | LOW protein: protein BOBBER-like protein;(source:Araport11) |
AT2G30850 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT2G15555 | other_RNA;(source:Araport11) |
AT1G50575 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT1G35143 | transposable_element_gene;(source:Araport11);similar to replication protein-related [Arabidopsis thaliana] (TAIR:AT1G52950.1);(source:TAIR10) |
AT2G31730 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G36040 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30610.1);(source:TAIR10) |
AT1G35300 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.1e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G47250 | RNA helicase family protein;(source:Araport11) |
AT5G51930 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT3G42830 | RING/U-box superfamily protein;(source:Araport11) |
AT1G52900 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT3G44093 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-162 P-value blast match to GB:CAA73042 polyprotein (Gypsy_Ty3-element) (Ananas comosus);(source:TAIR10) |
AT2G30600 | BTB/POZ domain-containing protein;(source:Araport11) |
AT4G30150 | Urb2/Npa2 family protein;(source:Araport11) |
AT1G63730 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G29870 | tRNA synthetase class II (G, H, P and S) family protein;(source:Araport11) |
AT4G26130 | cotton fiber protein;(source:Araport11) |
AT4G18340 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G34050 | Ankyrin repeat family protein;(source:Araport11) |
AT1G45229 | transmembrane protein;(source:Araport11) |
AT3G03290 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT5G39535 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT5G02230 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G49160 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
AT5G54148 | sarcosine dehydrogenase-2C protein;(source:Araport11) |
AT2G40630 | Uncharacterized conserved protein (UCP030365);(source:Araport11) |
AT2G18115 | pseudogene of glycine-rich protein;(source:Araport11) |
AT5G53486 | transmembrane protein;(source:Araport11) |
AT1G13635 | DNA glycosylase superfamily protein;(source:Araport11) |
AT5G35932 | pseudogene of hypothetical protein;(source:Araport11) |
AT1G77480 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G69526 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G19550 | glutamate racemase;(source:Araport11) |
AT1G04430 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G03160 | B-cell receptor-associated-like protein;(source:Araport11) |
AT1G22440 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT5G43960 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT1G61390 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G24610 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G64830 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G71691 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G33170 | Leucine-rich repeat receptor-like protein kinase family protein;(source:Araport11) |
AT5G47635 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT3G09930 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G26480 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT1G24068 | other_RNA;(source:Araport11) |
AT4G04925 | transmembrane protein;(source:Araport11) |
AT5G28143 | pseudogene of topoisomerase II;(source:Araport11) |
AT2G30660 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT4G35940 | hypothetical protein;(source:Araport11) |
AT2G22530 | Alkaline-phosphatase-like family protein;(source:Araport11) |
AT1G51970 | B3 domain protein;(source:Araport11) |
AT5G37240 | hypothetical protein;(source:Araport11) |
AT2G26810 | Putative methyltransferase family protein;(source:Araport11) |
AT1G11370 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G16855 | hypothetical protein;(source:Araport11) |
AT2G15760 | calmodulin-binding protein (DUF1645);(source:Araport11) |
AT1G71695 | Peroxidase superfamily protein;(source:Araport11) |
AT5G22400 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
AT5G59190 | subtilase family protein;(source:Araport11) |
AT5G26620 | hypothetical protein;(source:Araport11) |
AT4G15775 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT1G66245 | hypothetical protein;(source:Araport11) |
AT3G47110 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G01060 | lysine-tRNA ligase;(source:Araport11) |
AT3G63360 | Encodes a defensin-like (DEFL) family protein. |
AT4G22285 | Ubiquitin C-terminal hydrolases superfamily protein;(source:Araport11) |
AT3G48208 | Encodes a Plant thionin family protein |
AT3G28810 | mediator of RNA polymerase II transcription subunit-like protein, putative (DUF1216);(source:Araport11) |
AT2G26450 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G45590 | Ribosomal protein L35;(source:Araport11) |
AT5G59330 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G17285 | transmembrane protein;(source:Araport11) |
AT1G33840 | LURP-one-like protein (DUF567);(source:Araport11) |
AT5G56530 | tRNA-splicing ligase (DUF239);(source:Araport11) |
AT3G15240 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
AT1G49570 | Peroxidase superfamily protein;(source:Araport11) |
AT2G42980 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G27230 | Frigida-like protein;(source:Araport11) |
AT1G69420 | DHHC-type zinc finger family protein;(source:Araport11) |
AT3G11810 | transmembrane protein;(source:Araport11) |
AT1G52060 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT1G44020 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G11190 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT3G22510 | Pre-rRNA-processing protein TSR2, conserved region;(source:Araport11) |
AT2G27430 | ARM repeat superfamily protein;(source:Araport11) |
AT4G18820 | AAA-type ATPase family protein;(source:Araport11) |
AT4G06572 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.4e-68 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G03510 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT2G21300 | ATP binding microtubule motor family protein;(source:Araport11) |
AT4G19460 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G22057 | cysteine-rich repeat secretory protein;(source:Araport11) |
AT4G00165 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G53345 | DHHA1 domain protein;(source:Araport11) |
AT2G25200 | hypothetical protein (DUF868);(source:Araport11) |
AT1G55700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G39805 | Integral membrane Yip1 family protein;(source:Araport11) |
AT3G45200 | hypothetical protein;(source:Araport11) |
AT4G22960 | FAM63A-like protein (DUF544);(source:Araport11) |
AT3G42550 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G05310 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G61150 | LisH and RanBPM domains containing protein;(source:Araport11) |
AT5G23212 | Encodes a defensin-like (DEFL) family protein. |
AT4G03923 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G37190 | plasma membrane, autoregulation-binding site, misato segment II, myosin-like, tubulin/FtsZ protein;(source:Araport11) |
AT5G28545 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.7e-08 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G50620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G01410 | NHL domain-containing protein;(source:Araport11) |
AT5G66590 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT1G31335 | transmembrane protein;(source:Araport11) |
AT4G17940 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G19615 | beta-1,4-xylosidase;(source:Araport11) |
AT5G22560 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G46370 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G35736 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G49030 | PLAC8 family protein;(source:Araport11) |
AT1G17010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G80610 | hypothetical protein;(source:Araport11) |
AT5G06990 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT5G19230 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
AT4G34380 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G57400 | transmembrane protein;(source:Araport11) |
AT3G10430 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G29310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G03930 | kinase-like protein;(source:Araport11) |
AT5G52965 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
AT2G27590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G47300 | F-box family protein;(source:Araport11) |
AT4G02250 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G05710 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G00090 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G41640 | Glycosyltransferase family 61 protein;(source:Araport11) |
AT2G45460 | SMAD/FHA domain-containing protein;(source:Araport11) |
AT5G32070 | transposable_element_gene;(source:Araport11);similar to AT hook motif-containing protein-related [Arabidopsis thaliana] (TAIR:AT3G42100.1);(source:TAIR10) |
AT3G29220 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30843.1);(source:TAIR10) |
AT1G53640 | transmembrane protein;(source:Araport11) |
AT3G27090 | DCD (Development and Cell Death) domain protein;(source:Araport11) |
AT3G63095 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT1G54890 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT5G23160 | transmembrane protein;(source:Araport11) |
AT4G39780 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT3G52330 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT2G17320 | pantothenate kinase;(source:Araport11) |
AT1G51530 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT4G07950 | DNA-directed RNA polymerase, subunit M, archaeal;(source:Araport11) |
AT5G49920 | Octicosapeptide/Phox/Bem1p family protein;(source:Araport11) |
AT5G11840 | YCF36, putative (DUF1230);(source:Araport11) |
AT5G18210 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT4G23520 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT5G22530 | Unknown protein, knockout shows increased sensitivity to Al stress. |
AT5G66060 | 2-oxoglutarate-dependent dioxygenase |
AT2G07720 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 1.1e-59 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G26747 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT4G00160 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G12930 | inactive rhomboid protein;(source:Araport11) |
AT5G14940 | Major facilitator superfamily protein;(source:Araport11) |
AT1G52950 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT2G43890 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G61280 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT3G59260 | pirin;(source:Araport11) |
AT3G19360 | Zinc finger (CCCH-type) family protein;(source:Araport11) |
AT1G70900 | hypothetical protein;(source:Araport11) |
AT1G64850 | Calcium-binding EF hand family protein;(source:Araport11) |
AT1G33250 | beta-1,3-n-acetylglucosaminyltransferase radical fringe protein, putative (DUF604);(source:Araport11) |
AT3G16510 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G36440 | hypothetical protein;(source:Araport11) |
AT4G27480 | GT14 enzyme |
AT2G47120 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G19420 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT5G48200 | hypothetical protein;(source:Araport11) |
AT1G14650 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein;(source:Araport11) |
AT5G48800 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT2G14810 | hypothetical protein;(source:Araport11) |
AT1G77525 | defensin-like protein;(source:Araport11) |
AT5G52815 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT1G63750 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G65483 | hypothetical protein;(source:Araport11) |
AT3G24780 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
AT2G23755 | transmembrane family 220 helix protein;(source:Araport11) |
AT5G61330 | rRNA processing protein-like protein;(source:Araport11) |
AT1G75970 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT1G35570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G11710.1);(source:TAIR10) |
AT4G28260 | acyl-UDP-N-acetylglucosamine O-acyltransferase;(source:Araport11) |
AT5G60580 | RING/U-box superfamily protein;(source:Araport11) |
AT1G77290 | Glutathione S-transferase family protein;(source:Araport11) |
AT5G06520 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein;(source:Araport11) |
AT2G22805 | Encodes a defensin-like (DEFL) family protein. |
AT2G34350 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
AT2G28960 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G22072 | Natural antisense transcript overlaps with AT3G22070;(source:Araport11) |
AT4G33170 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G33847 | hypothetical protein;(source:Araport11) |
AT5G64850 | sorbin/SH3 domain protein;(source:Araport11) |
AT5G43240 | hypothetical protein (DUF674);(source:Araport11) |
AT5G12300 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G36210 | transmembrane/coiled-coil protein (DUF726);(source:Araport11) |
AT1G33260 | Protein kinase superfamily protein;(source:Araport11) |
AT4G08630 | fas-binding factor-like protein;(source:Araport11) |
AT1G15840 | hypothetical protein;(source:Araport11) |
AT5G25470 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT2G36580 | Pyruvate kinase family protein;(source:Araport11) |
AT4G32360 | Pyridine nucleotide-disulfide oxidoreductase family protein;(source:Araport11) |
AT3G12040 | Encodes a 3-methyladenine-DNA glycosylase. Arabdiopsis cDNA complements the methyl methanesulfonate-sensitive phenotype of an Escherichia coli double mutant deficient in 3-methyladenine glycosylases (DNA-3-methyladenine glycosidases I and II, EC 3.2.2.20 and 3.2.2.21, respectively, encoded by tag and alkA). |
AT3G52520 | hypothetical protein;(source:Araport11) |
AT1G24210 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT4G20920 | double-stranded RNA-binding domain (DsRBD)-containing protein;(source:Araport11) |
AT2G39270 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G48710 | DEK domain-containing chromatin associated protein;(source:Araport11) |
AT5G42960 | outer envelope pore 24B-like protein;(source:Araport11) |
AT5G25320 | ACT-like superfamily protein;(source:Araport11) |
AT2G43630 | nucleusenvelope protein;(source:Araport11) |
AT5G34852 | pseudogene of Intron maturase;(source:Araport11) |
AT1G28850 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G20085 | similarity to Retrotransposon - like protein (Copia-like retroelement pol polyprotein-like). |
AT1G47950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-238 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT3G17225 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G30170 | Peroxidase family protein;(source:Araport11) |
AT1G04790 | RING/U-box superfamily protein;(source:Araport11) |
AT5G43040 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G46192 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.4e-69 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G61200 | Thioesterase superfamily protein;(source:Araport11) |
AT1G23205 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G01331 | Encodes a ECA1 gametogenesis related family protein |
AT5G55610 | isopentenyl-diphosphate delta-isomerase;(source:Araport11) |
AT5G38250 | Protein kinase family protein;(source:Araport11) |
AT5G22930 | enabled-like protein (DUF1635);(source:Araport11) |
AT3G46260 | kinase-like protein;(source:Araport11) |
AT3G13403 | Encodes a defensin-like (DEFL) family protein. |
AT4G29990 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT5G65380 | MATE efflux family protein;(source:Araport11) |
AT2G18070 | hypothetical protein;(source:Araport11) |
AT5G10190 | Major facilitator superfamily protein;(source:Araport11) |
AT3G13030 | hAT transposon superfamily protein;(source:Araport11) |
AT4G10507 | other_RNA;(source:Araport11) |
AT5G67020 | hypothetical protein;(source:Araport11) |
AT5G53135 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-199 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G30757 | transmembrane protein;(source:Araport11) |
AT4G23730 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT1G70590 | F-box family protein;(source:Araport11) |
AT1G65541 | hypothetical protein;(source:Araport11) |
AT2G01560 | Plant protein 1589 of unknown function;(source:Araport11) |
AT5G35205 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-36 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G01200 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT4G37620 | transposable_element_gene;(source:Araport11);similar to RNase H domain-containing protein [Arabidopsis thaliana] (TAIR:AT4G09490.1);(source:TAIR10) |
AT5G19350 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G15830 | hypothetical protein;(source:Araport11) |
AT1G66830 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G48675 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT3G11420 | beta-1,3-N-acetylglucosaminyltransferase lunatic protein, putative (DUF604);(source:Araport11) |
AT2G28690 | TOX high mobility group box protein, putative (DUF1635);(source:Araport11) |
AT3G51360 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G77131 | Annotated as pseudogene of PGSIP, glycogenin glucosyltransferase.Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT5G24316 | proline-rich family protein;(source:Araport11) |
AT3G59850 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G30150 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G11240 | ribosomal RNA-processing protein;(source:Araport11) |
AT2G40820 | stomatal closure actin-binding-like protein;(source:Araport11) |
AT2G34190 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G78840 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G65120 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT3G52470 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G47020 | MraZ;(source:Araport11) |
AT1G68875 | hypothetical protein;(source:Araport11) |
AT3G49350 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G37030 | membrane protein;(source:Araport11) |
AT5G28491 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G28720 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G76780 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT1G31370 | Ubiquitin-specific protease family C19-related protein;(source:Araport11) |
AT1G65200 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT1G14460 | AAA-type ATPase family protein;(source:Araport11) |
AT3G46186 | pseudogene of RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G55221 | Pseudogene of AT1G55240 |
AT1G79245 | pseudogene of Winged helix-turn-helix transcription repressor DNA-binding protein;(source:Araport11) |
AT3G06778 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT4G17486 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT5G59662 | Natural antisense transcript overlaps with AT5G59660;(source:Araport11) |
AT3G29000 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G27473 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G70505 | transmembrane protein;(source:Araport11) |
AT5G54370 | Late embryogenesis abundant (LEA) protein-like protein;(source:Araport11) |
AT4G19360 | SCD6 protein-like protein;(source:Araport11) |
AT2G28970 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G15500 | RNA-binding protein;(source:Araport11) |
AT5G38220 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G11340 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT4G22640 | LTPG protein |
AT5G36937 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.2e-09 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G54350 | C2H2-type zinc finger protein;(source:Araport11) |
AT1G61260 | cotton fiber (DUF761);(source:Araport11) |
AT5G05830 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT5G11325 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT3G18150 | RNI-like superfamily protein;(source:Araport11) |
AT5G07315 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT3G20620 | F-box family protein-like protein;(source:Araport11) |
AT1G21330 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G40680.1);(source:TAIR10) |
AT4G11300 | ROH1, putative (DUF793);(source:Araport11) |
AT3G60540 | Preprotein translocase Sec, Sec61-beta subunit protein;(source:Araport11) |
AT2G03100 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.2e-225 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G36860 | pre-tRNA tRNA-Tyr (anticodon: GTA);(source:Araport11, TAIR10) |
AT1G26660 | Prefoldin chaperone subunit family protein;(source:Araport11) |
AT5G50190 | other_RNA;(source:Araport11) |
AT3G32975 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-133 P-value blast match to gb|AAL06422.1|AF378081_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
AT1G51790 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G56160 | Sodium Bile acid symporter family;(source:Araport11) |
AT1G66910 | Protein kinase superfamily protein;(source:Araport11) |
AT1G03280 | Transcription factor TFIIE, alpha subunit;(source:Araport11) |
AT4G17910 | transferases, transferring acyl groups;(source:Araport11) |
AT1G77765 | transmembrane protein;(source:Araport11) |
AT1G76290 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT4G37700 | hypothetical protein;(source:Araport11) |
AT1G24420 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G46195 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 8.8e-38 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G05160 | CCCH-type zinc fingerfamily protein with RNA-binding domain-containing protein;(source:Araport11) |
AT3G24070 | Zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT1G22140 | zinc finger CCCH domain protein;(source:Araport11) |
AT1G12180 | 14.7 kDa heat shock-like protein;(source:Araport11) |
AT5G57230 | Thioredoxin superfamily protein;(source:Araport11) |
AT2G36680 | Modifier of rudimentary (Mod(r)) protein;(source:Araport11) |
AT1G21930 | transmembrane protein;(source:Araport11) |
AT1G15860 | defective in cullin neddylation protein (DUF298);(source:Araport11) |
AT1G72820 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT2G36255 | Encodes a defensin-like (DEFL) family protein. |
AT1G31220 | N10-formyltetrahydrofolate-dependent phosphoribosylglycinamide formyltransferase that catalyzes the conversion of phosphoribosyl glycineamide to phosphoribosyl N-formylglycineamide |
AT4G31980 | PPPDE thiol peptidase family protein;(source:Araport11) |
AT5G23610 | DYAD protein;(source:Araport11) |
AT1G51310 | tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase;(source:Araport11) |
AT5G33300 | chromosome-associated kinesin-like protein;(source:Araport11) |
AT1G72060 | serine-type endopeptidase inhibitor;(source:Araport11) |
AT5G48500 | pathogenic type III effector avirulence factor Avr AvrRpt-cleavage: cleavage site protein;(source:Araport11) |
AT3G43890 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G03440 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT2G29810 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G60200 | hypothetical protein;(source:Araport11) |
AT3G47610 | transcription regulator/ zinc ion binding protein;(source:Araport11) |
AT1G51040 | Protein kinase superfamily protein;(source:Araport11) |
AT5G08480 | VQ motif-containing protein;(source:Araport11) |
AT1G76070 | hypothetical protein;(source:Araport11) |
AT5G28310 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G36240 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT5G42220 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT1G04900 | NADH dehydrogenase ubiquinone complex I, assembly factor-like protein (DUF185);(source:Araport11) |
AT1G30282 | Natural antisense transcript overlaps with AT1G30280;(source:Araport11) |
AT1G29580 | mediator of RNA polymerase II transcription subunit;(source:Araport11) |
AT1G23560 | OBP32pep, putative (DUF220);(source:Araport11) |
AT5G26830 | Encodes a dual-targeted threonyl-tRNA synthetase found in both the chloroplast and mitochondrion. The mRNA is cell-to-cell mobile. |
AT2G14900 | Gibberellin-regulated family protein;(source:Araport11) |
AT5G64880 | transmembrane protein;(source:Araport11) |
AT1G76580 | Squamosa promoter-binding protein-like (SBP domain) transcription factor family protein;(source:Araport11) |
AT4G04296 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.4e-13 P-value blast match to GB:NP_038602 L1 repeat, Tf subfamily, member 18 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G33070 | MADS-box family protein;(source:Araport11) |
AT1G05670 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT5G27238 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G43610 | Chitinase family protein;(source:Araport11) |
AT5G35735 | Auxin-responsive family protein;(source:Araport11) |
AT4G20730 | transposable_element_gene;(source:Araport11);similar to ASY2, DNA binding [Arabidopsis thaliana] (TAIR:AT4G32200.1);(source:TAIR10) |
AT1G70400 | NOSIC domain protein;(source:Araport11) |
AT1G33230 | TMPIT-like protein;(source:Araport11) |
AT4G16563 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G69818 | Encodes a defensin-like (DEFL) family protein. |
AT5G66310 | ATP binding microtubule motor family protein;(source:Araport11) |
AT3G49960 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
AT5G56570 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT4G33910 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G08600 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT3G57110 | exonuclease V;(source:Araport11) |
AT2G33845 | Nucleic acid-binding, OB-fold-like protein;(source:Araport11) |
AT1G77095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 9.8e-14 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G24220 | Lipase class 3-related protein;(source:Araport11) |
AT1G78865 | other_RNA;(source:Araport11) |
AT4G32990 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G23540 | ARM repeat superfamily protein;(source:Araport11) |
AT3G50300 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G39580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G07485 | hypothetical protein;(source:Araport11) |
AT1G51860 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G16530 | hypothetical protein;(source:Araport11) |
AT2G37700 | Fatty acid hydroxylase superfamily;(source:Araport11) |
AT2G23321 | hypothetical protein;(source:Araport11) |
AT3G07450 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G36140 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT5G42740 | Sugar isomerase (SIS) family protein;(source:Araport11) |
AT1G77790 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G23037 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT4G06702 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G41140 | Myosin heavy chain-related protein;(source:Araport11) |
AT1G78170 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT3G21940 | Receptor protein kinase-like protein;(source:Araport11) |
AT1G61460 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT3G59310 | solute carrier family 35 protein (DUF914);(source:Araport11) |
AT4G09870 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G22570 | Major facilitator superfamily protein;(source:Araport11) |
AT1G51035 | hypothetical protein;(source:Araport11) |
AT1G12670 | Encodes a Plant thionin family protein [pseudogene] |
AT3G43715 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT3G25495 | pseudogene of leucine-rich repeat protein |
AT4G32390 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT2G30780 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G75870 | hypothetical protein;(source:Araport11) |
AT2G25409 | hypothetical protein;(source:Araport11) |
AT5G66455 | pseudogene of pentatricopeptide (PPR) repeat-containing protein |
AT1G45140 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-37 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G16220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G10490 | GNAT acetyltransferase (DUF699);(source:Araport11) |
AT1G43775 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-147 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT2G36410 | transcriptional activator (DUF662);(source:Araport11) |
AT3G50010 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G39090 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G34847 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.0e-27 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G13210 | Uncharacterized conserved protein UCP015417, vWA;(source:Araport11) |
AT5G24940 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G44600 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G59300 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G46190 | TRAF-like family protein;(source:Araport11) |
AT3G52500 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G27875 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT1G28327 | E3 ubiquitin-protein ligase;(source:Araport11) |
AT2G42460 | MATH domain/coiled-coil protein;(source:Araport11) |
AT2G26270 | BRCT domain DNA repair protein;(source:Araport11) |
AT3G60710 | F-box family protein. |
AT1G79570 | kinase superfamily with octicosapeptide/Phox/Bem1p domain-containing protein;(source:Araport11) |
AT1G70100 | neurofilament heavy protein;(source:Araport11) |
AT1G22830 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G35570 | pseudogene of Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT1G13820 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G02260 | Divalent ion symporter;(source:Araport11) |
AT3G46360 | transmembrane protein;(source:Araport11) |
AT3G20590 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G11362 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G12760 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT3G04300 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G39952 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G05410 | MATH domain/coiled-coil protein;(source:Araport11) |
AT1G27752 | Ubiquitin system component Cue protein;(source:Araport11) |
AT3G33058 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.4e-112 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G51520 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G22030 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G25930 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
AT1G45015 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
AT4G02540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G65320 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G47100 | hypothetical protein;(source:Araport11) |
AT3G48220 | F-box protein;(source:Araport11) |
AT1G66650 | Protein with RING/U-box and TRAF-like domain;(source:Araport11) |
AT1G24388 | hypothetical protein;(source:Araport11) |
AT1G15405 | other_RNA;(source:Araport11) |
AT5G25415 | hypothetical protein (DUF239);(source:Araport11) |
AT3G06437 | pseudogene of hypothetical protein;(source:Araport11) |
AT4G04495 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.9e-24 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G36230 | transmembrane protein;(source:Araport11) |
AT1G61350 | ARM repeat superfamily protein;(source:Araport11) |
AT5G45630 | senescence regulator (Protein of unknown function, DUF584);(source:Araport11) |
AT1G30190 | cotton fiber protein;(source:Araport11) |
AT3G43710 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G47740 | pre-tRNA tRNA-Gly (anticodon: CCC);(source:Araport11, TAIR10) |
AT3G25720 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT3G47050 | Glycosyl hydrolase family protein;(source:Araport11) |
AT1G42980 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
AT1G53370 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G13851 | pseudogene of hypothetical protein;(source:Araport11) |
AT5G67411 | GRAS family transcription factor;(source:Araport11) |
AT5G42610 | calcium uniporter (DUF607);(source:Araport11) |
AT3G29680 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G01516 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G43910 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
AT4G00905 | NC domain-containing protein-like protein;(source:Araport11) |
AT5G48430 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G05080 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G26270 | Phosphatidylinositol 3- and 4-kinase family protein;(source:Araport11) |
AT1G10865 | cytochrome C oxidase assembly factor;(source:Araport11) |
AT1G48220 | Protein kinase superfamily protein;(source:Araport11) |
AT5G53020 | Ribonuclease P protein subunit P38-like protein;(source:Araport11) |
AT5G65305 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT3G46700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G36650 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 26%25 identity and 8.3e-12 P-value to GP|20279456|gb|AAM18736.1|AC092548_14|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT4G28450 | This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays and may be involved in the formation of a CUL4-based E3 ubiquitin ligase |
AT2G24170 | Endomembrane protein 70 protein family;(source:Araport11) |
AT1G21440 | Phosphoenolpyruvate carboxylase family protein;(source:Araport11) |
AT4G13580 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT1G05790 | lipase class 3 family protein;(source:Araport11) |
AT3G19663 | hypothetical protein;(source:Araport11) |
AT3G10880 | tropomyosin;(source:Araport11) |
AT5G59080 | hypothetical protein;(source:Araport11) |
AT3G51350 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT3G10185 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
AT1G01540 | Protein kinase superfamily protein;(source:Araport11) |
AT3G45660 | Encodes a member of the NAXT NPF subfamily. |
AT1G61890 | MATE efflux family protein;(source:Araport11) |
AT4G34500 | Protein kinase superfamily protein;(source:Araport11) |
AT5G66330 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G50970 | Membrane trafficking VPS53 family protein;(source:Araport11) |
AT3G42796 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.5e-31 P-value blast match to reverse transcriptase (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G44820 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
AT1G14688 | E3 ubiquitin ligase;(source:Araport11) |
AT4G11580 | RNI-like superfamily protein;(source:Araport11) |
AT3G49200 | O-acyltransferase (WSD1-like) family protein;(source:Araport11) |
AT4G24050 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G29320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G56830 | Similar in sequence to NPQ6 and NPQ7, but loss of function mutant does not exhibit a nonphotochemical quenching phenotype. |
AT4G03370 | Ubiquitin family protein;(source:Araport11) |
AT3G04250 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G30320 | Remorin family protein;(source:Araport11) |
AT5G51680 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G80120 | LURP-one-like protein (DUF567);(source:Araport11) |
AT4G06534 | transmembrane protein;(source:Araport11) |
AT1G35830 | VQ motif-containing protein;(source:Araport11) |
AT3G44280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
AT3G45256 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative AP endonuclease/reverse transcriptase, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT1G33780 | electron transporter, putative (DUF179);(source:Araport11) |
AT1G11210 | cotton fiber protein, putative (DUF761);(source:Araport11) |
AT4G23490 | fringe-like protein (DUF604);(source:Araport11) |
AT2G18150 | Peroxidase superfamily protein;(source:Araport11) |
AT4G26380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G11340 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G37790 | Protein kinase superfamily protein;(source:Araport11) |
AT1G61370 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT2G28570 | hypothetical protein;(source:Araport11) |
AT4G24090 | homer protein;(source:Araport11) |
AT5G18750 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT2G19360 | tRNA-splicing ligase, putative (DUF239);(source:Araport11) |
AT5G63180 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G17440 | chromogranin (DUF1639);(source:Araport11) |
AT1G03982 | PAK-box/P21-Rho-binding family protein;(source:Araport11) |
AT1G02030 | C2H2-like zinc finger protein;(source:Araport11) |
AT1G06700 | Protein kinase superfamily protein;(source:Araport11) |
AT3G43550 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G12090 | Cornichon family protein;(source:Araport11) |
AT4G22280 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G08910 | DNAJ heat shock family protein;(source:Araport11) |
AT5G24320 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G09584 | pseudogene of nucleic acid binding / zinc ion binding protein;(source:Araport11) |
AT5G05310 | TLC ATP/ADP transporter;(source:Araport11) |
AT4G11410 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G17495 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-213 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G27340 | Myb domain protein;(source:Araport11) |
AT5G60700 | glycosyltransferase family protein 2;(source:Araport11) |
AT2G22942 | growth factor;(source:Araport11) |
AT4G30500 | transmembrane protein (DUF788);(source:Araport11) |
AT2G23834 | hypothetical protein;(source:Araport11) |
AT3G03610 | ELMO/CED-12 family protein;(source:Araport11) |
AT1G05450 | Encodes a Protease inhibitor/seed storage/LTP family protein |
AT4G15070 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G09620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G24920 | secE/sec61-gamma protein transport protein;(source:Araport11) |
AT2G16895 | pseudogene of UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G28515 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G48960 | Ribosomal protein L13e family protein;(source:Araport11) |
AT5G58610 | PHD finger transcription factor;(source:Araport11) |
AT5G66675 | transmembrane protein, putative (DUF677);(source:Araport11) |
AT1G29360 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-24 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT4G28930 | hypothetical protein;(source:Araport11) |
AT1G63820 | CCT motif family protein;(source:Araport11) |
AT4G29120 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT1G53625 | hypothetical protein;(source:Araport11) |
AT1G67270 | Zinc-finger domain of monoamine-oxidase A repressor R1 protein;(source:Araport11) |
AT4G21950 | hypothetical protein;(source:Araport11) |
AT5G09290 | Inositol monophosphatase family protein;(source:Araport11) |
AT5G47435 | encodes one of the two putative formyltetrahydrofolate deformylase. Located in the mitochondrion. Involved in photorespiratory tetrahydrofolate cycle. |
AT5G15260 | ribosomal protein L34e superfamily protein;(source:Araport11) |
AT1G10455 | B3 DNA-binding domain protein;(source:Araport11) |
AT1G11572 | Encodes a Plant thionin family protein |
AT1G04490 | hypothetical protein (DUF3527);(source:Araport11) |
AT4G26210 | Mitochondrial ATP synthase subunit G protein;(source:Araport11) |
AT4G37820 | transmembrane protein;(source:Araport11) |
AT4G07820 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT1G10720 | BSD domain-containing protein;(source:Araport11) |
AT1G76660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G02510 | NADH dehydrogenase (ubiquinone)s;(source:Araport11) |
AT2G02795 | transmembrane protein;(source:Araport11) |
AT4G12065 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT5G23650 | Homeodomain-like transcriptional regulator;(source:Araport11) |
AT2G32315 | Natural antisense transcript overlaps with AT2G32310;(source:Araport11) |
AT4G08340 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
AT3G05160 | Major facilitator superfamily protein;(source:Araport11) |
AT2G39160 | hypothetical protein;(source:Araport11) |
AT2G28270 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G43570 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT1G09645 | transmembrane protein;(source:Araport11) |
AT1G55830 | coiled-coil protein;(source:Araport11) |
AT1G73570 | HCP-like superfamily protein;(source:Araport11) |
AT3G17500 | F-box family protein;(source:Araport11) |
AT3G23245 | hypothetical protein;(source:Araport11) |
AT5G32678 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 0. P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G52800 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT1G50000 | methyltransferase;(source:Araport11) |
AT4G10520 | Subtilase family protein;(source:Araport11) |
AT1G21286 | Pseudogene of AT1G21245; wall-associated kinase-related protein |
AT2G28780 | P-hydroxybenzoic acid efflux pump subunit;(source:Araport11) |
AT2G35658 | transmembrane protein;(source:Araport11) |
AT1G76185 | NADH-ubiquinone oxidoreductase chain;(source:Araport11) |
AT2G25520 | Drug/metabolite transporter superfamily protein;(source:Araport11) |
AT3G52527 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-22 P-value blast match to GB:AAC02672 polyprotein (Ty1_Copia-element) (Arabidopsis arenosa);(source:TAIR10) |
AT4G10655 | Encodes a defensin-like (DEFL) family protein. |
AT1G33475 | SNARE-like superfamily protein;(source:Araport11) |
AT3G13280 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT5G09876 | hypothetical protein;(source:Araport11) |
AT3G20380 | TRAF-like family protein;(source:Araport11) |
AT3G13560 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G44860 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
AT2G33140 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT3G21540 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT4G32000 | Protein kinase superfamily protein;(source:Araport11) |
AT2G37440 | DNAse I-like superfamily protein;(source:Araport11) |
AT1G09620 | ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
AT5G65660 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT4G13330 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G18790 | pre-mRNA-splicing factor ISY1-like protein;(source:Araport11) |
AT1G73970 | obscurin-like protein;(source:Araport11) |
AT5G35610 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT3G52765 | pre-tRNA tRNA-Asp (anticodon: GTC);(source:Araport11, TAIR10) |
AT1G61830 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G28610 | LOW protein: ATP-dependent RNA helicase DRS1-like protein;(source:Araport11) |
AT1G53110 | proton pump-interactor;(source:Araport11) |
AT5G41800 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT3G23160 | plant/protein (DUF668);(source:Araport11) |
AT5G65180 | ENTH/VHS family protein;(source:Araport11) |
AT2G38823 | hypothetical protein;(source:Araport11) |
AT3G49630 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT4G08990 | DNA (cytosine-5-)-methyltransferase family protein;(source:Araport11) |
AT4G33180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G01030 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT1G74750 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G76705 | calmodulin binding protein;(source:Araport11) |
AT3G58600 | Adaptin ear-binding coat-associated protein 1 NECAP-1;(source:Araport11) |
AT2G16760 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT3G51440 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT3G45935 | pre-tRNA tRNA-Val (anticodon: AAC);(source:Araport11, TAIR10) |
AT2G39710 | Encodes a Cysteine-rich peptide (CRP) family protein |
AT1G80690 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT2G35250 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT2G46455 | OxaA/YidC-like membrane insertion protein;(source:Araport11) |
AT2G13190 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.5e-06 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G37510 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G42690 | transcription factor, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT1G14455 | hypothetical protein;(source:Araport11) |
AT4G27620 | intracellular protein transporter;(source:Araport11) |
AT5G37476 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-18 P-value blast match to GB:CAA37925 orf 3 (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G43640 | Signal recognition particle, SRP9/SRP14 subunit;(source:Araport11) |
AT4G09432 | Natural antisense transcript overlaps with AT4G09430;(source:Araport11) |
AT3G10116 | COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family;(source:Araport11) |
AT5G19221 | Natural antisense transcript overlaps with AT5G19220;(source:Araport11) |
AT1G14730 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT4G14280 | ARM repeat superfamily protein;(source:Araport11) |
AT5G55010 | hypothetical protein;(source:Araport11) |
AT4G29590 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G44198 | hypothetical protein;(source:Araport11) |
AT2G27630 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT5G35738 | pseudogene of zinc-dependent activator protein-1;(source:Araport11) |
AT1G11670 | MATE efflux family protein;(source:Araport11) |
AT2G24615 | Encodes a defensin-like (DEFL) family protein. |
AT2G23710 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G09370.1);(source:TAIR10) |
AT1G77730 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT5G04860 | splicing factor 3A subunit;(source:Araport11) |
AT5G50860 | Protein kinase superfamily protein;(source:Araport11) |
AT4G35985 | Senescence/dehydration-associated protein-like protein;(source:Araport11) |
AT5G03370 | acylphosphatase family;(source:Araport11) |
AT3G27330 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT1G70770 | Involved in cell wall modifications resulting in resistance to the biotroph Hpa. |
AT1G05675 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G06922 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-20 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT1G02750 | Drought-responsive family protein;(source:Araport11) |
AT2G37540 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G49170 | hypothetical protein;(source:Araport11) |
AT2G23900 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G61035 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT3G62280 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G43675 | similarity to non-LTR retroelement protein |
AT5G45500 | RNI-like superfamily protein;(source:Araport11) |
AT1G14390 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G38870 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT4G23720 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT3G51950 | Contains single CCCH domain. |
AT1G02590 | Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding protein;(source:Araport11) |
AT3G57460 | catalytic/ metal ion binding / metalloendopeptidase/ zinc ion binding protein;(source:Araport11) |
AT3G48070 | RING/U-box superfamily protein;(source:Araport11) |
AT1G66440 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G28923 | Pseudogene of AT5G01080; beta-galactosidase |
AT1G74010 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT5G24210 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G11925 | Encodes a Stigma-specific Stig1 family protein |
AT1G52070 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT5G24430 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT2G48030 | DNAse I-like superfamily protein;(source:Araport11) |
AT5G38130 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT3G54880 | zinc finger protein;(source:Araport11) |
AT4G08145 | transposable_element_gene;(source:Araport11);hypothetical protein, contains Pfam domain, PF04827: Protein of unknown function (DUF635);(source:TAIR10) |
AT1G52110 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT4G00890 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT1G03210 | Phenazine biosynthesis PhzC/PhzF protein;(source:Araport11) |
AT2G43620 | Chitinase family protein;(source:Araport11) |
AT2G41950 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT1G11360 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT5G51220 | ubiquinol-cytochrome C chaperone family protein;(source:Araport11) |
AT3G20730 | PPR superfamily protein;(source:Araport11) |
AT4G07940 | pre-mRNA-splicing factor CWC22-like protein, putative (DUF3245);(source:Araport11) |
AT1G69900 | Actin cross-linking protein;(source:Araport11) |
AT3G48205 | Encodes a Plant thionin family protein |
AT3G12410 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G55960 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G60783 | cyclin-dependent kinase inhibitor SMR2-like protein;(source:Araport11) |
AT2G18830 | RNA-binding (RRM/RBD/RNP motif) family protein;(source:Araport11) |
AT1G61400 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT5G05430 | RNA-binding protein;(source:Araport11) |
AT5G66670 | pectinesterase, putative (DUF677);(source:Araport11) |
AT5G13980 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT2G33970 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G18485 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G51750 | hypothetical protein;(source:Araport11) |
AT5G36903 | pseudogene of protein related to self-incompatibility |
AT5G01715 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
AT4G15563 | F-box-like protein;(source:Araport11) |
AT1G28990 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G29340 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT3G52285 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT2G13975 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G43920.1);(source:TAIR10) |
AT1G18382 | Natural antisense transcript overlaps with AT1G18380;(source:Araport11) |
AT2G13665 | Natural antisense transcript overlaps with AT2G13660;(source:Araport11) |
AT2G34060 | Peroxidase superfamily protein;(source:Araport11) |
AT1G65070 | DNA mismatch repair protein MutS, type 2;(source:Araport11) |
AT2G15670 | transmembrane protein;(source:Araport11) |
AT4G06538 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G27220 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT2G36630 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT4G04410 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-176 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT5G25040 | Major facilitator superfamily protein;(source:Araport11) |
AT5G54240 | membrane lipoprotein lipid attachment site-like protein, putative (DUF1223);(source:Araport11) |
AT4G33440 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G61260 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT1G68630 | PLAC8 family protein;(source:Araport11) |
AT3G47230 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G12505.1);(source:TAIR10) |
AT4G23580 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G71170 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT3G03000 | Calmodulin like protein localized in the plant vacuolar compartment with a function of binding and modifying the activity of a tonoplast transporter (AtNHX1) from within the vacuole in a Ca+2- and pH-dependent manner |
AT1G55880 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT3G46680 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G32295 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT3G04600 | Nucleotidylyl transferase superfamily protein;(source:Araport11) |
AT2G30820 | aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit;(source:Araport11) |
AT3G41761 | other_RNA;(source:Araport11) |
AT1G10585 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT4G04200 | Microsomal signal peptidase 25 kDa subunit (SPC25);(source:Araport11) |
AT1G74640 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G13228 | RING/U-box superfamily protein;(source:Araport11) |
AT5G25360 | hypothetical protein;(source:Araport11) |
AT5G35118 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.5e-10 P-value blast match to GB:NP_038607 L1 repeat, Tf subfamily, member 9 (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G46540 | ENTH/VHS family protein;(source:Araport11) |
AT5G25970 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT3G24927 | pseudogene of expressed protein;(source:Araport11) |
AT5G54860 | Major facilitator superfamily protein;(source:Araport11) |
AT3G28950 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT4G22020 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT3G26720 | Glycosyl hydrolase family 38 protein;(source:Araport11) |
AT2G02060 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G50030 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G03852 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT3G25090 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT4G30380 | Encodes a Plant Natriuretic Peptide (PNP). PNPs are a class of systemically mobile molecules distantly related to expansins; their biological role has remained elusive. |
AT3G03280 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT3G46840 | Subtilase family protein;(source:Araport11) |
AT2G25210 | Ribosomal protein L39 family protein;(source:Araport11) |
AT3G58770 | hypothetical protein;(source:Araport11) |
AT5G20860 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G08450 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G10890 | myosin heavy chain-like protein;(source:Araport11) |
AT1G11440 | hypothetical protein;(source:Araport11) |
AT4G37553 | Natural antisense transcript overlaps with AT4G37550 and AT4G37560;(source:Araport11) |
AT4G22190 | serine/arginine repetitive matrix-like protein;(source:Araport11) |
AT1G24733 | pseudogene of CCoAMT (caffeoyl-CoA 3-O-methyltransferase) |
AT5G22315 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT5G17110 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT3G22183 | hypothetical protein;(source:Araport11) |
AT3G22850 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT1G72141 | transmembrane protein;(source:Araport11) |
AT5G57000 | DEAD-box ATP-dependent RNA helicase;(source:Araport11) |
AT2G15780 | Cupredoxin superfamily protein;(source:Araport11) |
AT3G50120 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT1G11920 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G02655 | transmembrane protein;(source:Araport11) |
AT3G27997 | pseudogene of expressed protein;(source:Araport11) |
AT2G20142 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT4G08953 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.4e-22 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G03510 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G19250 | Glycoprotein membrane precursor GPI-anchored;(source:Araport11) |
AT3G62330 | Zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT3G11860 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
AT4G23515 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT3G03700 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT1G53610 | transmembrane protein;(source:Araport11) |
AT5G27495 | Encodes a defensin-like (DEFL) family protein. |
AT1G27921 | Natural antisense transcript overlaps with AT1G27920;(source:Araport11) |
AT4G03113 | transmembrane protein;(source:Araport11) |
AT3G54750 | downstream neighbor of Son;(source:Araport11) |
AT5G27510 | Protein kinase superfamily protein;(source:Araport11) |
AT5G47250 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT5G03705 | pre-tRNA tRNA-Leu (anticodon: AAG);(source:Araport11, TAIR10) |
AT5G43180 | transmembrane protein, putative (Protein of unknown function, DUF599);(source:Araport11) |
AT4G07800 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G13250.1);(source:TAIR10) |
AT1G26620 | T-box transcription factor, putative (DUF863);(source:Araport11) |
AT4G02480 | AAA-type ATPase family protein;(source:Araport11) |
AT3G11300 | hypothetical protein;(source:Araport11) |
AT3G13820 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G62920 | proteasome maturation factor;(source:Araport11) |
AT1G19810 | pseudogene of cell division cycle 48C;(source:Araport11) |
AT5G10110 | DNA-directed RNA polymerase subunit beta;(source:Araport11) |
AT3G58940 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G50190 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT1G04425 | other_RNA;(source:Araport11) |
AT1G13609 | Encodes a defensin-like (DEFL) family protein. |
AT5G34920 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 3.2e-40 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G24750 | pseudogene of glutamate receptor 2.2;(source:Araport11) |
AT1G77520 | O-methyltransferase family protein;(source:Araport11) |
AT2G46735 | death domain associated protein;(source:Araport11) |
AT3G11680 | aluminum activated malate transporter family protein;(source:Araport11) |
AT2G33690 | Late embryogenesis abundant protein, group 6;(source:Araport11) |
AT3G09385 | pseudogene of Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G07480 | Transcription factor IIA, alpha/beta subunit;(source:Araport11) |
AT1G05894 | hypothetical protein;(source:Araport11) |
AT1G67480 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G42100 | transposable_element_gene;(source:Araport11);similar to AT hook motif-containing protein-related [Arabidopsis thaliana] (TAIR:AT1G35940.1);(source:TAIR10) |
AT5G27095 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G63990 | Inositol monophosphatase family protein;(source:Araport11) |
AT2G39040 | Peroxidase superfamily protein;(source:Araport11) |
AT1G23710 | hypothetical protein (DUF1645);(source:Araport11) |
AT1G05950 | hypothetical protein;(source:Araport11) |
AT1G27750 | nucleic acid binding protein;(source:Araport11) |
AT4G31130 | keratin-associated protein (DUF1218);(source:Araport11) |
AT5G28823 | hypothetical protein;(source:Araport11) |
AT3G53190 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G03100 | F-box/RNI-like superfamily protein, expressed in the peroxisome. |
AT3G22540 | hypothetical protein (DUF1677);(source:Araport11) |
AT1G24485 | ER protein carbohydrate-binding protein;(source:Araport11) |
AT5G46890 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G02270 | Calcium-binding endonuclease/exonuclease/phosphatase family;(source:Araport11) |
AT5G18180 | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein;(source:Araport11) |
AT2G46150 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT1G54610 | Protein kinase superfamily protein;(source:Araport11) |
AT5G36090 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G28010.1);(source:TAIR10) |
AT1G26610 | C2H2-like zinc finger protein;(source:Araport11) |
AT5G12043 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT3G11720 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G19060 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT3G29970 | B12D protein;(source:Araport11) |
AT3G53775 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT5G16900 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G45690 | Encodes a member of the NAXT NPF subfamily. |
AT3G42255 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase;(source:TAIR10) |
AT3G33530 | Transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT1G22200 | Endoplasmic reticulum vesicle transporter protein;(source:Araport11) |
AT1G26860 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G01700.1);(source:TAIR10) |
AT5G04970 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G65560 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G47770 | Beta-galactosidase related protein;(source:Araport11) |
AT4G17790 | SNARE associated Golgi protein family;(source:Araport11) |
AT4G19380 | Long-chain fatty alcohol dehydrogenase family protein;(source:Araport11) |
AT3G15940 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G16800 | 3-methylglutaconyl-CoA hydratase localized to mitochondria. Knockout displays accelerated senescence when subjected to extended dark conditions;knockout senescing leaves and knockout seeds accumulate leu, ile, and val. |
AT1G07190 | Lon protease;(source:Araport11) |
AT3G61898 | transmembrane protein;(source:Araport11) |
AT1G80450 | VQ motif-containing protein;(source:Araport11) |
AT3G59230 | RNI-like superfamily protein;(source:Araport11) |
AT1G10050 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT1G69520 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G35334 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.3e-50 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G21520 | hypothetical protein;(source:Araport11) |
AT4G28990 | RNA-binding protein-like protein;(source:Araport11) |
AT4G26940 | Galactosyltransferase family protein;(source:Araport11) |
AT5G08690 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. The mRNA is cell-to-cell mobile. |
AT1G03030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G22760 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G16060 | ATP binding microtubule motor family protein;(source:Araport11) |
AT5G28600 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT1G35770.1);(source:TAIR10) |
AT3G44516 | Pseudogene of AT1G31990; unknown protein |
AT1G62050 | Ankyrin repeat family protein;(source:Araport11) |
AT3G53342 | hypothetical protein;(source:Araport11) |
AT1G53120 | RNA-binding S4 domain-containing protein;(source:Araport11) |
AT2G36650 | CHUP1-like protein;(source:Araport11) |
AT1G13230 | Encodes a leucine-rich repeat protein pii-2. Located in the endoplasmic reticulum/plasma membrane continuum in Arabidopsis roots. Required for growth promotion and enhanced seed production mediated by the endophytic fungus Piriformospora indica in Arabidopsis. |
AT5G10695 | methionyl-tRNA synthetase;(source:Araport11) |
AT1G28620 | pseudogene of GDSL-like Lipase/Acylhydrolase superfamily protein;(source:Araport11) |
AT5G22050 | Protein kinase superfamily protein;(source:Araport11) |
AT1G58050 | RNA helicase family protein;(source:Araport11) |
AT2G18370 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the lipid transfer protein (PR-14) family with the following members: At2g38540/LTP1, At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4, At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7, At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10, At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13, At5g62065/LTP14, At4g08530/LTP15. |
AT5G27705 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.2e-58 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT4G06542 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT4G15120 | VQ motif-containing protein;(source:Araport11) |
AT1G32928 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT1G15810 | S15/NS1, RNA-binding protein;(source:Araport11) |
AT3G23300 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G66860 | Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain-containing protein;(source:Araport11) |
AT1G45244 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G30430 | F-box family protein;(source:Araport11) |
AT4G02370 | pectinesterase (Protein of unknown function, DUF538);(source:Araport11) |
AT1G54700 | hypothetical protein;(source:Araport11) |
AT2G24735 | other_RNA;(source:Araport11) |
AT3G25210 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G54870 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
AT1G52800 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G57950 | cotton fiber protein;(source:Araport11) |
AT3G44718 | Encodes a Plant thionin family protein |
AT1G48400 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G06617 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-37 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G14860 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G20970 | calponin-like domain protein;(source:Araport11) |
AT5G28235 | Ulp1 protease family protein;(source:Araport11) |
AT3G58890 | RNI-like superfamily protein;(source:Araport11) |
AT1G32250 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT3G07510 | maternal effect embryo arrest protein;(source:Araport11) |
AT1G64870 | hypothetical protein;(source:Araport11) |
AT2G23700 | Itga6 (Protein of unknown function, DUF547);(source:Araport11) |
AT4G19220 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G54905 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.3e-08 P-value blast match to GB:AAC02666 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G36350 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT5G06220 | LETM1-like protein;(source:Araport11) |
AT1G55690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G14260 | LURP-one-like protein (DUF567);(source:Araport11) |
AT5G52530 | dentin sialophosphoprotein-like protein;(source:Araport11) |
AT1G63580 | Encodes a plasma membrane-localized protein with two DUF26 domains and a GPI anchor domain. |
AT1G33130 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.3e-125 P-value blast match to At5g36655.1/81-333 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G08610 | NADH dehydrogenase ubiquinone 1 alpha subcomplex subunit;(source:Araport11) |
AT1G80570 | RNI-like superfamily protein;(source:Araport11) |
AT5G58784 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT5G35570 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G27150 | Target gene of MIR2111-5p. |
AT2G05260 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G52960 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G13250.1);(source:TAIR10) |
AT5G03430 | phosphoadenosine phosphosulfate (PAPS) reductase family protein;(source:Araport11) |
AT5G10820 | Major facilitator superfamily protein;(source:Araport11) |
AT3G29033 | glycine-rich protein;(source:Araport11) |
AT3G50900 | hypothetical protein;(source:Araport11) |
AT1G28740 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT4G26470 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G67460 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G67050 | membrane-associated kinase regulator;(source:Araport11) |
AT5G63085 | Encodes a Plant thionin family protein |
AT1G17940 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT2G25460 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
AT1G67620 | Lojap-related protein;(source:Araport11) |
AT2G35850 | transmembrane protein;(source:Araport11) |
AT5G51795 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
AT5G64380 | Inositol monophosphatase family protein;(source:Araport11) |
AT3G23600 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G02550 | hypothetical protein;(source:Araport11) |
AT4G04090 | BTB/POZ domain-containing protein;(source:Araport11) |
AT5G52390 | PAR1 protein;(source:Araport11) |
AT3G57470 | Insulinase (Peptidase family M16) family protein;(source:Araport11) |
AT3G56300 | Cysteinyl-tRNA synthetase, class Ia family protein;(source:Araport11) |
AT5G05598 | Encodes a Defensin-like (DEFL) family protein |
AT4G13620 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. The mRNA is cell-to-cell mobile. |
AT1G71290 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G16175 | Thioesterase superfamily protein;(source:Araport11) |
AT1G40104 | hypothetical protein;(source:Araport11) |
AT1G05440 | C-8 sterol isomerase;(source:Araport11) |
AT5G28280 | pseudogene of sterol desaturase domain-containing protein;(source:Araport11) |
AT1G58320 | PLAC8 family protein;(source:Araport11) |
AT2G17340 | pantothenate kinase;(source:Araport11) |
AT2G20780 | Major facilitator superfamily protein;(source:Araport11) |
AT1G16225 | Target SNARE coiled-coil domain protein;(source:Araport11) |
AT3G53590 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT4G19500 | nucleoside-triphosphatase/transmembrane receptor/nucleotide binding/ATP binding protein;(source:Araport11) |
AT1G11540 | Sulfite exporter TauE/SafE family protein;(source:Araport11) |
AT5G33230 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G28960.1);(source:TAIR10) |
AT2G06760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.4e-38 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT4G23215 | pseudogene of cysteine-rich receptor-like protein kinase family protein |
AT3G43522 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to putative Ta11-like non-LTR retroelement protein;(source:TAIR10) |
AT3G58530 | RNI-like superfamily protein;(source:Araport11) |
AT5G60680 | transcription initiation factor TFIID subunit (Protein of unknown function, DUF584);(source:Araport11) |
AT1G47570 | RING/U-box superfamily protein;(source:Araport11) |
AT2G39580 | zinc finger C3H1 domain protein;(source:Araport11) |
AT1G69190 | encodes a bifunctional cytosolic hydroxymethyldihydropterin pyrophosphokinase/ dihydropteroate synthase (HPPK/DHPS)that is involved in tetrahydrofolate biosynthesis and is responsive to oxidative stress. |
AT1G02360 | Chitinase family protein;(source:Araport11) |
AT2G01460 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G07650 | Actin-binding FH2 protein;(source:Araport11) |
AT3G30705 | transmembrane protein;(source:Araport11) |
AT3G06665 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT3G62790 | NADH-ubiquinone oxidoreductase-like protein;(source:Araport11) |
AT1G58130 | pseudogene of F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT4G11200 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G30370.1);(source:TAIR10) |
AT1G02550 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G50340 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G15755 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G19120 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
AT4G30060 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G40920 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G21215 | transmembrane protein;(source:Araport11) |
AT2G20805 | DNA-binding storekeeper protein transcriptional regulator-like protein;(source:Araport11) |
AT5G10560 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G09280 | transmembrane protein;(source:Araport11) |
AT1G61360 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G38790 | ER lumen protein retaining receptor family protein;(source:Araport11) |
AT1G73325 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
AT5G62660 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G07190 | B-cell receptor-associated protein 31-like protein;(source:Araport11) |
AT1G76600 | PADRE protein up-regulated after infection by S. sclerotiorun. |
AT4G11440 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT2G42170 | Actin family protein;(source:Araport11) |
AT1G35660 | erythroid differentiation factor-like protein;(source:Araport11) |
AT2G12640 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.7e-25 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G22122 | hypothetical protein;(source:Araport11) |
AT5G28580 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 7.3e-33 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT5G50310 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G37975 | Yos1-like protein;(source:Araport11) |
AT4G01110 | late embryogenesis abundant hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G19055 | hypothetical protein;(source:Araport11) |
AT3G49270 | extensin-like protein;(source:Araport11) |
AT5G37750 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT2G40200 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G29720 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 2.7e-94 P-value blast match to gb|AAL06421.1|AF378079_1 reverse transcriptase (Athila4) (Arabidopsis thaliana) (Gypsy_Ty3-family);(source:TAIR10) |
AT3G27390 | transmembrane protein;(source:Araport11) |
AT1G16230 | Target SNARE coiled-coil domain protein;(source:Araport11) |
AT5G07910 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G30310 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.6e-19 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT2G16990 | Major facilitator superfamily protein;(source:Araport11) |
AT2G17525 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G01750 | LURP-one-like protein (DUF567);(source:Araport11) |
AT4G06549 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, temporary gene name assignment;(source:TAIR10) |
AT3G43850 | hypothetical protein;(source:Araport11) |
AT4G27840 | SNARE-like superfamily protein;(source:Araport11) |
AT3G01960 | hypothetical protein;(source:Araport11) |
AT3G03855 | Annotated as pseudogene of disease resistance protein.Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 . |
AT5G54400 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G08350 | Mutants have decreased tolerance to cold and oxidative stress. Gene expression induced by drought and ABA. |
AT1G80520 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT4G32960 | BRISC/BRCA1-A complex protein;(source:Araport11) |
AT1G48268 | pseudogene of F-box family protein |
AT5G38440 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT2G11220 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-16 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G38065 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G09890 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT3G45050 | transmembrane protein;(source:Araport11) |
AT5G49990 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G32700 | PLATZ transcription factor family protein;(source:Araport11) |
AT2G14090 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G33930 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G37795 | pre-tRNA tRNA-Asn (anticodon: GTT);(source:Araport11, TAIR10) |
AT2G39920 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT1G69910 | Protein kinase superfamily protein;(source:Araport11) |
AT3G45530 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G04990 | serine/arginine repetitive matrix-like protein (DUF761);(source:Araport11) |
AT1G59850 | ARM repeat superfamily protein;(source:Araport11) |
AT1G12890 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT1G34330 | Possibly not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G57840 | pseudogene of Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G20350 | actin cytoskeleton-regulatory complex pan-like protein;(source:Araport11) |
AT2G03972 | pseudogene of heat shock protein |
AT5G42210 | Major facilitator superfamily protein;(source:Araport11) |
AT1G10340 | Ankyrin repeat family protein;(source:Araport11) |
AT5G61495 | hypothetical protein;(source:Araport11) |
AT2G44040 | Dihydrodipicolinate reductase, bacterial/plant;(source:Araport11) |
AT5G55660 | DEK domain-containing chromatin associated protein;(source:Araport11) |
AT1G63860 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G08310 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G04030 | eisosome protein;(source:Araport11) |
AT4G07700 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.9e-13 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G15270 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT2G47500 | P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain-containing protein;(source:Araport11) |
AT1G60075 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G46295 | transmembrane protein;(source:Araport11) |
AT3G46600 | GRAS family transcription factor;(source:Araport11) |
AT5G53030 | hypothetical protein;(source:Araport11) |
AT5G48680 | Sterile alpha motif (SAM) domain-containing protein;(source:Araport11) |
AT1G66920 | Protein kinase superfamily protein;(source:Araport11) |
AT5G41380 | CCT motif family protein;(source:Araport11) |
AT1G04778 | hypothetical protein;(source:Araport11) |
AT1G53350 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT3G56750 | plant/protein;(source:Araport11) |
AT3G50665 | pre-tRNA tRNA-Glu (anticodon: TTC);(source:Araport11, TAIR10) |
AT5G41890 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G39380 | TSL-kinase interacting-like protein;(source:Araport11) |
AT1G31175 | cytochrome C oxidase biogenesis Cmc1-like protein;(source:Araport11) |
AT4G32375 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G33890 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G46871 | Encodes a defensin-like (DEFL) family protein. |
AT2G27900 | coiled-coil protein;(source:Araport11) |
AT5G48770 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G58410 | HEAT/U-box domain-containing protein;(source:Araport11) |
AT3G24190 | Protein kinase superfamily protein;(source:Araport11) |
AT1G65720 | transmembrane protein;(source:Araport11) |
AT4G19340 | SCD6 protein-like protein;(source:Araport11) |
AT1G14710 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G17250 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G57820 | zinc ion binding protein;(source:Araport11) |
AT2G40270 | Protein kinase family protein;(source:Araport11) |
AT1G55840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G71730 | hypothetical protein;(source:Araport11) |
AT1G61550 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT2G11320 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, blastp match of 41%25 identity and 1.7e-199 P-value to GP|14140296|gb|AAK54302.1|AC034258_20|AC034258 putative helicase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT3G18250 | Putative membrane lipoprotein;(source:Araport11) |
AT1G62550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to non-LTR retroelement reverse transcriptase-like protein GI:9758853 from (Arabidopsis thaliana);(source:TAIR10) |
AT4G36470 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G14960 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT4G01380 | plastocyanin-like domain-containing protein;(source:Araport11) |
AT1G03820 | E6-like protein;(source:Araport11) |
AT3G15357 | phosphopantothenoylcysteine decarboxylase subunit;(source:Araport11) |
AT5G51620 | Uncharacterized protein family (UPF0172);(source:Araport11) |
AT4G05018 | transmembrane protein;(source:Araport11) |
AT3G21320 | EARLY FLOWERING protein;(source:Araport11) |
AT5G44530 | Subtilase family protein;(source:Araport11) |
AT1G34097 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.3e-158 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT4G08490 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.7e-81 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G28927 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 3.9e-45 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT5G42830 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G16950 | krueppel-like factor;(source:Araport11) |
AT3G44060 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT2G32450 | Calcium-binding tetratricopeptide family protein;(source:Araport11) |
AT2G03932 | Encodes a defensin-like (DEFL) family protein. |
AT3G15310 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G32621.1);(source:TAIR10) |
AT1G12100 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G09600 | Protein kinase superfamily protein;(source:Araport11) |
AT1G36622 | transmembrane protein;(source:Araport11) |
AT5G43030 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G65150 | TRAF-like family protein;(source:Araport11) |
AT2G45710 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
AT5G24352 | Serine/threonine-protein kinase WNK (With No Lysine)-like protein;(source:Araport11) |
AT4G11540 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G15810 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G06570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G36630 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp1/En/Spm), has a 2.5e-213 P-value blast match to ref|NP_189784.1| TNP1-related protein (Arabidopsis thaliana) (CACTA-element);(source:TAIR10) |
AT3G62500 | F-box protein RMF;(source:Araport11) |
AT5G17270 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
AT4G13160 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT5G24610 | cyclic AMP-responsive element-binding protein;(source:Araport11) |
AT2G18570 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G58720 | RING/U-box superfamily protein;(source:Araport11) |
AT2G16410 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G15550.1);(source:TAIR10) |
AT1G45832 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.3e-80 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G06700 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.7e-54 P-value blast match to dbj|BAB64937.1| TdcA1-ORF1-ORF2 (Daucus carota) Spm/En-like (CACTA-like);(source:TAIR10) |
AT3G49140 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G74680 | Exostosin family protein;(source:Araport11) |
AT3G10195 | Encodes a defensin-like (DEFL) family protein. |
AT3G46280 | kinase-like protein;(source:Araport11) |
AT5G61940 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT2G30984 | Natural antisense transcript overlaps with AT2G30985;(source:Araport11) |
AT1G07473 | hypothetical protein;(source:Araport11) |
AT3G54980 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G04780 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G39980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT2G05171 | Pseudogene of AT3G18310 |
AT1G16640 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT3G43570 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G39630 | Encodes a putative dolichyl-phosphate β-glucosyltransferase. |
AT2G02061 | Nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT3G42645 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 3.4e-127 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G42760 | DUF1685 family protein;(source:Araport11) |
AT5G49665 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT2G36180 | EF hand calcium-binding protein family;(source:Araport11) |
AT2G33255 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G01700 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G27420 | bromodomain testis-specific protein;(source:Araport11) |
AT5G48900 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G25400 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G25820 | Exostosin family protein;(source:Araport11) |
AT1G04230 | rRNA-processing EFG1-like protein (DUF2361);(source:Araport11) |
AT1G42350 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-102 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G10613 | RNA-directed DNA polymerase (reverse transcriptase)-related family protein;(source:Araport11) |
AT1G59950 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT2G25975 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.1e-14 P-value blast match to GB:CAA26446 ORF2 (Ty1_Copia-element) (Drosophila melanogaster);(source:TAIR10) |
AT1G07280 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G08430 | SWIB/MDM2 and Plus-3 and GYF domain-containing protein;(source:Araport11) |
AT5G23760 | Copper transport protein family;(source:Araport11) |
AT3G02270 | Trimeric LpxA-like enzyme;(source:Araport11) |
AT1G28930 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G22410 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT4G11385 | hypothetical protein;(source:Araport11) |
AT2G24130 | Leucine-rich receptor-like protein kinase family protein;(source:Araport11) |
AT5G47225 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
AT5G02940 | ion channel POLLUX-like protein, putative (DUF1012);(source:Araport11) |
AT1G78922 | transmembrane protein;(source:Araport11) |
AT5G10460 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT2G24395 | chaperone protein dnaJ-like protein;(source:Araport11) |
AT1G77640 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT1G04720 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT2G29920 | hypothetical protein;(source:Araport11) |
AT2G26240 | Transmembrane proteins 14C;(source:Araport11) |
AT5G41550 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G35240 | DNA-directed RNA polymerase subunit beta, putative (DUF630 and DUF632);(source:Araport11) |
AT2G13125 | hypothetical protein;(source:Araport11) |
AT2G34670 | benzoyl-CoA reductase subunit C, putative (DUF630 and DUF632);(source:Araport11) |
AT1G23201 | GCK domain protein;(source:Araport11) |
AT3G11560 | LETM1-like protein;(source:Araport11) |
AT3G63052 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G23340 | RNI-like superfamily protein;(source:Araport11) |
AT1G72600 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT2G03250 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT3G15090 | GroES-like zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT4G19520 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G03330 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G12915 | Ribosomal protein S5/Elongation factor G/III/V family protein;(source:Araport11) |
AT2G31860 | pseudogene of poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
AT4G06750 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 3.0e-60 P-value blast match to gb|AAG52024.1|AC022456_5 Tam1-homologous transposon protein TNP2, putative;(source:TAIR10) |
AT2G14160 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G29660 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G02840 | ARM repeat superfamily protein;(source:Araport11) |
AT2G19960 | hAT family dimerization domain-containing protein;(source:Araport11) |
AT3G52030 | F-box family protein with WD40/YVTN repeat doamin;(source:Araport11) |
AT5G11140 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT5G04120 | Encodes a cofactor-dependent phosphoglycerate mutase (dPGM) - like protein with phosphoserine phosphatase activity that may be responsible for serine anabolism. |
AT2G36695 | hypothetical protein;(source:Araport11) |
AT5G56975 | pre-tRNA tRNA-Val (anticodon: CAC);(source:Araport11, TAIR10) |
AT1G74990 | RING/U-box superfamily protein;(source:Araport11) |
AT5G51880 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G59080 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G19650 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT4G18180 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G14517 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-38 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G35023 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 9.4e-88 P-value blast match to O65231 /281-442 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G04545 | Encodes a defensin-like (DEFL) family protein. |
AT3G09080 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G19400 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT3G54190 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G19300 | methyltransferase C9orf114 protein;(source:Araport11) |
AT2G30220 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G49280 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G11550 | ARM repeat superfamily protein;(source:Araport11) |
AT1G18700 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT3G05350 | Metallopeptidase M24 family protein;(source:Araport11) |
AT4G01897 | dihydroorotate dehydrogenase;(source:Araport11) |
AT4G01245 | hypothetical protein;(source:Araport11) |
AT1G28940 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT2G02210 | transposable_element_gene;(source:Araport11);pseudogene, Ulp1 protease family, contains Pfam profile PF02902: Ulp1 protease family, C-terminal catalytic domain;(source:TAIR10) |
AT5G62610 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G20820 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G75810 | transmembrane protein;(source:Araport11) |
AT4G32440 | Plant Tudor-like RNA-binding protein;(source:Araport11) |
AT4G34103 | pseudogene of protein binding / zinc ion binding protein |
AT1G02650 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G66855 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT2G13146 | Pseudogene of AT2G12905 |
AT3G12850 | COP9 signalosome complex-related / CSN complex-like protein;(source:Araport11) |
AT2G26695 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
AT5G04730 | Ankyrin-repeat containing protein;(source:Araport11) |
AT3G11320 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT2G29995 | PSY3-like protein;(source:Araport11) |
AT2G11950 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.9e-158 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT1G18290 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT5G40348 | Natural antisense transcript overlaps with AT5G40350;(source:Araport11) |
AT3G29640 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G29632.1);(source:TAIR10) |
AT1G59550 | This locus is annotated as a protein-coding gene in TAIR10. Based on communication with Jean-Luc GALLOIS (April 2013), this gene is re-annotated as a UBX domain-containing pseudogene. Note that the Map Detail Image on the locus detial page and in GBrowse will not be updated until after the next genome release. |
AT3G26770 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G46535 | hypothetical protein;(source:Araport11) |
AT2G28440 | proline-rich family protein;(source:Araport11) |
AT1G16360 | LEM3 (ligand-effect modulator 3) family protein / CDC50 family protein;(source:Araport11) |
AT2G32520 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT4G29905 | hypothetical protein;(source:Araport11) |
AT3G06880 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G32291 | Pseudogene of AT2G31470; F-box family protein |
AT1G57700 | Protein kinase superfamily protein;(source:Araport11) |
AT2G16595 | Translocon-associated protein (TRAP), alpha subunit;(source:Araport11) |
AT4G23915 | Encodes an alanine tRNA with the anticodon CGC that recognizes the alanine codon GCG. |
AT2G03130 | Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein;(source:Araport11) |
AT3G19025 | pseudogene of alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G08240 | transmembrane protein;(source:Araport11) |
AT1G63600 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT3G61820 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G39020 | SH3 domain-containing protein;(source:Araport11) |
AT5G06540 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G18460 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
AT5G48605 | Encodes a defensin-like (DEFL) family protein. |
AT5G42905 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT3G44261 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G07825 | transmembrane protein;(source:Araport11) |
AT1G31390 | TRAF-like family protein;(source:Araport11) |
AT1G58090 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G11320 | GDSL esterase/lipase;(source:Araport11) |
AT3G55780 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT4G16235 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
AT3G54530 | hypothetical protein;(source:Araport11) |
AT2G32235 | hypothetical protein;(source:Araport11) |
AT4G28940 | Phosphorylase superfamily protein;(source:Araport11) |
AT2G05030 | transposable_element_gene;(source:Araport11);contains domain GAG/POL/ENV POLYPROTEIN (PTHR10178);(source:TAIR10) |
AT3G52710 | hypothetical protein;(source:Araport11) |
AT1G36700 | pseudogene of Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G06599 | ubiquitin family protein;(source:Araport11) |
AT1G66860 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT3G17120 | transmembrane protein;(source:Araport11) |
AT3G17710 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G44935 | hypothetical protein;(source:Araport11) |
AT3G12150 | alpha/beta hydrolase family protein;(source:Araport11) |
AT4G08860 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / ribonuclease H [Arabidopsis thaliana] (TAIR:AT2G27870.1);(source:TAIR10) |
AT3G18620 | DHHC-type zinc finger family protein;(source:Araport11) |
AT2G33360 | cadherin EGF LAG seven-pass G-type receptor, putative (DUF3527);(source:Araport11) |
AT1G26690 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT3G48570 | secE/sec61-gamma protein transport protein;(source:Araport11) |
AT5G59500 | protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase;(source:Araport11) |
AT2G13274 | Pseudogene of AT2G13150; transcription factor |
AT1G75670 | DNA-directed RNA polymerase;(source:Araport11) |
AT4G33130 | rho GTPase-activating protein;(source:Araport11) |
AT3G57350 | Nucleoporin interacting component (Nup93/Nic96-like) family protein;(source:Araport11) |
AT5G22620 | encodes a putative 2-carboxy-D-arabinitol 1-phosphate phosphatase |
AT1G16760 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G03900 | pseudogene of zinc transporter 7 precursor;(source:Araport11) |
AT5G58280 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT4G34420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G59725 | DNAJ heat shock family protein;(source:Araport11) |
AT4G16650 | O-fucosyltransferase family protein;(source:Araport11) |
AT4G23610 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT2G02515 | hypothetical protein;(source:Araport11) |
AT4G33830 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT1G23330 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G25870 | hypothetical protein;(source:Araport11) |
AT4G33467 | hypothetical protein;(source:Araport11) |
AT3G06180 | Ribosomal protein L34e superfamily protein;(source:Araport11) |
AT2G16380 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G46616 | hypothetical protein;(source:Araport11) |
AT1G80200 | transmembrane protein;(source:Araport11) |
AT4G28706 | pfkB-like carbohydrate kinase family protein;(source:Araport11) |
AT1G56630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G66480 | Involved in chloroplast avoidance movement under intermediate and high light intensities; PADRE protein up-regulated after infection by S. sclerotiorun. |
AT3G27200 | Cupredoxin superfamily protein;(source:Araport11) |
AT4G39900 | adenine deaminase;(source:Araport11) |
AT2G09860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 6.1e-47 P-value blast match to GB:BAA20419 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G35607 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 8.6e-07 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G54955 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G05145.1);(source:TAIR10) |
AT3G13020 | hAT transposon superfamily protein;(source:Araport11) |
AT2G06985 | pseudogene of Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G43826 | pseudogene of P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G12280 | copper amine oxidase family protein;(source:Araport11) |
AT4G28380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT3G46470 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G50790 | esterase/lipase/thioesterase family protein;(source:Araport11) |
AT4G10980 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.7e-44 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G12460 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G08540 | ribosomal RNA small subunit methyltransferase J;(source:Araport11) |
AT4G21865 | hypothetical protein;(source:Araport11) |
AT4G28070 | AFG1-like ATPase family protein;(source:Araport11) |
AT4G39610 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT2G13940 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.4e-197 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT4G33985 | membrane insertase, putative (DUF1685);(source:Araport11) |
AT1G07170 | Similar to human splicing factor 3b, 14 kda subunit, SF3b14b. |
AT3G45080 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G33950 | pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10) |
AT2G18420 | Encodes a Gibberellin-regulated GASA/GAST/Snakin family protein |
AT1G45248 | Nucleolar histone methyltransferase-related protein;(source:Araport11) |
AT3G03845 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT2G20463 | Encodes a defensin-like (DEFL) family protein. |
AT3G09050 | 8-amino-7-oxononanoate synthase;(source:Araport11) |
AT3G12030 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
AT5G01090 | Concanavalin A-like lectin family protein;(source:Araport11) |
AT1G67820 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G50770 | Aminotransferase-like, plant mobile domain family protein;(source:Araport11) |
AT4G15960 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G43755 | non-LTR retrolelement reverse transcriptase-like protein;(source:Araport11) |
AT1G74300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G57840 | encodes a protein whose sequence is similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase from Dianthus caryophyllus (gi:2239091) |
AT5G08440 | transmembrane protein;(source:Araport11) |
AT1G17147 | VQ motif-containing protein;(source:Araport11) |
AT4G03816 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.6e-22 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT4G12423 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-26 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT3G50210 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT5G40275 | other_RNA;(source:Araport11) |
AT1G36640 | transmembrane protein;(source:Araport11) |
AT1G30130 | DUF1365 family protein;(source:Araport11) |
AT4G08039 | Encodes a defensin-like (DEFL) family protein. |
AT2G24693 | Encodes a defensin-like (DEFL) family protein. |
AT5G26700 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G10780 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT5G11960 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT4G11521 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT1G18270 | ketose-bisphosphate aldolase class-II family protein;(source:Araport11) |
AT5G02680 | methionine-tRNA ligase;(source:Araport11) |
AT1G30350 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G61910 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT1G35200 | pseudogene of Ribosomal protein L4/L1 family;(source:Araport11) |
AT5G44220 | F-box family protein;(source:Araport11) |
AT2G14590 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G27606.1);(source:TAIR10) |
AT3G49950 | GRAS family transcription factor;(source:Araport11) |
AT5G37480 | maltase-glucoamylase, intestinal protein;(source:Araport11) |
AT2G40955 | hypothetical protein;(source:Araport11) |
AT4G19570 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G10080 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G32105 | Beta-1,3-N-Acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G50220 | B3 domain protein;(source:Araport11) |
AT4G09060 | hypothetical protein;(source:Araport11) |
AT5G39995 | pseudogene of myb domain protein 110;(source:Araport11) |
AT4G27850 | Glycine-rich protein family;(source:Araport11) |
AT1G65900 | plant/protein;(source:Araport11) |
AT1G35115 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.1e-168 P-value blast match to gb|AAO73527.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G21650 | Encodes protein phosphatase 2A (PP2A) B'zeta subunit. Targeted to mitochondria. |
AT5G27280 | Zim17-type zinc finger protein;(source:Araport11) |
AT5G23510 | hypothetical protein;(source:Araport11) |
AT5G21105 | Plant L-ascorbate oxidase;(source:Araport11) |
AT1G71300 | Vps52 / Sac2 family;(source:Araport11) |
AT1G61480 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G31960 | hypothetical protein;(source:Araport11) |
AT4G18501 | hypothetical protein;(source:Araport11) |
AT3G50200 | hypothetical protein (DUF247);(source:Araport11) |
AT2G16240 | pre-tRNA tRNA-Gln (anticodon: CTG);(source:Araport11, TAIR10) |
AT5G51180 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G54240 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G35170 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT4G01700 | Chitinase family protein;(source:Araport11) |
AT5G66950 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT2G41380 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G23520 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT4G19902 | pseudogene of Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT3G58193 | snoRNA;(source:Araport11) |
AT5G56980 | Pathogen-associated molecular pattern-induced gene.Responsive to jasmonic acid and wounding. |
AT5G38610 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G04313 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.8e-52 P-value blast match to GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum)GB:CAA32025 ORF (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT4G11945 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to transposases;(source:TAIR10) |
AT3G07180 | GPI transamidase component PIG-S-like protein;(source:Araport11) |
AT2G44580 | zinc ion binding protein;(source:Araport11) |
AT2G40230 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G06570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G25185 | Encodes a defensin-like (DEFL) family protein. |
AT3G01380 | sulfatase and phosphatidylinositolglycan class N domain-containing protein;(source:Araport11) |
AT1G68470 | Exostosin family protein;(source:Araport11) |
AT1G77200 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT5G56890 | Protein kinase superfamily protein;(source:Araport11) |
AT4G16040 | transmembrane protein;(source:Araport11) |
AT2G29910 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G04850 | ubiquitin-associated (UBA)/TS-N domain-containing protein;(source:Araport11) |
AT1G16040 | phosphatidylinositol-glycan biosynthesis class F-like protein;(source:Araport11) |
AT5G02240 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile. |
AT5G41590 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G22800 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G07330 | NFU1 iron-sulfur cluster protein;(source:Araport11) |
AT3G28940 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT5G17680 | disease resistance protein (TIR-NBS-LRR class);(source:Araport11) |
AT2G12770 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.9e-24 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT4G24750 | Rhodanese/Cell cycle control phosphatase superfamily protein;(source:Araport11) |
AT3G11500 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT2G46915 | DUF3754 family protein, putative (DUF3754);(source:Araport11) |
AT4G23090 | transmembrane protein;(source:Araport11) |
AT2G03821 | hypothetical protein;(source:Araport11) |
AT1G06137 | transmembrane protein;(source:Araport11) |
AT5G62140 | ATP-dependent Clp protease ATP-binding subunit;(source:Araport11) |
AT4G36945 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT3G53490 | valine-tRNA ligase;(source:Araport11) |
AT1G42602 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G32425 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.5e-44 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT1G36980 | transmembrane 50A-like protein;(source:Araport11) |
AT1G56120 | Leucine-rich repeat transmembrane protein kinase;(source:Araport11) |
AT1G55770 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G35780 | N-lysine methyltransferase;(source:Araport11) |
AT2G30985 | hypothetical protein;(source:Araport11) |
AT2G33205 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT1G73740 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G41740 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G27771 | pseudogene of (SAUR) auxin-responsive family protein |
AT4G27657 | hypothetical protein;(source:Araport11) |
AT2G14080 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G36297 | pseudogene of aspartyl protease family protein |
AT3G58910 | F-box family protein;(source:Araport11) |
AT5G38260 | Protein kinase superfamily protein;(source:Araport11) |
AT5G60978 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT3G27990 | None;(source:Araport11) |
AT4G05497 | RNI-like superfamily protein;(source:Araport11) |
AT1G61100 | disease resistance protein (TIR class);(source:Araport11) |
AT4G33160 | F-box family protein;(source:Araport11) |
AT5G66790 | Protein kinase superfamily protein;(source:Araport11) |
AT3G17150 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G03010 | RNI-like superfamily protein;(source:Araport11) |
AT2G14870 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G45211 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT2G47680 | zinc finger (CCCH type) helicase family protein;(source:Araport11) |
AT3G10780 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT2G28810 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT3G49370 | Calcium-dependent protein kinase (CDPK) family protein;(source:Araport11) |
AT4G09490 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G03730 | pyrroline-5-carboxylate reductase;(source:Araport11) |
AT1G19968 | other_RNA;(source:Araport11) |
AT2G20298 | pseudogene of exonuclease family protein |
AT3G32043 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.2e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G40590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G43250 | coiled-coil protein (DUF572);(source:Araport11) |
AT2G29030 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT2G35360 | ubiquitin family protein;(source:Araport11) |
AT5G14330 | transmembrane protein;(source:Araport11) |
AT3G07230 | wound-responsive protein-like protein;(source:Araport11) |
AT4G37250 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G61600 | DUF1262 family protein (DUF1262);(source:Araport11) |
AT5G59700 | Protein kinase superfamily protein;(source:Araport11) |
AT1G56540 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G75530 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
AT5G59490 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G06780 | glycine-rich protein;(source:Araport11) |
AT4G29750 | CRS1 / YhbY (CRM) domain-containing protein;(source:Araport11) |
AT2G42320 | nucleolar protein gar2-like protein;(source:Araport11) |
AT1G05920 | B3 domain protein (DUF313);(source:Araport11) |
AT5G23903 | transmembrane protein;(source:Araport11) |
AT5G50130 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G38396 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT5G51730 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G55560 | Protein kinase superfamily protein;(source:Araport11) |
AT1G21528 | hypothetical protein;(source:Araport11) |
AT1G20990 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G17740 | hypothetical protein;(source:Araport11) |
AT4G11950 | transmembrane protein, putative (DUF1191);(source:Araport11) |
AT4G21700 | DUF2921 family protein, putative (DUF2921);(source:Araport11) |
AT1G26773 | hypothetical protein;(source:Araport11) |
AT5G22545 | hypothetical protein;(source:Araport11) |
AT5G28630 | glycine-rich protein;(source:Araport11) |
AT2G26380 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G55550 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G16210 | HEAT repeat-containing protein;(source:Araport11) |
AT4G36750 | Quinone reductase family protein;(source:Araport11) |
AT1G20816 | outer envelope pore-like protein;(source:Araport11) |
AT3G43450 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G20760.1);(source:TAIR10) |
AT5G64090 | hyccin;(source:Araport11) |
AT3G17920 | Outer arm dynein light chain 1 protein;(source:Araport11) |
AT4G04190 | transmembrane protein;(source:Araport11) |
AT4G07630 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, contains Pfam profile PF03078: ATHILA ORF-1 family;(source:TAIR10) |
AT3G55470 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G80745 | Transcription factor TFIIIC, tau55-related protein;(source:Araport11) |
AT3G04750 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G48960 | HAD-superfamily hydrolase, subfamily IG, 5-nucleotidase;(source:Araport11) |
AT5G15040 | Paired amphipathic helix (PAH2) superfamily protein;(source:Araport11) |
AT1G76770 | HSP20-like chaperone |
AT4G12990 | transmembrane protein;(source:Araport11) |
AT1G69110 | pseudogene of Ribosomal protein S10p/S20e family protein;(source:Araport11) |
AT3G57160 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT3G25130 | acidic leucine-rich nuclear phosphoprotein 32 family B protein;(source:Araport11) |
AT1G67340 | HCP-like superfamily protein with MYND-type zinc finger;(source:Araport11) |
AT4G17250 | transmembrane protein;(source:Araport11) |
AT5G66250 | kinectin-like protein;(source:Araport11) |
AT1G27620 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G52710 | Rubredoxin-like superfamily protein;(source:Araport11) |
AT5G48440 | FAD-dependent oxidoreductase family protein;(source:Araport11) |
AT1G09510 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase |
AT5G49430 | WD40/YVTN repeat and Bromo-WDR9-I-like domain-containing protein;(source:Araport11) |
AT1G21280 | Copia-like polyprotein/retrotransposon;(source:Araport11) |
AT2G02770 | 4-phosphopantetheinyl transferase domain protein;(source:Araport11) |
AT5G42560 | Abscisic acid-responsive (TB2/DP1, HVA22) family protein;(source:Araport11) |
AT3G22250 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G26940 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G30930 | F-box family protein;(source:Araport11) |
AT3G22430 | RNA recognition motif XS domain protein;(source:Araport11) |
AT1G08710 | F-box protein that is induced in roots by drought stress. |
AT2G03010 | hypothetical protein (DUF577);(source:Araport11) |
AT3G27350 | transcriptional regulator ATRX-like protein;(source:Araport11) |
AT3G62580 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT5G31821 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.2e-86 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT3G33130 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.9e-256 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT3G60260 | ELMO/CED-12 family protein;(source:Araport11) |
AT5G19175 | Encodes a defensin-like (DEFL) family protein. |
AT5G38000 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT4G37100 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT5G65490 | suppressor-like protein;(source:Araport11) |
AT1G67920 | hypothetical protein;(source:Araport11) |
AT3G25240 | sulfate/thiosulfate import ATP-binding protein, putative (DUF506);(source:Araport11) |
AT5G21090 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G11830 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G30540 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT1G56415 | Expressed protein;(source:Araport11) |
AT4G25690 | stress response NST1-like protein;(source:Araport11) |
AT4G09770 | TRAF-like family protein;(source:Araport11) |
AT5G47710 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G07150 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G23390 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT2G13760 | no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
AT3G28770 | transmembrane protein, putative (DUF1216);(source:Araport11) |
AT3G03405 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G25597 | transmembrane protein;(source:Araport11) |
AT4G22530 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G33205 | pseudogene of hypothetical protein (Protein of unknown function;(source:Araport11) |
AT3G47090 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G15840 | pseudogene of hypothetical protein;(source:Araport11) |
AT2G44430 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT1G23170 | Involved in cell wall modifications resulting in resistance to the biotroph Hpa. |
AT1G24148 | hypothetical protein;(source:Araport11) |
AT5G54780 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT1G06260 | Cysteine peptidase,activity detected in leaf and flower. |
AT5G11090 | serine-rich protein-like protein;(source:Araport11) |
AT1G12990 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G75710 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G29780 | Expression of the gene is affected by multiple stresses. Knockout and overexpression lines show no obvious phenotypes. |
AT5G03880 | Thioredoxin family protein;(source:Araport11) |
AT4G28340 | pyrroline-5-carboxylate reductase;(source:Araport11) |
AT1G02070 | zinc ion-binding protein;(source:Araport11) |
AT2G41710 | Integrase-type DNA-binding superfamily protein;(source:Araport11) |
AT4G28830 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G67620 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT5G05350 | PLAC8 family protein;(source:Araport11) |
AT1G27330 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
AT5G56747 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-45 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G61198 | other_RNA;(source:Araport11) |
AT1G67880 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G56700 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
AT1G51200 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT1G31130 | polyadenylate-binding protein 1-B-binding protein;(source:Araport11) |
AT3G50180 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT1G22040 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G09780 | TRAF-like family protein;(source:Araport11) |
AT1G29600 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT5G51105 | ECA1 gametogenesis family protein (DUF1278);(source:Araport11) |
AT5G63340 | hypothetical protein;(source:Araport11) |
AT1G44790 | ChaC-like family protein;(source:Araport11) |
AT1G03290 | ELKS/Rab6-interacting/CAST family protein;(source:Araport11) |
AT5G67430 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G16800 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G36960 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G56660 | MAEBL domain protein;(source:Araport11) |
AT5G48540 | receptor-like protein kinase-related family protein;(source:Araport11) |
AT5G09760 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G43440 | encodes a protein whose sequence is similar to ACC oxidase |
AT5G45310 | coiled-coil protein;(source:Araport11) |
AT3G17080 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G33870 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G30650 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G10175.1);(source:TAIR10) |
AT2G41342 | hypothetical protein;(source:Araport11) |
AT2G25355 | PNAS-3-like protein;(source:Araport11) |
AT3G19660 | hypothetical protein;(source:Araport11) |
AT1G12190 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G25630 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.8e-20 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT3G29771 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G59070 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G63230 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G01180 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G07310 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G62180 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G51450 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT2G34240 | ubiquitin carboxyl-terminal hydrolase-like protein, putative (Protein with domains of unknown function DUF627 and DUF632);(source:Araport11) |
AT5G08780 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
AT1G19390 | Wall-associated kinase family protein;(source:Araport11) |
AT3G26115 | Pyridoxal-5-phosphate-dependent enzyme family protein;(source:Araport11) |
AT5G35760 | Beta-galactosidase related protein;(source:Araport11) |
AT1G13000 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT1G31163 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT5G11080 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT3G54100 | O-fucosyltransferase family protein;(source:Araport11) |
AT3G29725 | pseudogene of HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G21060 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT1G02540 | hypothetical protein;(source:Araport11) |
AT3G60480 | StAR lipid transfer-like protein;(source:Araport11) |
AT3G52870 | IQ calmodulin-binding motif family protein;(source:Araport11) |
AT1G28830 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G29034 | transmembrane protein;(source:Araport11) |
AT1G22800 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G24175 | kinesin-like protein;(source:Araport11) |
AT3G56410 | hypothetical protein (DUF3133);(source:Araport11) |
AT5G38820 | Encodes a putative amino acid transporter. |
AT4G06676 | etoposide-induced protein;(source:Araport11) |
AT2G14878 | other_RNA;(source:Araport11) |
AT2G46550 | transmembrane protein;(source:Araport11) |
AT2G14690 | Encodes a putative glycosyl hydrolase family 10 protein (xylanase). |
AT1G53366 | hypothetical protein;(source:Araport11) |
AT3G29690 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT5G26740 | organic solute transporter ostalpha protein (DUF300);(source:Araport11) |
AT3G59180 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT1G48070 | Thioredoxin superfamily protein;(source:Araport11) |
AT2G04115 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G06660 | transmembrane/coiled-coil protein (Protein of unknown function DUF106, transmembrane);(source:Araport11) |
AT4G35720 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT1G45010 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT3G10250 | histidine-tRNA ligase;(source:Araport11) |
AT2G44780 | Encodes a Uclacyanin/Basic blue family protein [pseudogene] |
AT5G19970 | GRAS family transcription factor family protein;(source:Araport11) |
AT3G19200 | hypothetical protein;(source:Araport11) |
AT1G10417 | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
AT2G01990 | XRI1-like protein;(source:Araport11) |
AT1G64295 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT2G40990 | DHHC-type zinc finger family protein;(source:Araport11) |
AT4G35750 | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein;(source:Araport11) |
AT5G50220 | F-box family protein;(source:Araport11) |
AT4G21903 | MATE efflux family protein;(source:Araport11) |
AT2G36815 | mid region of cactin;(source:Araport11) |
AT1G62370 | RING/U-box superfamily protein;(source:Araport11) |
AT3G54780 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G05140 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT1G36970 | transmembrane protein, putative (DUF1985);(source:Araport11) |
AT4G03824 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.5e-62 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT1G74088 | galacturonosyltransferase;(source:Araport11) |
AT4G16190 | Papain family cysteine protease;(source:Araport11) |
AT3G33030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.8e-50 P-value blast match to GB:CAA72990 open reading frame 2 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G27660 | hypothetical protein;(source:Araport11) |
AT2G23330 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.9e-195 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT3G59320 | solute carrier family 35 protein (DUF914);(source:Araport11) |
AT4G34065 | Pseudogene of AT5G06265; hyaluronan mediated motility receptor-related |
AT5G14210 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G59680 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G37670 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G01925 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G35600 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 6.1e-41 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G01570 | plectin-like protein;(source:Araport11) |
AT2G05330 | BTB/POZ domain-containing protein;(source:Araport11) |
AT1G27100 | Actin cross-linking protein;(source:Araport11) |
AT1G68140 | zinc finger/BTB domain protein, putative (DUF1644);(source:Araport11) |
AT1G09195 | Ppx-GppA phosphatase;(source:Araport11) |
AT5G35207 | transposable_element_gene;(source:Araport11);pseudogene, similar to simiar to ribosomal protein, blastp match of 45%25 identity and 6.7e-47 P-value to GP|19571128|dbj|BAB86552.1||AP003566 simiar to ribosomal protein {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT5G44290 | Protein kinase superfamily protein;(source:Araport11) |
AT2G20740 | Tetraspanin family protein;(source:Araport11) |
AT3G50130 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT1G76994 | hypothetical protein;(source:Araport11) |
AT1G58055 | Encodes a defensin-like (DEFL) family protein. |
AT5G27220 | Frigida-like protein;(source:Araport11) |
AT2G10950 | BSD domain-containing protein;(source:Araport11) |
AT1G50130 | pseudogene of ATP binding/leucine-tRNA ligases/aminoacyl-tRNA ligase;(source:Araport11) |
AT3G01850 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT2G04925 | Encodes a defensin-like (DEFL) family protein. |
AT3G10290 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT5G47740 | Adenine nucleotide alpha hydrolases-like superfamily protein;(source:Araport11) |
AT5G56690 | FBD, F-box and Leucine Rich Repeat domains containing protein;(source:Araport11) |
AT2G28310 | trimethylguanosine synthase (DUF707);(source:Araport11) |
AT1G60970 | SNARE-like superfamily protein;(source:Araport11) |
AT2G42955 | F-box/LRR protein;(source:Araport11) |
AT5G28253 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.2e-60 P-value blast match to Q9SHN7 /450-633 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT1G36660 | pseudogene of FAR1-related sequence 5;(source:Araport11) |
AT5G44730 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G45760 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT4G08230 | glycine-rich protein;(source:Araport11) |
AT1G73630 | EF hand calcium-binding protein family;(source:Araport11) |
AT5G02670 | hypothetical protein;(source:Araport11) |
AT3G16750 | hypothetical protein;(source:Araport11) |
AT1G28400 | GATA zinc finger protein;(source:Araport11) |
AT1G14600 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G48745 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT5G49560 | Putative methyltransferase family protein;(source:Araport11) |
AT4G10140 | transmembrane protein;(source:Araport11) |
AT2G19150 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G54067 | B3 domain protein;(source:Araport11) |
AT2G40113 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT4G21902 | hypothetical protein;(source:Araport11) |
AT3G52580 | Ribosomal protein S11 family protein;(source:Araport11) |
AT2G10300 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT2G19010 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT2G30840 | encodes a protein whose sequence is similar to 2-oxoglutarate-dependent dioxygenase |
AT2G28750 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 27%25 identity and 1.8e-07 P-value to GP|14018103|gb|AAK52166.1|AC084831_20|AC084831 putative reverse transcriptase {Oryza sativa};(source:TAIR10) |
AT2G28080 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G17500 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G10970 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT3G54925 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G20852 | pre-tRNA tRNA-Cys (anticodon: GCA);(source:Araport11, TAIR10) |
AT3G16565 | threonyl and alanyl tRNA synthetase second additional domain-containing protein;(source:Araport11) |
AT4G25620 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G73850 | DNA ligase (DUF1666);(source:Araport11) |
AT1G63530 | hypothetical protein;(source:Araport11) |
AT2G44260 | DUF946 family protein (DUF946);(source:Araport11) |
AT2G41810 | imidazolonepropionase (Protein of unknown function, DUF642);(source:Araport11) |
AT1G61500 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G08340 | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein;(source:Araport11) |
AT5G47730 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G61440 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT1G47813 | hypothetical protein;(source:Araport11) |
AT3G59570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT1G70450 | Its expression is enriched in root hair cells (compared to non-root hair cells) and this enrichment is associated with increase in the transcription-associated mark trimethylation of H3 lysine 4 (H3K4me3) and decrease in the Polycomb silencing-associated mark trimethylation of H3 lysine 27 (H3K27me3) in root hair cells relative to non-root hair cells. |
AT2G40205 | Ribosomal protein L41 family;(source:Araport11) |
AT5G49580 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT3G32925 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.1e-13 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G15700 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G06330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G61345 | pre-tRNA tRNA-Lys (anticodon: TTT);(source:Araport11, TAIR10) |
AT2G31800 | Integrin-linked protein kinase family;(source:Araport11) |
AT3G52105 | DIS3-exonuclease-like protein;(source:Araport11) |
AT5G66820 | transmembrane protein;(source:Araport11) |
AT5G51470 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT3G25080 | hypothetical protein;(source:Araport11) |
AT1G08440 | aluminum activated malate transporter family protein;(source:Araport11) |
AT3G42160 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G11110 | LisH and RanBPM domains containing protein;(source:Araport11) |
AT1G04555 | transmembrane protein;(source:Araport11) |
AT1G13310 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT1G18210 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G10860 | hypothetical protein;(source:Araport11) |
AT2G47200 | hypothetical protein;(source:Araport11) |
AT2G22160 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT4G17850 | hypothetical protein;(source:Araport11) |
AT1G61770 | J domain protein. The mRNA is cell-to-cell mobile. |
AT5G32702 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.2e-150 P-value blast match to dbj|BAA78425.1| polyprotein (Arabidopsis thaliana) (AtRE1) (Ty1_Copia-element);(source:TAIR10) |
AT2G31902 | Natural antisense transcript overlaps with AT2G31900;(source:Araport11) |
AT1G66450 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G37980 | Zinc-binding dehydrogenase family protein;(source:Araport11) |
AT2G37880 | MIZU-KUSSEI-like protein (Protein of unknown function, DUF617);(source:Araport11) |
AT3G30281 | Pseudogene of AT1G19260; hAT dimerisation domain-containing protein |
AT3G13882 | Ribosomal protein L34;(source:Araport11) |
AT1G13605 | Encodes a defensin-like (DEFL) family protein. |
AT3G58310 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
AT4G29270 | HAD superfamily, subfamily IIIB acid phosphatase;(source:Araport11) |
AT2G07480 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.4e-101 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT5G45170 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G18310 | ubiquitin hydrolase;(source:Araport11) |
AT5G25070 | neurofilament light protein;(source:Araport11) |
AT5G54062 | egg cell-secreted-like protein;(source:Araport11) |
AT5G05090 | Homeodomain-like superfamily protein;(source:Araport11) |
AT3G48830 | tRNA nucleotidyltransferase/polyA polymerase family protein;(source:Araport11) |
AT2G46375 | hypothetical protein;(source:Araport11) |
AT3G02590 | Fatty acid hydroxylase superfamily protein;(source:Araport11) |
AT2G27660 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G19160 | transglutaminase family protein;(source:Araport11) |
AT5G47050 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT3G22920 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G66235 | no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
AT1G66210 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT3G27327 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.7e-320 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G23510 | OBP32pep protein;(source:Araport11) |
AT2G43375 | other_RNA;(source:Araport11) |
AT4G31441 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G53635 | hypothetical protein;(source:Araport11) |
AT2G05910 | LURP-one-like protein (DUF567);(source:Araport11) |
AT3G06680 | Ribosomal L29e protein family;(source:Araport11) |
AT1G59770 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.2e-49 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G62330 | hypothetical protein;(source:Araport11) |
AT1G33590 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G51160 | Ankyrin repeat family protein;(source:Araport11) |
AT5G58595 | snoRNA;(source:Araport11) |
AT4G01740 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G52780 | PII, uridylyltransferase (DUF2921);(source:Araport11) |
AT5G49540 | Rab5-interacting family protein;(source:Araport11) |
AT5G50330 | Protein kinase superfamily protein;(source:Araport11) |
AT4G35710 | DUF241 domain protein, putative (DUF241);(source:Araport11) |
AT5G37250 | RING/U-box superfamily protein;(source:Araport11) |
AT2G31740 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G35070 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT5G51670 | hypothetical protein (DUF668);(source:Araport11) |
AT3G53270 | Small nuclear RNA activating complex (SNAPc), subunit SNAP43 protein;(source:Araport11) |
AT5G03020 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G46940 | fold protein;(source:Araport11) |
AT1G63220 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G41860 | transmembrane protein;(source:Araport11) |
AT1G32780 | GroES-like zinc-binding dehydrogenase family protein;(source:Araport11) |
AT2G42770 | Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein;(source:Araport11) |
AT5G25280 | serine-rich protein-like protein;(source:Araport11) |
AT1G63205 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT5G37017 | Pseudogene of AT5G16486 |
AT3G53080 | D-galactoside/L-rhamnose binding SUEL lectin protein;(source:Araport11) |
AT1G67130 | F-box family protein;(source:Araport11) |
AT2G44200 | pre-mRNA splicing factor domain-containing protein;(source:Araport11) |
AT4G38550 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT2G31432 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT3G62650 | hypothetical protein;(source:Araport11) |
AT1G67570 | zinc finger CONSTANS-like protein (DUF3537);(source:Araport11) |
AT2G43141 | snoRNA;(source:Araport11) |
AT5G49680 | Conserved among eukaryotes, similar to Arabidopsis SABRE. The phenotype of the kip/sab double mutant suggests related functions for both genes, however, the KIP protein is mostly required for tip-growth. Predicted to be targeted to the secretory pathway. mRNA was detected in all organs, with most abundance in pollen and roots. |
AT2G13280 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative reverse transcriptase, blastp match of 27%25 identity and 7.6e-27 P-value to GP|20279456|gb|AAM18736.1|AC092548_14|AC092548 putative reverse transcriptase {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT1G23590 | OBP32pep protein, putative (Domain of unknown function DUF220);(source:Araport11) |
AT2G37435 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT4G31660 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT2G31820 | Ankyrin repeat family protein;(source:Araport11) |
AT1G11620 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G38255 | hypothetical protein (DUF239);(source:Araport11) |
AT3G03670 | Peroxidase superfamily protein;(source:Araport11) |
AT4G28900 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.7e-236 P-value blast match to GB:AAA57005 Hopscotch polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT4G32970 | BRISC/BRCA1-A complex protein;(source:Araport11) |
AT3G44150 | Expp1 protein;(source:Araport11) |
AT1G50690 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT2G04680 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G23080 | transmembrane protein, putative (DUF239);(source:Araport11) |
AT3G20460 | Major facilitator superfamily protein;(source:Araport11) |
AT4G18255 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT5G41660 | transmembrane protein;(source:Araport11) |
AT5G58210 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G02090 | hypothetical protein;(source:Araport11) |
AT5G41810 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT2G24620 | S-locus glycoprotein family protein;(source:Araport11) |
AT5G23460 | hypothetical protein;(source:Araport11) |
AT4G28088 | Low temperature and salt responsive protein family;(source:Araport11) |
AT5G51510 | jagunal-like protein;(source:Araport11) |
AT2G18690 | transmembrane protein;(source:Araport11) |
AT5G28288 | Encodes a defensin-like (DEFL) family protein. |
AT3G45030 | Ribosomal protein S10p/S20e family protein;(source:Araport11) |
AT5G02615 | pre-tRNA tRNA-Arg (anticodon: TCG);(source:Araport11, TAIR10) |
AT2G04042 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.0e-26 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G49120 | DUF581 family protein, putative (DUF581);(source:Araport11) |
AT3G10180 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT3G13990 | dentin sialophosphoprotein, putative (DUF1296);(source:Araport11) |
AT5G37450 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G08350 | Endomembrane protein 70 protein family;(source:Araport11) |
AT5G18550 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT5G13810 | Glutaredoxin family protein;(source:Araport11) |
AT5G37130 | Protein prenylyltransferase superfamily protein;(source:Araport11) |
AT3G20300 | extracellular ligand-gated ion channel protein (DUF3537);(source:Araport11) |
AT2G41835 | zinc finger (C2H2 type, AN1-like) family protein;(source:Araport11) |
AT5G13560 | structural maintenance of chromosomes protein;(source:Araport11) |
AT3G55735 | pre-tRNA tRNA-Met;(source:Araport11, TAIR10) |
AT4G29950 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT1G74780 | Nodulin-like / Major Facilitator Superfamily protein;(source:Araport11) |
AT3G55677 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G22403 | other_RNA;(source:Araport11) |
AT4G14610 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT4G02317 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.6e-25 P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
AT1G06540 | hypothetical protein;(source:Araport11) |
AT1G61105 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT4G40011 | hypothetical protein;(source:Araport11) |
AT2G09992 | pseudogene of disease-resistance protein |
AT4G22440 | hypothetical protein;(source:Araport11) |
AT3G07195 | RPM1-interacting protein 4 (RIN4) family protein;(source:Araport11) |
AT2G31990 | Exostosin family protein;(source:Araport11) |
AT3G15130 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G50350 | membrane insertase, putative (DUF1685);(source:Araport11) |
AT5G10660 | calmodulin-binding protein-like protein;(source:Araport11) |
AT1G54445 | Encodes a defensin-like (DEFL) family protein. |
AT4G18660 | delay of germination protein;(source:Araport11) |
AT2G46380 | extra-large G-like protein, putative (DUF3133);(source:Araport11) |
AT3G52535 | Natural antisense transcript overlaps with AT3G52540;(source:Araport11) |
AT2G14570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G48290.1);(source:TAIR10) |
AT1G35430 | transmembrane protein;(source:Araport11) |
AT3G20150 | Kinesin motor family protein;(source:Araport11) |
AT2G44370 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G62990 | myelin transcription factor-like protein;(source:Araport11) |
AT1G47705 | pseudogene of F-box/RNI/FBD-like domain protein;(source:Araport11) |
AT3G30740 | pseudogene of Ribosomal protein S25 family protein;(source:Araport11) |
AT2G21520 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT1G09160 | Protein phosphatase 2C family protein;(source:Araport11) |
AT1G47655 | Dof-type zinc finger DNA-binding family protein;(source:Araport11) |
AT2G01580 | transmembrane protein;(source:Araport11) |
AT5G44910 | Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11) |
AT3G12390 | Nascent polypeptide-associated complex (NAC), alpha subunit family protein;(source:Araport11) |
AT5G38393 | pseudogene of F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G04840 | Ribosomal protein S3Ae;(source:Araport11) |
AT5G53990 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT1G35340 | ATP-dependent protease La (LON) domain protein;(source:Araport11) |
AT1G74790 | catalytics;(source:Araport11) |
AT4G21213 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G42440 | Protein kinase superfamily protein;(source:Araport11) |
AT5G52410 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
AT2G04046 | Encodes a defensin-like (DEFL) family protein. |
AT3G28400 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.6e-39 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT5G60150 | hypothetical protein;(source:Araport11) |
AT3G60850 | hypothetical protein;(source:Araport11) |
AT5G28570 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G12725.1);(source:TAIR10) |
AT3G44400 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT4G12180 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.2e-28 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT2G46620 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G52120 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT3G25590 | micronuclear linker histone polyprotein-like protein;(source:Araport11) |
AT1G68330 | membrane-associated kinase regulator;(source:Araport11) |
AT3G19850 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT5G55530 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G70581 | other_RNA;(source:Araport11) |
AT2G47540 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G74290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G58590 | other_RNA;(source:Araport11) |
AT1G12070 | Immunoglobulin E-set superfamily protein;(source:Araport11) |
AT4G03380 | hypothetical protein;(source:Araport11) |
AT4G17150 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G22060 | contains Pfam profile: PF01657 Domain of unknown function that is usually associated with protein kinase domain Pfam:PF00069, however this protein does not have the protein kinase domain |
AT5G34864 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.3e-143 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT5G23850 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT4G28780 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G59710 | actin cross-linking protein (DUF569);(source:Araport11) |
AT5G46720 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT5G48657 | defense protein-like protein;(source:Araport11) |
AT1G73490 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G26440 | transmembrane protein, putative (DUF707);(source:Araport11) |
AT3G21080 | ABC transporter-like protein;(source:Araport11) |
AT3G28695 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT1G73655 | FKBP-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT1G25460 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G44720 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
AT3G04854 | hypothetical protein;(source:Araport11) |
AT4G36640 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G62499 | YTH family protein;(source:Araport11) |
AT1G61475 | ATP binding / protein kinase;(source:Araport11) |
AT3G07320 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT1G33610 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT1G43980 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G28703 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT3G50540 | hypothetical protein;(source:Araport11) |
AT3G13590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G58280 | MATH domain/coiled-coil protein;(source:Araport11) |
AT5G37470 | hypothetical protein (DUF577);(source:Araport11) |
AT3G04330 | Kunitz family trypsin and protease inhibitor protein;(source:Araport11) |
AT4G33140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G21010 | PADRE proteinup-regulated after infection by S. sclerotiorun. |
AT2G23300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G28894 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.8e-23 P-value blast match to GB:AAD12998 pol polyprotein (Ty1_Copia-element) (Zea mays);(source:TAIR10) |
AT1G78410 | VQ motif-containing protein;(source:Araport11) |
AT5G14140 | nucleic acid binding / zinc ion binding protein;(source:Araport11) |
AT4G35670 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT5G50460 | secE/sec61-gamma protein transport protein;(source:Araport11) |
AT4G27654 | transmembrane protein;(source:Araport11) |
AT3G63020 | hypothetical protein (DUF3049);(source:Araport11) |
AT3G29120 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 5.8e-98 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT2G33855 | transmembrane protein;(source:Araport11) |
AT5G45220 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G60760 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT5G28295 | hypothetical protein;(source:Araport11) |
AT2G40995 | Encodes a defensin-like (DEFL) family protein. |
AT3G04980 | DNAJ heat shock N-terminal domain-containing protein;(source:Araport11) |
AT5G10605 | methyltransferase;(source:Araport11) |
AT4G01515 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.1e-18 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G58210 | TRAF-like family protein;(source:Araport11) |
AT3G45095 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.4e-140 P-value blast match to dbj|BAA78426.1| polyprotein (AtRE2-1) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT2G44380 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G47550 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT2G39540 | Gibberellin-regulated family protein;(source:Araport11) |
AT2G30890 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT4G26040 | hypothetical protein;(source:Araport11) |
AT1G53633 | hypothetical protein;(source:Araport11) |
AT4G17215 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G65470 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G22390 | FANTASTIC four-like protein (DUF3049);(source:Araport11) |
AT5G30380 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
AT1G25530 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT5G62970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT5G40510 | Sucrase/ferredoxin-like family protein;(source:Araport11) |
AT5G37040 | F-box family protein;(source:Araport11) |
AT4G18900 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G07140 | Protein kinase superfamily protein;(source:Araport11) |
AT5G22860 | Serine carboxypeptidase S28 family protein;(source:Araport11) |
AT1G28790 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G35370 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT5G35380 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT3G25990 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G00005 | PRA1 (Prenylated rab acceptor) family protein;(source:Araport11) |
AT5G52030 | TraB family protein;(source:Araport11) |
AT3G48140 | B12D protein;(source:Araport11) |
AT4G03695 | pseudogene of hypothetical protein;(source:Araport11) |
AT4G32630 | ArfGap/RecO-like zinc finger domain-containing protein;(source:Araport11) |
AT4G16146 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
AT1G12380 | hypothetical protein;(source:Araport11) |
AT2G26050 | hypothetical protein (DUF1644);(source:Araport11) |
AT3G25400 | dCTP pyrophosphatase-like protein;(source:Araport11) |
AT3G04360 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT5G54760 | Translation initiation factor SUI1 family protein;(source:Araport11) |
AT3G05950 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT5G24690 | plant/protein, putative (DUF3411);(source:Araport11) |
AT3G17400 | F-box family protein;(source:Araport11) |
AT4G23510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT5G12040 | Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein;(source:Araport11) |
AT3G51330 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT5G01210 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT4G06571 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G46552 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.6e-184 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT4G31310 | AIG2-like (avirulence induced gene) family protein;(source:Araport11) |
AT5G17960 | Encodes a member of a Cys-rich protein family known as C1-clan proteins, that contains C1_2, C1_3 and ZZ/PHD type C1 domains. Its expression is responsive to phytohormones and is affected by biotic (chitin) and different abiotic (salinity, drought, cold and UV) treatments. |
AT2G28605 | Encodes a PsbP domain-OEC23 like protein localized in thylakoid (peripheral-lumenal side). |
AT4G08640 | ATP binding protein;(source:Araport11) |
AT5G39785 | hypothetical protein (DUF1666);(source:Araport11) |
AT3G22030 | Receptor protein kinase-like protein;(source:Araport11) |
AT4G10170 | SNARE-like superfamily protein;(source:Araport11) |
AT2G20350 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT4G08780 | Peroxidase superfamily protein;(source:Araport11) |
AT2G32870 | TRAF-like family protein;(source:Araport11) |
AT3G46730 | NB-ARC domain-containing disease resistance protein;(source:Araport11) |
AT5G07820 | Plant calmodulin-binding protein-like protein;(source:Araport11) |
AT5G25860 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT1G53660 | Nucleotide/sugar transporter family protein |
AT5G59210 | myosin heavy chain-like protein;(source:Araport11) |
AT5G51490 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT4G00580 | COP1-interacting protein-like protein;(source:Araport11) |
AT2G41550 | Rho termination factor;(source:Araport11) |
AT3G51340 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G07795 | transposable_element_gene;(source:Araport11);pseudogene, replication protein A1;(source:TAIR10) |
AT5G42330 | hypothetical protein;(source:Araport11) |
AT5G01660 | influenza virus NS1A-binding protein;(source:Araport11) |
AT4G11930 | hypothetical protein;(source:Araport11) |
AT3G55590 | Glucose-1-phosphate adenylyltransferase family protein;(source:Araport11) |
AT4G03480 | Ankyrin repeat family protein;(source:Araport11) |
AT4G30390 | UDP-arabinopyranose mutase;(source:Araport11) |
AT4G09300 | LisH and RanBPM domains containing protein;(source:Araport11) |
AT2G45610 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G69450 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G16930 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G58412 | Encodes a Plant thionin family protein |
AT4G14190 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G23440 | Peptidase C15, pyroglutamyl peptidase I-like protein;(source:Araport11) |
AT2G10990 | pseudogene of reverse transcriptase-like protein;(source:Araport11) |
AT3G21351 | transmembrane protein;(source:Araport11) |
AT1G35710 | kinase family with leucine-rich repeat domain-containing protein;(source:Araport11) |
AT5G51800 | Protein kinase superfamily protein;(source:Araport11) |
AT1G05650 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G05786 | hypothetical protein;(source:Araport11) |
AT2G31345 | transmembrane protein;(source:Araport11) |
AT2G22820 | hypothetical protein;(source:Araport11) |
AT1G64680 | beta-carotene isomerase D27;(source:Araport11) |
AT1G28640 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT3G53820 | C2H2 and C2HC zinc fingers superfamily protein;(source:Araport11) |
AT3G61700 | helicase with zinc finger protein;(source:Araport11) |
AT3G23175 | HR-like lesion-inducing protein-like protein;(source:Araport11) |
AT5G59990 | CCT motif family protein;(source:Araport11) |
AT1G44191 | Encodes a ECA1 gametogenesis related family protein |
AT2G05133 | Pseudogene of AT2G37680 |
AT2G02550 | PIN domain-like family protein;(source:Araport11) |
AT1G54450 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G42290 | transcription activator-like protein;(source:Araport11) |
AT1G51823 | hypothetical protein;(source:Araport11) |
AT4G01040 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G37270 | RING/U-box superfamily protein;(source:Araport11) |
AT5G39430 | DUF1336 family protein, putative (DUF1336);(source:Araport11) |
AT3G44710 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT4G00895 | ATPase, F1 complex, OSCP/delta subunit protein;(source:Araport11) |
AT1G36070 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT2G40250 | SGNH hydrolase-type esterase superfamily protein;(source:Araport11) |
AT3G55710 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G63930 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G24450 | Transcription factor IIIC, subunit 5;(source:Araport11) |
AT5G17830 | Plasma-membrane choline transporter family protein;(source:Araport11) |
AT4G37483 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G03610 | plant/protein (DUF789);(source:Araport11) |
AT5G35740 | Carbohydrate-binding X8 domain superfamily protein;(source:Araport11) |
AT5G12340 | PADRE protein up-regulated after infection by S. sclerotiorum. |
AT5G15390 | tRNA/rRNA methyltransferase (SpoU) family protein;(source:Araport11) |
AT3G46860 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT2G20280 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT4G36700 | RmlC-like cupins superfamily protein;(source:Araport11) |
AT4G23364 | Pseudogene of AT4G23340; oxidoreductase, 2OG-Fe(II) oxygenase family protein |
AT5G47860 | Gut esterase (DUF1350);(source:Araport11) |
AT2G44820 | axoneme-associated protein MST101(2) protein;(source:Araport11) |
AT1G11145 | hypothetical protein (DUF674);(source:Araport11) |
AT3G48660 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
AT4G36660 | polyol transporter, putative (DUF1195);(source:Araport11) |
AT1G05120 | Helicase protein with RING/U-box domain-containing protein;(source:Araport11) |
AT3G27510 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G68680 | SH3/FCH domain protein;(source:Araport11) |
AT1G71910 | hypothetical protein;(source:Araport11) |
AT3G26130 | Cellulase (glycosyl hydrolase family 5) protein;(source:Araport11) |
AT4G27852 | Natural antisense transcript overlaps with AT4G27850 and AT4G27860;(source:Araport11) |
AT2G13690 | PRLI-interacting factor;(source:Araport11) |
AT1G18900 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G15790 | RING/U-box superfamily protein;(source:Araport11) |
AT5G46260 | disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G43720 | FAM136A-like protein (DUF842);(source:Araport11) |
AT5G47150 | YDG/SRA domain-containing protein;(source:Araport11) |
AT5G16700 | Glycosyl hydrolase superfamily protein;(source:Araport11) |
AT5G36980 | U3 small nucleolar RNA-associated protein;(source:Araport11) |
AT2G14520 | CBS domain protein (DUF21);(source:Araport11) |
AT2G23200 | Protein kinase superfamily protein;(source:Araport11) |
AT2G07600 | pseudogene of NADH-Ubiquinone oxidoreductase (complex I);(source:Araport11) |
AT1G24240 | Ribosomal protein L19 family protein;(source:Araport11) |
AT1G52910 | fiber (DUF1218);(source:Araport11) |
AT1G28970 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G20045 | transmembrane protein;(source:Araport11) |
AT3G14880 | transcription factor-like protein;(source:Araport11) |
AT1G79740 | hAT transposon superfamily;(source:Araport11) |
AT2G25482 | Encodes a ECA1 gametogenesis related family protein |
AT2G33390 | hypothetical protein;(source:Araport11) |
AT3G20260 | DUF1666 family protein (DUF1666);(source:Araport11) |
AT5G38275 | pseudogene of PR5-like receptor kinase;(source:Araport11) |
AT1G27470 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT2G37195 | acyl-CoA-binding domain protein;(source:Araport11) |
AT1G49100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G34550 | F-box protein;(source:Araport11) |
AT5G43000 | hypothetical protein;(source:Araport11) |
AT4G18940 | RNA ligase/cyclic nucleotide phosphodiesterase family protein;(source:Araport11) |
AT3G57820 | pseudogene of Translation protein SH3-like family protein;(source:Araport11) |
AT3G06950 | Pseudouridine synthase family protein;(source:Araport11) |
AT5G28830 | calcium-binding EF hand family protein;(source:Araport11) |
AT5G18500 | Protein kinase superfamily protein;(source:Araport11) |
AT5G66340 | hypothetical protein;(source:Araport11) |
AT1G63830 | PLAC8 family protein;(source:Araport11) |
AT5G25451 | Pseudogene of AT5G25440; protein kinase family protein |
AT5G62890 | Xanthine/uracil permease family protein;(source:Araport11) |
AT1G60180 | pseudogene of F-box family protein |
AT1G64380 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT3G04140 | Ankyrin repeat family protein;(source:Araport11) |
AT5G52055 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.7e-30 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G01960 | RING/U-box superfamily protein;(source:Araport11) |
AT4G19239 | Pseudogene of AT5G01080; beta-galactosidase |
AT1G24530 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G48210 | Protein kinase superfamily protein;(source:Araport11) |
AT3G53235 | hypothetical protein;(source:Araport11) |
AT1G52810 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G34690 | pseudogene of maturase K;(source:Araport11) |
AT3G27520 | cryptic loci regulator;(source:Araport11) |
AT3G07273 | hypothetical protein;(source:Araport11) |
AT2G25735 | hypothetical protein;(source:Araport11) |
AT1G52320 | kinesin-like protein;(source:Araport11) |
AT5G64830 | programmed cell death 2 C-terminal domain-containing protein;(source:Araport11) |
AT1G36940 | myotubularin-like protein;(source:Araport11) |
AT1G73400 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G62220 | Protein kinase superfamily protein;(source:Araport11) |
AT4G39270 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G15053 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT1G68440 | Transmembrane protein;(source:Araport11). Expression induced by abiotic stressors such as ABA, drought, heat, light, NaCl, osmotic stress and wounding. |
AT1G70430 | Protein kinase superfamily protein;(source:Araport11) |
AT2G04500 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G72880 | Survival protein SurE-like phosphatase/nucleotidase;(source:Araport11) |
AT1G62090 | pseudogene of Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G30335 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 2.2e-129 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT1G77530 | O-methyltransferase family protein;(source:Araport11) |
AT4G17915 | pseudogene of pentatricopeptide (PPR) repeat-containing/C3HC4-type RING finger containing protein |
AT5G43770 | proline-rich family protein;(source:Araport11) |
AT2G13170 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.2e-88 P-value blast match to GB:AAD22153 polyprotein (Gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G19796 | other_RNA;(source:Araport11) |
AT1G19380 | sugar, putative (DUF1195);(source:Araport11) |
AT4G38940 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G21050 | hyccin;(source:Araport11) |
AT4G40050 | signal transducer, putative (DUF3550/UPF0682);(source:Araport11) |
AT3G18640 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT4G34150 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT1G66180 | The gene encodes a putative aspartyl protease (ASP). Its expression is induced in response to light and ascorbate. The mRNA is cell-to-cell mobile. |
AT5G19015 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Tnp2/En/Spm), has a 8.7e-16 P-value blast match to GB:CAA40555 TNP2 (CACTA-element) (Antirrhinum majus);(source:TAIR10) |
AT3G22937 | pseudogene of no-apical-meristem-associated carboxy-terminal domain protein;(source:Araport11) |
AT1G26100 | Cytochrome b561/ferric reductase transmembrane protein family;(source:Araport11) |
AT1G56090 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G11050 | Protein kinase superfamily protein;(source:Araport11) |
AT5G35076 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.4e-45 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT3G28155 | hypothetical protein;(source:Araport11) |
AT1G27170 | transmembrane receptors / ATP binding protein;(source:Araport11) |
AT2G37820 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G70944 | transmembrane protein;(source:Araport11) |
AT5G45670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT4G33870 | Peroxidase superfamily protein;(source:Araport11) |
AT1G65845 | transmembrane protein;(source:Araport11) |
AT5G44418 | pseudogene of cytochrome P450;(source:Araport11) |
AT1G69580 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G41170 | F-box family protein;(source:Araport11) |
AT1G21200 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT2G03470 | ELM2 domain-containing protein;(source:Araport11) |
AT3G22053 | cysteine-rich repeat secretory protein;(source:Araport11) |
AT3G42803 | transposable_element_gene;(source:Araport11);pseudogene, similar to P0707D10.17, similar to putative non-LTR retroelement reverse transcriptase;(source:TAIR10) |
AT3G29773 | pseudogene of nuclease;(source:Araport11) |
AT4G15040 | Subtilisin-like serine endopeptidase family protein;(source:Araport11) |
AT2G15170 | Plant basic secretory protein (BSP) family protein;(source:Araport11) |
AT5G53050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G33070 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.8e-191 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G11600 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, and genefinder;(source:TAIR10) |
AT4G24320 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT3G13830 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G38920 | SPX (SYG1/Pho81/XPR1) domain-containing protein / zinc finger (C3HC4-type RING finger) protein-like protein;(source:Araport11) |
AT5G27750 | F-box/FBD-like domains containing protein;(source:Araport11) |
AT1G48640 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT1G67328 | Natural antisense transcript overlaps with AT1G67330;(source:Araport11) |
AT5G56452 | FBD-like domain family protein;(source:Araport11) |
AT3G29300 | transmembrane protein;(source:Araport11) |
AT4G16840 | transmembrane protein;(source:Araport11) |
AT5G11970 | ABC family ABC transporter, putative (DUF3511);(source:Araport11) |
AT4G26960 | hypothetical protein;(source:Araport11) |
AT1G69980 | structural polyprotein;(source:Araport11) |
AT1G19485 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G01732 | Natural antisense transcript overlaps with AT5G01730;(source:Araport11) |
AT3G30685 | transposable_element_gene;(source:Araport11);pseudogene, similar to Hypothetical protein with similarity to putative Ac-like transposases, similar to Ac-like transposase GB:AAD25149 from (Arabidopsis thaliana);(source:TAIR10) |
AT2G24280 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G62410 | MIF4G domain-containing protein;(source:Araport11) |
AT2G22510 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G22780 | Adaptor protein complex AP-2, alpha subunit;(source:Araport11) |
AT2G32220 | Ribosomal L27e protein family;(source:Araport11) |
AT3G19430 | late embryogenesis abundant protein-related / LEA protein-like protein;(source:Araport11) |
AT2G34655 | hypothetical protein;(source:Araport11) |
AT1G05136 | hypothetical protein;(source:Araport11) |
AT3G26147 | hypothetical protein;(source:Araport11) |
AT1G59865 | transmembrane protein;(source:Araport11) |
AT1G15757 | Encodes a defensin-like (DEFL) family protein. |
AT4G18460 | D-Tyr-tRNA(Tyr) deacylase family protein;(source:Araport11) |
AT2G25280 | AmmeMemoRadiSam system protein B;(source:Araport11) |
AT4G13968 | Encodes a defensin-like (DEFL) family protein. |
AT4G04745 | hypothetical protein;(source:Araport11) |
AT3G15650 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G35350 | EXS (ERD1/XPR1/SYG1) family protein;(source:Araport11) |
AT3G17365 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT2G16270 | transmembrane protein;(source:Araport11) |
AT2G40050 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G58225 | hypothetical protein;(source:Araport11) |
AT4G31985 | Ribosomal protein L39 family protein;(source:Araport11) |
AT4G10720 | Ankyrin repeat family protein;(source:Araport11) |
AT1G10650 | SBP (S-ribonuclease binding protein) family protein;(source:Araport11) |
AT3G45670 | Protein kinase superfamily protein;(source:Araport11) |
AT2G11610 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.6e-24 P-value blast match to O22278 /203-375 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT5G17340 | Putative membrane lipoprotein;(source:Araport11) |
AT1G64610 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT3G57320 | threonine-tRNA ligase 2;(source:Araport11) |
AT3G26934 | hypothetical protein;(source:Araport11) |
AT2G47010 | calcium/calcium/calmodulin-dependent Serine/Threonine-kinase;(source:Araport11) |
AT1G51920 | transmembrane protein;(source:Araport11) |
AT1G05291 | GPI inositol-deacylase C, putative (DUF1218);(source:Araport11) |
AT1G67325 | Ran BP2/NZF zinc finger-like superfamily protein;(source:Araport11) |
AT4G20430 | Subtilase family protein;(source:Araport11) |
AT1G23350 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G32380 | Transmembrane protein 97, predicted |
AT3G53840 | Protein kinase superfamily protein;(source:Araport11) |
AT5G42010 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G45207 | Remorin family protein;(source:Araport11) |
AT2G01050 | zinc ion binding / nucleic acid binding protein;(source:Araport11) |
AT5G47920 | transcription elongation factor;(source:Araport11) |
AT1G70550 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT3G32047 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT5G38310 | hypothetical protein;(source:Araport11) |
AT4G39970 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G01130 | hypothetical protein (DUF674);(source:Araport11) |
AT4G26483 | nicotianamine synthase;(source:Araport11) |
AT2G17590 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G23360 | filament-like protein (DUF869);(source:Araport11) |
AT3G15250 | TPRXL;(source:Araport11) |
AT3G41979 | 5.8SrRNA |
AT1G14330 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT2G27385 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT5G41680 | Protein kinase superfamily protein;(source:Araport11) |
AT5G07940 | dentin sialophosphoprotein-like protein;(source:Araport11) |
AT2G37980 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G73170 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G17780 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G01445 | hypothetical protein;(source:Araport11) |
AT1G50450 | Saccharopine dehydrogenase;(source:Araport11) |
AT3G62200 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT5G03110 | protamine P1 family protein;(source:Araport11) |
AT1G29465 | transmembrane protein;(source:Araport11) |
AT4G02340 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G01175 | transmembrane protein;(source:Araport11) |
AT1G55160 | WAS/WASL-interacting family protein;(source:Araport11) |
AT1G30590 | RNA polymerase I specific transcription initiation factor RRN3 protein;(source:Araport11) |
AT2G38260 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G23840 | transmembrane protein;(source:Araport11) |
AT5G67510 | Translation protein SH3-like family protein;(source:Araport11) |
AT2G30650 | ATP-dependent caseinolytic (Clp) protease/crotonase family protein;(source:Araport11) |
AT4G00560 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G07160 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G22020 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT1G54750 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G48655 | RING/U-box superfamily protein;(source:Araport11) |
AT5G25200 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT3G48440 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G05390 | S-adenosyl-L-methionine-dependent methyltransferase;(source:Araport11) |
AT1G55980 | FAD/NAD(P)-binding oxidoreductase family protein;(source:Araport11) |
AT2G38660 | Amino acid dehydrogenase family protein;(source:Araport11) |
AT4G06585 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.8e-06 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G44920 | Encodes a pentapeptide-repeat protein (PRP) composed of 25 repeats capped by N- and C-terminal a-helices. Unlike other PRPs, At2g44920 consists exclusively of type II b-turns |
AT2G36895 | D-tagatose-1,6-bisphosphate aldolase subunit;(source:Araport11) |
AT5G59640 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 5.1e-159 P-value blast match to GB:AAD55677 putative transposase protein (CACTA-element) transposon=Shooter (Zea mays);(source:TAIR10) |
AT4G18815 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT3G52920 | transcriptional activator (DUF662);(source:Araport11) |
AT2G19940 | Putative N-acetyl-gamma-glutamyl-phosphate reductase;(source:Araport11) |
AT1G65850 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT3G01930 | Major facilitator superfamily protein;(source:Araport11) |
AT5G19590 | DUF538 family protein (Protein of unknown function, DUF538);(source:Araport11) |
AT4G27360 | Dynein light chain type 1 family protein;(source:Araport11) |
AT5G08670 | Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level. |
AT1G20370 | Pseudouridine synthase family protein;(source:Araport11) |
AT4G27020 | inositol-1,4,5-trisphosphate 5-phosphatase;(source:Araport11) |
AT5G49040 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT2G13469 | pseudogene of putative nucleic-acid protein;(source:Araport11) |
AT5G62130 | Per1-like family protein;(source:Araport11) |
AT4G19930 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT4G17580 | Bax inhibitor-1 family protein;(source:Araport11) |
AT2G44220 | NEP-interacting protein (DUF239);(source:Araport11) |
AT5G10130 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G64330 | myosin heavy chain-like protein;(source:Araport11) |
AT2G37220 | Encodes a chloroplast RNA binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT3G54270 | sucrose-6F-phosphate phosphohydrolase family protein;(source:Araport11) |
AT5G43196 | Pseudogene of AT5G43210; endo/excinuclease amino terminal domain-containing protein |
AT5G03700 | D-mannose binding lectin protein with Apple-like carbohydrate-binding domain-containing protein;(source:Araport11) |
AT4G31650 | Transcriptional factor B3 family protein;(source:Araport11) |
AT5G14035 | pre-tRNA tRNA-Lys (anticodon: CTT);(source:Araport11, TAIR10) |
AT3G13432 | transmembrane protein;(source:Araport11) |
AT5G47170 | hypothetical protein;(source:Araport11) |
AT2G44390 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G45238 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT2G15160 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 1.8e-86 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G15350 | DUF4050 family protein;(source:Araport11) |
AT3G62640 | DUF3511 domain protein (DUF3511);(source:Araport11) |
AT5G46080 | Protein kinase superfamily protein;(source:Araport11) |
AT4G05060 | PapD-like superfamily protein;(source:Araport11) |
AT5G67050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G11000 | hypothetical protein (DUF868);(source:Araport11) |
AT1G77770 | forkhead box protein, putative (DUF1644);(source:Araport11) |
AT1G08270 | vacuolar protein sorting-associated protein;(source:Araport11) |
AT1G73160 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G29075 | glycine-rich protein;(source:Araport11) |
AT2G45530 | RING/U-box superfamily protein;(source:Araport11) |
AT2G30190 | pre-tRNA tRNA-Gly (anticodon: GCC);(source:Araport11, TAIR10) |
AT3G49300 | proline-rich family protein;(source:Araport11) |
AT4G24160 | Encodes a soluble lysophosphatidic acid acyltransferase with additional triacylglycerol lipase and phosphatidylcholine hydrolyzing enzymatic activities. Plays a pivotal role in maintaining the lipid homeostasis by regulating both phospholipid and neutral lipid levels. |
AT4G28420 | Tyrosine transaminase family protein;(source:Araport11) |
AT1G78250 | pre-tRNA tRNA-Met (anticodon: CAT);(source:Araport11, TAIR10) |
AT5G48730 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G09690 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G25610 | C2H2-like zinc finger protein;(source:Araport11) |
AT3G13662 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT3G46140 | Protein kinase superfamily protein;(source:Araport11) |
AT2G34740 | protein phosphatase 2C family protein;(source:Araport11) |
AT5G40981 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G02930 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G58920 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G04500 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G35540 | transmembrane protein;(source:Araport11) |
AT3G28850 | Glutaredoxin family protein;(source:Araport11) |
AT5G67200 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G30945 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G33260 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins - Arabidopsis thaliana;(source:TAIR10) |
AT3G03500 | TatD related DNase;(source:Araport11) |
AT5G04267 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G24290 | MAC/Perforin domain-containing protein;(source:Araport11) |
AT2G06822 | Pseudogene of AT2G06822 |
AT2G11135 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT4G04273.1);(source:TAIR10) |
AT2G35345 | hypothetical protein;(source:Araport11) |
AT5G35753 | DnaJ heat shock amino-terminal domain protein (DUF3444);(source:Araport11) |
AT1G05700 | Leucine-rich repeat transmembrane protein kinase protein;(source:Araport11) |
AT1G52100 | Mannose-binding lectin superfamily protein;(source:Araport11) |
AT2G01008 | maternal effect embryo arrest protein;(source:Araport11) |
AT2G06280 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G56960 | basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11) |
AT5G48175 | transmembrane protein;(source:Araport11) |
AT2G26030 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT1G28880 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT2G32000 | DNA topoisomerase, type IA, core;(source:Araport11) |
AT1G21738 | hypothetical protein;(source:Araport11) |
AT5G40540 | Protein kinase superfamily protein;(source:Araport11) |
AT1G73860 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G21020 | pseudogene of NOD26-like intrinsic protein 3;(source:Araport11) |
AT5G63500 | transmembrane protein, putative (DUF 3339);(source:Araport11) |
AT4G39838 | Natural antisense transcript overlaps with AT4G39840;(source:Araport11) |
AT1G44160 | HSP40/DnaJ peptide-binding protein;(source:Araport11) |
AT1G15620 | transmembrane protein;(source:Araport11) |
AT2G28280 | pseudogene of F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G46350 | LRR receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT1G44707 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G35798 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 1.9e-52 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT2G27310 | F-box family protein;(source:Araport11) |
AT2G19980 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT5G63905 | transmembrane protein;(source:Araport11) |
AT4G12170 | Thioredoxin superfamily protein;(source:Araport11) |
AT5G52710 | Copper transport protein family;(source:Araport11) |
AT2G19920 | RNA-dependent RNA polymerase family protein;(source:Araport11) |
AT1G15450 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT5G48140 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT1G48730 | hypothetical protein;(source:Araport11) |
AT1G67410 | Exostosin family protein;(source:Araport11) |
AT2G38250 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G12870 | Gamma interferon responsive lysosomal thiol (GILT) reductase family protein;(source:Araport11) |
AT5G06480 | Immunoglobulin E-set superfamily protein;(source:Araport11) |
AT1G42420 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G32690 | DUF740 family protein;(source:Araport11) |
AT5G61660 | glycine-rich protein;(source:Araport11) |
AT4G27250 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G26430 | Encodes a functioning member of the GDS(L) lipase family with preference for long chain substrates that does not hydrolyze choline esters. |
AT4G30180 | hypothetical protein;(source:Araport11) |
AT2G18140 | Peroxidase superfamily protein;(source:Araport11) |
AT5G47600 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT2G41470 | agamous-like MADS-box protein;(source:Araport11) |
AT5G60250 | zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT5G57120 | nucleolar/coiled-body phosphoprotein;(source:Araport11) |
AT3G44970 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT1G67510 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G35965 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 5.9e-244 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G49390 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G05730 | Encodes a defensin-like (DEFL) family protein. The mRNA is cell-to-cell mobile. |
AT2G21905 | Encodes a ECA1 gametogenesis related family protein [pseudogene] |
AT3G49400 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G51350 | ARM repeat superfamily protein;(source:Araport11) |
AT5G01670 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT3G24510 | Encodes a defensin-like (DEFL) family protein. |
AT1G61420 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G01323 | ECA1-like gametogenesis related family protein;(source:Araport11) |
AT5G24190 | Lipase class 3-related protein;(source:Araport11) |
AT1G78995 | hypothetical protein;(source:Araport11) |
AT1G54820 | Protein kinase superfamily protein;(source:Araport11) |
AT5G57535 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT5G49770 | Leucine rich receptor kinase. |
AT2G18560 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT3G58610 | ketol-acid reductoisomerase;(source:Araport11) |
AT2G29360 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G45638 | other_RNA;(source:Araport11) |
AT2G41178 | Natural antisense transcript overlaps with AT2G41180;(source:Araport11) |
AT5G42250 | Zinc-binding alcohol dehydrogenase family protein;(source:Araport11) |
AT1G32570 | hypothetical protein;(source:Araport11) |
AT1G65130 | Ubiquitin carboxyl-terminal hydrolase-related protein;(source:Araport11) |
AT5G64460 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT4G28160 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT1G12030 | phosphoenolpyruvate carboxylase, putative (DUF506);(source:Araport11) |
AT3G16555 | F-box and associated interaction domains-containing protein;(source:Araport11).SON1 paralog. |
AT1G10705 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
AT4G08250 | GRAS family transcription factor;(source:Araport11) |
AT2G29600 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G60710 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT4G27270 | Quinone reductase family protein;(source:Araport11) |
AT1G20310 | syringolide-induced protein;(source:Araport11) |
AT1G43940 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G42540.1);(source:TAIR10) |
AT3G61610 | Galactose mutarotase-like superfamily protein;(source:Araport11) |
AT5G64735 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT5G04045 | Encodes a defensin-like (DEFL) family protein. |
AT1G52180 | Aquaporin-like superfamily protein;(source:Araport11) |
AT1G18335 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT4G28800 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G09735 | S1FA-like DNA-binding protein;(source:Araport11) |
AT1G62320 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
AT3G33187 | Encodes a defensin-like (DEFL) family protein. |
AT4G30640 | RNI-like superfamily protein;(source:Araport11) |
AT5G66580 | PADRE protein. |
AT3G44330 | M28 Zn-peptidase nicastrin;(source:Araport11) |
AT2G30300 | Major facilitator superfamily protein;(source:Araport11) |
AT1G01390 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G54620 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G12750 | Homeodomain-like transcriptional regulator;(source:Araport11) |
AT5G13440 | Ubiquinol-cytochrome C reductase iron-sulfur subunit;(source:Araport11) |
AT4G03965 | RING/U-box superfamily protein;(source:Araport11) |
AT2G29065 | GRAS family transcription factor;(source:Araport11) |
AT1G09400 | FMN-linked oxidoreductases superfamily protein;(source:Araport11) |
AT5G19880 | Peroxidase superfamily protein;(source:Araport11) |
AT5G38195 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G25380 | pseudogene of zinc finger protein-related |
AT4G01960 | transmembrane protein;(source:Araport11) |
AT2G04070 | Expression in rosette leaves is activated by high concentration of boron. |
AT1G22330 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G47370 | Calcium-dependent phosphotriesterase superfamily protein;(source:Araport11) |
AT5G35810 | Ankyrin repeat family protein;(source:Araport11) |
AT5G64690 | neurofilament triplet H protein-like protein;(source:Araport11) |
AT5G60530 | Root tip expressed LEA protein involved in ribosome biogenesis. |
AT4G32870 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G02730 | GRIP/coiled-coil protein, putative (DUF1664);(source:Araport11) |
AT5G22280 | peptidyl-prolyl cis-trans isomerase G;(source:Araport11) |
AT5G44990 | Glutathione S-transferase family protein;(source:Araport11) |
AT4G05170 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G56360 | hypothetical protein;(source:Araport11) |
AT1G63280 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT1G75290 | encodes a protein whose sequence is similar to an isoflavone reductase |
AT1G10040 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G58520 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT5G54710 | Ankyrin repeat family protein;(source:Araport11) |
AT3G10300 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G16170 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT2G34400 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT5G24318 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT4G19645 | TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein;(source:Araport11) |
AT3G23570 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G44840 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT4G11550 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT5G45180 | Flavin-binding monooxygenase family protein;(source:Araport11) |
AT3G05725 | hypothetical protein (DUF3511);(source:Araport11) |
AT4G08280 | Thioredoxin superfamily protein;(source:Araport11) |
AT4G35165 | egg cell-secreted-like protein (DUF1278);(source:Araport11) |
AT1G49000 | transmembrane protein;(source:Araport11) |
AT1G28390 | Protein kinase superfamily protein;(source:Araport11) |
AT3G13965 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT2G03955 | Encodes a defensin-like (DEFL) family protein. |
AT3G55860 | hypothetical protein;(source:Araport11) |
AT2G04860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT2G07155 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 7.9e-17 P-value blast match to GB:CAA29005 ORFa of Maize Ac (hAT-element) (Zea mays);(source:TAIR10) |
AT1G30060 | COP1-interacting protein-like protein;(source:Araport11) |
AT1G14260 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT4G39420 | spatacsin carboxy-terminus protein;(source:Araport11) |
AT2G26970 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G41720 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT1G58037 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT4G00955 | wall-associated receptor kinase-like protein;(source:Araport11) |
AT1G52700 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G69660 | TRAF-like family protein;(source:Araport11) |
AT1G56480 | pseudogene of Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G02700 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G62840 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT3G44205 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 1.5e-40 P-value blast match to GB:AAA21566 mudrA of transposon=MuDR (MuDr-element) (Zea mays);(source:TAIR10) |
AT2G22426 | hypothetical protein;(source:Araport11) |
AT1G69150 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT1G67910 | hypothetical protein;(source:Araport11) |
AT1G32190 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G24650 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G09490 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G43020 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, predicted proteins, Arabidopsis thaliana;(source:TAIR10) |
AT4G12230 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G45730 | hypothetical protein;(source:Araport11) |
AT2G23450 | Protein kinase superfamily protein;(source:Araport11) |
AT3G61545 | pre-tRNA tRNA-Glu (anticodon: CTC);(source:Araport11, TAIR10) |
AT3G56060 | Glucose-methanol-choline (GMC) oxidoreductase family protein;(source:Araport11) |
AT3G42910 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT5G28250.1);(source:TAIR10) |
AT3G13950 | ankyrin;(source:Araport11) |
AT4G14370 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G14010 | emp24/gp25L/p24 family/GOLD family protein;(source:Araport11) |
AT1G77750 | Ribosomal protein S13/S18 family;(source:Araport11) |
AT1G35545 | Natural antisense transcript overlaps with AT1G35550 and AT1G35540;(source:Araport11) |
AT1G60830 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G31700 | transmembrane protein;(source:Araport11) |
AT2G36600 | pre-tRNA tRNA-Arg (anticodon: TCT);(source:Araport11, TAIR10) |
AT3G50170 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G21810 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT3G17110 | Probably not a pseudogene based on evidence for transcription (RNA-seq) and translation (Ribo-seq) described in PMID:27791167 |
AT1G11220 | cotton fiber, putative (DUF761);(source:Araport11) |
AT1G12590 | pre-tRNA tRNA-Gly (anticodon: TCC);(source:Araport11, TAIR10) |
AT1G54550 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT3G26950 | transmembrane protein;(source:Araport11) |
AT5G31804 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.3e-259 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT1G72190 | D-isomer specific 2-hydroxyacid dehydrogenase family protein;(source:Araport11) |
AT3G60520 | zinc ion-binding protein;(source:Araport11) |
AT1G21326 | VQ motif-containing protein;(source:Araport11) |
AT4G39560 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G71350 | eukaryotic translation initiation factor SUI1 family protein;(source:Araport11) |
AT5G44375 | pre-tRNA tRNA-Val (anticodon: TAC);(source:Araport11, TAIR10) |
AT1G63070 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT3G21100 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT2G19460 | DUF3511 domain protein (DUF3511);(source:Araport11) |
AT2G04300 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G40680 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT1G65010 | Encodes a microtubule-associated protein. Putative role in flower development. Comparison of SALK_061426C to Columbia wild type in normal lighting and under low light of 33 micromoles per meter-squared per second resulted in a trend toward earlier bolting in the mutant under low light (P=0.055) (Ann Stapleton and Patrick Pridgen, 2009, personal communication). |
AT5G24750 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G06477 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 2.1e-112 P-value blast match to GB:AAD19359 polyprotein (gypsy_Ty3-element) (Sorghum bicolor);(source:TAIR10) |
AT2G04033 | Encodes a defensin-like (DEFL) family protein. |
AT3G06620 | PAS domain-containing protein tyrosine kinase family protein;(source:Araport11) |
AT1G55440 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G04220 | Target of miR825/825. Mutants have decreased resistance to fungal pathogens. |
AT4G25020 | D111/G-patch domain-containing protein;(source:Araport11) |
AT4G32640 | Sec23/Sec24 protein transport family protein;(source:Araport11) |
AT1G55930 | CBS domain-containing protein / transporter associated domain-containing protein;(source:Araport11) |
AT3G43352 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.6e-09 P-value blast match to gb|AAO73529.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT2G33760 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT1G08050 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT3G60660 | spindle/kinetochore-associated-like protein;(source:Araport11) |
AT3G02700 | NC domain-containing protein-like protein;(source:Araport11) |
AT5G47980 | HXXXD-type acyl-transferase family protein;(source:Araport11) |
AT1G64910 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT4G07475 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to En/Spm-like transposon protein;(source:TAIR10) |
AT3G57400 | transmembrane protein;(source:Araport11) |
AT5G57340 | ras guanine nucleotide exchange factor Q-like protein;(source:Araport11) |
AT3G09960 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT4G08395 | hypothetical protein;(source:Araport11) |
AT5G46780 | VQ motif-containing protein;(source:Araport11) |
AT4G32030 | hypothetical protein;(source:Araport11) |
AT3G32023 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 2.7e-54 P-value blast match to At1g15560.1/58-302 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G39345 | pre-tRNA tRNA-His (anticodon: GTG);(source:Araport11, TAIR10) |
AT1G03660 | Ankyrin-repeat containing protein;(source:Araport11) |
AT3G10950 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
AT1G53330 | encodes a member of the pentatricopeptide repeat (PPR) gene family. T-DNA insertion mutants had a complex phenotypic expression, ranging from embryo lethal to seedling lethal, to just subtle changes. |
AT5G25050 | Major facilitator superfamily protein;(source:Araport11) |
AT5G37330 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT5G60966 | pre-tRNA tRNA-Thr (anticodon: CGT);(source:Araport11, TAIR10) |
AT5G39370 | Curculin-like (mannose-binding) lectin family protein;(source:Araport11) |
AT5G05330 | Encodes a protein with a putative HMG-box domain. The high-mobility group (HMG) proteins are chromatin-associated proteins that act as architectural factors in various nucleoprotein structures, which regulate DNA-dependent processes such as transcription and recombination. Expression of this gene was not detected according to Grasser et al. (J. Mol. Biol. 2006:358, 654-664). |
AT3G15760 | cytochrome P450 family protein;(source:Araport11) |
AT2G25730 | zinc finger FYVE domain protein;(source:Araport11) |
AT4G17765 | pre-tRNA tRNA-Trp (anticodon: CCA);(source:Araport11, TAIR10) |
AT3G17580 | SsrA-binding protein;(source:Araport11) |
AT4G19970 | nucleotide-diphospho-sugar transferase family protein;(source:Araport11) |
AT5G08180 | Ribosomal protein L7Ae/L30e/S12e/Gadd45 family protein;(source:Araport11) |
AT3G50640 | hypothetical protein;(source:Araport11) |
AT2G23820 | Metal-dependent phosphohydrolase;(source:Araport11) |
AT5G05230 | RING/U-box superfamily protein;(source:Araport11) |
AT3G17490 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G78780 | pathogenesis-related family protein;(source:Araport11) |
AT1G67310 | Calmodulin-binding transcription activator protein with CG-1 and Ankyrin domain;(source:Araport11) |
AT2G35859 | Natural antisense transcript overlaps with AT2G35860;(source:Araport11) |
AT3G21770 | Peroxidase superfamily protein;(source:Araport11) |
AT3G04700 | carboxylate clamp-TPR protein (DUF1685);(source:Araport11) |
AT3G28580 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G47940 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT3G12870 | transmembrane protein;(source:Araport11) |
AT5G13360 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT5G40860 | transmembrane protein;(source:Araport11) |
AT2G25070 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G55070 | LisH/CRA/RING-U-box domains-containing protein;(source:Araport11) |
AT2G04260 | pseudogene of P-loop nucleoside triphosphate hydrolase superfamily protein;(source:Araport11) |
AT1G79890 | RAD3-like DNA-binding helicase protein;(source:Araport11) |
AT5G46325 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT1G77145 | transmembrane protein, putative (DUF506);(source:Araport11) |
AT2G44798 | Natural antisense transcript overlaps with AT2G44800;(source:Araport11) |
AT4G08691 | hypothetical protein;(source:Araport11) |
AT1G43150 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 5.3e-25 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT1G23100 | GroES-like family protein;(source:Araport11) |
AT4G24530 | O-fucosyltransferase family protein;(source:Araport11) |
AT5G57480 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G15800 | hypothetical protein;(source:Araport11) |
AT5G07620 | Protein kinase superfamily protein;(source:Araport11) |
AT4G27810 | hypothetical protein;(source:Araport11) |
AT3G43635 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT5G07810 | SNF2 domain-containing protein / helicase domain-containing protein / HNH endonuclease domain-containing protein;(source:Araport11) |
AT3G21620 | ERD (early-responsive to dehydration stress) family protein;(source:Araport11) |
AT5G56745 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT1G33600 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G33330 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G27020 | plant/protein;(source:Araport11) |
AT1G14780 | MAC/Perforin domain-containing protein;(source:Araport11) |
AT3G01830 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT5G50805 | pre-tRNA tRNA-Gln (anticodon: TTG);(source:Araport11, TAIR10) |
AT4G22066 | Pseudogene of AT5G66830; F-box family protein |
AT2G17723 | Encodes a defensin-like (DEFL) family protein. |
AT1G64355 | 1-acyl-sn-glycerol-3-phosphate acyltransferase;(source:Araport11) |
AT3G44274 | pseudogene of Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G43897 | transposable_element_gene;(source:Araport11);pseudogene, similar to ORF-c, blastp match of 58%25 identity and 1.7e-32 P-value to GP|6069570|dbj|BAA85461.1||AB022081 ORF-c {Brassica rapa};(source:TAIR10) |
AT2G13730 | transposable_element_gene;(source:Araport11) |
AT4G25680 | PPPDE putative thiol peptidase family protein;(source:Araport11) |
AT3G56720 | pre-mRNA-splicing factor;(source:Araport11) |
AT3G49610 | B3 domain protein (DUF313);(source:Araport11) |
AT1G48690 | Auxin-responsive GH3 family protein;(source:Araport11) |
AT1G55535 | transmembrane protein;(source:Araport11) |
AT3G58960 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT5G09880 | Splicing factor, CC1-like protein;(source:Araport11) |
AT3G18535 | |
AT2G05530 | Glycine-rich protein family;(source:Araport11) |
AT4G31230 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT3G18840 | LOW protein: PPR containing-like protein;(source:Araport11) |
AT5G35601 | pseudogene of aconitase 3;(source:Araport11) |
AT4G36370 | hypothetical protein;(source:Araport11) |
AT4G32140 | EamA-like transporter family;(source:Araport11) |
AT1G74840 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G06619 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 1.0e-28 P-value blast match to At5g59620.1/14-257 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G31520 | hypothetical protein;(source:Araport11) |
AT2G01023 | hypothetical protein;(source:Araport11) |
AT5G21080 | Uncharacterized protein;(source:Araport11) |
AT2G14110 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT3G54040 | PAR1 protein;(source:Araport11) |
AT1G68340 | hypothetical protein (DUF1639);(source:Araport11) |
AT5G24340 | 3-5 exonuclease domain-containing protein;(source:Araport11) |
AT5G18920 | Cox19-like CHCH family protein;(source:Araport11) |
AT5G03795 | Exostosin family protein;(source:Araport11) |
AT1G47810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G07728 | Natural antisense transcript overlaps with AT1G07725;(source:Araport11) |
AT5G39770 | Represents a non-function pseudogene homologous to AtMSU81 (At4g30870). |
AT5G06125 | pre-tRNA tRNA-Leu (anticodon: TAG);(source:Araport11, TAIR10) |
AT1G08165 | hypothetical protein;(source:Araport11) |
AT3G01870 | hypothetical protein (DUF946);(source:Araport11) |
AT3G14060 | hypothetical protein;(source:Araport11) |
AT5G03377 | pseudogene of acylphosphatase family protein |
AT3G21985 | pseudogene of cysteine-rich repeat secretory-like protein (DUF26);(source:Araport11) |
AT4G36850 | PQ-loop repeat family protein / transmembrane family protein;(source:Araport11) |
AT2G34700 | Pollen Ole e 1 allergen and extensin family protein;(source:Araport11) |
AT1G43835 | transposable_element_gene;(source:Araport11);Mariner-like transposase family, has a 2.7e-63 P-value blast match to GB:AAC28384 mariner transposase (Mariner_TC1-element) (Glycine max);(source:TAIR10) |
AT1G69860 | Major facilitator superfamily protein;(source:Araport11) |
AT3G61160 | Protein kinase superfamily protein;(source:Araport11) |
AT5G20060 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G62150 | peptidoglycan-binding LysM domain-containing protein;(source:Araport11) |
AT4G37240 | PADRE protein down-regulated after infection by S. sclerotiorun. |
AT3G44840 | SABATH methyltransferase |
AT2G44210 | carboxyl-terminal peptidase (DUF239);(source:Araport11) |
AT1G28080 | RING finger protein;(source:Araport11) |
AT3G56550 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G40080 | Mitochondrial ribosomal protein L27;(source:Araport11) |
AT5G11500 | coiled-coil protein;(source:Araport11) |
AT2G39640 | glycosyl hydrolase family 17 protein;(source:Araport11) |
AT5G56544 | pseudogene of arginyl-tRNA synthetase |
AT3G43980 | Ribosomal protein S14p/S29e family protein;(source:Araport11) |
AT2G04580 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G22440.1);(source:TAIR10) |
AT4G04320 | malonyl-CoA decarboxylase family protein;(source:Araport11) |
AT5G53742 | Encodes a ECA1 gametogenesis related family protein |
AT1G06640 | encodes a protein whose sequence is similar to a 2-oxoglutarate-dependent dioxygenase The mRNA is cell-to-cell mobile. |
AT1G17145 | RING/U-box superfamily protein;(source:Araport11) |
AT4G05040 | ankyrin repeat family protein;(source:Araport11) |
AT1G13940 | T-box transcription factor, putative (DUF863);(source:Araport11) |
AT1G23610 | hypothetical protein;(source:Araport11) |
AT1G15885 | hypothetical protein;(source:Araport11) |
AT4G38650 | Glycosyl hydrolase family 10 protein;(source:Araport11) |
AT5G15030 | paired amphipathic helix Sin3-like protein;(source:Araport11) |
AT4G14390 | Ankyrin repeat family protein;(source:Araport11) |
AT5G56840 | myb-like transcription factor family protein;(source:Araport11) |
AT3G28880 | serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit;(source:Araport11) |
AT2G11880 | None;(source:Araport11) |
AT1G63660 | GMP synthase (glutamine-hydrolyzing), putative / glutamine amidotransferase;(source:Araport11) |
AT5G05180 | myosin heavy chain, striated protein;(source:Araport11) |
AT1G09490 | similar to Eucalyptus gunnii alcohol dehydrogenase of unknown physiological function (GI:1143445), Vigna unguiculata (gi:1854445), NOT a cinnamyl-alcohol dehydrogenase; Location of EST gb:H37170, gb:H77227 and gb:AA605565 |
AT5G08460 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G80400 | RING/U-box superfamily protein;(source:Araport11) |
AT5G38240 | Protein kinase family protein;(source:Araport11) |
AT5G59410 | Rab5-interacting family protein;(source:Araport11) |
AT5G29550 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 7.4e-126 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT4G12500 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G44360 | ecotropic viral integration site protein;(source:Araport11) |
AT4G22730 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G05190 | pseudogene of cytochrome P450;(source:Araport11) |
AT1G09880 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT5G32630 | transposable_element_gene;(source:Araport11);pseudogene, similar to putative helicase, various predicted helicase proteins, Arabidopsis thaliana and others;(source:TAIR10) |
AT1G53163 | membrane-associated kinase regulator;(source:Araport11) |
AT1G75140 | membrane protein;(source:Araport11) |
AT3G54740 | zein-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT2G17760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT2G41060 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G28560 | BCS1 AAA-type ATPase;(source:Araport11) |
AT3G32050 | hypothetical protein;(source:Araport11) |
AT1G37120 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 8.3e-14 P-value blast match to GB:AAA67727 reverse transcriptase (LINE-element) (Mus musculus);(source:TAIR10) |
AT3G26930 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT1G49870 | myosin-2 heavy chain-like protein;(source:Araport11) |
AT1G62870 | hypothetical protein;(source:Araport11) |
AT1G12244 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT2G06090 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT1G43030 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.1e-109 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT2G26360 | Mitochondrial substrate carrier family protein;(source:Araport11) |
AT2G24160 | pseudogene of receptor like protein 37;(source:Araport11) |
AT1G51300 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT1G52330 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G60790 | F-box family protein;(source:Araport11) |
AT5G47430 | DWNN domain, a CCHC-type zinc finger;(source:Araport11) |
AT4G17700 | hypothetical protein;(source:Araport11) |
AT5G61470 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G36500 | hypothetical protein;(source:Araport11) |
AT2G27320 | NEP-interacting protein, putative (DUF239);(source:Araport11) |
AT3G23530 | Cyclopropane-fatty-acyl-phospholipid synthase;(source:Araport11) |
AT3G43146 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 3.9e-55 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT3G50040 | hypothetical protein;(source:Araport11) |
AT2G11140 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.0e-71 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G59765 | None;(source:Araport11) |
AT1G68735 | Encodes a defensin-like (DEFL) family protein. |
AT5G52890 | AT hook motif-containing protein;(source:Araport11) |
AT4G03945 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G70050 | pre-tRNA tRNA-Pro (anticodon: AGG);(source:Araport11, TAIR10) |
AT3G18510 | ATP-dependent helicase/nuclease subunit;(source:Araport11) |
AT5G23370 | GRAM domain-containing protein / ABA-responsive protein-like protein;(source:Araport11) |
AT5G67350 | hypothetical protein;(source:Araport11) |
AT1G14170 | RNA-binding KH domain-containing protein;(source:Araport11) |
AT2G28990 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT5G15870 | glycosyl hydrolase family 81 protein;(source:Araport11) |
AT3G06750 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT5G54170 | Polyketide cyclase/dehydrase and lipid transport superfamily protein;(source:Araport11) |
AT2G44760 | dihydroorotate dehydrogenase (DUF3598);(source:Araport11) |
AT1G19240 | transmembrane protein;(source:Araport11) |
AT4G11680 | Zinc finger, C3HC4 type (RING finger) family protein;(source:Araport11) |
AT1G29650 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.5e-28 P-value blast match to GB:NP_038603 L1 repeat, Tf subfamily, member 23 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G48370 | Thioesterase/thiol ester dehydrase-isomerase superfamily protein;(source:Araport11) |
AT1G77270 | hypothetical protein;(source:Araport11) |
AT1G69510 | cAMP-regulated phosphoprotein 19-related protein;(source:Araport11) |
AT4G14226 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G76330 | pre-tRNA tRNA-Ser (anticodon: TGA);(source:Araport11, TAIR10) |
AT3G24508 | Encodes a defensin-like (DEFL) family protein. |
AT5G62420 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT3G05755 | pre-tRNA tRNA-Pro (anticodon: CGG);(source:Araport11, TAIR10) |
AT1G69760 | suppressor SRP40-like protein;(source:Araport11) |
AT3G27540 | beta-1,4-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT1G31274 | Pseudogene of AT5G26622; beta-galactosidase |
AT4G11860 | FAM63A-like protein (DUF544);(source:Araport11) |
AT2G31335 | hypothetical protein;(source:Araport11) |
AT1G65550 | Xanthine/uracil permease family protein;(source:Araport11) |
AT5G09345 | pre-tRNA tRNA-Leu (anticodon: CAA);(source:Araport11, TAIR10) |
AT3G43610 | Spc97 / Spc98 family of spindle pole body (SBP) component;(source:Araport11) |
AT1G38140 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (Ptta/En/Spm), has a 9.2e-38 P-value blast match to At5g29026.1/8-244 CACTA-like transposase family (Ptta/En/Spm) (CACTA-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G47445 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 7.6e-84 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G62750 | hypothetical protein;(source:Araport11) |
AT1G28840 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT2G37320 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT5G27970 | ARM repeat superfamily protein;(source:Araport11) |
AT1G64405 | hypothetical protein;(source:Araport11) |
AT2G45750 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G51810 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G58420 | TRAF-like superfamily protein;(source:Araport11) |
AT3G10720 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT1G08210 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G55590 | RNI-like superfamily protein;(source:Araport11) |
AT2G05000 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT3G47320.1);(source:TAIR10) |
AT1G19000 | Homeodomain-like superfamily protein;(source:Araport11) |
AT5G26050 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT3G47490 | HNH endonuclease;(source:Araport11) |
AT3G56610 | prolamin-like protein;(source:Araport11) |
AT5G37474 | Encodes a defensin-like (DEFL) family protein. |
AT2G27160 | hypothetical protein;(source:Araport11) |
AT2G01130 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT1G62270 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT1G09932 | Phosphoglycerate mutase family protein;(source:Araport11) |
AT1G52565 | cytochrome P450 family protein;(source:Araport11) |
AT5G35930 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT3G29785 | Pol-like polyprotein/retrotransposon;(source:Araport11) |
AT1G28250 | transmembrane protein;(source:Araport11) |
AT2G44510 | CDK inhibitor P21 binding protein;(source:Araport11) |
AT1G24440 | RING/U-box superfamily protein;(source:Araport11) |
AT2G14710 | F-box family protein;(source:Araport11) |
AT2G29340 | NAD-dependent epimerase/dehydratase family protein;(source:Araport11) |
AT5G38905 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT1G07175 | alternative NAD(P)H dehydrogenase;(source:Araport11) |
AT5G22690 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G43450 | hypothetical protein;(source:Araport11) |
AT2G15327 | hypothetical protein;(source:Araport11) |
AT2G08986 | hypothetical protein;(source:Araport11) |
AT4G02405 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G04985 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G78060 | Glycosyl hydrolase family protein;(source:Araport11) |
AT3G47830 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G26850 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT1G61750 | Receptor-like protein kinase-related family protein;(source:Araport11) |
AT5G48420 | hypothetical protein;(source:Araport11) |
AT5G59170 | Proline-rich extensin-like family protein;(source:Araport11) |
AT1G47860 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 9.0e-40 P-value blast match to GB:NP_038605 L1 repeat, Tf subfamily, member 30 (LINE-element) (Mus musculus);(source:TAIR10) |
AT5G18490 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT3G15640 | Rubredoxin-like superfamily protein;(source:Araport11) |
AT5G45960 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT5G10290 | leucine-rich repeat transmembrane protein kinase family protein;(source:Araport11) |
AT2G13080 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family, has a 1.7e-183 P-value blast match to GB:AAD11615 prpol (gypsy_Ty3-element) (Zea mays);(source:TAIR10) |
AT5G34854 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 1.3e-96 P-value blast match to gb|AAG52949.1| gag/pol polyprotein (Endovir1-1) (Arabidopsis thaliana) (Ty1_Copia-family);(source:TAIR10) |
AT4G04730 | Ta11-like non-LTR retrotransposon;(source:Araport11) |
AT2G47720 | hypothetical protein;(source:Araport11) |
AT5G14700 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G48180 | CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase;(source:Araport11) |
AT3G09110 | hypothetical protein (DUF674);(source:Araport11) |
AT5G07400 | forkhead-associated domain-containing protein / FHA domain-containing protein;(source:Araport11) |
AT4G22580 | Exostosin family protein;(source:Araport11) |
AT4G03440 | Ankyrin repeat family protein;(source:Araport11) |
AT2G22750 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G17100 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT5G37072 | pseudogene of Ribosomal protein S4 (RPS4A) family protein;(source:Araport11) |
AT1G21770 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT4G26550 | Got1/Sft2-like vescicle transport protein family;(source:Araport11) |
AT3G42251 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein, similar to contains similarity to Arabidopsis thaliana hypothetical protein (GB:AC004483);(source:TAIR10) |
AT5G49525 | transmembrane protein;(source:Araport11) |
AT3G02100 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT2G11170 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT1G32460 | hypothetical protein;(source:Araport11) |
AT2G18480 | Major facilitator superfamily protein;(source:Araport11) |
AT2G24370 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT2G13910 | pseudogene of Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G55646 | TPRXL;(source:Araport11) |
AT4G32860 | Avr9/Cf-9 rapidly elicited protein;(source:Araport11) |
AT2G47440 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT3G60286 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT1G67460 | Minichromosome maintenance (MCM2/3/5) family protein;(source:Araport11) |
AT5G01365 | pre-tRNA tRNA-Ala (anticodon: AGC);(source:Araport11, TAIR10) |
AT1G33550 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G51940 | oxidoreductase/transition metal ion-binding protein;(source:Araport11) |
AT4G14230 | CBS domain protein with a domain protein (DUF21);(source:Araport11) |
AT3G02315 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT1G62840 | ankyrin repeat/KH domain protein (DUF1442);(source:Araport11) |
AT3G44100 | MD-2-related lipid recognition domain-containing protein;(source:Araport11) |
AT2G22220 | pre-tRNA tRNA-Ile (anticodon: AAT);(source:Araport11, TAIR10) |
AT3G15420 | Transcription factor TFIIIC, tau55-related protein;(source:Araport11) |
AT3G15960 | mismatched DNA binding / ATP binding protein;(source:Araport11) |
AT5G27900 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 2.1e-26 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT3G42180 | Exostosin family protein;(source:Araport11) |
AT5G24100 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT3G49340 | Cysteine proteinases superfamily protein;(source:Araport11) |
AT2G10530 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 6.9e-42 P-value blast match to GB:BAA11674 ORF(AA 1-1338) (Ty1_Copia-element) (Nicotiana tabacum);(source:TAIR10) |
AT1G13550 | hypothetical protein (DUF1262);(source:Araport11) |
AT3G50160 | transmembrane protein, putative (DUF247);(source:Araport11) |
AT3G20360 | TRAF-like family protein;(source:Araport11) |
AT5G20050 | Protein kinase superfamily protein;(source:Araport11) |
AT2G23860 | pseudogene of PapD-like superfamily protein;(source:Araport11) |
AT5G66490 | hypothetical protein;(source:Araport11) |
AT5G24180 | Lipase class 3-related protein;(source:Araport11) |
AT3G28480 | Oxoglutarate/iron-dependent oxygenase;(source:Araport11) |
AT5G22700 | LOW protein: F-box/FBD/LRR-like protein;(source:Araport11) |
AT1G13485 | hypothetical protein;(source:Araport11) |
AT1G17450 | B-block binding subunit of TFIIIC;(source:Araport11) |
AT1G02610 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT2G38680 | 5-nucleotidase / magnesium ion binding protein;(source:Araport11) |
AT5G50120 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G65676 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 3.5e-191 P-value blast match to GB:BAA78424 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana)gi|4996363|dbj|BAA78424.1| polyprotein (AtRE2) (Arabidopsis thaliana) (Ty1_Copia-element);(source:TAIR10) |
AT1G43280 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 6.6e-47 P-value blast match to Q9ZQM3 /24-192 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT4G04426 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 4.7e-149 P-value blast match to GB:CAA31653 polyprotein (Ty1_Copia-element) (Arabidopsis thaliana);(source:TAIR10) |
AT5G53592 | FBD-like domain family protein;(source:Araport11) |
AT5G37030 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G05370 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G48490 | hypothetical protein;(source:Araport11) |
AT3G06210 | ARM repeat superfamily protein;(source:Araport11) |
AT1G16660 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-268 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT3G61810 | Glycosyl hydrolase family 17 protein;(source:Araport11) |
AT5G44970 | Protein with RNI-like/FBD-like domain;(source:Araport11) |
AT5G03905 | Iron-sulfur cluster biosynthesis family protein;(source:Araport11) |
AT3G26910 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G29170 | transmembrane protein (DUF872);(source:Araport11) |
AT3G05440 | C2 domain-containing protein;(source:Araport11) |
AT5G43230 | EEIG1/EHBP1 protein amino-terminal domain protein;(source:Araport11) |
AT4G31100 | wall-associated kinase;(source:Araport11) |
AT1G70740 | Protein kinase superfamily protein;(source:Araport11) |
AT1G70420 | DNA ligase-like protein, putative (DUF1645);(source:Araport11) |
AT1G76440 | HSP20-like chaperones superfamily protein;(source:Araport11) |
AT3G17140 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT4G30020 | PA-domain containing subtilase family protein;(source:Araport11) |
AT5G10745 | transmembrane protein;(source:Araport11) |
AT3G30733 | pseudogene of RING/U-box superfamily protein;(source:Araport11) |
AT1G55450 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G48020 | hypothetical protein;(source:Araport11) |
AT1G77280 | kinase with adenine nucleotide alpha hydrolases-like domain-containing protein;(source:Araport11) |
AT1G33090 | MATE efflux family protein;(source:Araport11) |
AT3G13000 | ubiquinone biosynthesis protein (Protein of unknown function, DUF547);(source:Araport11) |
AT3G21781 | Natural antisense transcript overlaps with AT3G21780;(source:Araport11) |
AT5G14410 | hypothetical protein;(source:Araport11) |
AT5G35340 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G61270 | O-glucosyltransferase rumi-like protein (DUF821);(source:Araport11) |
AT2G02630 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G29260 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT1G73350 | ankyrin repeat protein;(source:Araport11) |
AT4G31280 | hypothetical protein;(source:Araport11) |
AT4G32560 | paramyosin-like protein;(source:Araport11) |
AT1G20100 | DNA ligase-like protein;(source:Araport11) |
AT5G24230 | Lipase class 3-related protein;(source:Araport11) |
AT2G37730 | glycosyltransferase (DUF604);(source:Araport11) |
AT4G38225 | glycerol kinase;(source:Araport11) |
AT1G36130 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 4.2e-84 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT5G46490 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G07740 | transposable_element_gene;(source:Araport11);similar to nucleic acid binding / zinc ion binding [Arabidopsis thaliana] (TAIR:AT2G01050.1);(source:TAIR10) |
AT2G03810 | 18S pre-ribosomal assembly protein gar2-like protein;(source:Araport11) |
AT3G19530 | hypothetical protein;(source:Araport11) |
AT1G02490 | hypothetical protein;(source:Araport11) |
AT3G25680 | SLH domain protein;(source:Araport11) |
AT5G44230 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G21940 | hybrid signal transduction histidine kinase M-like protein;(source:Araport11) |
AT5G54700 | Ankyrin repeat family protein;(source:Araport11) |
AT5G35777 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 2.0e-67 P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT5G44680 | DNA glycosylase superfamily protein;(source:Araport11) |
AT4G31410 | E3 ubiquitin-protein ligase, putative (DUF1644);(source:Araport11) |
AT1G55100 | transposable_element_gene;(source:Araport11);pseudogene, putative ATP synthase beta subunit;(source:TAIR10) |
AT2G42060 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT3G48630 | hypothetical protein;(source:Araport11) |
AT1G22180 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G44717 | Pseudogene of AT5G03495; nucleotide binding protein |
AT1G43895 | pseudogene of Protein kinase superfamily protein;(source:Araport11) |
AT1G72855 | Natural antisense transcript overlaps with AT1G72860;(source:Araport11) |
AT1G69050 | hypothetical protein;(source:Araport11) |
AT5G57500 | Galactosyltransferase family protein;(source:Araport11) |
AT4G38030 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT2G46630 | serine/arginine repetitive matrix protein;(source:Araport11) |
AT2G24165 | pseudogene of receptor like protein 30;(source:Araport11) |
AT3G57890 | Tubulin binding cofactor C domain-containing protein;(source:Araport11) |
AT3G17780 | B-cell receptor-associated-like protein;(source:Araport11) |
AT5G56590 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT5G23520 | smr (Small MutS Related) domain-containing protein;(source:Araport11) |
AT1G78330 | pseudogene of Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
AT1G49900 | C2H2 type zinc finger transcription factor family;(source:Araport11) |
AT2G07880 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT2G11090.1);(source:TAIR10) |
AT1G25886 | transposable_element_gene;(source:Araport11);similar to Ulp1 protease family protein [Arabidopsis thaliana] (TAIR:AT2G14770.2);(source:TAIR10) |
AT5G58530 | Glutaredoxin family protein;(source:Araport11) |
AT2G33350 | CCT motif family protein;(source:Araport11) |
AT5G12880 | proline-rich family protein;(source:Araport11) |
AT4G06548 | transposable_element_gene;(source:Araport11);Mutator-like transposase family, has a 2.5e-39 P-value blast match to Q9SJR8 /172-333 Pfam PF03108 MuDR family transposase (MuDr-element domain);(source:TAIR10) |
AT2G25950 | PITH domain protein (DUF1000);(source:Araport11) |
AT1G34095 | hypothetical protein;(source:Araport11) |
AT1G76120 | Pseudouridine synthase family protein;(source:Araport11) |
AT1G66710 | pseudogene of S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT4G00356 | Encodes a defensin-like (DEFL) family protein. |
AT5G07360 | Amidase family protein;(source:Araport11) |
AT1G04540 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G14920 | Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein;(source:Araport11) |
AT1G51230 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT5G48860 | hypothetical protein;(source:Araport11) |
AT2G47640 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT3G55790 | transmembrane protein;(source:Araport11) |
AT1G06923 | transcription repressor OFP17-like protein;(source:Araport11) |
AT5G51380 | RNI-like superfamily protein;(source:Araport11) |
AT3G09060 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT4G01780 | XH/XS domain-containing protein;(source:Araport11) |
AT5G10120 | Ethylene insensitive 3 family protein;(source:Araport11) |
AT4G23760 | Cox19-like CHCH family protein;(source:Araport11) |
AT5G46930 | pectin methylesterase inhibitor |
AT4G23740 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G03580 | F-box family protein-like protein;(source:Araport11) |
AT5G53940 | Yippee family putative zinc-binding protein;(source:Araport11) |
AT1G32172 | other_RNA;(source:Araport11) |
AT3G15710 | Peptidase S24/S26A/S26B/S26C family protein;(source:Araport11) |
AT5G25270 | Ubiquitin-like superfamily protein;(source:Araport11) |
AT3G32475 | transposable_element_gene;(source:Araport11);pseudogene, hypothetical protein;(source:TAIR10) |
AT3G21970 | cysteine-rich repeat secretory protein, putative (DUF26);(source:Araport11) |
AT4G11000 | Ankyrin repeat family protein;(source:Araport11) |
AT1G01500 | Erythronate-4-phosphate dehydrogenase family protein;(source:Araport11) |
AT1G26930 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT4G22980 | molybdenum cofactor sulfurase-like protein;(source:Araport11) |
AT1G56553 | Encodes a defensin-like (DEFL) family protein. |
AT1G66310 | F-box/RNI-like/FBD-like domains-containing protein;(source:Araport11) |
AT2G07811 | pseudogene of mitochondrial protein |
AT1G57690 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT4G32915 | glutamyl-tRNA(Gln) amidotransferase subunit C;(source:Araport11) |
AT3G29330 | zinc finger RNA-binding-like protein;(source:Araport11) |
AT4G15740 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G40020 | Nucleolar histone methyltransferase-related protein;(source:Araport11) |
AT3G04960 | trichohyalin, putative (DUF3444);(source:Araport11) |
AT3G16840 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G30780 | F-box associated ubiquitination effector family protein;(source:Araport11) |
AT3G43955 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G30910 | Molybdenum cofactor sulfurase family protein;(source:Araport11) |
AT3G50340 | hypothetical protein;(source:Araport11) |
AT2G17000 | Mechanosensitive ion channel family protein;(source:Araport11) |
AT2G30940 | Protein kinase superfamily protein;(source:Araport11) |
AT3G49050 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT3G20340 | Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. |
AT4G06646 | transposable_element_gene;(source:Araport11);pseudogene, similar to OJ1081_B12.13, blastp match of 33%25 identity and 9.8e-51 P-value to GP|27817864|dbj|BAC55632.1||AP003865 OJ1081_B12.13 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G04100 | MATE efflux family protein;(source:Araport11) |
AT2G01790 | TRAF-like family protein;(source:Araport11) |
AT4G11630 | Ribosomal protein L19 family protein;(source:Araport11) |
AT3G47580 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G32160 | beta-casein (DUF760);(source:Araport11) |
AT5G28285 | transposable_element_gene;(source:Araport11);CACTA-like transposase family (En/Spm), has a 9.8e-101 P-value blast match to GB:BAA20532 ORF of transposon Tdc1 (CACTA-element) (Daucus carota);(source:TAIR10) |
AT5G25920 | hypothetical protein;(source:Araport11) |
AT5G57890 | Glutamine amidotransferase type 1 family protein;(source:Araport11) |
AT2G16930 | Ribosomal protein L27 family protein;(source:Araport11) |
AT3G14240 | Subtilase family protein;(source:Araport11) |
AT3G48650 | pseudogene of pectinesterase;(source:Araport11) |
AT5G66800 | membrane-associated kinase regulator-like protein;(source:Araport11) |
AT1G11593 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT1G45760 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 2.6e-37 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT4G11790 | Pleckstrin homology (PH) domain superfamily protein;(source:Araport11) |
AT5G24260 | prolyl oligopeptidase family protein;(source:Araport11) |
AT5G57210 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT1G27350 | Ribosome associated membrane protein RAMP4;(source:Araport11) |
AT1G13480 | hypothetical protein (DUF1262);(source:Araport11) |
AT4G17590 | NOL1/NOP2/sun family protein;(source:Araport11) |
AT5G39850 | Ribosomal protein S4;(source:Araport11) |
AT3G60780 | hypothetical protein (DUF1442);(source:Araport11) |
AT3G29580 | MATH domain/coiled-coil protein;(source:Araport11) |
AT5G56350 | Pyruvate kinase family protein;(source:Araport11) |
AT1G62421 | hypothetical protein;(source:Araport11) |
AT5G60570 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT3G24530 | AAA-type ATPase family protein / ankyrin repeat family protein;(source:Araport11) |
AT5G26731 | hypothetical protein;(source:Araport11) |
AT4G14780 | Protein kinase superfamily protein;(source:Araport11) |
AT1G74870 | RING/U-box superfamily protein;(source:Araport11) |
AT4G29090 | Ribonuclease H-like superfamily protein;(source:Araport11) |
AT5G49110 | fanconi anemia group I-like protein;(source:Araport11) |
AT1G45242 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT5G05400 | LRR and NB-ARC domains-containing disease resistance protein;(source:Araport11) |
AT5G37540 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G07840 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:BAA22288 pol polyprotein (Ty1_Copia-element) (Oryza australiensis)GB:BAA22288 polyprotein (Ty1_Copia-element) (Oryza australiensis)gi|2443320|dbj|BAA22288.1| polyprotein (RIRE1) (Oryza australiensis) (Ty1_Copia-element);(source:TAIR10) |
AT3G03620 | MATE efflux family protein;(source:Araport11) |
AT1G19030 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G13655.1);(source:TAIR10) |
AT5G59740 | UDP-N-acetylglucosamine (UAA) transporter family;(source:Araport11) |
AT3G60110 | DNA-binding bromodomain-containing protein;(source:Araport11) |
AT4G13230 | Late embryogenesis abundant protein (LEA) family protein;(source:Araport11) |
AT4G26830 | O-Glycosyl hydrolases family 17 protein;(source:Araport11) |
AT2G31290 | Ubiquitin carboxyl-terminal hydrolase family protein;(source:Araport11) |
AT1G12630 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT3G21965 | pseudogene of Receptor-like protein kinase-related family protein;(source:Araport11) |
AT5G45000 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT2G39430 | Disease resistance-responsive (dirigent-like protein) family protein;(source:Araport11) |
AT3G19310 | PLC-like phosphodiesterases superfamily protein;(source:Araport11) |
AT1G21651 | zinc ion binding protein;(source:Araport11) |
AT5G37840 | PADRE protein, up-regulated after infection by S. sclerotiorum. |
AT1G02990 | hypothetical protein;(source:Araport11) |
AT1G19860 | Zinc finger C-x8-C-x5-C-x3-H type family protein;(source:Araport11) |
AT5G65440 | transmembrane protein;(source:Araport11) |
AT3G19370 | filament-like protein (DUF869);(source:Araport11) |
AT3G22750 | Protein kinase superfamily protein;(source:Araport11) |
AT1G13380 | sodium/hydrogen exchanger (DUF1218);(source:Araport11) |
AT3G10760 | Homeodomain-like superfamily protein;(source:Araport11) |
AT2G23870 | pseudogene of Terpenoid cyclases family protein;(source:Araport11) |
AT3G24840 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT2G24880 | Plant self-incompatibility protein S1 family;(source:Araport11) |
AT4G23000 | Calcineurin-like metallo-phosphoesterase superfamily protein;(source:Araport11) |
AT3G60370 | Encodes an immunophilin, FKBP20-2, that belongs to the FK-506 binding protein (FKBP) subfamily functioning as peptidyl-prolyl isomerases (PPIases) in protein folding. FKBP20-2 has a unique pair of cysteines at the C terminus and was found to be reduced by thioredoxin (Trx) (itself reduced by NADPH by means of NADP-Trx reductase). The FKBP20-2 protein, which contains only two of the five amino acids required for catalysis, showed a low level of PPIase activity that was unaffected on reduction by Trx. Genetic disruption of the FKBP20-2 gene provide evidence that FKBP20-2 participates specifically in the accumulation of the PSII supercomplex in the chloroplast thylakoid lumen by means of a mechanism that has yet to be determined. |
AT5G06265 | hyaluronan mediated motility receptor-like protein;(source:Araport11) |
AT3G01880 | vacuolar sorting-associated protein (DUF946);(source:Araport11) |
AT5G40290 | HD domain-containing metal-dependent phosphohydrolase family protein;(source:Araport11) |
AT2G46000 | LDL receptor wingless signaling/trafficking chaperone;(source:Araport11) |
AT1G15790 | mediator of RNA polymerase II transcription subunit 15a-like protein;(source:Araport11) |
AT5G44660 | hypothetical protein;(source:Araport11) |
AT5G38810 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT5G38570 | F-box/RNI-like superfamily protein;(source:Araport11) |
AT3G33055 | transposable_element_gene;(source:Araport11);gypsy-like retrotransposon family (Athila), has a 3.2e-282 P-value blast match to GB:CAA57397 Athila ORF 1 (Arabidopsis thaliana);(source:TAIR10) |
AT2G04135 | transposable_element_gene;(source:Araport11);similar to unknown protein [Arabidopsis thaliana] (TAIR:AT5G33303.1);(source:TAIR10) |
AT3G09010 | Protein kinase superfamily protein;(source:Araport11) |
AT1G54460 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT4G13495 | other_RNA;(source:Araport11) |
AT3G48209 | Encodes a Plant thionin family protein |
AT4G35785 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G25800 | Polynucleotidyl transferase, ribonuclease H-like superfamily protein;(source:Araport11) |
AT1G03740 | Protein kinase superfamily protein;(source:Araport11) |
AT2G21850 | Cysteine/Histidine-rich C1 domain family protein;(source:Araport11) |
AT2G35410 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT5G62760 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G30340 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 0. P-value blast match to GB:CAA72989 open reading frame 1 (Ty1_Copia-element) (Brassica oleracea);(source:TAIR10) |
AT1G33817 | transposable_element_gene;(source:Araport11);copia-like retrotransposon family, has a 8.1e-100 P-value blast match to gb|AAO73521.1| gag-pol polyprotein (Glycine max) (SIRE1) (Ty1_Copia-family);(source:TAIR10) |
AT3G17230 | plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G19160 | Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein;(source:Araport11) |
AT5G14030 | translocon-associated protein beta (TRAPB) family protein;(source:Araport11) |
AT2G42480 | MATH domain/coiled-coil protein;(source:Araport11) |
AT3G52120 | SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / D111/G-patch domain-containing protein;(source:Araport11) |
AT4G30490 | AFG1-like ATPase family protein;(source:Araport11) |
AT2G44770 | ELMO/CED-12 family protein;(source:Araport11) |
AT4G05510 | transposable_element_gene;(source:Araport11);hAT-like transposase family (hobo/Ac/Tam3), has a 4.0e-144 P-value blast match to GB:AAD24567 transposase Tag2 (hAT-element) (Arabidopsis thaliana);(source:TAIR10) |
AT1G27990 | transmembrane protein;(source:Araport11) |
AT4G03230 | G-type lectin S-receptor-like Serine/Threonine-kinase;(source:Araport11) |
AT5G03660 | transcriptional activator (DUF662);(source:Araport11) |
AT5G55132 | Encodes a defensin-like (DEFL) family protein. |
AT4G16810 | VEFS-Box of polycomb protein;(source:Araport11) |
AT3G10595 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT1G06135 | transmembrane protein;(source:Araport11) |
AT5G65925 | hypothetical protein;(source:Araport11) |
AT5G47300 | F-box and associated interaction domains-containing protein;(source:Araport11) |
AT2G27770 | DUF868 family protein (DUF868);(source:Araport11) |
AT3G09760 | RING/U-box superfamily protein;(source:Araport11) |
AT1G51890 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G75510 | Transcription initiation factor IIF, beta subunit;(source:Araport11) |
AT5G14020 | Endosomal targeting BRO1-like domain-containing protein;(source:Araport11) |
AT3G13525 | snoRNA;(source:Araport11) |
AT3G29140 | hypothetical protein;(source:Araport11) |
AT3G05050 | Protein kinase superfamily protein;(source:Araport11) |
AT1G28900 | pre-tRNA tRNA-Pro (anticodon: TGG);(source:Araport11, TAIR10) |
AT3G09330 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT3G06000 | RNI-like superfamily protein;(source:Araport11) |
AT2G32030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G10090 | Early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G15890 | Disease resistance protein (CC-NBS-LRR class) family;(source:Araport11) |
AT2G11150 | pseudogene of putative replication protein A1 |
AT2G11910 | hypothetical protein;(source:Araport11) |
AT2G17610 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 3.6e-21 P-value blast match to GB:AAA39398 ORF2 (Mus musculus) (LINE-element);(source:TAIR10) |
AT4G14819 | hypothetical protein (DUF1677);(source:Araport11) |
AT5G41420 | This gene encodes a small protein and has either evidence of transcription or purifying selection. |
AT4G05500 | pseudogene of RNI-like superfamily protein;(source:Araport11) |
AT3G51690 | DNA helicase homolog PIF1. |
AT2G12462 | sterile alpha motif (SAM) domain protein;(source:Araport11) |
AT5G45510 | Leucine-rich repeat (LRR) family protein;(source:Araport11) |
AT5G64250 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT1G49730 | Protein kinase superfamily protein;(source:Araport11) |
AT3G07890 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT4G28360 | Ribosomal protein L22p/L17e family protein;(source:Araport11) |
AT3G49130 | SWAP (Suppressor-of-White-APricot)/surp RNA-binding domain-containing protein;(source:Araport11) |
AT5G36080 | Myb/SANT-like DNA-binding domain protein;(source:Araport11) |
AT1G36445 | transposable_element_gene;(source:Araport11);pseudogene, similar to OSJNBa0026J14.30, blastp match of 62%25 identity and 5.5e-108 P-value to GP|20146463|dbj|BAB89243.1||AP004231 OSJNBa0026J14.30 {Oryza sativa (japonica cultivar-group)};(source:TAIR10) |
AT2G26100 | Galactosyltransferase family protein;(source:Araport11) |
AT5G36260 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT4G25570 | Encodes cytochrome b561. |
AT4G33890 | Component of SAGA complex, SPT module subunit, interacts with HAG1. |
AT5G67410 | transcriptional regulator of RNA polII, SAGA, subunit;(source:Araport11) |
AT2G24530 | Member of SAGA complex, SPT modulu subunit, interacts with HAG1. |
AT1G27930 | Arabinogalactan methylesterase,involved in arabinogalactan glucuronic acid methylation. Interacts with eIF3. |
AT5G06950 | Transcription factor of the B-ZIP family that has high affinity for C-box motifs. Interacts with NPR1 and may regulate PR gene expression. Phosphorylated by a CK2-like protein in vitro. Phosphorylation is enhanced by salicylic acid treatment. |
AT5G21170 | Encodes AKINbeta1, a subunit of the SnRK1 kinase (Sucrose non-fermenting-1-related protein kinase). Involved in regulation of nitrogen and sugar metabolism. As part of the regulatory subunit, it binds maltose which promotes kinase activity. Acts as a global regulator of genes involved in carbon, lipid and nitrogen metabolism. |
AT4G32660 | Encodes protein kinase AME3. |
AT4G03070 | Encodes a possible 2-oxoglutarate-dependent dioxygenase that is involved in glucosinolate biosynthesis. The gene is expressed in all ecotypes examined but the enzymatic activity has not been determined experimentally. In Col, there is one copy of this gene (aka AOP1.1) but Ler contains two copies, AOP1.1 and a tightly linked AOP1.2. |
AT2G30020 | Encodes AP2C1. Belongs to the clade B of the PP2C-superfamily. Acts as a MAPK phosphatase that negatively regulates MPK4 and MPK6. |
AT1G49050 | Encodes a member of the aspartyl protease family. Interacts with BAGP1 and BAG6 and appears to be required for cleavage of BAG6 as BAG6 is not cleaved in APCB1 mutant backgrounds. |
AT1G01020 | ARV1 family protein;(source:Araport11) |
AT2G30130 | Overexpression/activation tagged allele has epinastic leaves, reduced apical dominance and is sterile. Gene is similar to asymmetric leaves (AS)/lateral organ boundary (LOB) genes which repress KNOX gene expression. |
AT1G24140 | Expression induced by fungal and bacterial pathogens. |
AT4G38250 | Transmembrane amino acid transporter family protein;(source:Araport11) |
AT3G29590 | At3g29590 (At5MAT) encodes a malonyl-CoA:anthocyanidin 5-O-glucoside-6"-O-malonyltransferase that is coordinately expressed with a epistatic 5-O-anthocyanidin glucosyltransferase (At4g14090). The enzyme is involved in the malonylation of anthocyanins in Arabidopsis. |
AT5G08790 | induced by wounding, belongs to a large family of putative transcriptional activators with NAC domain. |
AT4G15415 | B' regulatory subunit of PP2A (AtB'gamma) |
AT1G01980 | Encodes an oligogalacturonide oxidase that inactivates the elicitor-active oligogalacturonides (OGs). |
AT1G30720 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30730 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30740 | FAD-binding Berberine family protein;(source:Araport11) |
AT4G20800 | FAD-binding Berberine family protein;(source:Araport11) |
AT4G20820 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26390 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26410 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G26420 | FAD-binding Berberine family protein;(source:Araport11) |
AT1G30700 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G65780 | Encodes a chloroplast branched-chain amino acid aminotransferase, can complement the yeast leu/iso-leu/val auxotrophy mutant. Note that the AT5G65780.2 gene model (TAIR10) has been obsoleted due to the lack of experimental support. The mRNA is cell-to-cell mobile. |
AT3G13790 | Encodes a protein with invertase activity. |
AT1G61660 | Encodes a transcriptional activator that regulates the expression of genes by binding to their GCG- or E-boxes to mediate physiological responses, including proline biosynthesis and ROS scavenging pathways, to enhance stress tolerance. Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT4G33720 | CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein;(source:Araport11) |
AT4G01610 | Encodes a capase involved in stress induced cell death. Activity detected in leaf and cell culture. |
AT3G58580 | Encodes a protein that is involved in mRNA processing and localized to cytoplasmic p-bodies. Double mutants with CCR4a show decreased sensitivity to high concentrations of sucrose. Involved in starch and sucrose metabolism. |
AT3G06010 | Encodes AtCHR12, a SNF2/Brahma-type chromatin-remodeling protein. AtCHR12 mediates temporary growth arrest in Arabidopsis upon perceiving environmental stress. |
AT2G28180 | member of Putative Na+/H+ antiporter family |
AT5G56340 | RING/U-box superfamily protein;(source:Araport11) |
AT2G44350 | encodes a mitochrondrion targeted citrate synthase, the first enzyme of the tricarboxylic acid cycle, catalyzing the condensation of acetyl-CoA and oxaloacetate, finally yielding citrate and CoA. |
AT5G03760 | encodes a beta-mannan synthase that is required for agrobacterium-mediated plant genetic transformation involves a complex interaction between the bacterium and the host plant. 3' UTR is involved in transcriptional regulation and the gene is expressed in the elongation zone of the root. |
AT2G24630 | encodes a XyG glucan synthase; gene similar to cellulose synthase |
AT2G25900 | Encodes a protein with two tandem-arrayed CCCH-type zinc fingers that binds RNA and is involved in RNA turnover. The mRNA is cell-to-cell mobile. |
AT5G10310 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT1G22810 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. Overexpression leands to delayed senescence and delayed flowering. Negatively regulates plant resistance to P. parasitica by suppressing PAMP-triggered immunity. |
AT5G48460 | Encodes a member of the fimbrin family. Different members of the fimbrin/plastin family have diverged biochemically during evolution to generate either tight actin bundles or loose networks with distinct biochemical and biophysical properties. FIM4 generates both actin bundles and branched actin filaments whereas FIM5 only generates actin bundles. |
AT3G11730 | Encodes a member of the Rab GTPase family of proteins. This protein interacts with the tail region of a myosin XI protein (AT5G43900) in a GTP-dependent manner. It has also been identified as an isoprenylated protein. |
AT3G51800 | putative nuclear DNA-binding protein G2p (AtG2) mRNA, |
AT5G48400 | member of Putative ligand-gated ion channel subunit family |
AT4G24990 | geranylgeranylated protein ATGP4 |
AT4G37900 | Protein of unknown function that contains DUF1399 domain and putative RNA binding motif. Expressed in many plant tissues and is involved in many aspects of plant growth and development as well as response to salt stress. |
AT1G48605 | Encodes a protein similar to yeast HAL3, which regulates the cell cycle and tolerance to salt stress through inhibition of the PPZ1 type-1 protein phosphatase. AtHAL3b mRNA levels are induced by salt stress. HAL3B presumably encodes for phosphopantothenoylcysteine decarboxylase being involved in Coenzyme A biosynthesis as indicated by functional complementation of a double mutant hal3 aaBb. |
AT4G03520 | Encodes a redox activated co-chaperone, chloroplast localized thioredoxin, similar to prokaryotic types. |
AT1G34360 | translation initiation factor 3 (IF-3) family protein;(source:Araport11) |
AT1G28210 | DnaJ homolog AtJ1 (atj) |
AT5G57160 | Encodes the Arabidopsis orthologue of the yeast and mammalian DNA ligase IV. Involved in the repair of DNA damage but, unlike in yeast, not required for T-DNA integration. Interacts with the Arabidopsis homologue of XRCC4. |
AT5G55460 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G01910 | Binds microtubules. Induces a crisscross mesh of microtubules, not bundles. Not involved in microtubule polymerization nor nucleation. Localizes to mitochondria. The mRNA is cell-to-cell mobile. |
AT4G29170 | A homolog of yeast, mouse and human mnd1delta protein. Null mutants exhibit normal vegetative and flower development; however, during prophase I, chromosomes become fragmented resulting in random distribution of the fragments between polyads. Both male and female meiosis are defective and strong accumulation of AtRAD51 was observed in the inflorescence nuclei of mutant plants. Similarly to its yeast and animal homologues, AtMnd1 might play a role in DSB repair during meiosis. |
AT4G24970 | MORC7 is a member of a family of GHKL ATPases. It is localized in the nuceloplasm and adjacent to chromocenters. Along with MORC4, it appears to repress the expression of genes involved in defense against pathogens. |
AT3G27560 | encodes a protein with kinase domains, including catalytic domains for serine/threonine as well as tyrosine kinases. a member of multi-gene family and is expressed in all tissues examined. |
AT5G26770 | NEAP2 is a member of a small family containing coiled-coil domains, a nuclear localization signal and a C-terminal predicted transmembrane domain. It localizes to the nuclear periphery. Mutants have altered nuclear morphology and chromatin structure. |
AT5G62720 | Integral membrane HPP family protein. Putative nitrate transporter. |
AT2G31450 | DNA glycosylase superfamily protein;(source:Araport11) |
AT1G15700 | One of two genes that encode the gamma subunit of Arabidopsis chloroplast ATP synthase. It is thought to be involved in the regulation of the ATP synthase activity. |
AT1G35537 | Encodes a defensin-like peptide with antifungal activity. |
AT3G47380 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. |
AT5G46960 | Pectin methylesterase inhibitor that is involved in resistance to Botrytis cinerea. Affects PME activity during infection to prevent disease. Closely related paralog of AT5G46950 (InvINH2). |
AT3G14300 | pectinesterase family protein;(source:Araport11) |
AT2G43050 | Plant invertase/pectin methylesterase inhibitor superfamily;(source:Araport11) |
AT5G21280 | Seed plant lineage specific gene that is expressed in response to oxidative and abiotic stresses. |
AT4G25090 | Riboflavin synthase-like superfamily protein;(source:Araport11) |
AT2G23310 | Encodes AtRER1C1, a Golgi membrane protein involved in returning the molecules that are exported from the endoplasmic reticulum (ER) to the Golgi apparatus back to the ER (a mechanism known as retrieval). There are two Arabidopsis homologues of AtRERC1: AtRER1A and AtRER1B. |
AT1G08600 | The Arabidopsis ATRX harbours a N-terminal ADD domain and a C-terminal helicase domain and is devoid of the large central region involved in DAXX interaction in mammals. Arabidopsis ATRX mutant alleles are viable, but with reduced fertility. Their combination with mutants for the H3.3 chaperone HIRA impairs plant survival. ATRX loss affects cellular histone H3.3 pools and modulates the H3.1/H3.3 balance. Notably, at a genome-wide scale, loss of ATRX leads to a reduced H3.3 level at genes characterized by elevated H3.3 occupancy and high expression, including the 45S ribosomal DNA (45S rDNA) loci. Indeed, expression of specific 45S rDNA sequence variants is altered by ATRX loss (DOI:10.1105/tpc.16.00877) |
AT1G32200 | Encodes a chloroplast glycerol-3-phosphate acyltransferase.Involved in the biosynthesis of chloroplast phosphatidylglycerol. |
AT3G20920 | Encodes an endoplasmic reticulum localized protein with similarity to yeast Sec62p. Mutants display growth defects and significantly reduced fertility. AtSec62 does not complement the thermosensitive phenotype of yeast Sec62 mutants. |
AT3G01720 | peptidyl serine alpha-galactosyltransferase;(source:Araport11) |
AT1G29060 | Encodes a golgi localized QcSNARE involved in response to salt and osmotic stress. Overexpression confers increased resistance to NaCl, mannitol and LiCl. SFT12 may act by mediating vacuolar sequestration of NaCl and other ions. |
AT1G32270 | member of SYP2 Gene Family |
AT3G18370 | C2 domain-containing protein;(source:Araport11) |
AT5G51460 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT3G54860 | Homologous to yeast VPS33. Forms a complex with VCL1 and AtVPS11. Involved in vacuolar biogenesis. |
AT4G12490 | Encodes a member of the AZI family of lipid transfer proteins. Contains a PRR domain that appears to be required for localization to the chloroplast. |
AT5G44380 | FAD-binding Berberine family protein;(source:Araport11) |
AT5G24240 | Encodes PI4Kc3, localizes to the nucleus and has autophosphorylation activity, but no lipid kinase activity. Overexpression mutants display late-flowering phenotype. |
AT4G21390 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT4G21430 | protein B160;(source:Araport11) |
AT1G79900 | encodes a mitochondrial ornithine transporter that exports ornithine from the mitochondria to the cytosol |
AT3G59660 | Encodes a C2-GRAM domain-containing protein that is induced by B. cinerea infection. It is required for cleavage of BAG6 and thus plays a role in mediating resistance to fungal infection. |
AT4G32460 | BDX is a DUF642 cell wall protein primarily expressed in vascular tissues of roots, leaves and embryos. Mutants show defects in seed and embryo development. |
AT5G51780 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G03040 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT2G42300 | Together with bHLH60 associates with phytochrome interacting factor 7 to regulate hypocotyl elongation. |
AT5G43650 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G71870 | Metabolite transporter involved in the anthocyanin response to anthocyanin induction conditions. Affects ABA signaling and localization. |
AT3G57090 | Encodes a protein with similarity to yeast FIS proteins. These membrane anchored proteins bind DRP proteins and function during organelle division. FIS1B is expressed ubiquitously and appears to be involved in peroxisome division. |
AT5G42020 | Luminal binding protein (BiP2) involved in polar nuclei fusion during proliferation of endosperm nuclei. |
AT4G37390 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. May function as a negative component in auxin signaling by regulating auxin activity. |
AT3G11480 | The gene encodes a SABATH methyltransferase that methylates both salicylic acid and benzoic acid. It is highly expressed in flowers, induced by biotic and abiotic stress and thought to be involved in direct defense mechanism. |
AT2G40950 | bZIP17 appears to regulate transcription as part of a salt and osmotic stress response. zip17 mutants show enhanced inhibition of primary root elongation in response to NaCl. Several salt-responsive genes, such as ATHB-7 show a reduced transcriptional response to a salt treatment in zip17 mutant seedlings. myc:bZIP17 undergoes proteolytic processing in salt-treated wild type seedlings, but not in s1p-3 (subtilase) mutants and there is also evidence for S1P-mediated cleavage of bZIP17 in vitro. In addition, an mGFP:bZIP17 protein moves from the ER to the nucleus following salt treatment. It is cleaved by S2P to allow translocation to the nucleus. |
AT3G10800 | Encodes bZIP28, a putative membrane-tethered transcriptional factor. Up-regulated in response to heat; a bZIP28 null mutant has a heat-sensitive phenotype. bZIP28 has a similar domain structure to the mammalian ATF6 protein involved in the unfolded protein response (UPR), and shares a bZIP domain, transmembrane domain, and a canonical S1P cleavage site. The bZIP28 seems to be glycosylated in vivo. bZIP28 does not appear to be transcriptionally up-regulated by UPR-inducing tunicamycin (TM) treatment. But, the expression level of three UPR-related genes is reduced in TM-treated zip28 mutants relative to wild type seedlings. And several UPR genes are transcriptionally upregulated when an N-terminal portion of the bZIP28 protein is expressed using the 35S promoter. A myc:bZIP28 fusion protein appears to be cleaved, likely at a canonical S2 cleavage site, following a TM treatment or a DTT stress-inducing treatment, but not a salt treatment. A portion of the mGFP:bZIP28 protein present in root cells appears to translocate from the cytoplasm and ER to the nucleus following TM treatment. It is cleaved by S2P to allow translocation to the nucleus. The mRNA is cell-to-cell mobile. |
AT5G28770 | BASIC LEUCINE ZIPPER protein which regulates the circadian oscillator gene PSEUDO RESPONSE REGULATOR7 (PRR7) to change the circadian phase in response to sugars. It upregulates PRR7 in response to low energy. bZIP63 and PRR7 are required for correct oscillator phase under light/dark cycles. bZIP protein BZO2H3 mRNA, partial cds |
AT2G24300 | Calmodulin-binding protein;(source:Araport11) |
AT4G31000 | Calmodulin-binding protein;(source:Araport11) |
AT4G25370 | Double Clp-N motif protein;(source:Araport11) |
AT4G12060 | Double Clp-N motif protein;(source:Araport11) |
AT2G45770 | chloroplast SRP receptor homolog, alpha subunit CPFTSY. Required for LHCP integration into isolated thylakoids. |
AT5G08650 | Critical for chloroplast protein synthesis under suboptimal conditions. Essential translation factor that promotes the efficiency of chloroplast protein synthesis. |
AT2G04530 | Encodes a protein with RNAse Z activity suggesting a role in tRNA processing. Protein contains a signal sequence for import into the chloroplast. |
AT2G04030 | Encodes a chloroplast-targeted 90-kDa heat shock protein located in the stroma involved in red-light mediated deetiolation response and crucial for protein import into the chloroplast stroma. Mutants are resistant to chlorate, have elongated hypocotyls in light, and affect the expression of NR2, CAB, and RBCS but NOT NR1 and NiR. |
AT1G17760 | Encodes a homolog of the mammalian protein CstF77, a polyadenylation factor subunit. RNA 3′-end?processing factor of antisense FLC transcript. Mediates silencing of the floral repressor gene FLC. Member of CstF complex. |
AT1G45180 | RING/U-box superfamily protein;(source:Araport11) |
AT4G31450 | RING/U-box superfamily protein;(source:Araport11) |
AT4G00070 | RING/U-box superfamily protein;(source:Araport11) |
AT1G17970 | RING/U-box superfamily protein;(source:Araport11) |
AT5G52140 | RING/U-box superfamily protein;(source:Araport11) |
AT3G27240 | Cytochrome C1 family;(source:Araport11) |
AT2G40140 | zinc finger (CCCH-type) family protein;(source:Araport11) |
AT5G54290 | Encodes CcdA, a thylakoid membrane protein required for the transfer of reducing equivalents from stroma to thylakoid lumen. |
AT4G27120 | ER-resident adaptor protein. Part of complex with C53 and UFL1, the E3 ligase that mediates ufmylation. Involved in the pathway that links ribosome-associated quality control with selective autophagy at the ER. |
AT4G04930 | Encodes a sphingolipid delta4-desaturase, involved in sphingolipid biosynthesis. Specifically expressed in floral tissues. Knockout mutants were devoid of sphinga-4,8-dienine in floral tissues. |
AT3G54600 | Class I glutamine amidotransferase-like superfamily protein;(source:Araport11) |
AT3G01420 | Encodes an alpha-dioxygenase involved in protection against oxidative stress and cell death. Induced in response to Salicylic acid and oxidative stress. Independent of NPR1 in induction by salicylic acid. The mRNA is cell-to-cell mobile. |
AT2G21550 | One of three DRTS genes, this is the most divergent one.THY3/DRTS3 is preferentially expressed in the shoot apex, stipules and root caps. |
AT1G47530 | MATE efflux family protein;(source:Araport11) |
AT1G69890 | Encodes a member of a conserved DUF domain family that is induced by NO. Based on mutant phenotype may be involved in NO stress response. |
AT3G55410 | Encodes the E1 subunit of the 2-oxoglutarate dehydrogenase. |
AT1G18100 | Encodes a member of the FT and TFL1 family of phosphatidylethanolamine-binding proteins. It is expressed in seeds and up-regulated in response to ABA. Loss of function mutants show decreased rate of germination in the presence of ABA. ABA dependent regulation is mediated by both ABI3 and ABI5. ABI5 promotes MFT expression, primarily in the radicle-hypocotyl transition zone and ABI3 suppresses it in the seed. |
AT1G07940 | GTP binding Elongation factor Tu family protein;(source:Araport11) |
AT2G32580 | transmembrane protein, putative (DUF1068);(source:Araport11) |
AT1G56050 | GTP-binding protein-like protein;(source:Araport11) |
AT1G34470 | magnesium transporter, putative (DUF803);(source:Araport11) |
AT4G23170 | Induced in response to Salicylic acid.Similar to receptor-like kinase 4 and 5. NPR1, a known positive regulator of the SA signaling pathway is responsible for the SA-dependent induction and constitutive repression of EP1 gene's basal expression. The mRNA is cell-to-cell mobile. |
AT4G32620 | Polycomb related protein that is part of a protein complex involved in histone deacetylation and heterochromatin silencing. |
AT3G05210 | encodes a homolog of human ERCC1 protein (yeast RAD10), which is a DNA repair endonuclease. Mutants are sensitive to UV-B and gamma radiation (G2 cell cycle phase arrest) and are defective in dark-repair of pyrimidine pyrimidone dimers. This protein incises the 5' end of damaged DNA, similar to ERCC1/RAD10. |
AT1G19210 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT5G61890 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT2G32170 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G13610 | Encodes a Fe(II)- and 2-oxoglutarate-dependent dioxygenase family gene F6'H1. Mutations in this gene compromise iron uptake and the production of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
AT4G13050 | Acyl-ACP thioesterase;(source:Araport11) |
AT1G12130 | Encodes a flavin-containing monooxygenases involved in biosynthesis of aliphatic glucosinolates. |
AT3G52750 | Nuclear gene that encodes a plastidial division protein (FtsZ2-2). FtsZ2-2 is involved in chloroplast morphology and internal organisation in addition to participating in chloroplast partition |
AT5G13480 | Encodes a protein with similarity to yeast Pfs2p, an mRNA processing factor. Involved in regulation of flowering time; affects FCA mRNA processing. Homozygous mutants are late flowering, null alleles are embryo lethal. |
AT3G06580 | Encodes a protein with galactose kinase activity. The gene was shown to complement the yeast Agal1 mutant defective in the galactokinase gene GAL1. |
AT1G27120 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. |
AT5G62620 | Encodes a Golgi-localized hydroxyproline-O-galactosyltransferase. Mutants display multiple phenotypes including reduced seed coat mucilage and accelerated leaf senescence. |
AT1G29670 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. The mRNA is cell-to-cell mobile. |
AT1G17890 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G14960 | encodes a protein similar to IAA-amido synthases. Lines carrying an insertion in this gene are hypersensitive to auxin. |
AT5G67540 | Arabinanase/levansucrase/invertase;(source:Araport11) |
AT3G11600 | One of two plant specific paralogs of unknown function. Interacts with GL2. GIR1/GIR2 loss of function resembles gl2 lof mutations. |
AT1G08750 | GPI8/PIG-K homolog involved in stomata development. Loss of function alleles do not transmit through the pollen. |
AT4G12790 | GPN GTPase involved in selective nuclear import of RNA polymerase II. |
AT3G60210 | GroES-like family protein;(source:Araport11) |
AT1G28480 | Encodes GRX480, a member of the glutaredoxin family that regulates protein redox state. GRX480 interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. GRX480 transcription is SA-inducible and requires NPR1. Maybe involved in SA/JA cross-talk. It has also been shown to interact with the transcription factor TGA2 and suppress ORA59 promoter activity. |
AT3G14130 | Aldolase-type TIM barrel family protein;(source:Araport11) |
AT5G47370 | homeobox-leucine zipper genes induced by auxin, but not by other phytohormones. Plays opposite roles in the shoot and root tissues in regulating auxin-mediated morphogenesis. |
AT4G37790 | Encodes homeobox protein HAT22, member of the HD-Zip II family. The mRNA is cell-to-cell mobile. |
AT2G22800 | Encodes homeobox protein HAT9. |
AT1G09940 | Encodes glutamyl-tRNA reductase. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins |
AT3G55350 | PIF / Ping-Pong family of plant transposase;(source:Araport11) |
AT5G24580 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G08570 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G55650 | HMG (high mobility group) box protein with ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
AT5G49760 | Leucine rich receptor kinase. Encodes a receptor of extracellular reactive oxygen species. |
AT3G45980 | Encodes a histone 2B (H2B) protein. This protein can be ubiquitinated in planta, and this modification depends on the HUB1 and HUB2 E3 ubiquitin ligases as well as the UBC1 and UBC2 E2 ubiquitin conjugating enzymes. Lysine 146 appears to be the site of the ubiquitin addition. |
AT1G75600 | Histone superfamily protein;(source:Araport11) |
AT5G02490 | Heat shock protein 70 (Hsp 70) family protein;(source:Araport11) |
AT2G23430 | Encodes a cyclin-dependent kinase inhibitor protein that functions as a negative regulator of cell division and promoter of endoreduplication. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Both SKP2b and RKP appear to be involved in the degradation of KRP1. |
AT3G24810 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
AT1G49620 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. Binds to D type cyclins and may inhibit cell cycle. |
AT5G05300 | IDL6 peptide is induced in response to Pathogen-Associated Molecular Patterns (PAMPs). Overexpression of IDL6 results in increased susceptibility to pathogens. |
AT5G58100 | Encodes a membrane protein involved in pollen nexine and sexine development. |
AT1G56460 | HIT zinc finger and PAPA-1-like domain-containing protein;(source:Araport11) |
AT4G22220 | Encodes a mitochondrial protein similar to E.coli IscU. In bacteria, IscU is a scaffold protein accepting sulfur and iron to build a transient Fe-S cluster,which is subsequently transferred to a target apoprotein. |
AT1G32130 | The C-terminal portion of this protein has high homology to the C-termini of the IWS1 (Interacts With Spt6) proteins found in yeast and humans. Interacts with transcription factor BES1. Involved in brassinosteroid-regulated gene expression. |
AT3G44110 | homologous to the co-chaperon DNAJ protein from E coli |
AT1G11950 | Transcription factor jumonji (jmjC) domain-containing protein;(source:Araport11) |
AT1G62310 | Encodes a probable H3K9me2 demethylase. Functions in trichome morphogenesis via regulation of GL3. |
AT1G23760 | Encodes aromatic rich glycoprotein JP630. |
AT3G50240 | Encodes a kinesin-related protein. |
AT5G15960 | cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level. |
AT1G55460 | DNA/RNA-binding protein Kin17, conserved region;(source:Araport11) |
AT3G23670 | Microtubule motor kinesin PAKRP1L/Kinesin-12B. Together with PAKRP1/Kinesin-12A, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
AT2G28060 | Component of the regulatory subunit of SNF1-related protein kinase. As part of the regulatory complex it binds maltose which promotes kinase activity. |
AT4G16850 | 6-transmembrane (6TM) protein that underlies a QTL for petal size with increased expression correlating to increased petal size. |
AT1G48050 | Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. Binds double stranded DNA breaks as a heterodimer with Ku70, involved in non-homologous end joining repair. Mutants are defective in T-DNA integration. Over expression confers increased resistance to DNA damage agents and increased susceptibility to T-DNA transformation. |
AT3G24750 | Encodes a member of the LAZY gene family that is expressed in the hypocotyl and the root |
AT3G20270 | Encodes one of the two LBP/BPI related proteins (AT1G04970/LBR-1, AT3G20270/LBR-2) that bind to LPS directly and regulate PR1 expression. |
AT1G24170 | Encodes a protein with putative galacturonosyltransferase activity. |
AT4G15093 | catalytic LigB subunit of aromatic ring-opening dioxygenase family;(source:Araport11) |
AT1G25570 | Di-glucose binding protein with Leucine-rich repeat domain-containing protein;(source:Araport11) |
AT3G22400 | Encodes lipoxygenase5 (LOX5). LOX5 activity in roots facilitates green peach aphid colonization of Arabidopsis foliage by promoting green peach aphid feeding from sieve element and water consumption from xylem. |
AT1G09970 | RLK7 belongs to a leucine-rich repeat class of receptor-likekinase (LRR-RLKs). It is involved in the control of germination speed and the tolerance to oxidant stress. The mRNA is cell-to-cell mobile. |
AT3G52200 | Encodes a dihydrolipoamide S-acetyltransferase, a subunit of the mitochondrial pyruvate dehydrogenase complex. |
AT1G18680 | HNH endonuclease domain-containing protein;(source:Araport11) |
AT1G18160 | required for ABA- and osmotic-stress-MAP3 kinase required for activation of SnRK2 kinases, enabling robust ABA and osmotic stress signal transduction. |
AT5G14980 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G19290 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G39410 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G39420 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT2G47630 | alpha/beta-Hydrolases superfamily protein;(source:Araport11) |
AT5G41910 | Mediator complex, subunit Med10;(source:Araport11) |
AT3G21350 | RNA polymerase transcriptional regulation mediator-like protein;(source:Araport11) |
AT1G48950 | C3HC zinc finger-like protein;(source:Araport11) |
AT1G23360 | Encodes a 2-phytyl-1,4-naphthoquinone methyltransferase that catalyzes the final step in phylloquinone (vitamin K1) biosynthesis. |
AT1G74440 | Similar to MPH1, can complement mph1-1 salt sensitivity phenotype. |
AT1G78830 | In combination with MYB4, MAN3, and Mannose part of signaling cascade which regulates cadmium tolerance. Mannose is able to bind to the GNA-related domain of MNB1; mannose binding to the GNA-related domain of MNB1 is required for MAN3-mediated Cd tolerance. |
AT5G26340 | Encodes a protein with high affinity, hexose-specific/H+ symporter activity. The activity of the transporter appears to be negatively regulated by phosphorylation. Importantly, microarray analysis, as well as the study of the expression of this gene in mutants involved in programmed cell death (PCD) demonstrated a tight correlation between this gene's expression and PCD. |
AT1G62010 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G56380 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62490 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G21150 | mTERF protein involved in mitochondrial development; required for salt tolerance. |
AT1G61960 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G61980 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62110 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT1G62120 | Mitochondrial transcription termination factor family protein;(source:Araport11) |
AT3G58060 | TP8 is a tonoplast localized member of CDF family of cation transporters. It functions in roots as an Mn transporter.MTP8 transports manganese into root vacuoles of iron-deficient plants and thereby prevents inhibition of iron deficiency-induced ferric chelate reductase by manganese. In seed embryos, MTP8 is responsible for manganese and iron enrichment in the subepidermal cell layer (particularly in vit1 mutant background.) |
AT3G24570 | contributes to osmotic stress tolerance |
AT5G08520 | Duplicated homeodomain-like superfamily protein;(source:Araport11) |
AT5G06560 | myosin-binding protein (Protein of unknown function, DUF593);(source:Araport11) |
AT2G22770 | Regulates the development of ER bodies. also involves in response to the endophytic fungus Piriformospora indica. |
AT3G15950 | Similar to TSK-associating protein 1 (TSA1), contains 10 EFE repeats, a novel repeat sequence unique to plants. Expressed preferentially in the roots.Protein is localized to ER bodies- an endoplasmic reticulum derived structure. Loss of function mutations lack ER bodies. |
AT5G02290 | Encodes a candidate protein kinase NAK that is similar to the oncogenes met and abl. |
AT4G09320 | nucleoside diphosphate kinase type 1 (NDPK1) gene, complete The mRNA is cell-to-cell mobile. |
AT5G13950 | nuclear factor kappa-B-binding protein;(source:Araport11) |
AT3G20610 | non-race specific disease resistance protein;(source:Araport11) |
AT3G54200 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT5G41835 | transposable_element_gene;(source:Araport11);non-LTR retrotransposon family (LINE), has a 1.2e-43 P-value blast match to GB:AAB41224 ORF2 (LINE-element) (Rattus norvegicus);(source:TAIR10) |
AT1G10300 | GTPase involved in HA - and ABA-mediated signaling pathways, particularly during defense respnses to pathogens. A truncated version of NOG1-2 has been detected in Col-0, Ler-0, Rsch-4 ecotypes. Functions similarly to the paralogous gene NOG1-1. |
AT5G18420 | CCR4-NOT transcription complex subunit;(source:Araport11) |
AT5G18230 | transcription regulator NOT2/NOT3/NOT5 family protein;(source:Araport11) |
AT5G60170 | E3 ligase involved in regulation of chloroplast protein synthesis through activity of PGR3. |
AT2G28540 | RNA binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT3G45710 | Encodes a chloride permeable transporter. Modulates chloride efflux from roots. |
AT1G22550 | Tonoplast localized pH dependent, low affinity nitrogen transporter.In shoots, expressed in leaf veins and mesophyll. In roots, GUS activity was detected in root vascular stele. More highly expressed in roots. |
AT2G38100 | Encodes a nitrate transporter that is involved in nitrogen accumulation in embryos. |
AT3G26490 | Phototropic-responsive NPH3 family protein;(source:Araport11) |
AT4G18790 | member of Nramp2 family |
AT1G11475 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB10. |
AT5G41010 | Non-catalytic subunit common to nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB12. |
AT4G21710 | Encodes the unique second-largest subunit of DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB2 and a homolog of the E. coli RNA polymerase beta subunit. |
AT2G15430 | Non-catalytic subunit of nuclear DNA-dependent RNA polymerases II, IV and V; homologous to budding yeast RPB3 and the E. coli RNA polymerase alpha subunit. A closely related paralog, encoded by At2g15400, can substitute for At2g15430 in the context of Pol V. |
AT5G09920 | Non-catalytic subunit specific to DNA-dependent RNA polymerase II; the ortholog of budding yeast RPB4) |
AT3G22900 | Non-catalytic subunit specific to DNA-directed RNA polymerase IV; homologous to budding yeast RPB7 |
AT3G57080 | Non-catalytic subunit unique to Nuclear DNA-dependent RNA polymerase V; homologous to budding yeast RPB5. |
AT4G17300 | Asparaginyl-tRNA synthetase protein involved in amino acid activation/protein synthesis. |
AT3G20760 | Nse4, component of Smc5/6 DNA repair complex;(source:Araport11) |
AT5G60980 | Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain-containing protein;(source:Araport11) |
AT1G05500 | Encodes a endomembrane-localized synaptotagmin. Synaptotagmin family proteins are calcium sensors that regulate exocytosis in mammalian cells. |
AT3G61050 | Encodes a novel transcriptional regulator, a calcium-dependent lipid-binding protein containing a C2 domain, that binds specifically to the promoter of THAS1 (thalianol synthase 1). It can bind ceramide and is involved in drought and salt tolerance. |
AT1G53590 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT2G40520 | Nucleotidyltransferase family protein;(source:Araport11) |
AT3G51620 | PAP/OAS1 substrate-binding domain superfamily;(source:Araport11) |
AT1G07640 | A member of the DOF transcription factors. Prominently expressed in the phloem of leaves and other organs. Expression is induced by wounding, MeJA and insect feeding. Upregulates glucosinolate biosynthesis. PEAR protein involved in the formation of a short-range concentration gradient that peaks at protophloem sieve elements, and activates gene expression that promotes radial growth. Locally promotes transcription of inhibitory HD-ZIP III genes, and thereby establishes a negative-feedback loop that forms a robust boundary that demarks the zone of cell division. |
AT1G76405 | outer envelope pore 21B-like protein;(source:Araport11) |
AT1G32090 | early-responsive to dehydration stress protein (ERD4);(source:Araport11) |
AT1G65080 | Structurally distinct member of Oxa1 superfamily , has tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2b.Involved in maturation of mitochondrial cytochrome c. |
AT3G44370 | Member of the Oxa1 super family protein insertases.It is structurally distinct having a tetratricopeptide repeat (TPR) domain at the C terminus. Paralog of OXA2a. Involved in biogenesis of mitochondrial respiratory chain complex IV, specifically via membrane insertion of COX2. |
AT5G61880 | Encodes PAM16L, a paralog of PAM16 (AT3G59280). |
AT1G30690 | Sec14p-like phosphatidylinositol transfer family protein;(source:Araport11) |
AT3G51670 | PATLs belong to a family of proteins having a Golgi dynamics (GOLD) domain in tandem with the Sec14p-like domain. PATLs are auxin regulated. Quadruple mutants (patl2456) show altered PIN1 lateralization in root endodermis cells. |
AT3G18940 | clast3-like protein;(source:Araport11) |
AT5G14710 | proteasome assembly chaperone-like protein;(source:Araport11) |
AT5G35580 | Protein kinase superfamily protein;(source:Araport11) |
AT1G76360 | Protein kinase superfamily protein;(source:Araport11) |
AT4G32730 | Encodes a putative c-myb-like transcription factor with three MYB repeats. |
AT2G02120 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. Mediates ammonium metabolism by regulatingglutamine synthetase activity. |
AT5G38710 | Methylenetetrahydrofolate reductase family protein;(source:Araport11) |
AT5G47690 | One of 5 PO76/PDS5 cohesion cofactor orthologs of Arabidopsis. |
AT2G36560 | A paternally expressed imprinted gene. |
AT2G39550 | encodes the beta subunit of geranylgeranyl transferase (GGT-IB), involved in both ABA-mediated and auxin signaling pathways. |
AT4G14450 | A member of a small family of proline/serine rich proteins of unknown function. It interacts with defense related MAP kinase MPK6. It's expression is induced by PAMP elicitors. May play a role in response to pathogens. |
AT1G04330 | A proline/serine rich protein of unknown function. It interacts with defense related MAP kinase MPK6 and others. May be involved in signaling during defense or stress response. |
AT1G43770 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G61120 | PHD finger-containing protein. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G49000 | F-box protein, part of SCF complex. |
AT4G11810 | Encodes an SPX domain protein that transports Pi into the vacuole. Overexpression of PHT5:2 leads to massive Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
AT4G22990 | Encodes a member of the PHOSPHATE TRANSPORTER 5 family (PHT5;3). Overexpression of PHT5:3 leads to Pi sequestration into vacuoles and altered regulation of Pi starvation-responsive genes. |
AT5G10410 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT5G65370 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT5G35200 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT2G25430 | AP180 N-terminal homology domain, TPLATE complex protein involved in clathrin-mediated endocytosis. |
AT1G33340 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT1G10900 | Phosphatidylinositol-4-phosphate 5-kinase family protein;(source:Araport11) |
AT1G08620 | Member of family of Jumonji C (JmjC)-containing demethylases, its catalytic domain exhibits both H3K4 and H3K9 demethylation activities. Together with MMD1 promotes in male meiocytes gene expression in an H3K9me3-dependent manner and thereby contributes to meiotic chromosome condensation. |
AT1G61850 | Encodes a non-specific lipase that hydrolyzes phospholipids as well as galactolipids, at both sn-1 and sn-2 positions. Involved in basal jasmonic acid biosynthesis by releasing the precursor fatty acid from membrane lipids. Mutant plants were impacted in resistance to fungus B. cinerea. |
AT3G17340 | Ran effector. |
AT1G21000 | PLATZ transcription factor family protein;(source:Araport11) |
AT4G17900 | PLATZ transcription factor family protein;(source:Araport11) |
AT3G27400 | Encodes a pectate lyase involved in response to nematodes. |
AT4G24780 | Encodes a pectate lyase involved in response to nematodes. |
AT5G11560 | catalytics;(source:Araport11) |
AT1G33612 | Encodes a receptor for the Plant Natriuretic Peptide (At2g18660, AtPNP-A). The receptor contains a functional guanylyl cyclase catalytic center embedded in the cytosolic kinase domain. This catalytic center can convert GTP into cGMP (and PPi) which enables ligand-specific downstream signalling. It is therefore consistent with the reported cGMP dependence of AtPNP-A effects (see DOI:10.1007/s11103-016-0465-8). |
AT1G76140 | Putative prolyl oligopeptidase. |
AT3G26020 | Encodes protein phosphatase 2A (PP2A) B'eta subunit. Targeted to nucleus and cytosol. |
AT4G01690 | Encodes protoporphyrinogen oxidase (PPOX). |
AT1G76950 | Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain-containing protein;(source:Araport11) |
AT5G52800 | primase/polymerase protein |
AT5G44565 | transmembrane protein;(source:Araport11) |
AT5G44580 | transmembrane protein;(source:Araport11) |
AT5G44572 | transmembrane protein;(source:Araport11) |
AT5G44575 | hypothetical protein;(source:Araport11) |
AT2G22420 | Encodes a cell wall-localized class III peroxidase that is directly regulated by the MADS-box transcription factor AGL15 and is involved in lignified tissue formation. |
AT5G64100 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT4G21960 | Encodes AT4g21960 (AT4g21960/T8O5_170). The mRNA is cell-to-cell mobile. |
AT5G01830 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G67340 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G37490 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65920 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G25160 | Encodes a U-box domain-containing E3 ubiquitin ligase with central Ser/Thr protein kinase domain whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT1G68940 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G36550 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G65500 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G61560 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G61550 | U-box domain-containing protein kinase family protein;(source:Araport11) |
AT5G51270 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G01660 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G18560 | Encodes PUCHI, a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. PUCHI is required for morphogenesis in the early lateral root primordium of Arabidopsis. Expressed in early floral meristem (stage 1 to 2). Required for early floral meristem growth and for bract suppression. Triple mutant with bop1 and bop2 displays a strong defect in the determination of floral meristem identity with reduced LFY expression and the lack of AP1 expression. |
AT3G09260 | Encodes beta-glucosidase.The major constituent of ER bodies. One of the most abundant proteins in Arabidopsis seedlings. Exist in an soluble (inactive) and non-soluble (active) form, most probably formed in a polymerization process. Involved in the mutualistic interaction between Arabidopsis and the endophytic fungus Piriformospora indica. |
AT2G05635 | DEAD helicase |
AT3G05480 | Involved in the regulation of DNA damage repair and homologous recombination. |
AT1G70200 | Encodes a RNA-Binding Protein RBD1. Promotes chilling tolerance through 23S rRNA processing. |
AT5G57720 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G41170 | Pentatricopeptide repeat (PPR-like) superfamily protein;(source:Araport11) |
AT4G33040 | Encodes a member of the CC-type glutaredoxin (ROXY) family that has been shown to interact with the transcription factor TGA2. |
AT5G61000 | Replication factor-A protein 1-like protein;(source:Araport11) |
AT1G15250 | cytosolic ribosomal protein gene, part of eL20 family |
AT2G01250 | Cytosolic ribosomal 60S subunit protein. |
AT4G29390 | Ribosomal protein S30 family protein;(source:Araport11) |
AT3G02250 | O-fucosyltransferase family protein;(source:Araport11) |
AT2G28620 | Mutants have radially swollen roots but do not exhibit defects in abundance or orientation of cortical microtubules, nor are microfibrils reduced. Cellulose synthesis is also unchanged with respect to wild type. There is a disruption in the normal pattern of cell wall placement. |
AT2G25420 | WD40 domain protein which interacts with ROS1 in the base excision repair pathway through DNA methylation. |
AT5G62460 | RZFP is a zinc finger protein involved in mediating abiotic stress tolerance. |
AT4G35740 | Encodes RECQ3, an ATP-dependent helicase. |
AT5G09460 | transcription factor bHLH143;(source:Araport11) |
AT5G63980 | Encodes a bifunctional protein that has 3'(2'),5'-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities and rescues sulfur assimilation mutants in yeast. It is involved in the response to cold, drought (negative regulator of drought tolerance), and ABA. Mutants in this gene exhibit enhanced induction of stress genes in response to cold, ABA, salt and dehydration and increased levels of 3'-phosphoadenosine 5'-phosphate (PAP). Involved in degradation of small mRNAs. Mutants also affect the accumulation of miRNA target cleavage products. Regulates light-dependent repression of hypocotyl elongation and flowering time via its 3'(2'),5'-bisphosphate nucleotidase activity. Its activity is sensitive to the redox state of its environment, decreasing under oxidative conditions and is regulated by dimerization and intra and inter-molecular disulfide bond formation. |
AT2G47820 | arginine-glutamic acid dipeptide repeat protein;(source:Araport11) |
AT1G32940 | Subtilase family protein;(source:Araport11) |
AT5G59810 | Subtilase family protein;(source:Araport11) |
AT5G51340 | SCC4 is a tetratricopeptide repeat containing protein and a likely component of a plant cohesion loading complex along with its partner SSC2 It is expressed primarily in dividing cells. Loss of function mutants are embryo lethal, arresting by globular stage. |
AT4G12120 | member of KEULE Gene Family |
AT4G14870 | Encodes a component of the thylakoid-localized Sec system involved in the translocation of cytoplasmic proteins into plastid. The mRNA is cell-to-cell mobile. |
AT3G48900 | Encodes one of two GEN1 homologs in Arabidopsis. It is a member of the class IV Rad2/XPG family of nucleases that processes Holliday junctions in a manner analogous to the HJ resolvases of phages, archaea, and bacteria. |
AT1G47710 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11) |
AT5G27350 | Encodes a sugar-porter family protein that is induced during leaf senescence. The increase in its gene expression during leaf senescence is paralleled by an accumulation of monosaccharides. The mRNA is cell-to-cell mobile. |
AT4G23570 | Closely related to SGT1B, may function in SCF(TIR1) mediated protein degradation. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. AtSGT1a is induced upon pathogen infection and can function in R gene-mediated resistance. |
AT4G11260 | Functions in plant disease resistance signaling, SCF(TIR1) mediated degradation of Aux/IAA proteins and HSP90 mediated degradation of R resistance proteins. AtSGT1a and AtSGT1b are functionally redundant in the resistance to pathogenes. AtSGT1b was more highly expressed than AtSGT1. The N-terminal TPR domain of AtSGT1a reduces the steady-state level of Arabidopsis SGT1 proteins whereas the same domain from AtSGT1b enhances SGT1 accumulation. The TPR domain is dispensable for SGT1 resistance. |
AT1G69220 | Encodes serine/threonine kinase 1 (SIK1), a Hippo homolog. Regulates cell proliferation and cell expansion. |
AT1G54385 | At1G54385 encodes the plant KASH protein SINE1; SINE1 interacts with SUN1 and SUN2, is colocalized with F-actin, and is localized at the nuclear envelope. |
AT5G42190 | Similar to SKP1 in yeast and humans which are involved in mitotic cell cycle control and ubiquitin mediated proteolysis. |
AT2G28870 | cyclin-dependent kinase inhibitor SMR1-like protein;(source:Araport11) |
AT5G59360 | hypothetical protein;(source:Araport11) |
AT5G02420 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT5G40460 | cyclin-dependent kinase inhibitor SMR3-like protein;(source:Araport11) |
AT1G17600 | SOC3 is a TIR-NB-leucine-rich repeat (TNL) protein.Mutants suppress loss of chs2 phenotype of auto-activation of immunity. When the TIR domain of SOC3 interacts with CHS2 the binding results in temperature activation of cell death, the suppressors inhibit this interaction. |
AT2G34210 | Transcription elongation factor Spt5;(source:Araport11) |
AT1G73820 | Protein phosphatase which physically interacts with the RRM1 motif of FCA to antagonize FCA binding with COOLAIR, which is critical for PRC2 enrichment and H3K27me3 deposition. |
AT5G44568 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G22890 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65486 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65490 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G65500 | Secreted peptide which functions in plant growth and pathogen defense. |
AT4G08810 | Calcium binding protein involved in cryptochrome and phytochrome coaction |
AT5G43990 | Encodes SUVR2, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
AT1G30020 | SVB family gene. |
AT4G24130 | ABA responsive SVB family gene. |
AT3G48740 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT5G23660 | Encodes a member of the SWEET sucrose efflux transporter family proteins. |
AT3G14770 | Nodulin MtN3 family protein;(source:Araport11) |
AT5G53190 | Nodulin MtN3 family protein;(source:Araport11) |
AT4G10850 | Nodulin MtN3 family protein;(source:Araport11) |
AT5G40260 | Encodes RPG1 (RUPTURED POLLEN GRAIN1), a member of the MtN3/saliva gene family. Crucial for exine pattern formation and cell integrity of microspores. |
AT2G39060 | Encodes a sucrose transporter that is expressed in nectaries and is involved in nectar secretion. |
AT2G14880 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT3G03590 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT5G40840 | Cohesion family protein SYN2 (SYN2). Plays a role in somatic DNA double strand break damage repair. |
AT1G20080 | Encodes a synaptotagmin localized on the Golgi apparatus and that regulates protein secretion via the unconventional protein transport from the cytosol to the extracellular matrix in plant cells. |
AT5G11100 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT3G19100 | Encodes a protein kinase that positively regulates gibberellic acid (GA) signaling by inactivating the E3 ubiquitin ligase GARU. GARU mediates ubiquitin-dependent degradation of GID1s, which are GA receptors. |
AT2G20110 | Tesmin/TSO1-like CXC domain-containing protein which is a transcriptional repressor of genes required for maintenance of DNA methylation, including MET1, CMT3, DDM1, KYP and VIMs. Functions redundantly with its paralogue TCX5 in repressing the expression of these genes. |
AT1G24706 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. Mutations in THO have severe developmental defects and affect the production of several different classes of small RNAs indicating a broader role in small RNA biosynthesis. |
AT3G02950 | Encodes a component of the putative Arabidopsis THO/TREX complex: THO1 or HPR1 (At5g09860), THO2 (At1g24706), THO3 or TEX1 (At5g56130), THO5 (At5g42920, At1g45233), THO6 (At2g19430), and THO7 (At5g16790, At3g02950). THO/TREX complexes in animals have been implicated in the transport of mRNA precursors. Mutants of THO3/TEX1, THO1, THO6 accumulate reduced amount of small interfering (si)RNA, suggesting a role of the putative Arabidopsis THO/TREX in siRNA biosynthesis. |
AT1G74950 | Key regulator in alternative splicing in the jasmonate signaling pathway, alone and in collaboration with other regulators. |
AT4G22300 | Formerly known as SOBER1, this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. This locus is now known as TIPSY1 and AT4G22305 corresponds to SOBER1. |
AT4G12650 | Endomembrane protein 70 protein family;(source:Araport11) |
AT5G25100 | Endomembrane protein 70 protein family;(source:Araport11) |
AT1G12930 | Ran effector. |
AT5G27840 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with ATUNIS1/TOPP9 (AT3G05580). |
AT5G07170 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of Aurora kinase activity. |
AT5G37478 | TPX2 (targeting protein for Xklp2) protein family;(source:Araport11) |
AT2G17930 | Component of the SPT module of the SAGA complex. |
AT4G36080 | Component of the SPT module of the SAGA complex. |
AT5G54750 | Part of multi-protein complex, acting as guanine nucleotide exchange factors (GEFs) and possibly as tethers, regulating intracellular trafficking. |
AT4G40000 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT3G50590 | WD40/YVTN repeat protein. |
AT1G30660 | A truncated version of Twinkle that retains only the DNA primase domain. |
AT1G14205 | Member of the uL18 RNA-binding protein family. uL18 proteins share a short structurally conserved domain that binds the 5S rRNA and allow its incorporation into ribosomes. Essential for the splicing of the first intron of rps12 in plastid. |
AT5G16310 | Peptidase C12, ubiquitin carboxyl-terminal hydrolase 1;(source:Araport11) |
AT5G26310 | UGT72E3 is an UDPG:coniferyl alcohol glucosyltransferase which glucosylates sinapyl- and coniferyl alcohol as well as sinapic acid. The enzyme is thought to be involved in lignin- and phenylpropanoid metabolism. A knockdown mutant line (72E3KD) was obtained using RNAi silencing. No reduction in coniferyl alcohol 4-O-glucoside and sinapyl alcohol 4-O-glucoside was detected in this line compared to wildtype, in contrast with the knockdown line constructed for UGT72E2 displayed a twofold reduction in the these phenylpropanoid 4-O-glucosides. Can influence the kinetics of lignin deposition by regulating monolignol flow to the cell wall as well as the potential of this compartment to incorporate monomers into the growing lignin polymer. |
AT4G27560 | Encodes a UDP-glycosyltransferase that contributes to cold, salt and drought stress tolerance via modulating anthocyanin accumulation. |
AT4G15480 | Encodes a protein that might have sinapic acid:UDP-glucose glucosyltransferase activity. |
AT1G06000 | encodes a flavonol-7-O-rhamnosyltransferase involved in the formation of rhamnosylated flavonols |
AT1G33980 | Involved in mRNA surveillance, detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). Regulates AT1G72910, AT1G72940, and ADR1-LIKE 2 in a temperature dependent manner. |
AT4G24060 | Plant-specific Dof transcription factor which regulates vascular cell di#erentiation and lignin biosynthesis. |
AT3G28710 | Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes, which plays an important role in plant growth. VHA-d1 is one of the two subunit isoforms. |
AT4G26710 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
AT4G02620 | Member of V-ATPase family. Vacuolar-type H + -ATPase (V-ATPase) is a multisubunit proton pump located on the endomembranes. |
AT1G16780 | Encodes a type II H+-PPases that localizes to and function as a proton pump of the Golgi apparatus in most tissues except for mature leaves. |
AT1G50360 | member of Myosin-like proteins |
AT5G14510 | Armadillo (ARM) repeat containing protein involved in vascular development. |
AT4G19003 | E2F/DP family winged-helix DNA-binding domain-containing protein;(source:Araport11) |
AT5G04920 | EAP30/Vps36 family protein;(source:Araport11) |
AT1G73030 | Encodes an ESCRT-related protein: CHMP1A/AT1G73030; CHMP1B/AT1G17730. CHMP1A and B mediate multivesicular body sorting of auxin carriers and are required for plant development. ESCRT: Endosomal Sorting Complexes Required For Transport machinery; CHMP: Charged Multivesicular Body Protein/Chromatin Modifying Protein. |
AT2G22880 | VQ motif-containing protein;(source:Araport11) |
AT3G14370 | The WAG2 and its homolog, WAG1 each encodes protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT5G65130 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4. |
AT1G49160 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its |
AT4G12020 | Encodes a member of the A1 subgroup of the MEKK (MAPK/ERK kinase kinase) family. MEKK is another name for Mitogen-Activated Protein Kinase Kinase Kinase (MAPKKK or MAP3K). This subgroup has four members: At4g08500 (MEKK1, also known as ARAKIN, MAP3Kb1, MAPKKK8), At4g08480 (MEKK2, also known as MAP3Kb4, MAPKKK9), At4g08470 (MEKK3, also known as MAP3Kb3, MAPKKK10) and At4g12020 (MEKK4, also known as MAP3Kb5, MAPKKK11, WRKY19). Nomenclatures for mitogen-activated protein kinases are described in Trends in Plant Science 2002,7(7):301. Co-regulates with DSC1 basal levels of immunity to root-knot nematodes. |
AT4G01250 | AtWRKY22 is a member of WRKY Transcription Factor; Group II-e. It is involved in regulation of dark induced leaf senescence. |
AT4G23550 | Encodes WRKY DNA-binding protein 29 (WRKY29). The mRNA is cell-to-cell mobile. |
AT4G11070 | member of WRKY Transcription Factor; Group III |
AT4G04450 | member of WRKY Transcription Factor; Group II-b. Interacts with lncRNA APOLO to trigger root hair cell expansion in response to cold. |
AT4G01720 | member of WRKY Transcription Factor; Group II-b |
AT4G23810 | member of WRKY Transcription Factor; Group III |
AT1G58440 | Encodes a putative protein that has been speculated, based on sequence similarities, to have squalene monooxygenase activity. |
AT4G33200 | member of Myosin-like proteins |
AT1G08730 | Encodes a class XI myosin that is involved in organelle motility, actin organization, and optimal growth of pollen tubes. |
AT4G28710 | member of Myosin-like proteins The mRNA is cell-to-cell mobile. |
AT3G04490 | Ran effector. XPO4 coordinates the nuclear accumulation of TOPLESS and TOPLESS-Related transcription corepressors, which plays a role in regulating salicylic acid-mediated defense feedback and modulating the strength of immunity induced by cpr5, a nucleoporin mutant. |
AT1G51510 | This gene is predicted to encode a protein involved in the exon junction complex. Though there is a predicted RNA binding motif, in the Drosophila ortholog (33% identity), this motif mediates interactions with Mago and is not available for RNA binding. The Arabidopsis Y14 protein appears to be predominantly nucleolar, but there is also some evidence for its presence in the cytoplasm. |
AT2G38860 | Encodes protease I (pfpI)-like protein YLS5. |
AT4G21160 | ADP-ribosylation factor GTPase-activating protein containing zinc finger and C2 domains and a novel PI-3-P-binding protein region. Binds PI-3-P. Highest expression levels in flowering tissue, rosettes and roots. A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT3G53600 | Nuclear C2H2 zinc finger protein.Expression is induced by cold, osmotic, salt, and drought stress. Over expression confers some drought tolerance whereas mutants display some drought sensitivity. |
AT2G45120 | C2H2-like zinc finger protein;(source:Araport11) |
AT5G38600 | Proline-rich spliceosome-associated (PSP) family protein / zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT1G59590 | ZCF37 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT1G58340 | Encodes a plant MATE (multidrug and toxic compound extrusion) transporter that is localized to the Golgi complex and small organelles and is involved in determining the rate of organ initiation. It is also involved in iron homeostasis when plants are under osmotic stress. |
AT4G33020 | member of Fe(II) transporter isolog family |
AT3G57700 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57640 | Protein kinase superfamily protein;(source:Araport11) |
AT3G57760 | Protein kinase superfamily protein;(source:Araport11) |
AT1G58350 | Putative serine esterase family protein;(source:Araport11) |
AT1G58270 | ZW9 mRNA, complete cds The mRNA is cell-to-cell mobile. |
AT1G22260 | One of two nearly identical proteins (ZYP1b) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility. |
AT1G22275 | One of two nearly identical proteins (ZYP1a) identified by similarity to transverse filament (TF) proteins. These proteins are involved in chromosome synapsis during meiosis I and localize to the synaptonemal complex (SC). Single mutants have reduced fertility and double mutants (induced by RNAi) have severely reduced fertility. |
AT2G16770 | Basic-region leucine zipper (bZIP23) transcription factor involved in the adaptation to zinc deficiency. Binds ZDRE motifs. |
AT1G44318 | Aldolase superfamily protein;(source:Araport11) |
AT5G14220 | Encodes PPO2, a putative protoporphyrinogen oxidase based on sequence homology. Also known as MEE61 (maternal effect embryo arrest 61). mee61 mutant shows arrested endosperm development. |
AT2G20960 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT4G31430 | Encodes a plant-specific protein that physically interacts with CRWN1 and its homolog CRWN4 and localizes at the inner nuclear membrane. KAKU4 deforms the nuclear envelope in a dose-dependent manner, in association with nuclear membrane invagination and stack formation. |
AT1G01480 | a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family, isolated from a flower-specific cDNA library. |
AT4G26200 | Member of a family of proteins in Arabidopsis that encode 1-Amino-cyclopropane-1-carboxylate synthase, an enzyme involved in ethylene biosynthesis. Not expressed in response to IAA. |
AT4G37770 | Encodes an auxin inducible ACC synthase. |
AT1G12010 | Encodes a protein that appears to have 1-amino-cyclopropane-1-carboxylic acid oxidase activity based on mutant analyses. The mRNA is cell-to-cell mobile. |
AT4G08040 | encodes an aminotransferase that belongs to ACC synthase gene family structurally |
AT3G49700 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. Mutants produce elevated levels of ethylene as etiolated seedlings. |
AT4G11280 | encodes a a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family The mRNA is cell-to-cell mobile. |
AT2G26420 | Encodes a phosphatidylinositol-4-phosphate 5-kinase. Exclusively expressed in roots. Essential for root hair growth. |
AT1G76690 | Encodes one of the closely related 12-oxophytodienoic acid reductases. This enzyme is not expected to participate in jasmonic acid biosynthesis because during in vitro assays, it shows very little activity with the naturally occurring OPDA isomer. Shows activity towards 2,4,6-trinitrotoluene. Expressed predominately in root. Predicted to be a cytosolic protein. |
AT1G09780 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
AT3G08590 | Encodes a 2,3-biphosphoglycerate-independent phosphoglycerate mutase that is involved in pollen development and stomatal movement. |
AT3G19010 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT1G13060 | Encodes 20S proteasome beta subunit PBE1 (PBE1). |
AT2G20580 | encoding the RPN subunits of the 26S proteasome The mRNA is cell-to-cell mobile. |
AT5G53000 | PP2A-associated protein with a possible function in the chilling response |
AT4G03415 | Encodes a myristoylated 2C-type protein phosphatase that interacts with AGB1 and is localized to the plasma membrane. |
AT2G17370 | Encodes a 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) that is involved in the synthesis of sterol and triterpenoid compounds. |
AT4G14440 | encodes a cytosolic delta3, delta2-enoyl CoA isomerase, involved in unsaturated fatty acid degradation |
AT1G01120 | Encodes a condensing enzyme KCS1 (3-ketoacyl-CoA synthase 1) which is involved in the critical fatty acid elongation process in wax biosynthesis. |
AT2G26250 | epidermis-specific, encodes KCS10, a putative 3-ketoacyl-CoA synthase. probably involved in the synthesis of long-chain lipids found in the cuticle. |
AT2G28630 | Encodes KCS12, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT4G34520 | Encodes KCS18, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT5G04530 | Encodes KCS19, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G07720 | Encodes KCS3, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G25450 | Encodes KCS5, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT1G68530 | Encodes KCS6, a member of the 3-ketoacyl-CoA synthase family involved in the biosynthesis of VLCFA (very long chain fatty acids). |
AT4G24770 | Encodes a chloroplast RNA-binding protein. A substrate of the type III effector HopU1 (mono-ADP-ribosyltransferase). Required for editing and stability of specific chloroplast mRNAs. |
AT2G26260 | Encodes an enzyme with 3β-hydroxysteroid dehydrogenase/C4-decarboxylase activity in vitro. The activity of the enzyme was determined using microsomal extracts of yeast overexpressing the Arabidopsis gene. Cytosolic fractions failed to be associated to the activity, leading to the speculation that the enzyme is membrane-bound. |
AT1G65060 | encodes an isoform of 4-coumarate:CoA ligase (4CL), which is involved in the last step of the general phenylpropanoid pathway. mRNA levels are not induced in response to wounding or to fungal infection by P. parasitica. mRNA is expressed in flowers, to a lesser degree in mature leaves and siliques and marginally in seedling roots and bolting stems of mature plants. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, ferulic acid, cinnamic acid and 5-OH-ferulic acid. At4CL3 was unable to use sinapic acid as substrate. |
AT3G21230 | The gene encodes a 4-coumarate coenzyme A ligase being able to use sinapate as substrate. The catalytic efficiency was in the following (descending) order: p-coumaric acid, caffeic acid, 5-OH-ferulic acid, ferulic acid and sinapic acid. At4CL5 was unable to use cinnamic acid as substrate. Knockout of At4CL5 (4cl5) revealed no effect on syringyl lignin content indicating that the activity observed does probably not occur in vivo. |
AT3G04770 | 40s ribosomal protein SA B;(source:Araport11) |
AT5G41670 | 6-phosphogluconate dehydrogenase family protein;(source:Araport11) |
AT1G13700 | Encodes a cytosolic 6-phosphogluconolactonase (PGL) thought to be involved in the oxidative pentose-phosphate pathway (OPPP). |
AT1G01100 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT4G00810 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT5G47700 | Co-orthologous gene of large ribosomal subunit protein RPP1. |
AT1G04620 | Encodes a 7-hydroxymethyl chlorophyll a reductase, an enzyme of the chlorophyll cycle that converts 7-hydroxymethyl chlorophyll a to chlorophyll a. |
AT1G21710 | Encodes 8-oxoguanine-DNA glycosylase. DNA repair enzyme. |
AT1G52340 | Encodes a cytosolic short-chain dehydrogenase/reductase involved in the conversion of xanthoxin to ABA-aldehyde during ABA biosynthesis. Mutants are insensitive to sucrose and glucose. |
AT4G26080 | Involved in abscisic acid (ABA) signal transduction. Negative regulator of ABA promotion of stomatal closure. |
AT3G24650 | Homologous to the maize transcription factor Viviparous-1. Full length ABI3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of ABI3 requires the B3 DNA-binding domain and an activation domain. In addition to the known N-terminal-located activation domain, a second transcription activation domain was found in the B1 region of ABI3. ABI3 is essential for seed maturation. Regulator of the transition between embryo maturation and early seedling development. Putative seed-specific transcriptional activator. ABI3 is a central regulator in ABA signaling and is unstable in vivo. It interacts with and can by polyubiquitinated by AIP2 in vivo. Based on double mutant analyses, ABI3 interacts genetically with both FUS3 and LEC1 and is involved in controlling accumulation of chlorophyll and anthocyanins, sensitivity to abscisic acid, and expression of the members of the 12S storage protein gene family. In addition, both FUS3 and LEC1 regulate positively the abundance of the ABI3 protein in the seed. Alternative splicing of ABI3 is developmentally regulated by SUA (AT3G54230). |
AT2G40220 | Encodes a member of the DREB subfamily A-3 of ERF/AP2 transcription factor family (ABI4). The protein contains one AP2 domain. There is only one member in this family. Involved in abscisic acid (ABA) signal transduction, ABA-mediated glucose response, and hexokinase-dependent sugar responses. Acts downstream of GUN1 in retrograde signaling. Expressed most abundantly in developing siliques and to a lesser degree in seedlings. |
AT5G64750 | Encodes a putative transcription factor containing an AP2 domain. Is a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. Expressed in response to ABA, osmotic stress, sugar stress and drought. Mutants are hypersensitive to these stresses. May be involved in regulation of ABA mediated stress response. The mRNA is cell-to-cell mobile. |
AT4G11890 | Encodes a receptor-like cytosolic kinase ARCK1. Negatively controls abscisic acid and osmotic stress signal transduction. |
AT4G38480 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT1G55870 | Encodes a poly(A)-specific ribonuclease, AtPARN. Expression of AtPARN is upregulated by ABA or stress treatment. Mutant is hypersensitivity to salicylic acid as well as ABA. Functions with AGS1 to regulate the poly(A) status of mitochondrial mRNA. |
AT3G18950 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G66070 | E3 ubiquitin ligase that functions in negative regulation of ABA signaling. |
AT3G56850 | Encodes an ABA-responsive element binding protein with a bZIP domain. Located in the nucleus and expressed in the embryo during seed maturation. |
AT4G01660 | Encodes an ABC1-like protein, member of the ATH subfamily; putative ABC transporter; isolated by functional complementation of a yeast abc1 mutant The mRNA is cell-to-cell mobile. |
AT4G31390 | Protein kinase superfamily protein;(source:Araport11) |
AT3G23560 | Member of the multidrug and toxic compound extrusion (MATE) family, protects roots from inhibitory compounds. |
AT2G38185 | RING/U-box superfamily protein;(source:Araport11) |
AT3G29575 | ABI five binding protein 3;(source:Araport11) |
AT3G19290 | bZIP transcription factor with specificity for abscisic acid-responsive elements (ABRE). Mediates ABA-dependent stress responses.ABF4 acts through SnRK2 pathway and binds to ABA response elements of the promoters of NYE1 and regulates their expression to promote chlorophyll degradation. |
AT1G67080 | Encodes a protein involved in the photoprotection of PSII. An aba4-1 mutant completely lacks neoxanthin,a component of the chromophore of the peripheral antenna system in PSII. ABA4 is required for neoxanthin biosynthesis, an intermediary step in abscisic acid biosynthesis, but no catalytic activity has been detected for the ABA4 protein. |
AT1G45249 | Leucine zipper transcription factor that binds to the abscisic acid (ABA)?responsive element (ABRE) motif in the promoter region of ABA-inducible genes. Enhances drought tolerance in vegetative tissues. Required for normal glucose response. Localized in the nucleus. Expressed constitutively in roots, leaf vascular tissues, and hydathodes or in all tissues under stress conditions. It's phosphorylated by a ABA-activated 42-KDa kinase. Overexpression of the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment. |
AT2G27150 | Encodes the aldehyde oxidase delta isoform catalyzing the final step in abscisic acid biosynthesis. |
AT3G61510 | Encodes a member of the 1-aminocyclopropane-1-carboxylate (ACC) synthase (S-adenosyl-L-methionine methylthioadenosine-lyase, EC 4.4.1.14) gene family. The gene is transcriptionally active but enzymatically inactive. The predicted amino-acid sequence of ACS1 is missing the highly conserved tripeptide, Thr-Asn-Pro (TNP), between Ile204 and Ser205. Introduction of TNP into ACS1 restores the ACS activity. |
AT5G65800 | 1-aminocyclopropane-1-carboxylate synthase (ACS) is encoded by a multigene family consisting of at least five members whose expression is induced by hormones, developmental signals, and protein synthesis inhibition. |
AT4G37000 | Mutants have spontaneous spreading cell death lesions and constitutive activation of defenses in the absence of pathogen infection. Its product was shown to display red chlorophyll catabolite reductase (RCCR), which catalyzes one step in the breakdown of the porphyrin component of chlorophyll. The enzyme was further assessed to be a Type-1 (pFCC-1-producing) RCCR.Upon P. syringae infection, ACD2 localization shifts from being largely in chloroplasts to partitioning to chloroplasts, mitochondria, and to a small extent, cytosol. Overexpression of ACD2 delayed cell death and the replication of P. syringae. |
AT4G14400 | encodes a novel protein with putative ankyrin and transmembrane regions. It is a member of one of the largest uncharacterized gene families in higher plants. The gene is involved in resistance to Pseudomonas syringae. |
AT2G23600 | Encodes a protein shown to have carboxylesterase activity, methyl salicylate esterase activity, methyl jasmonate esterase activity, and methyl IAA esterase activity in vitro. MES2 appears to be involved in MeSA hydrolysis in planta. This protein does not act on MeGA4, or MEGA9 in vitro and has been show to be capable of hydrolyzing methyl ester nicotinate back to nicotinate. |
AT1G36160 | Encodes acetyl-CoA carboxylase. Mutant displays uncoordinated cell divisions which are enhanced by cytokinins. Mutant also has aberrant organization of the apical region in the embryo and abnormal root and shoot development and is deficient in freezing tolerance after cold acclimation. Essential for very long chain fatty acid elongation. The mRNA is cell-to-cell mobile. |
AT5G36880 | Encodes a plastidic acetyl-coA synthetase. This enzyme plays a role in converting acetate to acetyl-coA in the plastids. It does not appear to be a major contributor to fatty acid biosynthesis based on mutant phenotypes. The enzyme seems to act as a monomer and may play an important role in preventing the toxic accumulation of fermentation products including acetaldehyde, acetate, and ethanol. It participates in the pyruvate dehydrogenase bypass pathway |
AT4G26970 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. The mRNA is cell-to-cell mobile. |
AT2G05710 | Encodes an aconitase that can catalyze the conversion of citrate to isocitrate through a cis-aconitate intermediate, indicating that it may participate in the TCA cycle and other primary metabolic pathways. The protein is believed to accumulate in the mitochondria and the cytosol. It affects CSD2 (At2g28190 - a superoxide dismutase) transcript levels and may play a role in the response to oxidative stress. One member of the family (ACO1 - At35830) was shown to specifically bind to the 5' UTR of CSD2 in vitro. ACO3 is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. The mRNA is cell-to-cell mobile. |
AT1G76990 | ACT domain repeat 3;(source:Araport11) |
AT2G36840 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. |
AT1G16880 | Encodes a ACT domain-containing protein. The ACT domain, named after bacterial aspartate kinase, chorismate mutase and TyrA (prephenate dehydrogenase), is a regulatory domain that serves as an amino acid-binding site in feedback-regulated amino acid metabolic enzymes. The mRNA is cell-to-cell mobile. |
AT1G49240 | Member of a subclass of actins composed of ACT2 and ACT8. Its mRNA is strongly expressed in strongly expressed in leaves, roots, stems, flowers, pollen, and siliques. However, protein expression, assayed by a ACT8:GUS fusion reporter, is very low in pollen. |
AT1G01750 | actin depolymerizing factor 11;(source:Araport11) |
AT3G46000 | Encodes depolymerizing factor 2. |
AT2G16700 | Encodes actin depolymerizing factor 5 (ADF5). |
AT4G00680 | actin depolymerizing factor 8;(source:Araport11) |
AT3G27000 | encodes a protein whose sequence is similar to actin-related proteins (ARPs) in other organisms. its transcript level is down regulated by light and is expressed in very low levels in all organs examined. |
AT1G33560 | Encodes a NBS-LRR disease resistance protein that possesses N-terminal kinase subdomains. Activation tagged mutant of ADR1 showed elevated levels of SA and reactive oxygen species in addition to number of defense gene transcripts. Exhibits resistance to number of microbial pathogens. |
AT3G12890 | Encodes a protein belonging to a class of CCT (CONSTANS, CONSTANS-like, TOC1) domain proteins. The protein contains a 43 amino acid-long sequence with high homology to the CCT domain but does not have any B-box or GATA-type zinc finger domains. Functions as a transcriptional activator and regulates the expression of at least a subset of sugar-inducible genes. |
AT1G55320 | Encodes a protein with similarity to acyl activating enzymes. AAE18 is localized to the peroxisome where it may be involved in metabolism of auxin precursors to active auxins. |
AT3G16910 | Encodes a peroxisomal protein with acetyl-CoA synthetase activity that is responsible for the activation of acetate for entry into the glyoxylate cycle. |
AT3G02610 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
AT5G16230 | Encodes one of two ∆9 palmitoyl-ACP desaturases responsible for the biosynthesis of ω-7 fatty acids in the maturing endosperm. |
AT5G27630 | Acyl-CoA binding protein with high affinity for oleoyl-CoA. Expressed in all plant organs. Involved in fatty acid transport. Plays a role in determining seed oil content. |
AT4G16760 | Encodes a medium to long-chain acyl-CoA oxidase. Catalyzes the first step of fatty acid beta-oxidation. Involved in jasmonate biosynthesis. Gene expression is induced by wounding, drought stress, abscisic acid, and jasmonate. |
AT4G24230 | acyl-CoA-binding protein ACBP3. Localized extracellularly in transiently expressed tobacco BY-2 cells and onion epidermal cells. Binds arachidonyl-CoA with high affinity. Microarray data shows up-regulation of many biotic- and abiotic-stress-related genes in an ACBP3 OE-1 in comparison to wild type. |
AT1G06090 | Membrane bound acyl-lipid desaturases which can perform Δ9 desaturation. |
AT3G02630 | One of seven acyl acyl carrier proteins. Expressed primarily in developing seeds.Involved in fatty acid metabolism. Redundant Δ9 stearoyl-ACP desaturase gene which together with FAB2 and AAD1 during embryo development provide precursors for the elaboration of embryo cuticle and therefore plays a specific role during the phase of invasive embryo growth through the endosperm. Together with FAB2, AAD5, and AAD6 redundantly participates in oil storage during the maturation phase. |
AT3G50860 | Clathrin adaptor complex small chain family protein;(source:Araport11) |
AT2G19790 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
AT4G24550 | Encodes a component of the AP4 complex and is involved in vacuolar sorting of storage proteins. |
AT4G01100 | Adenine nucleotide transporter. Located in mitochondrion. Expressed in a broad range of tissues, but predominantly in root tips. Loss of function mutants exhibit reduced root growth and respiration. |
AT4G12440 | adenine phosphoribosyl transferase 4;(source:Araport11) |
AT3G57610 | encoding adenylosuccinate synthetase (AdSS), the enzyme involved in the first step of the formation of the purine nucleotide AMP (conversion of IMP to adenylo-succinate) |
AT4G11940 | Encodes a nuclear localized dosage sensitive paternally expressed imprinted gene. It is a member of a family of molecular chaperones called J-domain. Loss of ADM function suppresses seed abortion of triploid embryos and also partially rescues the effect of mea mutations. |
AT1G23490 | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. A member of ARF GTPase family. Arabidopsis has 21 known members, known to be essential for vesicle coating and uncoating and functions in GTP-binding. The gene is shown to play a role in cell division, cell expansion and cellulose production using antisense construct. |
AT3G03120 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to ADP-ribosylation factor 1; ARF 1 (GP:385340) {Drosophila melanogaster}, other ARFs and ARF-like proteins. |
AT1G02440 | A member of ARF GTPase family. A thaliana has 21 members of this family, known to be essential for vesicle coating and uncoating and functions in GTP-binding. Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. |
AT5G13490 | Encodes mitochondrial ADP/ATP carrier |
AT4G33300 | Encodes a member of the ADR1 family nucleotide-binding leucine-rich repeat (NB-LRR) immune receptors. |
AT4G18960 | Floral homeotic gene encoding a MADS domain transcription factor. Specifies floral meristem and carpel and stamen identity. Binds CArG box sequences. It is the only C function gene. It interacts genetically with the other homeotic genes to specify the floral organs. |
AT1G22130 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL104 is expressed in pollen.It forms heterodimers with other MICK family members (AGL65 and AGL30). Involved in late stages of pollen development and pollen tube growth. |
AT1G71692 | Encodes a member of the MADS box family of transcription factors. Involved in root cell differentiation and flowering time. Loss of function mutations have abnormal cellular differentiation in the roots and are late flowering. AGL12 along with AGL14, and AGL17 is preferentially expressed in root tissues and represent the only characterized MADS box genes expressed in roots. |
AT3G61120 | Encodes AGL13, a member of the AGL6 clade of the MADS-box gene family. Expressed in both pollen and ovules. Functions in male and female gametophyte morphogenesis. |
AT5G13790 | AGL15 (AGAMOUS-Like 15) is a member of the MADS domain family of regulatory factors. Although AGL15 is preferentially expressed during embryogenesis, AGL15 is also expressed in leaf primordia, shoot apical meristems and young floral buds, suggesting that AGL15 may play a role during post-germinative development. Transgenic plants that ectopically express AGL15 show delays in the transition to flowering, perianth abscission and senescence and fruit and seed maturation. Role in embryogenesis and gibberellic acid catabolism. Targets B3 domain transcription factors that are key regulators of embryogenesis.AGL15 binds the HAE promoter in floral receptacles and represses HAE expression. AGL15 is phosphorylated in a MKK4/5 dependent manner in floral receptacles. Serines 231 and 257 are phosphorylated in floral receptacles. AGL15 also directly regulates the expression of the peroxidase PRX17, linking it to lignified tissue expression. |
AT3G57230 | MADS-box transcription factor. Expressed in leaf, root and stem, with higher RNA accumulation in guard cells and trichomes. AGL16 can directly interact with SVP and indirectly interact with FLC. Furthermore, the accumulation of AGL16 transcripts is modulated by miR824 (AT4G24415). The flowering time effect for the miR824/AGL16 module is more obvious in the Col-FRI background than in the Col-0 background. AGL16 controls flowering via a allelic dosage effect in long-day non-vernalized conditions. |
AT2G45660 | Controls flowering and is required for CO to promote flowering. It acts downstream of FT. Overexpression of (SOC1) AGL20 suppresses not only the late flowering of plants that have functional FRI and FLC alleles but also the delayed phase transitions during the vegetative stages of development. AGL20/SOC1 acts with AGL24 to promote flowering and inflorescence meristem identity.AGL20 upregulates expression of AGL24 in response to GA. |
AT1G65360 | Encodes AGL23, a Type I MADS-box gene that controls female gametophyte development and the biogenesis of organelles during embryo development. |
AT4G24540 | Encodes a MADS-box protein involved in flowering. Regulates the expression of SOC1 and is also upregulated by SOC1. Binds with IMK3 kinase domain. Phosphorylated by IMK3; likely to be a target for IMK3 kinase domain. |
AT5G26880 | Root Specific |
AT2G26320 | AGAMOUS-like 33;(source:Araport11) |
AT5G26630 | MADS-box transcription factor family protein;(source:Araport11) |
AT5G62165 | Encodes a MADS box transcription factor. Expressed in quiescent center. Involved in floral transition. |
AT3G04100 | AGAMOUS-like 57;(source:Araport11) |
AT2G45650 | Sequence suggests this encodes a MADS-box transcription factor. Negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis. |
AT1G77980 | Encodes a member of the MIKC (MADS box, Keratin binding domain, and C terminal domain containing )family of transcriptional regulators. AGL66 is expressed in pollen.It forms heterodimers with other MICK family members (AGL104). Involved in late stages of pollen development and pollen tube growth. |
AT5G51870 | Encodes a MADS-box transcription factor involved in floral transition. |
AT3G30260 | Agamous-like transcription factor. A target of SPL10, AGL79 knockdowns show defects in leaf shape, shoot branching, and flowering time. |
AT3G66656 | AGAMOUS-like 91;(source:Araport11) |
AT1G46408 | AGAMOUS-like 97;(source:Araport11) |
AT3G25250 | Arabidopsis protein kinase The mRNA is cell-to-cell mobile. |
AT3G44610 | Kinase involved in the first positive phototropism and gravitropism. Phosphorylates serine residues in the cytoplasmic loop of PIN1 and shares phosphosite preferences with D6PK. Critical component for both hypocotyl phototropism and gravitropism, control tropic responses mainly through regulation of PIN-mediated auxin transport by protein phosphorylation. |
AT5G03640 | AGCVIII kinase involved in the pulse-induced first positive phototropism. |
AT2G13810 | ALD1 is a L-lysine alpha-aminotransferase. It is part of the pipecolic acid biosynthetic pathway, where it catalyzes the biochemical conversion of lysine to epsilon-amino-alpha-ketocaproic acid (KAC) which is subject to subsequent transamination, cyclization and isomerization to form 2,3-dehydropipecolic acid. |
AT1G74800 | Encodes a Golgi-localized hydroxyproline galactosyltransferase GALT5. Functions together with GALT2 as redundant GALTs that control AGP (arabinogalactan-proteins) O-glycosylation, which is essential for normal growth and development. Mutants display multiple phenotypes including reduced root hair growth. |
AT4G37750 | ANT is required for control of cell proliferation and encodes a putative transcriptional regulator similar to AP2. Loss of function alleles have reduced fertility, abnormal ovules and abnormal lateral organs. Expressed in the chalaza, floral organ primordia, and lateral shoot organ primordia. Regulates growth and cell numbers during organogenesis. |
AT5G10510 | Encodes an AP2-domain transcription factor involved in root stem cell identity and root development. It is also required to maintain high levels of PIN1 expression at the periphery of the meristem and modulate local auxin production in the central region of the SAM which underlies phyllotactic transitions. Intronic sequences are required for its expression in flowers.Acts redundantly with PLT5 and 7 in lateral root pattern formation. |
AT1G72330 | Encodes for alanine aminotransferase ALAAT2. |
AT1G50200 | Alanyl-tRNA synthetase;(source:Araport11) |
AT5G01370 | Nuclear protein with a lysine-rich domain and a C-terminal serine-rich domain. Interacts with Alcatraz (ALC). ACI1 is mainly expressed in the vascular system. Involved in cell separation during fruit dehiscence. |
AT3G24503 | Arabidopsis thaliana aldehyde dehydrogenase AtALDH1a mRNA. a sinapaldehyde dehydrogenase catalyzes both the oxidation of coniferylaldehyde and sinapaldehyde forming ferulic acid and sinapic acid, respectively |
AT1G54100 | Aldehyde dehydrogenase |
AT3G53880 | NAD(P)-linked oxidoreductase superfamily protein;(source:Araport11) |
AT5G60360 | Encodes a senescence-associated thiol protease. The mRNA is cell-to-cell mobile. |
AT5G26210 | Encodes a member of the Alfin1-like family of nuclear-localized PHD (plant homeodomain) domain containing proteins. All AL proteins except AL3 bind to di- or trimethylated histone H3 (H3K4me3/2). Members of this family include: AT5G05610 (AL1), AT3G11200 (AL2), AT3G42790 (AL3), AT5G26210 (AL4), AT5G20510 (AL5), AT2G02470 (AL6), AT1G14510 (AL7). |
AT4G34860 | Plant neutral invertase family protein;(source:Araport11) |
AT3G06500 | Encodes an alkaline/neutral invertase which localizes in mitochondria. It may be modulating hormone balance in relation to the radicle emergence. Mutants display severely reduced shoot growth and reduced oxygen consumption. Mutant root development is not affected as reported for A/N-InvA mutant (inva) plants. The mRNA is cell-to-cell mobile. |
AT1G72000 | Plant neutral invertase family protein;(source:Araport11) |
AT5G16970 | encodes a 2-alkenal reductase (EC 1.3.1.74), plays a key role in the detoxification of reactive carbonyls |
AT3G25780 | Encodes allene oxide cyclase, one of the enzymes involved in jasmonic acid biosynthesis. One of four genes in Arabidopsis that encode this enzyme. mRNA expression is upregulated in senescing leaves. Note: Nomenclature for Arabidopsis allene oxide cyclase 3 (AOC3, AT3G25780) gene is based on Stenzel et al. 2003 Plant Molecular Biology 51:895-911. AOC3 (AT3G25780) is also referred to as AOC2 in He et al. 2002 Plant Physiology, 128:876-884. The mRNA is cell-to-cell mobile. |
AT3G52720 | Encodes an alpha carbonic anhydrase (CAH1) located in the chloroplast stroma. Most chloroplast proteins are encoded by the nuclear genome and imported with the help of sorting signals that are intrinsic parts of the polypeptides. CAH1 takes an alternative route through the secretory pathway, and becomes N-glycosylated before entering the chloroplast. Glycosylation and intra-molecular disulfide bridge fromation are necessary for the correct folding, ER export, trafficking and activity of the protein. |
AT2G28210 | alpha carbonic anhydrase 2;(source:Araport11) |
AT5G04180 | alpha carbonic anhydrase 3;(source:Araport11) |
AT1G73680 | Encodes an alpha dioxygenase. Recombinant protein catalyzes the conversion of a wide range of fatty acids into 2(R)-hydroperoxy derivatives. |
AT5G22770 | AP-2 complex subunit alpha-1. Part of endomembrane trafficking system. |
AT4G25000 | Predicted to be secreted protein based on signalP prediction. Involved in starch mobilization. Mutants are defective in alpha-amylase activity. (Note: AMY1 has been found in the literature to be referred to as AMY3, which is not to be confused with AMY3/At1g69830). |
AT1G68560 | Encodes a bifunctional alpha-l-arabinofuranosidase/beta-d-xylosidase that belongs to family 3 of glycoside hydrolases. |
AT3G54720 | Encodes glutamate carboxypeptidase. Various alleles show-increased cotyledon number and rate of leaf initiation, show transformation of leaves to cotyledons, altered flowering time and photomorphogenesis and an increased level of cytokinin biosynthesis. Involved in ethylene enhanced hypocotyl elongation in the light. Strong genetic interaction between TGH and AMP1. |
AT3G51290 | pyridoxal-phosphate-dependent serine hydroxymethyltransferase, putative (DUF632);(source:Araport11) |
AT1G68370 | DnaJ-like protein with homology to coiled coils found in cytoskeleton-interacting proteins. |
AT5G10940 | ASG2 is farnesylated protein and this post-translational modification impacts its subcellular localization. It is the homolog of the human anti-obesity factor WDTC1 and is involved in the negative regulation of fatty acid biosynthesis. The non-farnesylated form displays a nucleo-cytosolic subcellular localization. The farnesylated form displays a cytosolic subcellular localization. Interaction with At4g05420 (DDB1a) was shown using BiFC approach. |
AT1G20650 | Protein kinase superfamily protein;(source:Araport11) |
AT5G47580 | transmembrane protein;(source:Araport11) |
AT3G22370 | Encodes AOX1a, an isoform of alternative oxidase that is expressed in rosettes, flowers, and root. The alternative oxidase of plant mitochondria transfers electrons from the ubiquinone pool to oxygen without energy conservations. It is regulated through transcriptional control and by pyruvate. Plays a role in shoot acclimation to low temperature. Also is capable of ameliorating reactive oxygen species production when the cytochrome pathway is inhibited. AOX1a also functions as a marker for mitochondrial retrograde response. The mRNA is cell-to-cell mobile. |
AT4G17970 | Anion transporter involved in stomatal closure. Gene has 3 splicing variants. |
AT5G27610 | protein ALWAYS EARLY 1;(source:Araport11) |
AT1G58360 | Encodes AAP1 (amino acid permease 1), a neutral amino acid transporter expressed in seeds. Functions in amino acid uptake into embryos. The transporter also functions in acquisition of glutamate and neutral amino acids by the root. |
AT5G63850 | Amino acid transporter whose expression is downregulated by dehydration. |
AT1G44100 | amino acid permease 5 |
AT5G49630 | Is a high affinity amino acid transporter capable of transporting aspartate and tryptophan. May be involved in the amino acid uptake from xylem. |
AT1G10010 | Encodes a high affinity amino acid transporter that is probably responsible for import of organic nitrogen into developing seeds. One of eight gene family members that encode amino acid permeases. Most closely related to AAP1 (75%) identity. |
AT4G21120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Mediates efficient uptake of Lys, Arg and Glu in a yeast system. The mRNA is cell-to-cell mobile. |
AT4G33090 | encodes an aminopeptidase, a ortholog of mouse microsomal AP (EC 3.4.11.2). |
AT1G26130 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT1G17500 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein. ALA4 acts redundantly with ALA3, ALA5, ALA9, ALA10 and ALA11 in root and shoot development |
AT1G72700 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT1G68710 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT3G25610 | Encodes aminophospholipid ATPase10 (ALA10), a P4-type ATPase flippase that internalizes exogenous phospholipids across the plasma membrane. |
AT4G13510 | Encodes a plasma membrane localized ammonium transporter. Contains a cytosolic trans-activation domain essential for ammonium uptake. The mRNA is cell-to-cell mobile. |
AT1G64780 | encodes an ammonium transporter protein believed to act as a high affinity transporter. It is expressed in the root, primarily in endodermal and cortical cells, and contributes to ammonium uptake in the root. |
AT3G24300 | Encodes a plasma membrane localized ammonium transporter. |
AT2G38290 | encodes a high-affinity ammonium transporter, which is expressed in shoot and root. Expression in root and shoot is under nitrogen and carbon dioxide regulation, respectively. |
AT2G18290 | Encodes APC10 (anaphase promoting complex 10). Overexpression of APC10 likely mimics auxin and ethylene sensitive phenotypes. Plays an essential role in cell proliferation during leaf development. |
AT2G39090 | tetratricopeptide repeat (TPR)-containing protein;(source:Araport11) |
AT1G05020 | ENTH/ANTH/VHS superfamily protein;(source:Araport11) |
AT5G61160 | anthocyanin 5-aromatic acyltransferase 1;(source:Araport11) |
AT4G00730 | Encodes a homeodomain protein of the HD-GLABRA2 group. Involved in the accumulation of anthocyanin and in root development. Loss of function mutants have increased cell wall polysaccharide content. |
AT5G05730 | ASA1 encodes the alpha subunit of anthranilate synthase, which catalyzes the rate-limiting step of tryptophan synthesis. ASA1 is induced by ethylene, and forms a link between ethylene signalling and auxin synthesis in roots. |
AT1G25220 | Catalyzes the first step of tryptophan biosynthesis: Chorismate L-Glutamine = Anthranilate Pyruvate L-Glutamate. Functions as a heterocomplex with anthranilate synthase alpha subunit (ASA1 or ASA2). |
AT5G28680 | Receptor-like kinase required for maintenance of pollen tube growth. Display polar localization at the plasma membrane of the pollen tube tip. |
AT4G36920 | Encodes a floral homeotic gene, a member of the AP2/EREBP (ethylene responsive element binding protein) class of transcription factors and is involved in the specification of floral organ identity, establishment of floral meristem identity, suppression of floral meristem indeterminancy, and development of the ovule and seed coat. AP2 also has a role in controlling seed mass. Dominant negative allele I28, revealed a function in meristem maintenance-mutant meristems are smaller than normal siblings. AP2 appears to act on the WUS-CLV pathway in an AG independent manner. |
AT4G13040 | Encodes a member of the AP2/EREBP transcription factor family that has only one AP2 domain. It is a positive regulator of disease defense that functions upstream of SA accumulation. |
AT3G54340 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies petal and stamen identities. Associates with PISTILLATA. |
AT1G69120 | Floral homeotic gene encoding a MADS domain protein homologous to SRF transcription factors. Specifies floral meristem and sepal identity. Required for the transcriptional activation of AGAMOUS. Interacts with LEAFY.Binds to promoter and regulates the expression of flowering time genes SVP, SOC1 and AGL24. |
AT5G10760 | Eukaryotic aspartyl protease family protein;(source:Araport11) |
AT1G78860 | curculin-like (mannose-binding) lectin family protein, low similarity to Ser/Thr protein kinase (Zea mays) GI:2598067; contains Pfam profile PF01453: Lectin (probable mannose binding) but not the protein kinase domain of the Z. mays protein |
AT1G34780 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. |
AT3G03860 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
AT2G14750 | Encodes adenosine-5'-phosphosulfate kinase. Provides activated sulfate for sulfation of secondary metabolites, including the glucosinolates. Essential for pollen viability. The mRNA is cell-to-cell mobile. |
AT4G04610 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the adenosine 5'-phosphosulfate reductase-like (APRL) group. The mRNA is cell-to-cell mobile. |
AT4G39940 | adenosine-5'-phosphosulfate-kinase (akn2) mRNA, complete The mRNA is cell-to-cell mobile. |
AT3G04080 | Encodes an Golgi-localized integral membrane enzyme with nucleoside diphosphate activity that when mutated in combination with ATAPY2 causes a complete inhibition of pollen germination.With respect to substrate specificity, APY1 shows the following preferences UTP>IDP>GDP. |
AT1G14240 | GDA1/CD39 nucleoside phosphatase family protein;(source:Araport11) |
AT4G38220 | Peptidase M20/M25/M40 family protein;(source:Araport11) |
AT2G44900 | ARABIDILLO-1 and its homolog, ARABIDILLO -2, are unique among Arabidopsis Arm-repeat proteins in having an F-box motif and fall into a phylogenetically distinct subgroup from other plant Arm-repeat proteins Similar to arm repeat protein in rice and armadillo/beta-catenin repeat family protein / F-box family protein in Dictyostelium. ARABIDILLO-1 promote lateral root development. Mutant plants form fewer lateral roots, while ARABIDILLO-1-overexpressing lines produce more lateral roots than wild-type seedlings. |
AT3G23620 | BRIX domain containing protein, similar to RNA biogenesis factors in yeast. Binds rRNA and likely also functions in RNA biogenesis in Arabidopsis. Essential gene, mutants are embryo lethal and does not transmit well through the gametophyte. |
AT1G52930 | Encodes one of two Arabidopsis orthologs of yeast BRX1, a protein involved in maturation of the large ribosomal subunit. The proteins are mainly localized in nucleolus. Mutant plants are affected in pre-rRNA processing. |
AT2G37940 | Inositol phosphorylceramide synthase 2;(source:Araport11) |
AT2G29525 | Inositol phosphorylceramide synthase |
AT1G62700 | Encodes a NAC-domain transcription factor. Expressed in the vascular tissue. |
AT5G18270 | NAC domain containing protein 87;(source:Araport11) |
AT1G77360 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G33920 | Protein phosphatase 2C family protein;(source:Araport11) |
AT5G06750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT2G17800 | A member of ROP GTPase family. Rac-like GTP-binding protein ARAC1/ATGP2. Encodes a geranylgeranylated GTP binding protein. Involved in the auxin-activated 26S proteasome-dependent Aux/IAA proteolysis pathway. |
AT1G72200 | RING/U-box superfamily protein;(source:Araport11) |
AT2G20030 | RING/U-box superfamily protein;(source:Araport11) |
AT5G43420 | RING/U-box superfamily protein;(source:Araport11) |
AT1G28040 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46495 | RING/U-box superfamily protein;(source:Araport11) |
AT2G25410 | RING/U-box superfamily protein;(source:Araport11) |
AT1G74410 | RING/U-box superfamily protein;(source:Araport11) |
AT4G40070 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09110 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09120 | RING/U-box superfamily protein;(source:Araport11) |
AT4G09130 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34990 | RING/U-box superfamily protein;(source:Araport11) |
AT2G42350 | RING/U-box superfamily protein;(source:Araport11) |
AT2G42360 | RING/U-box superfamily protein;(source:Araport11) |
AT1G72220 | RING/U-box superfamily protein;(source:Araport11) |
AT3G18930 | RING/U-box superfamily protein;(source:Araport11) |
AT2G35910 | RING/U-box superfamily protein;(source:Araport11) |
AT5G06490 | RING/U-box superfamily protein;(source:Araport11) |
AT3G18773 | RING/U-box superfamily protein;(source:Araport11) |
AT4G24015 | RING/U-box superfamily protein;(source:Araport11) |
AT2G28920 | RING/U-box superfamily protein;(source:Araport11) |
AT2G44578 | RING/U-box superfamily protein;(source:Araport11) |
AT2G44581 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46494 | RING/U-box superfamily protein;(source:Araport11) |
AT2G46493 | RING/U-box superfamily protein;(source:Araport11) |
AT5G53110 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34000 | RING/U-box superfamily protein;(source:Araport11) |
AT1G17860 | Member of Kunitz trypsin inhibitor (KTI) family involved in plant defense response against spider mites. |
AT5G61670 | Encodes a close homolog of the Cauliflower OR (Orange) protein that is located in the chloroplast of light grown organs but in the nucleus of etiolated cotyledons. The function of OR is to induce the differentiation of proplastids or other noncolored plastids into chromoplasts for carotenoid accumulation. Both proteins contain a Cysteine-rich zinc finger domain that is highly specific to DnaJ-like molecular chaperons. The AtOR protein interacts directly with the PSY (phytoene synthase) protein and acts as a positive posttranscriptional regulator of its expression, thereby affecting carotenoid biosynthesis. |
AT5G55240 | Catalyze hydroperoxide-dependent mono-oxygenation reactions. Require calcium for peroxygenase activity. Probably deeply buried in lipid droplets or microsomes. |
AT1G04360 | RING/U-box superfamily protein;(source:Araport11) |
AT1G22500 | Gene encodes a putative C3HC4-type RING zinc finger factor. it is induced in response to light and ascorbate stimulus. |
AT1G49230 | RING/U-box superfamily protein;(source:Araport11) |
AT1G30680 | Twinkle is a dual localized (mitochondria and chloroplast) DNA primase-helicase. It synthesizes RNA primers from a 5′ -(G/C)GGA-3′ template, where the last two 3' nucleotides are cryptic. Mitochondrial protein involved in DNA replication which binds to DNA polymerases, Pol1A and Pol1B. |
AT5G44930 | Encodes a putative arabinosyltransferase that is associated with arabinan biosynthesis and is not redundant with ARAD1. The two glycosyltransferases may function in complexes held together by disulfide bridges. |
AT4G37450 | AGP18 is a lysine-rich arabinogalactan-protein (AGP) and part of a multi-gene family of glycoproteins with approx. 50 members. It falls into one subclass with AGP17 and AGP19, other lysine-rich AGPs. It is expressed in young leaves, shoots, roots and flowers and is active in the regulation of the selection and survival of megaspores. |
AT3G01700 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP11 function results in decreased fertility due to defects in pollen tube growth. |
AT5G11740 | Encodes arabinogalactan protein (AGP15). The mRNA is cell-to-cell mobile. |
AT2G46330 | Encodes arabinogalactan protein (AGP16). |
AT2G22470 | Encodes arabinogalactan-protein (AGP2). |
AT3G61640 | arabinogalactan protein 20;(source:Araport11) |
AT5G53250 | arabinogalactan protein 22;(source:Araport11) |
AT2G47930 | arabinogalactan protein 26;(source:Araport11) |
AT2G33790 | pollen Ole e 1 allergen protein containing 14.6% proline residues, similar to arabinogalactan protein (Daucus carota) GI:11322245, SP:Q03211 Pistil-specific extensin-like protein precursor (PELP) {Nicotiana tabacum}; contains Pfam profile PF01190: Pollen proteins Ole e I family |
AT5G10430 | Encodes arabinogalactan-protein (AGP4) that is expressed in female reproductive tissues. It is involved in promoting degeneration of the persistent synergid after fertilization. In mutant ovules, the persistent synergid does not degrade resulting in polytuby. |
AT1G35230 | Encodes arabinogalactan-protein (AGP5). The mRNA is cell-to-cell mobile. |
AT5G14380 | Encodes an arabinogalactan protein that is expressed in pollen, pollen sac and pollen tube. Loss of AGP6 function results in decreased fertility due to defects in pollen tube growth. |
AT2G14890 | putative proline-rich protein (At2g14890) mRNA, complete The mRNA is cell-to-cell mobile. |
AT5G36925 | hypothetical protein;(source:Araport11) |
AT5G36920 | Secreted peptide which functions in plant growth and pathogen defense. |
AT1G08680 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD14 belongs to the class 4, together with AGD15. |
AT5G61980 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD1 belongs to the class 1, together with AGD2, AGD3 and AGD4. Not expressed in hypocotyls and cotyledons. |
AT4G05330 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT1G10870 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. AGD4 belongs to the Class 1, together with AGD1, AGD2, and AGD3. |
AT4G17890 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. |
AT5G46750 | A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes. The mRNA is cell-to-cell mobile. |
AT1G59980 | ARG1-like 2;(source:Araport11) |
AT4G08900 | Encodes an arginase, likely to be involved in polyamine biosynthesis in pollen. |
AT2G16500 | Encodes a arginine decarboxylase (ADC), a rate-limiting enzyme that catalyzes the first step of polyamine (PA) biosynthesis via ADC pathway in Arabidopsis thaliana. Arabidopsis genome has two ADC paralogs, ADC1 and ADC2. Double mutant analysis showed that ADC genes are essential for the production of PA, and are required for normal seed development. Promoter region of ADC1 contains 742-bp AT-rich transposable element, called AtATE, that belongs to the MITE families of repetitive elements. |
AT5G05700 | Encodes an arginyl-tRNA:protein transferase (ATE1), a component of the N-end rule pathway that targets protein degradation through the identity of the amino-terminal residue of specific protein substrates. Arabidopsis contains two ATE genes: At5g05700/ATE1, At3g11240/ATE2. Another component of the N-end rule pathway is At5g02310/PROTEOLYSIS6 (PRT6). PRT6 and ATE were shown to regulate seed after-ripening, seedling sugar sensitivity, seedling lipid breakdown, and abscisic acid (ABA) sensitivity of germination. Mutants of ATE1 also display delayed leaf senescence and altered responses to pathogens. |
AT4G25500 | Encodes an arginine/serine-rich splicing factor. The transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS40 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis (DOI:10.1093/nar/gkv751). |
AT5G52040 | Encodes an arginine/serine-rich splicing factor. Transcript is alternatively spliced and is differentially expressed in different tissues (flowers, roots, stems, and leaves) examined. Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. RS41 binds to HYL1 and co-localizes to the nuclear dicing body. Along with RS41, it appears to be involved in pri-miRNA processing and miRNA biogenesis. |
AT3G53500 | Barta et al (2010) have proposed a nomenclature for Serine/Arginine-Rich Protein Splicing Factors (SR proteins): Plant Cell. 2010, 22:2926. |
AT2G27040 | AGO4 is a member of a class of PAZ/PIWI domain containing proteins involved in siRNA mediated gene silencing.Loss of function mutations have reduced site specific CpNpG and CpHpH methylation, abnormal ovule/megagametophyte develoment and increased susceptibility to bacterial pathogens including Tobacco rattle virus. |
AT2G27880 | AGO5.Required for antiviral RNA silencing.Confers resistance to Potato virus X. |
AT2G32940 | Encodes a nuclear localized 879-amino-acid protein that contains conserved PAZ and PIWI domains that is important for the accumulation of specific heterochromatin-related siRNAs, and for DNA methylation and transcriptional gene silencing. |
AT5G21150 | AGO9-dependent sRNA silencing is crucial to specify cell fate in the Arabidopsis ovule. AGO9 is expressed in reproductive companion cells but not in the associated male or female gametes or their precursors. Therefore, AGO9 acts non-cell autonomously to silencing the activity of TEs activity in the female gametophyte.Loss of function mutants produce ectopic megaspore mother cell and supernumary female gametophytes. |
AT1G69440 | Encodes ARGONAUTE7, a member of the ARGONAUTE family, characterised by the presence of PAZ and PIWI domains. Involved in the regulation of developmental timing. Required for the accumulation of TAS3 ta-siRNAs but not for accumulation of miR171, miR173, miR390 or mi391. Localized in mature rosette leaves and floral buds. |
AT5G63750 | RING/U-box superfamily protein;(source:Araport11) |
AT1G05890 | RING/U-box superfamily protein;(source:Araport11) |
AT2G31770 | RING/U-box superfamily protein;(source:Araport11) |
AT5G19330 | Encodes an armadillo repeat protein involved in the abscisic acid response. The protein interacts with a transcription factor, ABF2, which controls ABA-dependent gene expression via the G-box-type ABA-responsive elements. |
AT3G26600 | Armadillo repeat protein. One of a family of four in Arabidopsis. Expressed in vegetative tissues, anthers and ovules. |
AT1G11790 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. |
AT3G44720 | Encodes a plastid-localized arogenate dehydratase involved in phenylalanine biosynthesis. Not less than six genes encoding ADT were identified in the Arabidopsis genome: ADT1 [At1g11790]; ADT2 [At3g07630]; ADT3 [At2g27820]; ADT4 [At3g44720]; ADT5 [At5g22630]; and ADT6 [At1g08250]. The mRNA is cell-to-cell mobile. |
AT2G20340 | Encodes an aromatic aldehyde synthase (AtAAS), which catalyzes the in vitro conversion of phenylalanine and 3,4-dihydroxy-L-phenylalanine to phenylacetaldehyde and dopaldehyde, respectively. The mRNA is cell-to-cell mobile. |
AT2G16220 | Stress induced gene. Mutants show increased sensitivity to arsenate. |
AT4G32320 | Encodes a cytosolic ascorbate peroxidase APX6. Ascorbate peroxidases are enzymes that scavenge hydrogen peroxide in plant cells. Eight types of APX have been described for Arabidopsis: three cytosolic (APX1, APX2, APX6), two chloroplastic types (stromal sAPX, thylakoid tAPX), and three microsomal (APX3, APX4, APX5) isoforms. |
AT2G19640 | ASH1-related protein 2;(source:Araport11) |
AT3G02890 | PHD protein which cooperates with PAIPP2 and BAH domain protein AIPP3 to read H3K4 histone marks. The BAH-PHD bivalent histone reader complex silences a substantial subset of H3K27me3-enriched loci, including development and stress response-related genes. Interacts with BDT1, acts with other PHD proteins to associate with flowering genes and thereby suppress their transcription. |
AT5G10240 | Encodes asparagine synthetase (ASN3). |
AT5G42050 | Stress responsive asparagine-rich protein. Binds to PevD (Verticillium dahliae ) fungal effector protein. NRP interacts with CRY2, leading to increased cytoplasmic accumulation of CRY2 in a blue light-independent manner (PMID:28633330).NRP also binds FyPP3 and recruits it to endosomes and thus targets it for degradation. |
AT2G22250 | Encodes a prokaryotic-type plastidic aspartate aminotransferase with glutamate/aspartate-prephenate aminotransferase (PAT) activity. |
AT5G19550 | Nitrogen metabolism. Major cytosolic isoenzyme controlling aspartate biosynthesis in the light. The mRNA is cell-to-cell mobile. |
AT5G13280 | Asp kinase inhibited by Lys and S-adenosylmethionine. Contains regulatory domains that belong to the ACT domain family, which allow binding to a extreme variety of ligands. Can function as a monomer or as a dimer with acetohydroxyacid synthase (HSDH). |
AT1G31230 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
AT4G19710 | Encodes a bifunctional aspartate kinase/homoserine dehydrogenase. These two activities catalyze the first and the third steps toward the synthesis of the essential amino acids threonine, isoleucine and methionine. |
AT1G11910 | Encodes an aspartic proteinase that forms a heterodimer and is stable over a broad pH range (ph 3-8). |
AT1G65620 | required for formation of a symmetric flat leaf lamina, encodes a member of a family of proteins characterized by cysteine repeats and a leucine zipper; involved in KNOX gene regulation. Acts together with ASL1 in proximal-distal symmetry determination. Forms a complex with AS1 that binds to the BP promoter and leads to silencing of BP. |
AT5G66870 | Encodes LOB domain protein whose overexpression results in KNOX gene repression. Overexpression also results in plants with hyponastic leaves, downward pointing flowers and reduced apical dominance. May be involved in the transcriptional regulation of the homeobox gene BP (brevipedicellus) during lateral organ differentiation. Acts together with AS2 in proximal-distal symmetry determination. |
AT2G46980 | Encodes ASY3, a coiled-coil domain protein that is required for normal meiosis. |
AT1G76510 | ARID/BRIGHT DNA-binding domain-containing protein;(source:Araport11) |
AT3G09470 | Protein similar to UNC93 of C.elegans. Mutants are hypersensitive to ABA treatment and salt sensitive and have disregulated K+ accumulation. |
AT3G60870 | Encodes an AT hook domain containing protein that, when overexpressed, delays flowering. Los s of function mutations have defects in primary and lateral root development. |
AT3G61310 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT1G63480 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G17950 | AT-hook motif containing nuclear localized (AHL) DNA-binding protein; substrate of immune MAPKs. Phosphorylation regulates AHL13 protein stability and thereby its immune functions. Regulates key factors of jasmonic acid biosynthesis and signaling and affects immunity toward Pseudomonas syringae and Botrytis cinerea pathogens. |
AT3G04590 | AHL proteins contain two conserved structural units, the AT-hook motif and DUF296 domain. |
AT4G35390 | AT-hook protein of GA feedback 1;(source:Araport11) |
AT4G12050 | Putative AT-hook DNA-binding family protein;(source:Araport11) |
AT4G25320 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT5G51590 | Member of the 29 AT-hook family TFs involved in the development of root xylem. |
AT1G63470 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT5G62260 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT4G00200 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT2G45850 | AT hook motif DNA-binding family protein;(source:Araport11) |
AT3G43240 | Interacts with CHR11, CHR17, and RTL1, several known subunits of ISWI. JA biosynthesisis is positively regulated by this chromatin remodeling complex, thereby promoting stamen filament elongation. |
AT4G02940 | ALKBH10B is a functional RNA N6-methyladenosine demethylase. Reduction in ALKBH10B decreases m6A levels, and affects the stability of flowering time genes including FT, SPL3 and SPL9. Mutant plants are early flowering. |
AT1G48980 | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11) |
AT3G48190 | Encodes a homolog of the human ATM gene, which is mutated in ataxia telangiectasia, a chromosome instability disorder. Suppresses leaf senescence triggered by DNA double-strand break through epigenetic control of senescence-associated genes. Characterization of mutants suggest a role homologous recombination for DNA damage repair in response to ionizing radiation as well as during meiosis. The protein has kinase domains and shows kinase activity in orthologs. There is also evidence that ATM might be involved in the telomerase-independent process known as Alternative Lengthening of Telomeres. |
AT3G17100 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT1G09250 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G45980 | Encodes an Atg8-interacting protein that is partially associated with the ER during favorable growth conditions and becomes mainly associated with a spherical compartment that dynamically moves along the ER network. In stress induced plants, ATI1 is localized to a novel plastid associated bodies that are transported to vesicles, in what appears to be an autophagy dependent process. ATI1 interacts with number of other plastid proteins such as NPQ4 and APE1. |
AT1G58080 | ATP phosphoribosyl transferase, catalyses first step of histidine biosynthesis |
AT3G52300 | ATP synthase D chain;(source:Araport11) |
AT1G71960 | Encodes a plasma membrane localized ABC transporter involved in abscisic acid transport and responses. |
AT3G47780 | member of ATH subfamily The mRNA is cell-to-cell mobile. |
AT2G36910 | Belongs to the family of ATP-binding cassette (ABC) transporters. Also known as AtMDR1.Possibly regulates auxin-dependent responses by influencing basipetal auxin transport in the root. Exerts nonredundant, partially overlapping functions with the ABC transporter encoded by AT3G28860. PGP1 mediates cellular efflux of IAA and interacts with PIN genes that may confer an accelerated vectoral component to PGP-mediated transport. The non-polar localization of PGP1 at root and shoot apices, where IAA gradient-driven transport is impaired, may be required to confer directionality to auxin transport in those tissues. The mRNA is cell-to-cell mobile. |
AT1G02520 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. The mRNA is cell-to-cell mobile. |
AT1G02530 | P-glycoprotein 12;(source:Araport11) |
AT3G28345 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
AT3G28380 | P-glycoprotein 17;(source:Araport11) |
AT4G28620 | Half-molecule ABC transporter ATM2. Arabidopsis thaliana has three ATM genes, namely ATM1, ATM2 and ATM3. Only ATM3 has an important function for plant growth. |
AT2G47000 | Encodes an auxin efflux transmembrane transporter that is a member of the multidrug resistance P-glycoprotein (MDR/PGP) subfamily of ABC transporters. Functions in the basipetal redirection of auxin from the root tip. Exhibits apolar plasma membrane localization in the root cap and polar localization in tissues above and is involved in root hair elongation. |
AT4G01830 | P-glycoprotein 5;(source:Araport11) |
AT1G30400 | glutathione S-conjugate transporting ATPase (AtMRP1) mRNA. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
AT1G30420 | member of MRP subfamily |
AT1G30410 | member of MRP subfamily |
AT2G07680 | Encodes ABCC13/MRP11, a member of the multidrug resistance associated protein MRP/ABCC subfamily. Its expression is induced by gibberellic acid and downregulated by naphthalene acetic acid, abscisic acid, and zeatin. |
AT2G34660 | encodes a multidrug resistance-associated protein that is MgATP-energized glutathione S-conjugate pump. An ABCC-type arsenite-phytochelatin transporter. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. The mRNA is cell-to-cell mobile. |
AT3G13080 | encodes an ATP-dependent MRP-like ABC transporter able to transport glutathione-conjugates as well as chlorophyll catabolites. The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
AT4G39850 | Encodes a peroxisomal protein of the ATP binding cassette (ABC) transporter class (PMP subfamily) with significant identity to the human X-linked adrenoleukodystrophy protein (ALDP). The gene product promotes germination and represses embryo dormancy. ABI3, ABA1, FUS3 and LEC1 are epistatic to this gene. Mutants accumulate fatty acyl CoA suggesting a defect in uptake of fatty acyl CoA into the peroxisome. |
AT1G64550 | Encodes a member of GCN subfamily. Predicted to be involved in stress-associated protein translation control. The mutant is affected in MAMP ((microbe-associated molecular patterns)-induced stomatal closure, but not other MAMP-induced responses in the leaves. Arabidopsis has five ABCF proteins, which are all closely related by sequence to yeast GCN20. None of these five are individually required for GCN2 kinase activity. |
AT2G39350 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT1G51500 | Encodes an ABC transporter involved in cuticular wax biosynthesis. Lines carrying recessive mutations in this locus have weakly glaucous stem surface, and relative elevated secondary alcohols and ketones. |
AT3G55090 | Belongs to a clade of five Arabidopsis thaliana ABCG half-transporters that are required for synthesis of an effective suberin barrier in roots and seed coats (ABCG2, ABCG6, and ABCG20) and for synthesis of an intact pollen wall (ABCG1 and ABCG16). |
AT3G25620 | ABC-2 type transporter family protein;(source:Araport11) |
AT5G06530 | Encodes ABCG22, an ABC transporter gene. Mutation results in increased water transpiration and drought susceptibility. |
AT5G60740 | ABC transporter family protein. Localizes to the growing tip of pollen tubes where it appears to be critical for localizing polyamines and reactive oxygen species. |
AT3G16340 | Encodes a p-coumaryl alcohol exporter involved in lignin biosynthesis. |
AT2G28070 | ABC-2 type transporter family protein;(source:Araport11) |
AT2G37280 | Encodes an ATP-binding cassette (ABC) transporter. Expressed in the vascular tissue of primary stem. |
AT2G36380 | pleiotropic drug resistance 6;(source:Araport11) |
AT3G53480 | Negative regulator of auxin polar transport inhibitors. ABCG37 regulates auxin distribution and homeostasis in roots by excluding IBA from the root apex, but does not act directly in basipetal transport. ABCG37 and ABCG36 act redundantly at outermost root plasma membranes and, transport IBA out of the cells. Also involved in root transmembrane secretion of fluorescent phenolics involved in Fe uptake. The mRNA is cell-to-cell mobile. |
AT3G30842 | pleiotropic drug resistance 10;(source:Araport11) |
AT4G25750 | ABC-2 type transporter family protein;(source:Araport11) |
AT4G15215 | pleiotropic drug resistance 13;(source:Araport11) |
AT3G21580 | cobalt ion transmembrane transporter;(source:Araport11) |
AT1G67940 | member of NAP subfamily The mRNA is cell-to-cell mobile. |
AT1G10670 | One of the three genes encoding subunit A of the trimeric protein ATP Citrate Lyase. Antisense ACLA-1 plants cause a reduction in cytosolic acetyl-CoA metabolism and have upregulation of stress-related genes and down-regulation of primary metabolism and growth genes, suggesting the mutation restricts normal growth and developmental processes and puts the plant into a state of stress. |
AT1G60810 | One of the three genes encoding subunit A of the trimeric enzyme ATP Citrate lyase |
AT1G09430 | Encodes subunit A of the heteromeric enzyme ATP citrate lyase (ACL). In animals, ACL is encoded by a single gene; ACL in Arabidopsis is composed of two polypeptides, ACLA (encoded by 3 genes) and ACLB (encoded by 2 genes). The holoenzyme has an A(4)B(4)stoichiometry. Expression of both ACLA and ACLB but not of either of the subunits alone results in ACL activity. |
AT5G07320 | Encodes an APC isoform in Arabidopsis, a calcium-dependent mitochondrial ATP-Mg/Pi transporter. |
AT3G22150 | Involved in RNA editing of plastid atpF and mitochondrial nad5. |
AT1G56310 | DEDDy-type 3′ -> 5′ exoribonuclease involved in miRNA degradation. |
AT5G61440 | Encodes a member of the thioredoxin family protein. Located in the chloroplast. The mRNA is cell-to-cell mobile. |
AT2G32980 | HAUS augmin-like complex subunit;(source:Araport11) |
AT3G63380 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT3G22910 | ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein;(source:Araport11) |
AT4G29900 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
AT3G21180 | one of the type IIB calcium pump isoforms. encodes an autoinhibited Ca(2+)-ATPase that contains an N-terminal calmodulin binding autoinhibitory domain. |
AT5G57110 | Arabidopsis-autoinhibited Ca2+ -ATPase, isoform 8, contains all of the characteristic motifs of Ca2+ -transporting P-type Ca2+ -ATPases and is localized to the plasma membrane. |
AT1G27770 | Encodes a chloroplast envelope Ca2+-ATPase with an N-terminal autoinhibitor. |
AT3G57330 | Lesion mimic phenotype when mutation in the gene is combined with a mutation in ACA4. Lesion mimic phenotype of double knockout can be suppressed by nutritional supplements that increase anion levels (e.g. 15 mM Nitrate, Chloride, or Phosphate) |
AT1G13210 | Autoinhibited Ca2+/ATPase II. ALA11 acts redundantly with ALA3, ALA4, ALA5, ALA9, ALA10 in root and shoot development as well as PIN trafficking and polarity . |
AT3G13970 | Autophagy protein. |
AT3G19190 | Encodes autophagy-related 2 (ATG2). The mRNA is cell-to-cell mobile. |
AT3G60640 | Autophagy protein. |
AT3G06420 | Autophagy protein. |
AT1G30280 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G49980 | auxin F-box protein 5;(source:Araport11) |
AT5G43700 | Auxin inducible protein similar to transcription factors. |
AT2G38120 | Encodes an auxin influx transporter. AUX1 resides at the apical plasma membrane of protophloem cells and at highly dynamic subpopulations of Golgi apparatus and endosomes in all cell types. AUX1 action in the lateral root cap and/or epidermal cells influences lateral root initiation and positioning. Shoot supplied ammonium targets AUX1 and inhibits lateral root emergence. The mRNA is cell-to-cell mobile. |
AT2G28350 | Involved in root cap cell differentiation. |
AT2G46530 | auxin response factor 11;(source:Araport11) |
AT1G35540 | auxin response factor 14;(source:Araport11) |
AT1G77850 | Encodes a transcriptional regulator that directly binds to the promoter of MYB108 and plays a crucial role in anther dehiscence, pollen wall pattern formation, tapetum development, and auxin signal transduction in anthers. It is post-transcriptionally regulated by miR160 and regulates early auxin response genes. |
AT1G19220 | Encodes an auxin response factor that contains the conserved VP1-B3 DNA-binding domain at its N-terminus and the Aux/IAA-like domains III and IV present in most ARFs at its C-terminus. The protein interacts with IAA1 (yeast two hybrid) and other auxin response elements such as ER7 and ER9 (yeast one hybrid). ARF19 protein can complement many aspects of the arf7 mutant phenotype and , together with ARF7, is involved in the response to ethylene. In the arf7 arf19 double mutant, several auxin-responsive genes (e.g. IAA5, LBD16, LBD29 and LBD33) are no longer upregulated by auxin. |
AT1G34410 | auxin response factor 21;(source:Araport11) |
AT1G30330 | Encodes a member of the auxin response factor family. Mediates auxin response via expression of auxin regulated genes. Acts redundantly with ARF8 to control stamen elongation and flower maturation. Expression of ARF6 is controlled by miR167. |
AT3G07390 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. The mRNA is cell-to-cell mobile. |
AT2G04160 | isolated from differential screening of a cDNA library from auxin-treated root culture. encodes a protein similar to subtilisin-like serine protease which is believed to be active outside the plant cell. |
AT2G34680 | isolated from differential screening of a cDNA library from auxin-treated root culture. sequence does not show homology to any known proteins and is predicted to be extracellular. |
AT3G59900 | Encodes ARGOS (Auxin-Regulated Gene Involved in Organ Size). Inducible by auxin. Involved in lateral organ size control. Transgenic plants expressing sense or antisense ARGOS cDNA display enlarged or reduced aerial organs, respectively. The alteration in organ size is attributable mainly to changes in cell number and the duration of organ growth. |
AT5G39720 | avirulence induced protein 2 like protein;(source:Araport11) |
AT3G10960 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
AT5G50300 | Encodes a homolog of the adenine-guanine-hypoxanthine transporter AzgA of Aspergillus nidulans. Function as a plant adenine-guanine transporter. Two closely related genes exist in Arabidopsis: AT3G10960 (Azg1) and AT5G50300 (Azg2). |
AT4G12470 | Encodes AZI1 (AZELAIC ACID INDUCED 1). Involved in the priming of salicylic acid induction and systemic immunity triggered by pathogen or azelaic acid. Targeting if AZI1 to chloroplasts is increased during SAR induction and that localization requires the PRR domain.It is involved in the uptake and movement of the azelaic acid signal. AZI1 uses a previously undescribed variant of the signal anchor proteins mechanism to target plastids. AZI1 uses a bipartite N-terminal signature: a non-cleavable TMD that anchors the protein to membranes, followed by a proline rich region with features that are shared with bona fide chloroplastic transit peptides. flg22 MAMP treatment strongly induces AZI1/EARLI1 protein levels and increases their relative enrichment in the plastid fraction. |
AT1G25440 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT2G21320 | B-box zinc finger family protein;(source:Araport11) |
AT1G75540 | Encodes a B-box zinc finger transcription factor BBX21 (also named STH2/salt tolerance homolog2 and LHUS/long hypocotyl under shade). Interacts with COP1 to control de-etiolation. Also genetically interacts with COP1 to regulate shade avoidance. The mRNA is cell-to-cell mobile. |
AT4G27310 | Encodes an atypical B-box domain protein that negatively regulates photomorphogenic development by interfering with the binding of the transcription factor HY5 to target gene promoters. Degradation of BBX28 in darkness is dependent on COP1 and occurs via the 26S proteasome pathway. BBX28 acts as a key factor in the COP1-HY5 regulatory hub by maintaining proper HY5 activity to ensure normal photomorphogenic development in plants. Interacts with CO via B-box domain resulting in decreased FT expression and delayed flowering. |
AT5G54470 | B-box type zinc finger family protein;(source:Araport11) |
AT3G21150 | Encodes a protein with a B-box domain predicted to act as a transcription factor. Expression of the BBX32 gene is affected by monochromatic red light. Genetic analysis shows BBX32 is under circadian control; it is a morning gene under clock regulation. |
AT5G48250 | B-box type zinc finger protein with CCT domain-containing protein;(source:Araport11) |
AT2G47890 | Acts as a positive regulator of red light signaling; overexpression causes markedly shortened hypocotyls under various light states. Binds to the HY5 promoter to activate its transcription, while both BBX21 and HY5 associate with its promoter to positively regulate its expression. T |
AT5G17430 | Encodes an AP2-domain containing protein similar to ANT. Expressed in embryos and lateral root primordium. PLT4 acts after PLT3,5 and 7 during lateral roof formation. |
AT5G48380 | Encodes a BAK1-interacting receptor-like kinase named BIR1. Negatively regulates multiple plant resistance signaling pathways, one of which is the SOBIR1(AT2G31880)-dependent pathway. |
AT1G27190 | Activated by TCP8/14/15/22, involved in modulation of GA-dependent stamen filament elongation. |
AT4G17840 | CAAX protease self-immunity protein;(source:Araport11) |
AT3G45260 | BIB is a member of the BIRD family of zinc finger proteins that includes JKD. BIB functions redundantly with JKD to retain SHR in the nucleus and thereby restrict SHR movement in root tissues. |
AT5G15160 | BNQ2 belongs to a family of atypical non-DNA binding basic helix-loop-helix (bHLH) proteins that heterodimerize with and negatively regulate bHLH transcription factors. Directly and negatively regulated by AP3 and PI in petals.Required for appropriate regulation of flowering time. |
AT5G65700 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. Very similar to BAM2,with more than 85% a.a. identity. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. Anthers of double mutants (bam1bam2) appeared abnormal at a very early stage and lack the endothecium, middle, and tapetum layers. Further analyses revealed that cells interior to the epidermis (in anther tissue) acquire some characteristics of pollen mother cells (PMCs), suggesting defects in cell fate specification. The pollen mother-like cells degenerate before the completion of meiosis, suggesting that these cells are defective. In addition, the BAM1 expression pattern supports both an early role in promoting somatic cell fates and a subsequent function in the PMCs. The mRNA is cell-to-cell mobile. |
AT4G20270 | Encodes a CLAVATA1-related receptor kinase-like protein required for both shoot and flower meristem function. It has a broad expression pattern and is involved in vascular strand development in the leaf, control of leaf shape, size and symmetry, male gametophyte development and ovule specification and function. The mRNA is cell-to-cell mobile. |
AT4G15370 | Encodes an oxidosqualene cyclase that primarily produces the tetracyclic triterpene baruol in vitro and when expressed in yeast. It can also make 22 other minor triterpenoid products with varying numbers of rings. |
AT1G06170 | Encodes a bHLH transcription factor that together with bHLH010 and bHLH091 is important for the normal transcriptome of the developing Arabidopsis anther, possibly by forming a feed-forward loop with DYT1. Recognizes the TCATGTGC box to activate the expression of target genes, including ATA20, EXL4, and MEE48. |
AT5G49450 | Encodes a transcription activator is a positive regulator of plant tolerance to salt, osmotic and drought stresses. |
AT2G18160 | Encodes a b-ZIP transcription factor. |
AT4G38900 | Basic-leucine zipper (bZIP) transcription factor family protein;(source:Araport11) |
AT2G21230 | bZIP30 is a transcriptional activator that is involved in regulation of growth and development of reproductive organs. It interacts with a number of developmental regulators including WUS, HEC1, KNAT1/BP, KNAT2, JAB, BEL1, and NGA1. |
AT1G59530 | basic leucine-zipper 4;(source:Araport11) |
AT1G13600 | basic leucine-zipper 58;(source:Araport11) |
AT5G60830 | basic leucine-zipper 70;(source:Araport11) |
AT2G35550 | basic pentacysteine 7;(source:Araport11) |
AT3G09000 | Encodes a microtubule-associated protein. Plays a minor role in cortical microtubule organization during leaf development. |
AT1G27850 | Encodes a microtubule-associated protein involved in cortical microtubule organization during leaf development. |
AT3G51540 | mucin-5AC-like protein;(source:Araport11) |
AT2G17770 | Encodes a paralog of bZIP transcription factor FD. This protein interacts with FD and FT. |
AT3G62420 | Encodes a group-S bZIP transcription factor. Forms heterodimers with group-C bZIP transcription factors. The heterodimers bind to the ACTCAT cis-element of proline dehydrogenase gene. |
AT1G42990 | bZIP60 consists of a bZIP DNA binding domain followed by a putative transmembrane domain. bZIP60 mRNA is upregulated by the addition of ER stress inducers, tunicamycin (inhibitor of N-linked glycosylation), DTT (inhibitor of disulfide bond formation) and azetin-2-carboxylate (proline analog perturbing protein structure). Upon ER stress, bZIP60 mRNA is spliced by IRE1A and IRE1B to produce bZIP60-S, an active transcription factor without the transmembrane domain. bZIP60-U, a product of unspliced form of bZIP60 mRNA, is localized at the ER membrane and bZIP60-S is localized in the nucleus. |
AT5G47120 | Encodes BI-1, a homolog of mammalian Bax inhibitor 1. Functions as an attenuator of biotic and abiotic types of cell death. Bax-induced cell death can be downregulated by ectopically expressing AtBI in planta. The mRNA is cell-to-cell mobile. |
AT2G44330 | RING/U-box superfamily protein;(source:Araport11) |
AT1G52670 | Single hybrid motif superfamily protein;(source:Araport11) |
AT5G52060 | A member of Arabidopsis BAG (Bcl-2-associated athanogene) proteins, plant homologs of mammalian regulators of apoptosis. Plant BAG proteins are multi-functional and remarkably similar to their animal counterparts, as they regulate apoptotic-like processes ranging from pathogen attack, to abiotic stress, to plant development. |
AT3G60920 | beige/BEACH domain protein;(source:Araport11) |
AT1G77890 | One of a pair of paralogs (the other is AT4G08540)that is a subunit of the lass III phosphatidylinositol 3-kinase (PI3K) complex but is not essential for PI3P biosynthesis. |
AT2G35940 | Encodes a member of the BEL-like homeodomain protein family. Ecotopic expression in the embryo sac leads to defects in nuclear migration and cellularization and embryo sacs with multiple egg cells. Loss of function alleles have no female gametophyte defects. The ecotopic expression phenotype requires KNAT3 because it can be suppressed by loss of KNAT3 function alleles. Localized to the nucleus but interaction with OFP1 relocates it to the cytoplasm. |
AT1G75430 | BEL1-like homeodomain 11;(source:Araport11) |
AT3G50750 | BES1/BZR1 homolog 1;(source:Araport11) |
AT4G36780 | BES1/BZR1 homolog 2;(source:Araport11) |
AT4G18890 | BES1/BZR1 homolog 3;(source:Araport11) |
AT1G70410 | Encodes a putative beta-carbonic anhydrase betaCA4. Together with betaCA1 (At3g01500) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. |
AT3G13750 | beta-galactosidase, glycosyl hydrolase family 35 The mRNA is cell-to-cell mobile. |
AT1G45191 | beta-glucosidase related protein, similar to beta-glucosidase GI:3820531 from (Pinus contorta); contains Pfam profile: PF00232 Glycosyl hydrolase family 1 |
AT5G42260 | beta glucosidase 12;(source:Araport11) |
AT2G44480 | beta glucosidase 17;(source:Araport11) |
AT5G28510 | beta glucosidase 24;(source:Araport11) |
AT3G60120 | beta glucosidase 27;(source:Araport11) |
AT5G24540 | beta glucosidase 31;(source:Araport11) |
AT2G32860 | beta glucosidase 33;(source:Araport11) |
AT1G26560 | beta glucosidase 40;(source:Araport11) |
AT1G61820 | beta glucosidase 46;(source:Araport11) |
AT1G62710 | Encodes a vacuolar processing enzyme belonging to a novel group of cysteine proteases that is expressed specifically in seeds and is essential for the proper processing of storage proteins. |
AT5G20330 | beta-1,3-glucanase 4;(source:Araport11) |
AT3G52060 | Encodes a plasmodesmal glycosyltransferase-like protein. Mutation results in defects in seed germination and delayed plant growth. |
AT2G45880 | Encodes a beta-amylase-like protein present in the nucleus rather than targeted to the chloroplast. Contains BRASSINAZOLE RESISTANT1 (BZR1)-type DNA binding domains. Activates gene expression in protoplast transactivation assays. |
AT1G55120 | Encodes a protein with fructan exohydrolase (FEH) activity acting on levan-type fructans (6-FEH, levanase). The enzyme does not have invertase activity. |
AT4G26140 | putative beta-galactosidase |
AT1G77410 | beta-galactosidase 16;(source:Araport11) |
AT1G72990 | beta-galactosidase 17;(source:Araport11) |
AT1G45130 | beta-galactosidase 5;(source:Araport11) |
AT1G61810 | beta-glucosidase 45;(source:Araport11) |
AT5G39990 | Encodes GlcAT14A, a beta-glucuronosyltransferase involved in the biosynthesis of type II arabinogalactan. The protein was localized to the Golgi apparatus when transiently expressed in Nicotiana benthamiana. Plays a role in cell elongation during seedling growth. |
AT1G24470 | Encodes one of the two Arabidopsis homologues to YBR159w encoding a S. cerevisiae beta-ketoacyl reductase (KCR), which catalyzes the first reduction during VLCFA (very long chain fatty acids, >18 carbon) elongation: KCR1 (At1g67730), KCR2 (At1g24470). Complementation of the yeast ybr159Delta mutant demonstrated that the two KCR proteins are divergent and that only AtKCR1 can restore heterologous elongase activity similar to the native yeast KCR gene. |
AT5G09730 | Encodes a protein similar to a beta-xylosidase located in the extracellular matrix. It is able to degrade terminal arabinosyl residues and likely participates in the in-vivo hydrolysis of arabinan. This is a member of glycosyl hydrolase family 3 and has six other closely related members. |
AT1G75380 | Encodes a nuclease involved in ABA-mediated callose deposition. It has been shown to interact with JAZ proteins, binds to a jasmonic acid-responsive element (JARE) and repress AtJMT expression. |
AT3G02260 | Calossin-like protein required for polar auxin transport. Involved in regulating sugar response and C/N balance. |
AT1G54200 | DNA mismatch repair Msh6-like protein;(source:Araport11) |
AT3G13980 | SKI/DACH domain protein;(source:Araport11) |
AT1G69160 | suppressor;(source:Araport11) |
AT1G13670 | hypothetical protein;(source:Araport11) |
AT1G59640 | A basic helix-loop-helix encoding gene (BIGPETAL, BPE) involved in the control of petal size. BPE is expressed via two mRNAs derived from an alternative splicing event. The BPEub (AT1G59640.1)transcript is expressed ubiquitously, whereas the BPEp (AT1G59640.2) transcript is preferentially expressed in petals. Plants that lack the petal-expressed variant BPEp have larger petals as a result of increased cell size. BPEp is positively regulated downstream of APETALA3, PISTILLATA, APETALA1 and PISTILLATA3 and is negatively regulated downstream of AGAMOUS. |
AT4G35380 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
AT4G22840 | Sodium Bile acid symporter family;(source:Araport11) |
AT2G26900 | Sodium Bile acid symporter family;(source:Araport11) |
AT5G15530 | biotin carboxyl carrier protein isoform 2 (BCCP2) mRNA, |
AT3G57130 | Encodes BOP1. Contains Pfam domain, PF00023: Ankyrin repeat and Pfam domain, PF00651: BTB/POZ domain. Lines carrying recessive mutations exhibit a number of visible defects, most pronounced being ectopic outgrowths of in leaf petioles of rosette leaves. Along with BOP2, BOP1 is required for nectary development and formation of normal abscission zones.Forms homodimers and heterodimers with BOP2. Nuclear localization is required for activity which includes positive regulation of AS2 in leaves. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP1 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP1 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP1 expression is restricted to pedicel axils by BP and PNY. BOP1 promotes KNAT6 (At1g23380) expression.BOP1 Interacts with BIL1/BZR1 and Inhibits BIL1/BZR1 transport into the nucleus. |
AT2G41370 | Encodes BOP2, a cytoplasmic and nuclear-localized NPR1 like protein with BTB/POZ domain and ankyrin repeats. Interacts with BOP1 and appears to be genetically redundant with BOP1.bop1/bop2 double mutants have longer leaves, often with leaflets on the petiole, asymmetric flowers with extra organs and no nectaries. Also defective in floral organ abscission. BOP1/2 promotes floral meristem fate and determinacy in a pathway targetting APETALA1 and AGAMOUS-LIKE24. PUCHI, BOP1 and BOP2 are redundantly required for expression of LFY and AP1. BOP2 is expressed in valve margin. Misexpression in stems causes short internodes and ectopic biosynthesis of lignin. BOP2 activity is antagonistic to BP (At4g08150) and PNY (At5g02030). BOP3 expression is restricted to pedicel axils by BP and PNY; promotes KNAT6 (At1g23380) expression. |
AT4G18950 | BHP1 is a Raf-like protein kinase involved in mediating blue light dependent stomatal opening. |
AT3G54810 | Encodes a protein containing a GATA type zinc finger domain that is expressed in the embryo axis and involved in germination. Mutants have a reduced rate of germination even when stratified. |
AT1G14580 | C2H2-like zinc finger protein;(source:Araport11) |
AT5G11250 | Encodes an atypical TIR-NBS-LRR protein that is involved in stress responses. Loss of function alleles overproduce stress hormones JA,SA, ABA, and ET. |
AT5G45100 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT1G79110 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT3G12920 | Encodes one of the BRGs (BOI-related gene) involved in resistance to Botrytis cinerea. |
AT2G45760 | encodes a protein that is similar to BONZAI1-binding protein BAP1. |
AT1G73177 | The BONSAI gene encodes a protein with similarity to the APC13 component of the Anaphase Promoting Complex. Plants with lowered level of BONSAI expression, resulting from hypomethylation, RNAi knock-down, or a T-DNA insertion show some abnormalities in shoot and inflorescence development. |
AT2G39660 | Encodes a plasma membrane-localized ser/thr protein kinase that is a crucial component of host response signaling required to activate the resistance responses to Botrytis and A. brassicicola infection. It is likely a negative regulator of salicylic acid accumulation and basal defense against virulent bacterial pathogens. Together with ER plays opposing roles in leaf morphogenesis and inflorescence architecture. Required to maintain appropriate auxin response during leaf margin morphogenesis. Interacts with ER-family proteins and directly phosphorylates ER. |
AT1G79420 | C-type mannose receptor (DUF620);(source:Araport11) |
AT1G27690 | lipase, putative (DUF620);(source:Araport11) |
AT4G17720 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G14340 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT5G32450 | ACD11 binding partner, negatively regulates ROS-mediated defense response. |
AT1G18400 | Encodes the brassinosteroid signaling component BEE1 (BR-ENHANCED EXPRESSION 1). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT1G73830 | Encodes the brassinosteroid signaling component BEE3 (BR-ENHANCED EXPRESSION 3). Positively modulates the shade avoidance syndrome in Arabidopsis seedlings. |
AT2G46020 | Encodes a SWI/SNF chromatin remodeling ATPase that upregulates transcription of all three CUC genes and is involved in the formation and/or maintenance of boundary cells during embryogenesis. Also mediates repression of expression of seed storage proteins in vegetative tissues. Interacts strongly with AtSWI3C, also with AtSWI3B, but not with AtSWI3A or AtSWI3D. |
AT5G11360 | Interleukin-1 receptor-associated kinase 4 protein;(source:Araport11) |
AT4G15400 | Encodes BIA1, a member of the BAHD acyltransferase family. Plays a role in controlling brassinosteroids levels, particularly in the root and hypocotyl in darkness. |
AT5G47950 | BIA2 is a putative HXXXD-type BAHD acyltransferase. Overexpression results in a BR deficient phenotype and is dependent on a functional HXXXD motif. BIA2 may function in BR homeostasis by regulating the pool of bioactive BR. |
AT4G18710 | Encodes BIN2, a member of the ATSK (shaggy-like kinase) family. BIN2 functions in the cross-talk between auxin and brassinosteroid signaling pathways. BIN2 regulates root epidermal cell fate specification by phosphorylating EGL3 and TTG1. BIN2-mediated phosphorylation appears to promote BZR1 export from the nucleus. KIB1 interacts with BIN2 blocking its interaction with substrates and promotes BIN2 degradation. |
AT3G61460 | Encodes a novel ring finger protein and forms an N-terminal hydrophobic domain and a C-terminal RING-H2 signature. Expression is down regulated by brassinolide. |
AT4G35230 | Encodes BR-signaling kinase 1 (BSK1), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT5G46570 | Encodes BR-signaling kinase 2 (BSK2), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT4G00710 | Encodes BR-signaling kinase 3 (BSK3), one of the three homologous BR-signaling kinases (BSK1, AT4G35230; BSK2, AT5G46570; BSK3, AT4G00710). Mediates signal transduction from receptor kinase BRI1 by functioning as the substrate of BRI1. Plasma membrane localized. |
AT1G63500 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT3G09240 | kinase with tetratricopeptide repeat domain-containing protein;(source:Araport11) |
AT3G15120 | Encodes BRP1, an ATPase domain-containing protein that interacts with BRAT1 to negatively regulate transcriptional silencing at methylated genomic regions. |
AT4G21070 | Encodes AtBRCA1, an ortholog of the human breast cancer susceptibility gene 1. Contains one N-terminal RING finger, two C-terminal BRCT and the p300/CBP interacting domain. Strongly induced by gamma rays, consistent with a putative role in DNA repair and in cell cycle control. |
AT4G30610 | Encodes a secreted glycosylated serine carboxypeptidase with broad substrate preference that is involved in brassinosteroid signalling via BRI1. It is proteolytically processed in vivo by a separate as yet unidentified protease. |
AT1G03445 | encodes a serine?threonine protein phosphatase with an N-terminal Kelch-repeat domain, which is nuclear localized and expressed preferentially in elongating cells. Genetic evidence suggest that this gene plays a redundant role (along with other members of the same gene family) in modulating growth in response to brassinosteroid. |
AT4G03080 | Protein phosphatase which promotes stomatal ACD by establishing kinase-based signalling asymmetry in the two daughter cells. |
AT4G33430 | Leu-rich receptor Serine/threonine protein kinase. Component of BR signaling that interacts with BRI1 in vitro and in vivo to form a heterodimer. Brassinolide-dependent association of BRI1 and BAK1 in vivo. Phosphorylation of both BRI1 and BAK1 on Thr residues was BR dependent. Although BAK1 and BRI1 alone localize in the plasma membrane, when BAK1 and BRI1 are coexpressed, the heterodimer BAK1/BRI1 they form is localized in the endosome. Contributes to postinvasive immunity against Alternaria brassicola. |
AT5G55040 | DNA-binding bromodomain-containing protein, interacts with core SWI/SNF complex components. |
AT5G62040 | BFT is a member of The FLOWERING LOCUS T (FT)/TERMINAL FLOWER 1 (TFL1) gene family that encodes regulators involved in control of flower development. |
AT1G03457 | RNA-binding (RRM/RBD/RNP motifs) family protein;(source:Araport11) |
AT1G18910 | E3 ubiquitin ligase that functions redundantly in the root with BTSL1 to negatively regulate iron uptake. |
AT2G40400 | Encodes a chloroplast localized protein of unknown function that is involved in regulation of chloroplast development. |
AT3G48360 | Encodes a protein (BT2) that is an essential component of the TAC1-mediated telomerase activation pathway. Acts redundantly with BT3 and BT1 during female gametophyte development and with BT3 during male gametophyte development. BT2 also mediates multiple responses to nutrients, stresses, and hormones. |
AT4G37610 | BTB and TAZ domain protein. Located in cytoplasm and expressed in fruit, flower and leaves. |
AT2G21480 | BUSP2 plays a smaller role than BUSP1 in pollen tube growth. bups1/2 double mutants have reduced feritlity due to premature rupture of pollen tubes before they reach the ovule but single busp2 mutants are fertile. BUSP2 interacts with RALF4/19 peptide ligands and ANX1/2 receptors. BUPS/ANX signaling may regulate and promote pollen tube growth. |
AT5G18930 | S-adenosylmethionine decarboxylase family member. |
AT1G01550 | Encodes a protein with no functionally characterized domains that to prevent the synthesis of a novel substance that moves from the root to the shoot, where it modifies shoot growth by interfering with auxin signaling. Synthesis and delivery of this substance requires neither phloem nor endodermis. |
AT4G01360 | Encodes a protein related to BYPASS1 (BPS1). Regulates production of mobile compound: bps signal. |
AT1G18740 | DUF793 domain containing protein. Expression is induced by cold. Loss of function mutations are more sensitive to freezing and have reduced levels of CBFs. May act by preventing degradation of CBFs. |
AT4G25490 | Transcriptional activator that binds to the DRE/CRT regulatory element and induces COR (cold-regulated) gene expression increasing plant freezing tolerance. It encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF1). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
AT1G29290 | Group II CEP family member; binds to vascular tissue independently of CEPR1 or CRA2. |
AT1G59835 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
AT3G50610 | DNA-directed RNA polymerase II subunit RPB1-like protein;(source:Araport11) |
AT1G70810 | Calcium-dependent lipid-binding (CaLB domain) family protein;(source:Araport11) |
AT4G01840 | Encodes AtTPK5, a member of the Arabidopsis thaliana K+ channel family of AtTPK/KCO proteins. AtTPK5 is targeted to the vacuolar membrane. May form homomeric ion channels in vivo. |
AT5G49480 | AtCP1 encodes a novel Ca2+-binding protein, which shares sequence similarities with calmodulins. The expression of AtCP1 is induced by NaCl. The mRNA is cell-to-cell mobile. |
AT4G27280 | EF-hand Ca2 + -binding protein, which is a Ca2+-dependent transducer of auxin-regulated gene expression and interacts with ICR1. |
AT5G44070 | Phytochelatin synthase gene confers tolerance to cadmium ions. Catalyzes phytochelatin (PC) synthesis from glutathione (GSH) in the presence of Cd2+, Zn2+, Cu2+ and Fe3+, but not by Co2+ or Ni2+. The mRNA is cell-to-cell mobile. |
AT4G34050 | Methyltransferase in the lignin biosynthetic pathway. |
AT1G67980 | Encodes S-adenosyl-L-methionine: transcaffeoyl Coenzyme A 3-O-methyltransferase. Methyltransferase in the lignin biosynthetic pathway. |
AT4G17615 | Member of AtCBL (Calcineurin B-like Calcium Sensor Proteins) family. Protein level is increased upon high salt, mannitol, and cold stresses. CBL1 interacts with CIPK23 and recruits the kinase to the plasma membrane where the substrate(s) of CIPK23 may reside. CBL1 localization is regulated by protein modification including myristolation and acylation. |
AT4G01420 | Encodes calcineurin B-like protein 5 (CBL5). Overexpression confers tolerance to drought and salt stress. |
AT4G16350 | Calcium sensor protein. Binds CIPK14. |
AT4G26560 | Encodes calcineurin B-like protein 7 (CBL7).Interacts with and modulates the activity of the PM ATPase AHA2. |
AT5G47100 | member of AtCBLs (Calcineurin B-like Calcium Sensor Proteins. CBL9 interacts with and targets CIPK23 to the plasma membrane in vivo. |
AT4G37640 | Encodes a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Belongs to plant 2B ATPase's with an N-terminal autoinhibitor. |
AT2G17290 | Encodes calcium dependent protein kinase 6 (CPK6), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK6 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. The protein kinase CPK6 is shown in biochemical assays to be directly activated by elevations in calcium concentrations in the physiological range (Laanements et al., 2013 PlantPhys.; PMID: 23766366). These data correlate with the in vivo function of CPK6 in Ca2+ and ABA activation of S-type anion channels (Mori et al., 2006 PLoS Biol.; PMID: 17032064) and the ability of CPK6 to mediate ABA activation of SLAC1 (Brandt et al., 2012 PNAS; PMID: 22689970). The mRNA is cell-to-cell mobile. |
AT4G38810 | SnRK2-Interacting Calcium Sensor. Encodes two different isoforms that can both inhibit SnRK2. The longer form (AT4G38810.2) is calcium dependant, the other is not. |
AT1G18890 | encodes a calcium-dependent protein kinase whose gene expression is induced by dehydration and high salt. Kinase activity could not be detected in vitro. |
AT2G41860 | member of Calcium Dependent Protein Kinase |
AT5G12180 | member of Calcium Dependent Protein Kinase |
AT4G36070 | member of Calcium Dependent Protein Kinase |
AT4G04720 | member of Calcium Dependent Protein Kinase |
AT4G04710 | member of Calcium Dependent Protein Kinase |
AT4G04700 | member of Calcium Dependent Protein Kinase |
AT1G76040 | member of Calcium Dependent Protein Kinase |
AT4G04695 | member of Calcium Dependent Protein Kinase. Involved in response to salicylic acid. |
AT3G57530 | Calcium-dependent Protein Kinase. ABA signaling component that regulates the ABA-responsive gene expression via ABF4. AtCPK32 has autophosphorylation activity and can phosphorylate ABF4 in vitro |
AT4G23650 | Encodes calcium dependent protein kinase 3 (CPK3), a member of the Arabidopsis CDPK gene family. CDPKs contain an intrinsic Ca2+-activation domain with four EF hand Ca2+-binding sites. CDPKs protein kinases have been proposed to function in multiple plant signal transduction pathways downstream of [Ca2+]cyt elevations, thus transducing various physiological responses. CPK3 is expressed in both guard cells and mesophyll cells. Functions in guard cell ion channel regulation. ABA and Ca(2+) activation of slow-type anion channels and, interestingly, ABA activation of plasma membrane Ca(2+)-permeable channels were impaired in independent alleles of single and double cpk3cpk6 mutant guard cells. Furthermore, ABA- and Ca(2+)-induced stomatal closing were partially impaired in these cpk3cpk6 mutant alleles. CPK6 is also a member of the Arabidopsis CDPK family. |
AT5G54590 | Splice variant At5g54590.2 encodes CRLK1 (440-amino acid in length) calcium/calmodulin-regulated receptor-like kinase crucial for cold tolerance. CRLK1 is Primarily localized in the plasma membrane. |
AT5G15730 | Protein kinase superfamily protein;(source:Araport11) |
AT1G05570 | Encodes a callose synthase 1 catalytic subunit . Member of Glycosyltransferase Family- 48. |
AT2G13680 | Responsible for the synthesis of callose deposited at the primary cell wall of meiocytes, tetrads and microspores. Required for exine formation during microgametogenesis and for pollen viability. Highest expression in meiocytes, tetrads, microspores and mature pollen. |
AT1G06490 | Encodes Callose Synthase 7 (CalS7), a phloem-specific callose synthase responsible for callose deposition in developing sieve elements during phloem formation and in mature phloem induced by wounding. |
AT3G16030 | lectin protein kinase family protein;(source:Araport11) |
AT2G41010 | Encodes a novel calmodulin binding protein whose gene expression is induced by dehydration and ionic (salt) and non-ionic (mannitol) osmotic stress. Lines over-expressing this gene are more sensitive and anti-sense lines are more tolerant to osmotic stress, suggesting this gene may be a negative regulator of response to osmotic stress. |
AT2G41110 | Encodes a touch-inducible calmodulin that has higher affinity to kinesin-like calmodulin binding motor protein than CAM4 or CAM6. The mRNA is cell-to-cell mobile. |
AT3G56800 | encodes a calmodulin |
AT5G21274 | Encodes a calmodulin isoform. Expressed in leaves. |
AT3G51920 | encodes a divergent member of calmodulin, which is an EF-hand family of Ca2+-binding proteins. This gene is expressed in leaves, flowers and siliques. The gene functionally complements yeast calmodulin 1 (CAM1) but only when selected against the plasmid harboring wild-type yeast sequences. Also the protein does not form formed a complex with a basic amphiphilic helical peptide in the presence of Ca2+ in vitro. Authors suggest that this gene may represent a Ca2+-binding sensor protein that interacts with a more limited set of target proteins than do more conventional CaM isoforms. Mutations in this gene alter plant responses to abiotic stress and abscisic acid. |
AT3G25600 | Calmodulin like protein. Paralog of CML15. |
AT5G42380 | calmodulin like 37;(source:Araport11) |
AT5G44460 | Calcium sensor. |
AT4G35987 | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein;(source:Araport11) |
AT5G58940 | Arabidopsis thaliana calmodulin-binding receptor-like kinase mRNA The mRNA is cell-to-cell mobile. |
AT2G11520 | high overall homology to CRCK1 |
AT3G16940 | Calmodulin binding transcription factor. Mutants display increased salt tolerance during early germination. Involved in regulation of salt stress responsive genes. |
AT4G35310 | calmodulin-domain protein kinase CDPK isoform 5 (CPK5) |
AT5G12480 | calmodulin-domain protein kinase CDPK isoform 7 (CPK7) |
AT3G22930 | Encodes a calmodulin-like protein. |
AT5G39670 | Calmodulin like protein involved in negative regulation of pattern triggered immunity. |
AT3G56690 | encodes a protein similar to ATPases and binds to calmodulin in vitro. This is a single-copy gene and is expressed in all tissues examined. |
AT1G78955 | Encodes a cyclase that generates predominantly a monocyclic triterpene alcohol. The product is 97% camelliol, 2% achilleol A and 0.2% beta-amyrin. Achilleol is an isomer of camelliol C with a 4-methylenecyclohexanol ring system. |
AT3G59090 | tobamovirus multiplication protein;(source:Araport11) |
AT5G02630 | Lung seven transmembrane receptor family protein;(source:Araport11) |
AT5G27210 | Protein of unknown function, transmembrane-40;(source:Araport11) |
AT2G46410 | Nuclear-localized R3-type MYB transcription factor. Positive regulator of hair-cell differentiation. Preferentially transcribed in hairless cells. Moves from atrichoblasts into trichoblast via plasmodesmata in a tissue-specific mode. N-terminus and part of the Myb domain are required for this movement, with W76 playing a crucial role. Capability to increase the size-exclusion limit of plasmodesmata. Regulated by WEREWOLF. |
AT3G27740 | Encodes carbamoyl phosphate synthetase (CPS) small subunit (carA), also named as VEN6. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
AT1G29900 | Encodes carbamoyl phosphate synthetase (CPS) large subunit (CARB), also named as VEN3. Heterologous expression of the Arabidopsis VEN3 and VEN6 genes in a CPS-deficient Escherichia coli strain fully restored bacterial growth in minimal medium, demonstrating the enzymatic activity of the VEN3 and VEN6 proteins. |
AT5G27420 | Encodes CNI1 (Carbon/Nitrogen Insensitive1) (also named as ATL31), a RING type ubiquitin ligase that functions in the Carbon/Nitrogen response for growth phase transition in Arabidopsis seedlings. The mRNA is cell-to-cell mobile. |
AT3G01500 | Encodes a putative beta-carbonic anhydrase betaCA1. Together with betaCA4 (At1g70410) regulates CO2-controlled stomatal movements in guard cells, as well as attenuates immunity. Differential CA gene expression in response to changing atmospheric CO2 conditions contribute to altered disease resistance levels. Activated by OXS2 under the treatment of salt. |
AT5G62180 | Carboxyesterase that binds stringolactones. |
AT1G49660 | Encodes a protein with carboxylesterase whose activity was tested using pNA. |
AT5G01270 | Encodes CPL2, a carboxyl-terminal domain (CTD) phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA polymerase II complex. Regulates plant growth, stress and auxin responses. |
AT3G63520 | Encodes a protein with 9-cis-epoxycarotenoid dioxygenase activity. The enzyme was shown to act on a variety of carotenoid including β-carotene, lutein, zeaxanthin, and all-trans-violaxanthin. When those compounds are used as substrates, the major reaction product detected is a C14 dialdehyde: 4,9-dimethyldodeca-2,4,6,8,10-pentaene-1,12-dial. The enzyme did not cleave as efficiently carotenoids containing 9-cis-double or allenic bonds. The mRNA is cell-to-cell mobile. |
AT4G32810 | Encodes a protein with similarity to carotenoid cleaving deoxygenases, the enzymes that cleave beta-carotene. Involved in the production of a graft transmissable signal to suppress axillary branching. Protein is localized to chloroplast stroma and expressed primarily in root tip. Mutants in the gene exhibit increased shoot branching, and light-dependent defects in hook opening and hypocotyl/root elongation. Only upregulated by auxin in the root and hypocotyl, and this is not required for the inhibition of shoot branching. |
AT4G26100 | Encodes a member of the casein kinase 1 protein family that is expressed in punctate particles at the cell periphery suggesting possible plasmodesmatal localization (member of CKL-B group). |
AT5G67380 | Casein kinase II (CK2) catalytic subunit (alpha 1). One known substrate of CK2 is Phytochrome Interacting Factor 1 (PIF1). CK2-mediated phosphorylation enhances the light-induced degradation of PIF1 to promote photomorphogenesis. |
AT4G14340 | Phosphorylates serine or threonine residues that are near and C-terminal to acidic side chains on a variety of target proteins. Member of CKL gene family (CKL-C group). |
AT5G57015 | Member of CKL gene family (member of CKL-B group). |
AT4G28880 | Member of CKL gene family (CKL-A group) |
AT4G28860 | Member of CKL gene family (CKL-A group) |
AT3G60250 | Regulatory (beta) subunit of the protein kinase CK2. Involved in regulation of the circadian clock in Arabidopsis |
AT1G04440 | Member of CKL gene family (CKL-C group). |
AT5G44550 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G03540 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G14380 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT3G16300 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G39530 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G39518 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT4G37235 | Uncharacterized protein family (UPF0497);(source:Araport11) |
AT2G16385 | CAF1 is a peptide hormone expressed in the root stele that specifically binds the endodermis-expressed leucine-rich repeat receptor kinase GASSHO1 (GSO1)/SCHENGEN3 and its homolog, GSO2. Together with CAF2 it is required for formation of the casparian band. |
AT4G35600 | Encodes a receptor-like cytoplasmic kinase that acts as a spatial inhibitor of cell separation. Analysis of the cDNA previously described in Meiners et al., 1991 revealed mistakes in the predicted open reading frame. The mRNA is cell-to-cell mobile. |
AT1G73875 | Deadenylase. |
AT1G20630 | Catalyzes the reduction of hydrogen peroxide using heme group as cofactor. Protects cells from toxicity by H2O2. |
AT4G35090 | Encodes a peroxisomal catalase, highly expressed in bolts and leaves. mRNA expression patterns show circadian regulation with mRNA levels being high in the subjective early morning. Loss of function mutations have increased H2O2 levels and increased H2O2 sensitivity. Mutants accumulate more toxic ions yet show decreased sensitivity to Li+. This decreased sensitivity is most likely due to an insensitivity to ethylene. Note that in Queval et al. (2007) Plant Journal, 52(4):640, SALK_057998 is named as cat2-1, SALK_076998 is named as cat2-2; in Bueso et al. (2007) Plant Journal, 52(6):1052, SALK_076998 is named as cat2-1. TAIR has adopted the nomenclature consistent with that in Bueso et al. (2007) after consultation with the authors: SALK_076998 (cat2-1), SALK_057998 (cat2-2). |
AT1G20620 | Catalase, catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. The mRNA is cell-to-cell mobile. |
AT1G54115 | Involved in cation (Na and K) homeostasis. |
AT3G13320 | low affinity calcium antiporter CAX2 The mRNA is cell-to-cell mobile. |
AT5G01490 | Encodes a cation/proton antiporter, a member of low affinity calcium antiporter CAX2 family. Involved in root development under metal stress. |
AT1G55730 | member of Low affinity calcium antiporter CAX2 family |
AT5G22910 | member of Putative Na+/H+ antiporter family |
AT1G64170 | member of Putative Na+/H+ antiporter family |
AT4G23700 | member of Putative Na+/H+ antiporter family |
AT3G53720 | member of Putative Na+/H+ antiporter family. Involved in the osmoregulation through K(+) fluxes and possibly pH modulation of an active endomembrane system in guard cells. |
AT5G01680 | member of Putative Na+/H+ antiporter family |
AT1G58030 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Localized to the tonoplast. |
AT5G36940 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
AT1G17120 | Encodes a member of the cationic amino acid transporter (CAT) subfamily of amino acid polyamine choline transporters. Does not mediate efficient uptake of basic amino acids in yeast or Xenopus systems but can transport neutral and acidic amino acid analogs. |
AT1G26310 | Floral homeotic gene encoding a MADS domain protein homologous to AP1. Enhances the flower to shoot transformation in ap1 mutants. |
AT2G38270 | Encodes protein homologous to CXIP1. CXIP1 is a PICOT domain containing protein interacts with CAX1, a high capacity calcium transporter. However, CXP2 does not interact with CAX1 and only moderately activates another calcium transporter CAX4. |
AT4G18700 | Encodes CBL-interacting protein kinase 12 (CIPK12). |
AT2G34180 | Encodes CBL-interacting protein kinase 13 (CIPK13). |
AT2G25090 | Encodes a member of the SNF1-related kinase (SnRK) gene family (SnRK3.18), which has also been reported as a member of the CBL-interacting protein kinases (CIPK16) and is involved in salinity tolerance. |
AT5G57630 | CBL-interacting protein kinase.When mutated plants are hypersensitive to salt and osmotic stress. |
AT2G38490 | member of AtCIPKs |
AT1G30270 | Arabidopsis thaliana CBL-interacting protein kinase 23. CIPK23 serves as a positive regulator of the potassium transporter AKT1 by directly phosphorylating AKT1. CIPK23 is activated by the binding of two calcineurin B-like proteins, CBL1 and CBL9. The mRNA is cell-to-cell mobile. |
AT4G14580 | CBL-interacting protein kinase |
AT5G10930 | Encodes CBL-interacting protein kinase 5 (CIPK5). |
AT3G23000 | Encodes a serine/threonine protein kinase with similarities to CBL-interacting protein kinases, SNF1 and SOS2. The mRNA is cell-to-cell mobile. |
AT1G80090 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
AT1G65320 | Cystathionine beta-synthase (CBS) family protein;(source:Araport11) |
AT2G16940 | Splicing factor which interacts with IRR and SR45 to mediate pre-mRNA splicing to facilitate protein function, however not contributing to target specificity. |
AT2G33590 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The expression pattern of AtCRL1 indicates that CRL1 has a role in embryogenesis and seed germination. AtCRL1 is induced by ABA, drought and heat, and is highly expressed in seeds. The mRNA is cell-to-cell mobile. |
AT2G33600 | Encodes a protein with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. Its expression pattern suggests that AtCRL2 is involved in the synthesis and/or maintenance of vascular tissue. |
AT5G22250 | Encodes one of the homologs of the yeast CCR4-associated factor 1: AT3G44260 (CAF1a), AT5G22250 (CAF1b). Has mRNA deadenylation activity. Also plays a role in plant defense responses. |
AT1G27890 | Deadenylase. |
AT1G61470 | Deadenylase. |
AT5G02800 | Encodes CDL1, a homolog of CDG1. CDL1 positively regulates brassinosteroid signaling and plant growth. |
AT1G62430 | Encodes a CDP-diacylglycerol synthase, involved in phospholipid biosynthesis. |
AT3G50530 | CDPK-related kinase |
AT1G50180 | Host immune receptor which recognizes the conserved effectors AvrE and HopAA1. |
AT1G47960 | Plant cell wall (CWI) and vacuolar invertases (VI) play important roles in carbohydrate metabolism, stress responses and sugar signaling. This protein may inhibit their activity. |
AT3G52600 | Cell wall invertase expressed in flowers and ovary placental tissues. Reduced expression is correlated with decreased ovule production suggesting a link between sugar sensing and ovule initiation. |
AT3G13784 | cell wall invertase 5;(source:Araport11) |
AT4G32410 | Encodes a cellulose synthase isomer. CESA1 mutants have cellulose defect in the primary cell wall. Multiple lines of evidence suggest that CESA1, along with CESA3 and CESA6 are present in the same plasma membrane complex for cellulose biosynthesis. lasma membrane complex for cellulose biosynthesis. As inferred from the null role of secondary wall-type CesAs, included in a set of five primary wall-type CesAs that may support trichome cell wall thickening. |
AT2G25540 | cellulose synthase |
AT5G44030 | Encodes a cellulose synthase involved in secondary cell wall biosynthesis. Confers resistance towards bacterial and fungal pathogens, independent of salicylic acid, ethylene and jasmonate signaling. The mRNA is cell-to-cell mobile. |
AT1G44120 | CELLULOSE SYNTHASE INTERACTIVE 2;(source:Araport11) |
AT2G35650 | a member of Glycosyltransferase- Family 2 and encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. Mutants exhibit defects in pollen tube growth and embryo development. The defective embryonic development was associated with reduced proliferation and failed cellularization of the endosperm. |
AT5G16190 | encodes a gene similar to cellulose synthase |
AT3G56000 | encodes a gene similar to cellulose synthase |
AT1G55850 | encodes a protein similar to cellulose synthase The mRNA is cell-to-cell mobile. |
AT4G24010 | encodes a protein similar to cellulose synthase |
AT4G23990 | encodes a protein similar to cellulose synthase |
AT5G22740 | Encodes a beta-mannan synthase based on in vitro enzyme assays from heterologously expressed protein. CSLA2 synthesizes the backbone of galactoglucomannan in seed coat epidermal cells. Both CSLA2 and MUCI10, which may be part of a protein complex, are critical for mucilage architecture. |
AT1G23480 | encodes a gene similar to cellulose synthase |
AT2G32610 | encodes a gene similar to cellulose synthase |
AT1G02730 | Encodes a gene similar to cellulose synthase. Knock-out mutant has reduced growth, reduced xylan level and reduced xylan synthase activity in stems.It's expression is cell cycle dependent and it appears to function in cell plate formation. |
AT1G32180 | encodes a gene similar to cellulose synthase |
AT2G33420 | hypothetical protein (DUF810);(source:Araport11) |
AT5G16910 | encodes a gene similar to cellulose synthase. Located in Golgi membranes. The mRNA is cell-to-cell mobile. |
AT4G37010 | Encodes a member of the Centrin family. Mutants are hypersensitive to UV and prone to UV induced DNA damage. Based on sequence similarity and mutant phenotype CEN2 is thought to be involved in nucelotide excision repair/DNA repair. |
AT1G15660 | Encodes a homologue of the human centromeric protein C (CENP-C). CENP-C co-localizes with the 180 bp centromeric regions of chromosomes throughout the cell cycle, but does not completely cover the 180 bp regions. |
AT1G34750 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G22820 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT5G16070 | TCP-1/cpn60 chaperonin family protein;(source:Araport11) |
AT5G56500 | Encodes a subunit of chloroplasts chaperonins that are involved in mediating the folding of newly synthesized, translocated, or stress-denatured proteins. Cpn60 subunits are: Cpn60alpha1 (At2g28000), AtCpn60alpha2 (At5g18820), AtCpn60beta1 (At1g55490), AtCpn60beta2 (At3g13470), AtCpn60beta3 (At5g56500), AtCpn60beta4 (At1g26230). |
AT3G62080 | Encodes a charged multi-vesicular body protein (CHMP7) homolog, that is an ESCRT-III-related protein and functions in the endosomal sorting pathway in humans. The Brassica homolog has been shown to be involved in plant growth and leaf senescence. |
AT3G21630 | LysM receptor-like kinase, based on protein sequence alignment analysis, it has a typical RD signaling domain in its catalytic loop and possesses autophosphorylation activity. Involved in the perception and transduction of the chitin oligosaccharide elicitor. Located in the plasma membrane. CERK1 phosphorylates LIK1, a LLR-RLK that is involved in innate immunity, |
AT5G24090 | Chitinase A (class III) expressed exclusively under environmental stress conditions. Shown be a plant lysozyme involved in plant immunity. |
AT3G04000 | ChlADR is an aldehyde reductase that catalyzes the reduction of the aldehyde carbonyl groups on saturated and alpha,beta-unsaturated aldehydes with more than 5 carbons in vitro. The N-terminal region of this protein directs GFP to the chloroplast where where ChlADR likely helps to maintain the photosynthetic process by detoxifying reactive carbonyls formed during lipid peroxidation. In addition, this enzyme can also reduce cis-3-hexenal, a major plant volatile compound that contributes to green leaf odor, as well as methylglyoxal in vitro. |
AT2G44650 | Encodes a chloroplast-localized chaperonin 10 whose mRNA is expressed in leaves and stems but not roots. |
AT1G71697 | Encodes choline kinase. mRNA levels are increased in response to wounding. The mRNA is cell-to-cell mobile. |
AT3G29200 | L-ascorbate peroxidase |
AT5G10870 | Encodes chorismate mutase AtCM2. |
AT5G66750 | Protein is similar to SWI2/SNF2 chromatin remodeling proteins. DDM1 is appears to act as a chromatin-remodeling ATPase involved in cytosine methylation in CG and non-CG contexts. Involved in gene silencing and maintenance of DNA methylation and histone methylation. Hypomethylation of many genomic regions occurs in ddm1 mutants, and can cause several phenotypic abnormalities, but some loci, such as BONSAI (At1g73177) can be hypermethylated in ddm1 mutants after several generations, leading to different phenotypes. DDM1 might be involved in establishing a heterochromain boundary. A line expressing an RNAi targeted against DDM1 shows some resistance to agrobacterium-mediated root transformation. |
AT2G21450 | chromatin remodeling 34;(source:Araport11) |
AT2G13370 | Chromatin-remodeling factor; has large number of MAPK docking sites (D-sites). |
AT5G18620 | Encodes a member of the A. thaliana imitation switch (AtISWI) subfamily of chromatin remodeling factors. Double mutation in CHR17 and CHR11 results in the loss of the evenly spaced nucleosome pattern in gene bodies, but does not affect nucleosome density. |
AT1G80740 | ecotype Kl-0 chromomethylase (CMT1). A plant line expressing an RNAi construct directed against DMT4 has reduced agrobacterium-mediated tumor formation. |
AT1G69770 | Encodes a chromomethylase involved in methylating cytosine residues at non-CG sites. Involved in preferentially methylating transposon-related sequences, reducing their mobility. CMT3 interacts with an Arabidopsis homologue of HP1 (heterochromatin protein 1), which in turn interacts with methylated histones. Involved in gene silencing. |
AT5G40090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT3G23690 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT2G30490 | Encodes a cinnamate-4-hydroxylase. Mutations in this gene impact phenylpropanoid metabolism, growth and development. |
AT1G80820 | Encodes an cinnamoyl CoA reductase isoform. Involved in lignin biosynthesis. |
AT4G37970 | cinnamyl alcohol dehydrogenase 6;(source:Araport11) |
AT4G39330 | cinnamyl alcohol dehydrogenase 9;(source:Araport11) |
AT2G17570 | Undecaprenyl pyrophosphate synthetase family protein;(source:Araport11) |
AT4G19810 | ChiC encodes a Class V chitinase that is a part of glycoside hydrolase family 18 based on CAZy groupings. It appears to primarily act as an exochitinase in vitro where it predominantly cleaves a chitobiose (GlcNAc)2 residue from the non-reducing end of a chitin oligosaccharide. However, it shows some minor endochitinase activity in vitro, as well. A putative 24 amino-acid signal peptide may direct this protein to the secretory system and it has been detected in cell wall apoplastic fluid. RT-PCR experiments demonstrate that ChiC transcript levels are increased in response to abscisisc acid, jasmonic acid, and NaCl stress. Microarray results also suggest that transcript levels rise in response to osmotic stress, two fungal pathogens, a bacterial pathogen, and the elicitor flagellin. The mRNA is cell-to-cell mobile. |
AT1G68110 | An ENTH (Epsin NH2 terminal homology)/ANTH/VHS superfamily protein with adenylate cyclase activity and a role in clathrin assembly and endocytosis. |
AT2G40060 | Encodes a clathrin that is localized to the cortical division zone and the cell plate and colocalizes with TPLATE during cell plate anchoring. The mRNA is cell-to-cell mobile. |
AT3G51890 | Clathrin light chain protein;(source:Araport11) |
AT1G75820 | Putative receptor kinase with an extracellular leucine-rich domain. Controls shoot and floral meristem size, and contributes to establish and maintain floral meristem identity. Negatively regulated by KAPP (kinase-associated protein phosphatase). CLV3 peptide binds directly CLV1 ectodomain. |
AT5G65480 | CCL1 is induced by WUS and binds to the kinase domains of BAM1 and CLV1. Localizes to lipid rich plasma membrane rafts. Likely to be involved in WUS/CLV signaling pathway. |
AT4G38060 | hypothetical protein;(source:Araport11) |
AT5G45780 | Encodes one of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that act as co-receptors and have essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT1G73165 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
AT1G68795 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT1G73965 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can partially replace CLV3 function in vivo. |
AT1G63245 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can not replace CLV3 function in vivo. |
AT1G70895 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT4G18510 | CLE2, putative ligand, member of large gene family homologous to Clavata3 |
AT1G05065 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT3G25905 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. |
AT3G24770 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE41 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE44 (At4g13195). The protein is expressed in the vascular system and is involved in axillary bud formation. The mRNA is cell-to-cell mobile. |
AT1G25425 | CLAVATA3/ESR-RELATED 43;(source:Araport11) |
AT4G13195 | Belongs to a large gene family, called CLE for CLAVATA3/ESR-related, encoding small peptides with conserved carboxyl termini. The C-terminal 12 amino acid sequence of CLE44 is identical to that of a dodeca peptide (TDIF, tracheary element differentiation inhibitory factor) isolated from Arabidopsis and functions as a suppressor of plant stem cell differentiation. TDIF sequence is also identical to the C-terminal 12 amino acids of CLE41 (At3g24770). The protein is expressed in the vascular system and is involved in axillary bud formation. |
AT2G31085 | Member of a large family of putative ligands homologous to the Clavata3 gene. Consists of a single exon. Can replace CLV3 function in vivo. |
AT2G23950 | Encodes an LLR receptor kinase that is expressed in protophloem and is required for CLE peptide sensing in roots. One of a group of LRR-RLKs, designated as CLAVATA3 INSENSITIVE RECEPTOR KINASES (CIKs), that acts as a co-regulator and has essential roles in regulating CLV3-mediated stem cell homeostasis. |
AT5G51660 | cleavage and polyadenylation specificity factor 160;(source:Araport11) |
AT2G20190 | Encodes a microtubule-associated protein that is involved in both cell division and cell expansion. It likely promotes microtubule stability. |
AT3G44340 | homologous to yeast and animal Sec24 proteins; expression in yeast cells enhances their survival under oxidative stress conditions. |
AT4G15560 | Encodes a protein with 1-deoxyxylulose 5-phosphate synthase activity involved in the MEP pathway. It is essential for chloroplast development in Arabidopsis |
AT5G45390 | One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001). The mRNA is cell-to-cell mobile. |
AT5G39930 | Encodes a protein with similarity to the CLP1 polyadenylation factor. |
AT5G55130 | putative molybdopterin synthase sulphurylase (cnx5) |
AT3G02210 | COBRA-like protein 1 precursor;(source:Araport11) |
AT4G16120 | putative membrane-anchored cell wall protein |
AT1G16670 | Encodes a cold-activated plasma membrane protein cold-responsive protein kinase that phosphorylates 14-3-3 proteins. The phosphorylated 14-3-3 proteins shuttle from the cytosol to the nucleus, where they interact with and destabilize the key cold-responsive C-repeat-binding factor (CBF) proteins, modulate CBF stability and the response to cold stress. |
AT1G45688 | CC1 is a plant specific gene that interacts with with the cellulose synthase complex and microtubules. It appears to play a role in localizing CESA to the membrane, microtuble dynamics , particularly during salt stress. |
AT4G35170 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT2G25240 | Serine protease inhibitor (SERPIN) family protein;(source:Araport11). Involved in stress response regulated cell death. |
AT5G67370 | DUF1230 family protein (DUF1230);(source:Araport11) |
AT4G24840 | oligomeric golgi complex subunit-like protein;(source:Araport11) |
AT3G21290 | Nuclear-localized intrinsically disordered protein involved in promoting miRNA activity. |
AT2G32950 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Contains a ring finger zinc-binding motif, a coiled-coil domain, and several WD-40 repeats, similar to G-beta proteins. The C-terminus has homology to TAFII80, a subunit of the TFIID component of the RNA polymerase II of Drosophila. Nuclear localization in the dark and cytoplasmic in the light. The mRNA is cell-to-cell mobile. |
AT5G05690 | Encodes a member of the CP90A family, a cytochrome P450 monooxygenase which converts 6-deoxocathasterone to 6-deoxoteasterone in the late C6 oxidation pathway and cathasterone to teasterone in the early C6 oxidation pathway of brassinolide biosynthesis. Expressed in cotyledons and leaves. Mutants display de-etiolation and derepression of light-induced genes in the dark, dwarfism, male sterility and activation of stress-regulated genes in the light. The expression of the gene using a CPD promoter:LUC fusion construct was shown to be under circadian and light control. Additionally, the circadian regulation was shown to be independent of BR levels as it remains unchanged in bri1 mutant lines. CPD appears to be involved in the autonomous pathway that regulates the transition to flowering, primarily through a BRI1-mediated signaling pathway that affects FLC expression levels, as uncovered by double mutant analyses. |
AT5G17880 | Encodes a TIR-NBS-LRR protein CSA1 that functions in photomorphogenic development. csa1 mutants display a constitutive shade-avoidance (CSA) phenotype (long stem) under high red:far-red rations (i.e. in the absence of a shade signal). csa1 mutation can be complemented by RPS4, a TIR-NBS-LRR protein that confers resistance against bacterium Pseudomonas syringae. |
AT1G29690 | Encodes a protein containing a domain with significant homology to the MACPF (membrane attack complex and perforin) domain of complements and perforin proteins that are involved in innate immunity in animals. Transgenic cad1-1 mutant plants show lesions seen in the hypersensitive response, as well as a spontaneous activation of expression of pathogenesis-related genes and leading to a 32-fold increase in salicylic acid (SA). CAD1 is postulated to act as a negative regulator controlling SA-mediated pathway of programmed cell death in plant immunity. |
AT5G50000 | Belongs to the Raf-like kinase subfamily of the mitogen-activated protein kinase kinase kinase (MAPKKK) family. Negatively regulates stomatal opening by negatively regulating plasma membrane H+-ATPase phosphorylation. |
AT3G50260 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. Involved in defense and freezing stress responses. There are 16 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. The mRNA is cell-to-cell mobile. |
AT1G61620 | Encodes a RING-finger E3 ubiquitin ligase that plays a major role in maintaining COP1 homeostasis by targeting COP1 for ubiquitination and degradation in dark-grown seedlings. The mRNA is cell-to-cell mobile. |
AT5G41790 | encodes a protein that physically interacts specifically with the putative coiled-coil region of COP1 in vitro. In hypocotyl and cotyledon protoplasts, it is associated to the cytoskeleton, but not in the root. expression is not regulated by light. The mRNA is cell-to-cell mobile. |
AT1G22920 | AJH1 encodes a protein similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Encodes a subunit of the COP9 complex that is involved in protein deneddylation. Plants with mutations in CSN5A and CSN5B have a de-etiolated phenotype. Required for the recovery of AUX/IAA repressor levels following recurrent heat stress to regulate auxin homeostasis. |
AT4G26430 | one of two genes encoding subunit 6 of COP9 signalosome complex |
AT1G71230 | Encodes a subunit of the COP9 complex, similar to JAB1, a specific mammalian coactivator of AP-1 transcription. Involved in protein deneddylation. Double mutants with CSN5A are constitutively photomorphogenic (de-etiolated) and have abnormal auxin responses. |
AT5G20650 | Encodes COPT5, a member of copper transporter family and functionally complements a high affinity copper transporter mutant in yeast. Plays an important role in the plant response to environmental copper scarcity, probably by remobilizing copper from prevacuolar vesicles, which could act as internal stores or recycling vesicles to provide the metal cofactor to key copper-dependent processes such as photosynthesis. |
AT2G26975 | Plasma membrane Cu transporter. |
AT3G19610 | Member of a novel, plant specific family of microtubule associated proteins. |
AT1G28680 | Catalyses trans-cis isomerization and lactonization in the biosynthesis of coumarins in roots. |
AT3G59420 | Encodes a membrane localized protein with similarity to receptor kinases which is involved in epidermal cell differentiation. Flowers of mutants have disorganized ovule integument growth and abnormal sepal margins. In the roots, mutants initiate more lateral roots but fewer laterals actually emerge due to defects in lateral root formation. Mutants also display disorganized columella. The root phenotypes can be traced to abnormalities in asymmetric divisions in the pericycle and root apex. Conflicting data regarding the role of the kinase domain- which may or may not be required for function. Complementation studies indicate that the C-terminal domain is also not required for signaling function. May be regulated by protein turnover which is mediated by endocytic processes. ACR4 phosphorylates the PROTEIN PHOSPHATASE 2A-3 (PP2A-3) catalytic subunit of the PP2A phosphatase holoenzyme and PP2A |
AT3G09780 | CRINKLY4 related 1;(source:Araport11) |
AT3G55950 | CRINKLY4 related 3;(source:Araport11) |
AT5G47850 | CRINKLY4 related 4;(source:Araport11) |
AT3G28630 | actin cross-linking protein, putative (DUF569);(source:Araport11) |
AT4G01710 | belongs to the DIS(distorted) gene family. Encodes a actin polymerization factor. Involved in cell expansion of trichome. |
AT4G24460 | Encodes one of the CRT-Like transporters (CLT1/AT5G19380, CLT2/AT4G24460, CLT3/AT5G12170). Required for glutathione homeostasis and stress responses. Mutants lacking these transporters are heavy metal-sensitive, glutathione(GSH)-deficient, and hypersensitive to Phytophthora infection. |
AT5G48560 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G07340 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT1G10120 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT3G49390 | RNA-binding protein, putative, RNA-binding protein RBP37, Arabidopsis thaliana, PIR:T04196.Member of a family of PAB2 domain containing proteins. |
AT3G14450 | RNA-binding protein, putative, contains Pfam profile: PF00076 RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (2 copies). Contains PAM PABC binding domain. |
AT4G02120 | Cytidine triphosphate synthase. |
AT1G26830 | Cullin, putative, similar to Cullin homolog 3 (CUL-3) SP:Q13618, GI:3639052 from (Homo sapiens); contains Pfam profile PF00888: Cullin family. Interacts with other components of E3 ligase complex suggesting it functions in RUB-modification. Forms complexes with BTB domain proteins forming a novel class of E3-based ubiquitin protein-ligase complexes. Mutant is early flowering and has a reduced sensitivity to far-red light. cul3a/cul3b homozygous/heterozygous plants are embryo lethal. |
AT1G76420 | Identified in an enhancer trap line; member of the NAC family of proteins. Expressed at the boundary between the shoot meristem and lateral organs and the polar nuclei in the embryo sac. Together with CUC2-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates axillary meristem initiation by directly binding to the DA1 promoter. |
AT5G53950 | Transcriptional activator of the NAC gene family, with CUC1 redundantly required for embryonic apical meristem formation, cotyledon separation and expression of STM. Proper timing of CUC2 expression is required to maintain the phyllotactic pattern initiated in the meristem. CUC2 expression in leaf sinus region is required for serration and the extent of serration is modulated by mir164A mediated repression of CUC2. Together with CUC3-DA1-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. Regulates the axillary meristem initiation, directly binding to the DA1 promoter. |
AT4G39830 | role in the degradation of ascorbate to (mono)dehydroascorbate |
AT4G30140 | Member of the GDSL lipase/esterase family of proteins that functions as cutinase. Expressed in pollen and at the zone of lateral root emergence. |
AT4G34180 | Encodes a cyclase-family protein that is a negative regulator of cell death that regulates pathogen-induced symptom development. |
AT1G44542 | Cyclase family protein;(source:Araport11) |
AT1G19780 | Encodes a member of the cyclic nucleotide gated channel (CNGC) family that is essential for male reproductive fertility. |
AT2G46430 | Encodes a cyclic nucleotide gated channel, downstream component of the signaling pathways leading to hypersensitive response (HR) resistance. |
AT4G30560 | member of Cyclic nucleotide gated channel family. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
AT3G17700 | cyclic nucleotide-binding transporter 1, member of a family of cyclic nucleotide gated channels. The mRNA is cell-to-cell mobile. |
AT2G46440 | Member of Cyclic nucleotide gated channel family. Positive regulator of resistance against avirulent fungal pathogen. The mRNA is cell-to-cell mobile. |
AT4G30360 | member of Cyclic nucleotide gated channel family |
AT2G23980 | Encodes a cyclic GMP-activated non-selective cation channel in the plasma membrane of guard cells. Required for constitutive growth of root hairs as Ca2+-permeable channels. |
AT1G17330 | cGMP-activated phosphodiesterase responsible for UVA induced decrease in cGMP. |
AT1G44110 | Cyclin A1;(source:Araport11) |
AT1G15570 | A2-type cyclin. Negatively regulates endocycles and acts as a key regulator of ploidy levels in Arabidopsis endoreduplication. Interacts physically with CDKA;1. Expressed preferentially in trichomes and young developing tissues. |
AT1G70210 | Encodes a D-type cyclin that physically interacts with CDC2A. Its expression is upregulated early during germination. |
AT2G22490 | encodes a D-type cyclin whose transcription level is regulated by sucrose but not phytohormones or nitrate. Protein physically interacts with CDC2A. CycD2 kinase activity is regulated by sequestration of CycD2 protein in a form inaccessible to immunoprecipitation and probably not complexed to CDC2A. |
AT4G34160 | encodes a cyclin D-type protein involved in the switch from cell proliferation to the final stages of differentiation. The gene is transcriptionally regulated by cytokinin and brassinosteroid. Protein interacts with cyclin-dependent kinase inhibitor ICK1. |
AT3G50070 | Encode CYCD3;3, a CYCD3 D-type cyclin. Important for determining cell number in developing lateral organs. Mediating cytokinin effects in apical growth and development. |
AT5G65420 | Encodes a D-type cyclin CYCD4;1 that physically interacts with CDC2A and is expressed during vascular tissue development, embryogenesis, and formation of lateral root primordia. Its expression is upregulated early during germination.Involved in stomatal cell lineage proliferation in the hypocotyl. |
AT5G10440 | Encodes a cyclin involved in cell proliferation during stomatal cell lineage development. |
AT4G03270 | Cyclin D6, involved in cortex/endodermis asymmetric stem cell division. |
AT2G45080 | cyclin p3;(source:Araport11) |
AT1G27630 | cyclin T 1;(source:Araport11) |
AT2G38620 | Encodes a member of a plant specific family of cyclin dependent kinases. |
AT1G69570 | CDF5 is a circadian regulated transcript that is antiphasic with respect to its natural antisense transcript (NAT) FLORE (AT1G69572).CDF5 transcript accumulation delays flowering. CDF5 links circadian oscillation and photoperiodism. |
AT2G07050 | Involved in the biosynthesis of brassinosteroids. Catalyzes the reaction from epoxysqualene to cycloartenol. |
AT4G33060 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT3G44600 | Cyclophilin71 is a WD40 domain cyclophilin, which functions in gene repression, organogenesis and meristem development. CYP71 physically interacts with histone H3. |
AT4G34960 | Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein;(source:Araport11) |
AT5G64660 | CYS, MET, PRO, and GLY protein 2;(source:Araport11) |
AT4G11320 | Papain family cysteine protease;(source:Araport11) |
AT4G36880 | cysteine proteinase1;(source:Araport11) |
AT4G23180 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) The mRNA is cell-to-cell mobile. |
AT4G23190 | Encodes putative receptor-like protein kinase that is induced by the soil-borne vascular bacteria, Ralstonia solanacearum. Naming convention from Chen et al 2003 (PMID 14756307) |
AT4G23210 | Encodes a Cysteine-rich receptor-like kinase (CRK13). Overexpression of CRK13 leads to hypersensitive response cell death, and induces defense against pathogens by causing increased accumulation of salicylic acid. |
AT4G23220 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23230 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23260 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23310 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23320 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G05200 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G38830 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G21230 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G21400 | Encodes a cysteine-rich receptor-like protein kinase. |
AT1G70530 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11470 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G11530 | Encodes a cysteine-rich receptor-like protein kinase. The mRNA is cell-to-cell mobile. |
AT4G04490 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G04510 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G00970 | Encodes a cysteine-rich receptor-like protein kinase. |
AT4G23130 | Encodes a receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
AT4G23140 | Arabidopsis thaliana receptor-like protein kinase. Naming convention from Chen et al 2003 (PMID 14756307) |
AT1G70520 | Encodes a cysteine-rich receptor-like protein kinase located to the plasma membrane. Involved in regulating microbe-associated molecular pattern-triggered ROS production and stress induced callose deposition at the plasmodesmata in roots. Required for MAMP-triggered responses and resistance to Pseudomonas syringae pv. tomato 118 DC3000 . |
AT4G22340 | cytidinediphosphate diacylglycerol synthase 2;(source:Araport11) |
AT2G46650 | member of Cytochromes b5 The mRNA is cell-to-cell mobile. |
AT5G53560 | Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase. |
AT1G60660 | member of Cytochromes b5 |
AT1G02410 | Encodes a member of the cytochrome c oxidase 11 protein family. It is an integral mitochondrial protein and likely plays an important role as a mitochondrial chaperone in COX complex assembly, affecting plant growth and pollen germination. |
AT1G69750 | cytochrome c oxidase 19-2;(source:Araport11) |
AT1G22450 | subunit 6b of cytochrome c oxidase |
AT2G35030 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT2G17330 | putative obtusifoliol 14-alpha demethylase. Expressed pseudogene. |
AT1G17060 | Encodes a protein with similarity to other cytochrome P450's and is a homolog of BAS1. Over expression causes a dwarf phenotype resembling brassinolide resistant mutants. Double mutant analysis of sob7/bas1 loss of function mutants suggests these genes have redundant functions in light responsiveness. SOB7 may function in metabolizing brassinolides. Expressed in leaf, root, stem and silique but expression highest in flower and cauline leaves. Dominant overexpressing plants have dwarf phenotype, short siliques/seeds, rounded dark green leaves and short hypocotyls in light and dark. Loss of function alleles result in plants with long hypocotyls. |
AT3G61880 | Encodes a cytochrome p450 monooxygenase. Overexpression of this gene allows fruit growth independently of fertilization. The gene is normally expressed only in floral organs(during the Arabidopsis stage 14 flower) and in the funiculus at anthesis. |
AT5G04330 | Cytochrome P450 superfamily protein;(source:Araport11) |
AT4G15310 | a member of the cytochrome P450 gene family. molecular function unknown. |
AT4G15398 | cytochrome P450 pseudogene |
AT2G45510 | member of CYP704A |
AT5G42580 | a member of the cytochrome P450 family |
AT2G14100 | a member of the cytochrome P450 family |
AT3G20080 | cytochrome P450, family 705, subfamily A, polypeptide 15;(source:Araport11) |
AT3G20090 | cytochrome P450, family 705, subfamily A, polypeptide 18;(source:Araport11) |
AT4G15350 | member of CYP705A |
AT3G20110 | member of CYP705A |
AT3G20120 | cytochrome P450, family 705, subfamily A, polypeptide 21;(source:Araport11) |
AT3G20130 | Encodes a member of the CYP705A family of cytochrome P450 enzymes. Mutants show altered gravitropic responses. |
AT1G28430 | member of CYP705A |
AT1G50560 | member of CYP705A |
AT1G50520 | member of CYP705A The mRNA is cell-to-cell mobile. |
AT3G20935 | cytochrome P450, family 705, subfamily A, polypeptide 28;(source:Araport11) |
AT3G20960 | cytochrome P450, family 705, subfamily A, polypeptide 33;(source:Araport11) |
AT4G15380 | member of CYP705A |
AT5G47990 | Encodes an endomembrane system-expressed member of the CYP705A family of cytochrome P450 enzymes. It appears to catalyze the addition of a double bond to thalian-diol at carbon 15. Reduced levels of THAD expression lead to a build up of thalian-diol in root extracts. thad1-1 mutants also have longer roots than wild type seedlings and show altered gravitropic responses. |
AT2G05180 | member of CYP705A |
AT2G27000 | member of CYP705A |
AT2G27010 | member of CYP705A |
AT4G12300 | member of CYP706A |
AT4G12330 | member of CYP706A |
AT4G19230 | Encodes a protein with ABA 8'-hydroxylase activity, involved in ABA catabolism. Member of the CYP707A gene family. CYP707A1 appears to play an important role in determining the ABA levels in dry seeds. Gene involved in postgermination growth. Overexpression of CYP707A1 leads to a decrease in ABA levels and a reduction in after-ripening period to break dormancy. |
AT5G45340 | Encodes a protein with ABA 8'-hydroxylase activity; involved in ABA catabolism. Mutant analyses show that disruption in the gene results in more drought tolerance whereas overexpression results in increased transpiration rate and reduced drought tolerance. Gene involved in postgermination growth. Plant P450 CYP707A3, ABA 8'-hydroxylase, binds enantioselectively (+)-ABA but not (-)-ABA, whereas the enzyme binds both enantiomers of AHI1 (a structural ABA analogue used as ABA 8'-hydroxylase competitive inhibitor). |
AT1G55940 | cytochrome P450 family protein;(source:Araport11) |
AT5G48000 | Encodes a member of the CYP708A family of cytochrome P450 enzymes. THAH appears to add a hydroxyl group to the triterpene thalianol. thah1 mutants have an elevated accumulation of thalianol. thah1-1 mutants have longer roots than wild type plants. Thalian-diol and desaturated thalian-diol are lost from the root extracts of thah1-1 mutants. Overexpression of the sequence from At5g48000.1 rescues the thah1-1 mutant phenotype (Field 2008); it is unknown whether the shorter sequences associated with other gene models would provide functional complementation. |
AT2G46960 | member of CYP709B |
AT1G13110 | member of CYP71B The mRNA is cell-to-cell mobile. |
AT2G30750 | Putative cytochrome P450; together with CYP71A13 produces dihydrocamalexic acid (DHCA), the precursor to the defense-related compound camalexin, which accumulates in the intercellular space and contributes to the resistance of mature Arabidopsis to P. syringae without directly inhibiting bacterial growth. |
AT5G24960 | putative cytochrome P450 |
AT4G13290 | putative cytochrome P450 |
AT3G26170 | putative cytochrome P450 |
AT1G13080 | cytochrome P450 monooxygenase |
AT3G26190 | putative cytochrome P450 |
AT3G26200 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G26210 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT3G26230 | putative cytochrome P450 |
AT1G13070 | putative cytochrome P450 |
AT3G26220 | cytochrome P450 monooxygenase |
AT3G26300 | putative cytochrome P450 |
AT3G26320 | putative cytochrome P450 |
AT5G35715 | encodes a protein with cytochrome P450 domain |
AT2G28850 | member of CYP710A |
AT5G24900 | Member of CYP714A. Encodes one of the two tandemly duplicated gene pair ELA1 (CYP714A1) and ELA2 (CYP714A2), homologs of the rice cytochrome P450 monooxygenase gene EUI1. Double mutation of ELA1 and ELA2 results in increased biomass and enlarged organs. |
AT2G42850 | cytochrome P450, family 718;(source:Araport11) |
AT3G14680 | putative cytochrome P450 |
AT3G14610 | putative cytochrome P450 |
AT3G14620 | putative cytochrome P450 The mRNA is cell-to-cell mobile. |
AT1G75130 | member of CYP721A |
AT1G19630 | cytochrome P450, family 722, subfamily A, polypeptide 1;(source:Araport11) |
AT5G38450 | cytochrome P450, family 735, subfamily A, polypeptide 1;(source:Araport11) |
AT1G67110 | cytochrome P450, family 735, subfamily A, polypeptide 2;(source:Araport11) |
AT2G45580 | cytochrome P450, family 76, subfamily C, polypeptide 3;(source:Araport11) |
AT2G45550 | Member of CYP76C family of cytochrome P450 enzymes.Has geraniol 9- or 8-hydroxylase activity. |
AT1G13710 | Encodes the cytochrome P450 CYP78A5 monooxygenase. Contributes to the generation of a growth-stimulating signal distinct from the classical phytohormones that prevents proliferation arrest, promoting organ growth. In ovules it is required for megagametogenesis, maternal control of seed size and restricting megaspore mother cell fate to a single cell. |
AT1G01190 | cytochrome P450, family 78, subfamily A, polypeptide 8;(source:Araport11) |
AT4G39950 | Belongs to cytochrome P450 and is involved in tryptophan metabolism. Converts Trp to indo-3-acetaldoxime (IAOx), a precursor to IAA and indole glucosinolates. The mRNA is cell-to-cell mobile. |
AT5G36220 | member of CYP81D family of cytochrome p450s. This gene was originally called CYP91A1, but was later renamed to CYP81D1. |
AT4G37340 | member of CYP81D |
AT2G23190 | member of CYP81D |
AT4G37400 | member of CYP81F |
AT5G10610 | member of CYP81K The mRNA is cell-to-cell mobile. |
AT5G10600 | member of CYP81K |
AT4G31970 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. CYP82C2 acts as a hydroxylase on indole-3-carbonyl nitrile to generate 4-OH-ICN. |
AT4G31950 | member of CYP82C |
AT4G31940 | The gene encodes a cytochrome P450 enzyme, CYP82C. It is involved in the early Fe deficiency response.CYP82C4 hydroxylates fraxetin to generate sideretin (5-hydroxyfraxetin). Fraxetin and sideretin are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.The mRNA is cell-to-cell mobile. |
AT2G25160 | cytochrome P450, family 82, subfamily F, polypeptide 1;(source:Araport11) |
AT4G13770 | Encodes a cytochrome p450 enzyme that catalyzes the initial conversion of aldoximes to thiohydroximates in the synthesis of glucosinolates not derived from tryptophan. Also has a role in auxin homeostasis. |
AT4G31500 | Encodes an oxime-metabolizing enzyme in the biosynthetic pathway of glucosinolates. Is required for phytochrome signal transduction in red light. Mutation confers auxin overproduction. |
AT5G58860 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly only in root tissue. |
AT4G00360 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems. |
AT1G01600 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed significantly at highest level in mature stems and flowers. |
AT1G63710 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at highest level in mature stems and flowers. |
AT2G45970 | Encodes a member of the CYP86A subfamily of cytochrome p450 genes. Expressed at moderate levels in flowers, leaves, roots and stems.Mutant seeds have reduced seed longevity, higher tetrazolium salt uptake and reduction, and reduced lipid polyester barriers (PMID:32519347). |
AT1G24540 | member of CYP86C |
AT1G64900 | Encodes cytochrome P450 (CYP89A2). The mRNA is cell-to-cell mobile. |
AT5G63450 | AtWRKY33 regulates root apoplastic barrier formation by controlling AtCYP94B1 leading to increased salt tolerance of Arabidopsis plants. Regulation by WRKY33 to control apoplastic barrier formation in roots to confer salt tolerance. |
AT3G01900 | member of CYP94B |
AT2G23180 | member of CYP96A |
AT5G02900 | member of CYP96A |
AT1G65340 | member of CYP96A |
AT5G52320 | cytochrome P450, family 96, subfamily A, polypeptide 4;(source:Araport11) |
AT2G40890 | encodes coumarate 3-hydroxylase (C3H), a P450-dependent monooxygenase. Involved in lignin biosynthesis and flavonoid biosynthesis. Also affects the biosynthesis of coumarins such as scopoletin and scopolin as a branching-out-pathway from the phenylpropanoid acid level. |
AT2G39770 | Encodes a GDP-mannose pyrophosphorylase/ mannose-1-pyrophosphatase. This enzyme provides GDP-mannose, which is used for cell wall carbohydrate biosynthesis and protein glycosylation as well as for ascorbate (vitamin C) biosynthesis. Mutations in this gene confer hypersensitivity to NH4+. |
AT2G19500 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
AT4G29740 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. |
AT5G21482 | This gene used to be called AtCKX5. It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins. Enzyme assays show preference for N6 -(2-isopentenyl)adenine 9-glucoside substrate. |
AT2G41510 | It encodes a protein whose sequence is similar to cytokinin oxidase/dehydrogenase, which catalyzes the degradation of cytokinins.Acts on zeatin 9-riboside-50-triphosphate substrate. |
AT4G11140 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT3G25890 | encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. The mRNA is cell-to-cell mobile. |
AT5G53290 | encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT4G27950 | Encodes a member of the ERF (ethylene response factor) subfamily B-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. CRF proteins relocalize to the nucleus in response to cytokinin. |
AT2G46310 | CRF5 encodes one of the six cytokinin response factors. It is transcriptionally upregulated in response to cytokinin. CRF5 belongs to the AP2/ERF superfamily of the transcriptional factors. CRF proteins rapidly relocalize to the nucleus in response to cytokinin. Analysis of loos-of-function mutants revealed that the CRFs function redundantly to regulate the development of embryos, cotyledons and leaves. |
AT2G43230 | Member of cytosolic ABA receptor kinases; interacts with ABA receptors RCAR11-14. Positively regulates germination, seedling architecture and root growth in response to ABA. |
AT1G35580 | CINV1 / A/N-InvG is an alkaline/neutral invertase that breaks sucrose down into fructose and glucose (GH100). The exact localization of CINV1 remains under investigation but there is evidence that fluorescently-tagged CINV1 localizes to the cytoplasm. atinvg mutants have reduced root growth, reduced invertase activity, and increased expression of antioxidant genes under basal conditions. The levels of CINV1 / A/N-InvG transcripts rise in response to a hydrogen peroxide treatment. The protein has been shown to interact with PIP5K9. |
AT4G09510 | CINV2 appears to function as a neutral invertase based on the phenotype of a cinv1(AT1G35580)/cinv2 double mutant. It is predicted to be a cytosolic enzyme. CINV1, CINV2, and possibly other cytosolic invertases may play an important role in supplying carbon from sucrose to non-photosynthetic tissues. |
AT1G04270 | Encodes cytosolic ribosomal protein S15. |
AT4G36400 | Encodes a (D)-2-hydroxyglutarate dehydrogenase. |
AT3G17090 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G12620 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G55050 | Protein phosphatase 2C family protein;(source:Araport11) |
AT3G51370 | Protein phosphatase 2C family protein;(source:Araport11) |
AT4G39800 | ** Referred to as MIPS2 in Mitsuhashi et al 2008. myo-inositol-1-phosphate synthase isoform 1.Expressed in leaf, root and silique. Immunolocalization experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT3G24420 | DLK2 is a divergent member of the DWARF14 family. It's expression is dependent on D14 and KAI2 but it does not appear to play a role in stringolactone metabolism. |
AT1G19270 | Encodes a ubiquitin-activated peptidase that is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. Together with CUC2/CUC3-UBP15 part of a regulatory module which controls the initiation of axillary meristems, thereby determining plant architecture. |
AT1G78420 | Activates the latent peptidases DA1, DAR1 and DAR2 by mono-ubiquitination at multiple sites. Subsequently, these activated peptidases destabilize various positive regulators of growth. |
AT4G36860 | DAR1 is a member of a small (7 member) ubiquitin binding protein family. It appears to play a role in regulation of endoreduplication in leaf epidermal tissue. |
AT5G17890 | Encodes a protein that appears to be involved in defense responses. Contains TIR, NB-LRR and LIM domains. A gain of function allele exhibits cold dependent phenotypes including apparent activation of defense responses and an increased freezing tolerance. The mRNA is cell-to-cell mobile. |
AT5G66620 | DA1-related protein 6;(source:Araport11) |
AT1G30370 | Encodes a mitochondria-localized class III phospholipase A1 that plays a role in seed viability. |
AT4G18550 | DSEL is cytosolic acylhydrolase that shows prefential lipase activity against the sn-1 position of several classes of lipids, including 1,3-diacylglycerols and 1-monoacylglycerols. Overexpression of DSEL leads to increased peroxisome and oil body levels in cotyledons and reduced beta-oxidation activity in seedlings. |
AT4G05420 | Structurally similar to damaged DNA binding proteins. DDB1a is part of a 350 KDa nuclear localized DET1 protein complex. This complex may physically interact with histone tails and while bound to chromatin- repress transcription of genes involved in photomorphogenesis. DDB1a is shown to be RUB-modified. |
AT3G60140 | Encodes a protein similar to beta-glucosidase and is a member of glycoside hydrolase family 1. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. The mRNA is cell-to-cell mobile. |
AT1G67070 | Encodes a protein with phosphomannose isomerase activity that is involved in synthesis of ascorbic acid. Expression is induced after 24 hours of dark treatment, in senescing leaves and treatment with exogenous photosynthesis inhibitor. Induction of gene expression was suppressed in excised leaves supplied with sugar. The authors suggest that the gene's expression pattern is responding to the level of sugar in the cell. |
AT4G31160 | Encodes a DCAF/DWD protein capable of interacting with DDB1 and associating with CUL4, likely as part of a nuclear ubiquitin ligase complex. DCAF1 appears to be required for plant embryogenesis and to affect several other developmental processes including leaf, shoot, and flower development. |
AT2G38050 | Similar to mammalian steroid-5-alpha-reductase. Involved in the brassinolide biosynthetic pathway. |
AT1G12840 | Encodes subunit C of the vacuolar H(+)-ATPase (V-ATPase). Bound and phosphorylated by AtWNK8. The mRNA is cell-to-cell mobile. |
AT1G03310 | Encodes a protein with strong similarity to isoamylase (EC:3.2.1.68) however lacks critical residues known to be important for activity. Appears to co localize with ISA1 in the chloroplast isoamylase complex. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. It has been postulated that AtISA2 interacts with AtISA1 to form the Iso1 complex. |
AT5G13570 | Encodes DCP2 with mRNA decapping activity. DCP2 forms a mRNA decapping complex with DCP1 (At1g08370) and VCS (VARICOSE) (At3g13300). Recombinant DCP2 is enzymatically active in vitro, generating from capped mRNAs m7GDP, and 5?-phosphorylated mRNAs. DCP1, DCP2 and VCS colocalize in cytoplasmic loci, which are putative Arabidopsis mRNA processing bodies. Null mutants of DCP1, DCP2, and VCS accumulate capped mRNAs with a reduced degradation rate. These mutants also share a similar lethal phenotype at the seedling cotyledon stage, with disorganized veins, swollen root hairs, and altered epidermal cell morphology. The protein was shown by immunoprecipitation not to interact with DCP1. |
AT1G26110 | Encodes Decapping 5, required for mRNA decapping, P-body formation and translational repression during postembryonic development. |
AT1G17400 | Protein of unknown function. Similar to LAZY1, a gene required or gravitropic response in shoots and roots. Involved in determining lateral root branch angle. |
AT4G33400 | Together with DEM2 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
AT3G19240 | Together with DEM1 plays an essential role in cell division in plants, most likely through an interaction with RAN1. |
AT3G09090 | Encodes DEX1 (defective in exine formation). Required for exine pattern formation during pollen development. |
AT2G16390 | Putative chromatin remodeling protein, member of a plant-specific subfamily of SWI2/SNF2-like proteins. Mutations nearly eliminate non-CpG methylation at a target promoter but do not affect rDNA or centromere methylation. Cooperates with PolIVb to facilitate RNA-directed de novo methylation and silencing of homologous DNA. Endogenous targets include intergenic regions near retrotransposon LTRs or short RNA encoding sequences that might epigenetically regulate adjacent genes. May be used to establish a basal yet reversible level of silencing in euchromatin. |
AT1G55350 | Similar to maize DEK1, a gene encoding a membrane protein of the calpain gene superfamily required for aleurone cell development in the endosperm of maize grains. A key component of the embryonic L1 cell-layer specification pathway. It localizes to membranes and undergoes intramolecular autolytic cleavage events that release the calpain domain into the cytoplasm. |
AT4G11393 | Encodes a defensin-like (DEFL) family protein. |
AT3G16550 | Encodes a putative DegP protease. |
AT3G03380 | Encodes a putative DegP protease. The mRNA is cell-to-cell mobile. |
AT5G39830 | Encodes DEG8. Forms a hexamer with DEG5 in the thylakoid lumen. Involved in the cleavage of photodamaged D2 protein of photosystem II (PSII). Recombinant DEG8 is proteolytically active toward both a model substrate (beta-casein) and photodamaged D1 protein of photosystem II. |
AT5G45380 | urea-proton symporter DEGRADATION OF UREA 3 (DUR3);(source:Araport11) |
AT1G21910 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 15 members in this subfamily including RAP2.1, RAP2.9 and RAP2.10. |
AT1G54410 | Encodes a KS-type dehydrin can reduce the formation of reactive oxygen species (ROS) from Cu. |
AT2G21490 | dehydrin LEA;(source:Araport11) |
AT1G64750 | Involved in the maintenance of genome integrity through homologous recombination. This function of DSS1 is performed through its interaction with the BRCA2 protein. |
AT3G55610 | encodes delta 1-pyrroline-5-carboxylate synthetase B. Gene expression is induced by dehydration, high salt and ABA. Knock-out mutations in P5CS2 are embryo-lethal. P5CS2 appears to be present in different cells and/or different subcellular locations from P5CS1 in a tissue-dependent manner. Mutants are defective in pollen development. |
AT1G48760 | Encodes the putative delta subunit of the AP(adaptor protein)-3 complex and plays a role in vacuolar function. |
AT2G39800 | encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. encodes a delta1-pyrroline-5-carboxylate synthase that catalyzes the rate-limiting enzyme in the biosynthesis of proline. Gene is expressed in reproductive organs and tissues under non-stress conditions but in the whole plant under water-limiting condition. Expression is also induced by abscisic acid and salt stress in a light-dependent manner. P5CS1 appears to be involved in salt stress responses related to proline accumulation, including protection from reactive oxidative species. P5CS1 appears to be present in different cells and/or different subcellular locations from P5CS2 in a tissue-dependent manner. |
AT5G04560 | Encodes a DNA glycosylase DEMETER (DME). Responsible for endosperm maternal-allele-specific hypomethylation at the MEDEA (MEA) gene. DME can excise 5-methylcytosine in vitro and when expressed in E. coli. DME establishes MEA imprinting by removing 5-methylcytosine to activate the maternal allele. |
AT3G10010 | Encodes a protein with DNA glycosylase activity that is involved in maintaining methylation marks. |
AT1G11500 | DUF1218 family member. |
AT3G23550 | MATE efflux family protein;(source:Araport11) |
AT5G52050 | MATE efflux family protein;(source:Araport11) |
AT5G06250 | Transcription repressor involved in regulation of inflorescence architecture. |
AT5G12290 | Encodes a mitochondrial outer membrane protein that is found in a complex with MIC60, TOM40, RISP and TOM20. Involved in galactoglycerolipid biosynthesis/lipid homeostasis. The dgd1 mutant phenotype is suppressed in the dgs1 mutant background. |
AT3G51520 | Encodes a functional acyl-CoA:diacylglycerol acyltransferase with different acyl-CoA substrate preferences and shows higher DAG to TAG conversion rate than AtDGAT1. It increases both C18:2 and C18:3 polyunsaturated fatty acids at the expense of C16:0. |
AT1G48300 | Cytosolic iron-sulfur protein with a [2Fe-2S] cluster which synthesizes triacylglycerol (DGAT activity). |
AT5G63770 | a member of the diacylglycerol kinase gene family. Encodes a functional diacylglycerol kinase. Involved in root elongation and plant development. Gene expression is induced by wounding or cold. |
AT4G24570 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). The mRNA is cell-to-cell mobile. |
AT5G64290 | dicarboxylate transport 2.1;(source:Araport11) |
AT3G03300 | Encodes a Dicer-like protein that functions in the antiviral silencing response in turnip-crinkle virus-infected plants but not in TMV or CMV-strain-Y-infected plants. Involved in the production of ta-siRNAs. Partially antagonizes the production of miRNAs by DCL1. Substitutes for DCL4 to produce viral siRNA when DCL4 is missing or inhibited. Able to produce siRNAs but not miRNAs. |
AT3G43920 | Encodes a ribonuclease III family protein that is required for endogenous RDR2-dependent siRNA (but not miRNA) formation. |
AT4G34570 | Encodes a bifunctional dihydrofolate reductase - thymidylate synthase gene. This is unique in Arabidopsis and protozoa. Other organisms have independent genes for this function. |
AT1G27980 | Encodes an ER-localized sphingoid long-chain base-1-phosphate lyase involved in the dehydration stress response. |
AT1G51360 | Involved in defense against fungal pathogens and located in cytosol. |
AT4G23690 | Encodes a homodimeric all-beta dirigent protein in the superfamily of calycins. Dirigent proteins impart stereoselectivity on the phenoxy radical coupling reaction yielding optically active lignans from two molecules of coniferyl alcohol. |
AT5G04760 | R-R-type MYB protein which plays negative roles in salt stress and is required for ABA signaling in Arabidopsis. |
AT4G38000 | DNA binding with one finger 4.7;(source:Araport11) |
AT5G04130 | Encodes a protein that when expressed together with GYRA generates an active supercoiling DNA gyrase enzyme that shares similar properties to its bacterial counterpart, including sensitivity to gyrase-specific antibiotics. |
AT3G17830 | Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
AT1G80030 | Molecular chaperone Hsp40/DnaJ family protein;(source:Araport11) |
AT3G13310 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT1G08130 | Encodes the Arabidopsis DNA ligase 1 that provides the major DNA ligase activity in cells and plays a key role in both DNA replication and excision repair pathways. In addition, it is an important component of the active DNA demethylation machinery and is indispensable for cell viability. AtLIG1 expresses one major and two minor mRNA transcripts differing only in the length of the 5' untranslated leader sequences preceding a common ORF. Translation from the first in-frame start codon produces an AtLIG1 isoform that is targeted exclusively to the mitochondria. Translation initiation from the second in-frame start codon produces an AtLIG1 isoform targeted only to the nucleus. |
AT1G66730 | Encodes a novel plant specific DNA ligase that is involved in seed germination and DNA repair. |
AT4G14140 | This gene is predicted to encode a DNA methyltransferase. A plant line expressing an RNAi construct directed against DMT2 has reduced agrobacterium-mediated tumor formation. |
AT1G67630 | DNA polymerase alpha 2;(source:Araport11) |
AT1G10520 | Encodes a homolog of the mammalian DNA polymerase lambda that is involved in the repair of UV-B induced DNA damage. |
AT5G55310 | Encodes one of two Arabidopsis type-I DNA topoisomerase I genes. Reducing the level of expression of this gene in a top1alpha (At5g55300) mutant background causes seedling lethality. |
AT4G21040 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
AT4G21080 | Dof-type zinc finger domain-containing protein;(source:Araport11) |
AT3G13235 | ubiquitin family protein;(source:Araport11) |
AT1G51700 | Encodes dof zinc finger protein (adof1). The mRNA is cell-to-cell mobile. |
AT3G21270 | Encodes Dof zinc finger protein adof2. |
AT3G19800 | Encodes the DUF177B version of the two DUF177 proteins in Arabidopsis. This version differs from DUF177A in containing a 23 aa insertion compared to the DUF177A sequence. |
AT2G46840 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. Loss of function mutant has a WT phenotype. Overexpression increases plant organ size, possibly by influencing the expression of the cell wall formation and auxin transporter genes that regulate cell size. |
AT2G47230 | Member of the plant-specific DUF724 protein family. Arabidopsis has 10 DUF724 proteins. |
AT3G62300 | Encodes a protein with Agenet/Tudor and DUF724 domains. It can interact with ABAP1, a negative regulator of DNA replication and transcription, with the plant histone modification 'reader' LHP1, and with non-modified histones. It may act as a link between DNA replication, transcription and chromatin remodeling during flower development. Loss of function mutant has a WT phenotype. |
AT5G14620 | A putative DNA methyltransferase with rearranged catalytic domains; similar to mammalian DNMT3 methyltransferases; contains UBA domains. The 3'-end proximal part of the gene coding region is highly methylated at both adenine and cytosine residues. |
AT3G17310 | Encodes DRM3 (Domains Rearranged Methyltransferase3), a catalytically mutated paralog of the cytosine methyltransferase DRM2. Despite being catalytically mutated, DRM3 is required for normal maintenance of non-CG DNA methylation, establishment of RNA-directed DNA methylation triggered by repeat sequences and accumulation of repeat-associated small RNAs. |
AT4G12010 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. Co-regulates with WRKY19 basal levels of immunity to root-knot nematodes. |
AT5G18370 | Leucine-rich repeat domain (NLR) receptor. Dominant negative alleles suppress catma3 autoimmunity. |
AT2G36800 | Encodes a DON-Glucosyltransferase. The UGT73C5 glucosylates both brassinolide and castasterone in the 23-O position. The enzyme is presumably involved in the homeostasis of those steroid hormones hence regulating BR activity. Transgenic plants overexpressing UGT73C5 show a typical BR-deficient phenotype. |
AT1G05800 | Encodes a galactolipase. Located in the chloroplast. Involved in the initial step of jasmonic acid biosynthesis. Expressed in vegetative tissues and is necessary for the biosynthesis of basal-level JAs in vegetative tissues. |
AT4G25670 | stress response NST1-like protein;(source:Araport11) |
AT4G22470 | Encodes a hybrid proline-rich protein that contains two tandem PRD-8CMs (proline-rich domain-eight cysteine motif) that is involved in systemic acquired resistance. |
AT1G45190 | downregulated in DIF1 18;(source:Araport11) |
AT2G45830 | downstream target of AGL15 2;(source:Araport11) |
AT5G24530 | Encodes a putative 2OG-Fe(II) oxygenase that is defense-associated but required for susceptibility to downy mildew. The mRNA is cell-to-cell mobile. |
AT3G48160 | E2F-like protein, an inhibitor of the endocycle, preserves the mitotic state of proliferating cells by suppressing transcription of genes that are required for cells to enter the DNA endoreduplication cycle. |
AT3G01330 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. |
AT1G59660 | Encodes a protein with similarity to mammalian nucleoporin Nup98.Its expression is upregulated in mutants that are NUP deficient. Nucleoportin which redundantly inhibits flowering together with Nup98a through multiple pathways including clock, photoperiod, and age pathways. Gates flowering in a CONSTANS (CO)-independent mode and bypasses the CO checkpoint in photoperiodic signaling and integrated signals from multiple pathways to directly target FLOWERING LOCUS T (FT) for flowering control. |
AT1G06770 | Encodes a C3HC4 RING-domain-containing ubiquitin E3 ligase capable of interacting with DREB2A. The DRIP1-GFP fusion protein is nuclear-localized. DRIP1 seems to be involved in regulating stress-related transcriptional changes and drought tolerance. |
AT5G17460 | glutamyl-tRNA (Gln) amidotransferase subunit C;(source:Araport11) |
AT1G73330 | encodes a plant-specific protease inhibitor-like protein whose transcript level in root disappears in response to progressive drought stress. The decrease in transcript level is independent from abscisic acid level. |
AT5G55970 | Drought-induced gene encoding an ER-localized RING-type E3 Ub ligase. |
AT5G41070 | Encodes a double-stranded RNA binding protein. |
AT3G23610 | Encodes a dual specificity protein phosphatase whose activity is modulated by CaM binding. |
AT5G03390 | hypothetical protein (DUF295);(source:Araport11) |
AT5G46130 | hypothetical protein (DUF295);(source:Araport11) |
AT5G46140 | hypothetical protein (DUF295);(source:Araport11) |
AT5G55440 | F-box protein, putative (DUF295);(source:Araport11) |
AT1G05550 | DUF295 domain protein of unknown function. Expressed in ovule integuments and nucellus. |
AT5G55270 | hypothetical protein (DUF295);(source:Araport11) |
AT5G52940 | DUF295 domain protein. |
AT3G21550 | transmembrane protein, putative (DUF679 domain membrane protein 2);(source:Araport11) |
AT4G24310 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT3G02430 | transmembrane protein, putative (DUF679);(source:Araport11) |
AT3G62230 | Target promoter of the male germline-specific transcription factor DUO1. Increases seed oil content by attenuating GL2 inhibition. Overexpression results in reduced trichome numbers. |
AT4G35560 | Target promoter of the male germline-specific transcription factor DUO1. The mRNA is cell-to-cell mobile. |
AT3G19820 | Involved in the conversion of the early brassinosteroid precursor 24-methylenecholesterol to campesterol. Brassinosteroids affect cellular elongation. Mutants have dwarf phenotype. DWF1 is a Ca2+-dependent calmodulin-binding protein. |
AT3G50660 | Encodes a 22α hydroxylase whose reaction is a rate-limiting step in brassinosteroid biosynthetic pathway. The protein is a member of CYP90B gene family. CLM is an epi-allele with small, compressed rosette, reduced internode length, and reduced fertility, appears in selfed ddm mutant plants possibly due to loss of cytosine methylation. Transcripts accumulate in actively growing tissues, and GUS expression is negatively regulated by brassinosteroids. Localized in the endoplasmic reticulum. The in vitro expressed protein can perform the C-22 hydroxylation of a variety of C27-, C28- and C29-sterols. Cholesterol was the best substrate, followed by campesterol. Sitosterol was a poor substrate. |
AT5G54510 | Encodes an IAA-amido synthase that conjugates Ala, Asp, Phe, and Trp to auxin. Lines overexpressing this gene accumulate IAA-ASP and are hypersensitive to several auxins. Identified as a dominant mutation that displays shorter hypocotyls in light grown plants when compared to wild type siblings. Protein is similar to auxin inducible gene from pea (GH3). |
AT4G03400 | Encodes a GH3-related gene involved in red light-specific hypocotyl elongation. Analysis of sense and antisense transgenic plants suggests that DFL2 is located downstream of red light signal transduction and determines the degree of hypocotyl elongation. |
AT1G03055 | Encodes the ortholog of rice D27. It is plastid-localized and is required for the inhibition of secondary bud outgrowth and operates on a nonmobile precursor upstream of MAX1 in the SL biosynthesis pathway. |
AT2G14120 | Encodes a dynamin related protein. DRPs are self-assembling GTPasse involved in fission and fusion of membranes. DRP3B functions in mitochondrion and peroxisome fission in combination with DRP3A. |
AT1G14830 | Encodes a dynamin-like protein that is involved in mitochondrial morphogenesis and pollen development. Protein is localized as speckles in the cytoplasm, partially co-localizes with mitochondrial markers, cell plate of dividing cells, and the tip of root hairs, root cap cells, and expanding part of trichoblasts. |
AT5G42080 | Encodes a dynamin-like protein related to phragmoplastin. Mutations in this gene, in combination with mutation in ADL1E, result in defects in embryogenesis, cell plate formation and trichome branching. Also controls vascular patterning in combination with VAN3 and GNOM. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosis. |
AT2G15690 | Encodes an atypical PPR-DYW protein containing five predicted PPR domains and a C-terminal DYW domain separated by an amino acid sequence that do not clearly correspond to an E domain. It is expressed in both the mitochondrion and chloroplast and is also involved in RNA editing in the mitochondrion and chloroplast as a core member of E+-type PPR editosomes. |
AT3G05640 | EGR1 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress.EGR1 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT5G27930 | EGR2 functions as a negative regulator of plant growth with prominent effect on plant growth during drought stress. EGR2 regulates microtubule organization and likely affects additional cytoskeleton and trafficking processes along the plasma membrane. |
AT2G40550 | Encodes a nuclear localized target of E2Fa-DPa, transcription factors controlling cell cycle progression. Required for sister chromatid cohesion and DNA repair. |
AT2G36010 | Member of the E2F transcription factors, (cell cycle genes), key components of the cyclin D/retinoblastoma/E2F pathway. |
AT2G33850 | Stigmatic factor that plays a role during the early post-pollination stages. |
AT4G12480 | Encodes a putative lipid transfer protein, vernalization-responsive and cold-induced. It is involved in priming the SAR and ISR responses, specifically in propagating the cell-to-cell mobile signal. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. The kinases MPK3 (AT3G45640) and MPK6 (AT2G43790) promote the accumulation of AZI1/EARLI1 at plastids during defense priming induction. |
AT2G40080 | Encodes a novel nuclear 111 amino-acid phytochrome-regulated component of a negative feedback loop involving the circadian clock central oscillator components CCA1 and LHY. ELF4 is necessary for light-induced expression of both CCA1 and LHY, and conversely, CCA1 and LHY act negatively on light-induced ELF4 expression. ELF4 promotes clock accuracy and is required for sustained rhythms in the absence of daily light/dark cycles. It is involved in the phyB-mediated constant red light induced seedling de-etiolation process and may function to coregulate the expression of a subset of phyB-regulated genes. |
AT5G04240 | Early Flowering 6 (ELF6) encodes a Jumonji N/C and zinc finger domain-containing protein that acts as a repressor in the photoperiod pathway. ELF6 interacts with BES1 in a Y2H assay, in vitro, and in Arabidosis protoplasts (based on BiFC). ELF6 may play a role in brassinosteroid signaling by affecting histone methylation in the promoters of BR-responsive genes. |
AT5G19700 | Encodes a MATE transporter involved in leaf senescence and iron homeostasis. |
AT4G14690 | Encodes an early light-induced protein. ELIPs are thought not to be directly involved in the synthesis and assembly of specific photosynthetic complexes, but rather affect the biogenesis of all chlorophyll-binding complexes. A study (PMID 17553115) has shown that the chlorophyll synthesis pathway was downregulated as a result of constitutive ELIP2 expression, leading to decreased chlorophyll availability for the assembly of pigment-binding proteins for photosynthesis. |
AT2G25060 | early nodulin-like protein 14;(source:Araport11) |
AT3G01070 | early nodulin-like protein 16;(source:Araport11) |
AT5G15350 | early nodulin-like protein 17;(source:Araport11) |
AT1G08500 | early nodulin-like protein 18;(source:Araport11) |
AT1G17800 | early nodulin-like protein 22;(source:Araport11) |
AT1G48940 | early nodulin-like protein 6;(source:Araport11) |
AT3G30775 | Encodes a proline oxidase that is predicted to localize to the inner mitochondrial membrane, its mRNA expression induced by high levels of Al and by osmotic stress. The promoter contains an L-proline-inducible element. |
AT4G24510 | Encodes a component of the fatty acid elongation machinery required for C28 to C30 fatty acid elongation. It does not require the acyltransferase catalytic site for biological function. |
AT5G57800 | encodes a transmembrane protein with similarity to the sterol desaturase family at the N-terminus and to the short-chain dehydrogenase/reductase family at the C-terminus. Mutant analyses indicate this protein is involved in cuticle membrane and wax biosynthesis. The mRNA is cell-to-cell mobile. |
AT3G60500 | Encodes a 3'-5' exoribonuclease, positively regulates CER3 transcription, involved in cuticular wax biosynthesis. |
AT4G34100 | Encodes a putative E3 ubiquitin ligase that is involved in cuticular wax biosynthesis and regulates 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) activity. HMGR catalyzes the major rate-limiting step of the mevalonic acid (MVA) pathway from which sterols and other isoprenoids are synthesized. Lines carrying a recessive mutation in this locus have reduced chain-length distribution, weakly glaucous stem surface, and has reduced fertility in early flowers, non-spreading floret, downward cupped leaves, leaf waxes nearly pure C24 and C26 acid. |
AT3G55830 | A member of the Glycosyltransferase Family 64, homologous to Poplar cambium-expressed GT64 gene. The EPC1 protein plays a critical role during plant development in maintaining the integrity of organs via cell-cell adhesion, thereby providing mechanical strength and facilitating the movement of metabolites throughout the plant.Loss of function specifically affects glycosylinositolphosphorylceramide (GIPC) mannosylation. |
AT5G56780 | Encodes a transcriptional regulator that is required for the induction of dormancy during late seed development.ET2 contains DNA and Zinc binding domains and is involved in DNA methylation. ET2 may function in DNA repair. |
AT4G39340 | Encodes a small cysteine-rich protein that is secreted by the egg cell during gamete interactions. The regulated secretion of EC1 by the egg cell upon sperm-egg interaction is proposed to ensure the appropriate localization of the cell-fusion machinery in distinct sperm membrane domains to accomplish gamete fusion. |
AT1G54270 | member of eIF4A - eukaryotic initiation factor 4A |
AT4G24800 | MA3 domain-containing protein;(source:Araport11) |
AT3G18910 | EIN2 targeting protein2;(source:Araport11) |
AT1G50940 | Encodes the electron transfer flavoprotein ETF alpha, a putative subunit of the mitochondrial electron transfer flavoprotein complex (ETF beta is At5g43430.1) in Arabidopsis. Mutations of the ETF beta gene results in accelerated senescence and early death compared to wild-type during extended darkness. |
AT4G16355 | Produces a long non-coding RNA that enhances resistance against Pseudomonas syringe pv. tomato DC3000. It directly interacts with Mediator subunit 19a and enhances the expression of innate immune response genes, like PR1. |
AT2G29950 | Member of a small family of proteins containing DUF1313 domain. Involved in flowering time. |
AT1G72630 | ELF4-like 2;(source:Araport11) |
AT1G17455 | ELF4-like 4;(source:Araport11) |
AT5G64905 | elicitor peptide 3 precursor;(source:Araport11) |
AT2G22000 | elicitor peptide 6 precursor;(source:Araport11) |
AT5G09978 | elicitor peptide 7 precursor;(source:Araport11) |
AT1G75000 | ELO family protein. |
AT5G11260 | Basic leucine zipper (bZIP) transcription factor. Nuclear localization. Involved in light-regulated transcriptional activation of G-box-containing promoters. Negatively regulated by Cop1. Although cytokinins do not appear to affect the gene's promoter activity, they appear to stabilize the protein. HY5 plays a role in anthocyanin accumulation in far-red light and blue light, but not in red light or in the dark. Mutant studies showed that the gene product is involved in the positive regulation of the PHYA-mediated inhibition of hypocotyl elongation. Binds to G- and Z-boxes, and other ACEs, but not to E-box. Loss of function mutation shows ABA resistant seedling phenotypes suggesting involvement for HY5 in mediating ABA responses. Binds to the promoter of ABI5 and regulates its expression.Involved in the regulation of response to nutrient levels. |
AT2G45330 | RNA 2-phosphotransferase, Tpt1 / KptA family;(source:Araport11) |
AT4G23250 | cysteine-rich receptor-like protein kinase 17;(source:Araport11) |
AT1G56200 | Encodes a chloroplast localized protein that is essential for chloroplast development. |
AT2G26060 | Encodes a homolog of the yeast Cytosolic Iron-sulfur protein Assembly protein CIA1. |
AT5G49930 | zinc knuckle (CCHC-type) family protein;(source:Araport11) |
AT2G37920 | copper ion transmembrane transporter;(source:Araport11) |
AT3G54350 | Forkhead-associated (FHA) domain-containing protein;(source:Araport11) |
AT2G28880 | ADCS encodes a protein that has two functional domains. The N-terminal domain has glutamine amidotransferase activity while the C-terminal domain has aminodeoxychorismate synthase (ADCS) activity. These two domains act together to catalyze the transformation of chorismate to 4-amino-4-deoxychorismate. This reaction is required for 4-aminobenzoate (pABA) production and ultimately for folate biosynthesis. The putative target peptide of ADCS can direct GFP to the chloroplast. |
AT3G16290 | Strong interaction with TIC inner envelope protein translocon which consists of Tic20/Tic56/Tic100/Tic214(Ycf1)(DOI:10.1105/tpc.18.00357). |
AT1G02780 | Ribosomal protein L19e family protein;(source:Araport11) |
AT3G48470 | embryo defective 2423;(source:Araport11) |
AT2G41720 | Encodes a pentatricopeptide repeat protein that is essential for trans-splicing of a chloroplast small ribosomal subunit transcript. |
AT3G20440 | Encodes BE1, a putative glycoside hydrolase. Involved in organogenesis and somatic embryogenesis by regulating carbohydrate metabolism. Mutation in BE1 has pleotrophic effect on the whole plant development. |
AT3G12080 | Encodes a putative plastid-targeted GTP-binding protein that is essential for embryogenesis and chloroplast development. |
AT4G14590 | embryo defective 2739;(source:Araport11) |
AT5G39680 | Pentatricopeptide repeat (PPR) superfamily protein;(source:Araport11) |
AT5G63420 | Encodes a member of the metallo-beta-lactamase protein family that plays a vital role in embryo morphogenesis and apical-basal pattern formation by regulating chloroplast development. In bacteria, RNase J plays an important role in rRNA maturation and in the 5′ stability of mRNA. |
AT2G38770 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G45000 | Encodes a nucleoporin, a component of the nuclear pore complex, that appears to be a major negative regulator of auxin signalling. Loss of function mutants are embryo lethal. |
AT3G02660 | Tyrosyl-tRNA synthetase, class Ib, bacterial/mitochondrial;(source:Araport11) |
AT5G15540 | Encodes Adherin SCC2. Essential for viability. Required for normal seed development. Plays a role in the establishment of sister-chromatid cohesion and chromosome organization during meiosis. |
AT2G31060 | elongation factor family protein;(source:Araport11) |
AT2G32590 | condensin complex subunit;(source:Araport11) |
AT2G39080 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G03870 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT5G40480 | embryo defective 3012;(source:Araport11) |
AT2G36000 | Encodes an mTERF protein localized in the chloroplast stroma. |
AT3G14900 | hypothetical protein;(source:Araport11) |
AT4G00620 | Amino acid dehydrogenase family protein;(source:Araport11) |
AT5G14320 | Ribosomal protein S13/S18 family;(source:Araport11) |
AT5G51200 | Originally identified as EDS4, enhanced disease sensitive phenotype and subsequently cloned and identified as NUCLEOPORIN205. Affects circadian clock and downstream genes including those involved in defense response. |
AT2G30200 | Malonyl-ACP expressed in developing seeds. Loss of function mutants are embryo lethal and over expression in seeds leads to increased seed oil content. |
AT2G01860 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT1G01960 | Encodes one of the functionally redundant ARF guanine-nucleotide exchange factors (ARF-GEFs). Functions as regulators of post-Golgi trafficking. |
AT2G35950 | embryo sac development arrest 12;(source:Araport11) |
AT2G34920 | RING/U-box superfamily protein;(source:Araport11) |
AT4G13235 | Encodes a defensin-like (DEFL) family protein. |
AT1G70540 | Plant invertase/pectin methylesterase inhibitor superfamily protein;(source:Araport11) |
AT2G34860 | DnaJ-like zinc finger domain-containing protein which regulates the assembly of photosystem I (PSI) and seed development. |
AT3G10000 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G00140 | Calcium-binding EF-hand family protein;(source:Araport11) |
AT4G13890 | Pyridoxal phosphate (PLP)-dependent transferases superfamily protein;(source:Araport11) |
AT4G33050 | Encodes a calmodulin-binding protein involved in stomatal movement. |
AT4G37890 | Involved in shoot regenaration from root explants. |
AT3G23440 | embryo sac development arrest 6;(source:Araport11) |
AT4G00310 | Putative membrane lipoprotein;(source:Araport11) |
AT1G10745 | Encodes a Maternally expressed gene (MEG) family protein |
AT5G51430 | Encodes a protein that is homologous to Cog7, a subunit of the conserved oligomeric Golgi (COG) complex, which is required for the normal morphology and function of the Golgi apparatus. It is likely to be involved in transport or retention of Golgi-localized proteins and in maintenance of Golgi morphology. |
AT5G51230 | Polycomb group protein with zinc finger domain involved in negative regulation of reproductive development. Forms a complex with FIE, CLF, and MSI1. This complex modulates the expression of target genes including AG, PI and AP3. |
AT5G64360 | EIP9 interacts with EMF1 to regulate flowering. It functions partially redundantly with SDJ2 and SDJ3 and interacts with SUVH1 and SUVH3 to form a SUVH-SDJ complex. The complex binds promoters with DNA methylation and mediates transcriptional activation of promoter methylated genes. |
AT3G12140 | Agenet domain containing nucleosome binding protein. Binds H3K36 sites. |
AT5G62500 | Encodes a homolog of animal microtubule-end-binding protein. There are two other members of this family. EB1 forms foci at regions where the minus ends of microtubules are gathered during mitosis and early cytokinesis. |
AT1G32280 | Encodes a homolog of the barley endosperm-specific gene END1 with seed and pollen specific expression. |
AT5G05460 | Encodes a cytosolic beta-endo-N-acetyglucosaminidase (ENGase). ENGases N-glycans cleave the O-glycosidic linkage between the two GlcNAc residues of the N-glycan core structure and thus generate a protein with a single GlcNAc attached to asparagine. |
AT1G72280 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO1 is mainly present in the Ox1 redox state. |
AT2G38960 | Encodes an oxidoreductin required for oxidative protein folding in the ER and exists in two distinct oxidized isoforms (Ox1 and Ox2), which are determined by the formation or breakage of the putative regulatory disulfide. AtERO2 is mainly present in the Ox2 redox state. |
AT1G29330 | Encodes a protein similar in sequence to animal and yeast endoplasmic reticulum retention signal receptor. This protein can functionally complement the yeast homologue. Transcript is detected in flower buds, stems, root, and leaves. |
AT3G09030 | EAP3 is a cytolsolic BTB/POZ-domain protein involved in trafficking of PEN3. |
AT1G10130 | Encodes a golgi localized P2A-type Ca2+ ATPase involved in Mn nutrition and homeostasis. |
AT5G05190 | hypothetical protein (DUF3133);(source:Araport11) |
AT4G39030 | Encodes an orphan multidrug and toxin extrusion transporter. Essential component of salicylic acid-dependent signaling for disease resistance. Member of the MATE-transporter family. Expression induced by salicylic acid. Mutants are salicylic acid-deficient. |
AT1G74710 | Encodes a protein with isochorismate synthase activity. Mutants fail to accumulate salicylic acid. Its function may be redundant with that of ICS2 (AT1G18870). |
AT1G17440 | Encodes one of two Arabidopsis proteins with similarity to the TBP-associated factor TAF12. The gene product is an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. Loss of function mutants show enhanced response to ethylene. Located in nucleus and expressed throughout the plant. Required for ERF1 expression. Cytokinin-hypersensitive 1 (CKH1) mutants are characterized by rapidly growing calli with a green color at low levels of cytokinins, which are insufficient to induce such cytokinin responses in wild-type explants. It is hypothesized that CKH1 acts as a negative regulator of cytokinin signaling in Arabidopsis. |
AT1G11300 | The annotation for At1g11300 in TAIR10 is incorrect. This locus has been split into two At1g11300 (symbol: EGM1) and At1g11305 (symbol: EGM2) (Olivier Loudet, personal communication, 2013-04-03). See Comment field for revised annotation. |
AT1G63650 | Mutant has reduced trichomes, anthocyanin, and seed coat mucilage and abnormally patterned stomates. Mutants are defective in jasmonate-induced anthocyanin accumulation. Encodes a bHLH Transcription Factor 1. The protein is functionally redundant with GL3 and TT8 and interacts with TTG1, the myb proteins GL1, PAP1 and 2, CPC and TRY, and it will form heterodimers with GL3. Expression in N (non-hair cell forming) cell layers is negatively regulated by WER. Expression in H cells (hair cell forming) is promoted by CPC/TRY. |
AT4G31820 | A member of the NPY family genes (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Encodes a protein with similarity to NHP3. Contains BTB/POZ domain. Promoter region has canonical auxin response element binding site and Wus binding site. Co-localizes to the late endosome with PID. Regulates cotyledon development through control of PIN1 polarity in concert with PID. Also involved in sepal and gynoecia development. |
AT5G10810 | enhancer of rudimentary homolog ATER |
AT3G13437 | Brassicaceae specific gene. Overexpression results in Verticillium wilt resistance. |
AT2G20875 | Encodes a secretory peptide EPF1 involved in stomatal development. EPF1 is related to EPF2 which controls asymmetric cell divisions during stomatal devlopment. Its transcript levels change after inducing MUTE expression in a mute background. |
AT1G34245 | Encodes a secretory peptide EPF2 expressed in proliferating cells of the stomatal lineage, known as meristemoids, and in guard mother cells, the progenitors of stomata. Controls asymmetric cell divisions during stomatal development. EPF2 is related to EPF1, also involved in stomatal development. Its transcript levels change after inducing MUTE expression in a mute background. EPF2 binds to the ER receptor triggering MAPK activation that in turn inhibits stomatal development. EPF2 competes with STOMAGEN for binding to receptor protein kinases ER, and TMM. |
AT3G13898 | Memmber of the EPF/EPFL (epidermal patterning factor/EPF-like) gene family, which genes encode plant-specific secretory peptides, several of which play a role in controlling stomatal density and patterning in the plant epidermis. |
AT4G05520 | Encodes AtEHD2, one of the Arabidopsis Eps15 homology domain proteins involved in endocytosis (AtEHD1, At3g20290). |
AT4G05130 | equilibrative nucleoside transporter 4;(source:Araport11) |
AT1G70330 | encodes an adenosine transporter that catalyze a proton-dependent adenosine transport. The mRNA is cell-to-cell mobile. |
AT4G00900 | Type IIA (SERCA-type) Ca2+ ATPase, catalyzes the efflux of calcium from the cytoplasm. |
AT1G75220 | Encodes a vacuolar glucose exporter that is induced in response to factors that activate vacuolar glucose pools like darkness, heat stress and wounding and repressed during conditions that trigger glucose accumulation in the vacuole like cold stress and external sugar supply. |
AT2G20880 | Encodes ERF53, a drought-induced transcription factor. Belongs to the AP2/ERF superfamily, and has a highly conserved AP2 domain. Regulates drought-responsive gene expressions by binding to the GCC box and/or dehydration-responsive element (DRE) in the promoter of downstream genes. Overexpression of AtERF53 driven by the CaMV35S promoter resulted in an unstable drought-tolerant phenotype in T2 transgenic plants. Involved in heat shock response. |
AT5G44210 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-9). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT3G55990 | Encodes ESK1 (Eskimo1). A member of a large gene family of DUF231 domain proteins whose members encode a total of 45 proteins of unknown function. ESK1 functions as a negative regulator of cold acclimation. Mutations in the ESK1 gene provides strong freezing tolerance. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). The mRNA is cell-to-cell mobile. |
AT2G01480 | ESMD1 is a golgi localized putative O-fucosyltransferase. |
AT1G47370 | RBA1 variant in Ag0 background is a TIR-only receptor protein that binds to the bacterial type III effector protein HopBA. The Col-0 variant, which is not expressed, is likely a psuedogene and more highly methylated than the Ag0 variant which is expressed. |
AT5G43060 | Peptidase, activity detected in extracts of root, leaf and cell culture. |
AT5G42950 | EXA1 is a GYF domain-containing gene of the SMY2 subgroup. Mutants exhibit resistance to potexviruses. |
AT2G21800 | Forms a complex with MUS81 that functions as endonuclease in DNA recombination and repair processes. |
AT2G25820 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT5G03280 | Involved in ethylene signal transduction. Acts downstream of CTR1. Positively regulates ORE1 and negatively regulates mir164A,B,C to regulate leaf senescence. A maternally expressed imprinted gene. Mutations in ein2 block ethylene stimulation of flavonol synthesis. The mRNA is cell-to-cell mobile. |
AT3G23240 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ERF1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. EREBP like protein that binds GCC box of ethylene regulated promoters such as basic chitinases. Constitutive expression of ERF1 phenocopies ethylene over production. Involved in ethylene signaling cascade,downstream of EIN2 and EIN3. |
AT5G61600 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Involved in regulating root architecture. |
AT5G07310 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. Cytokinin production induced by jasmonate represses adventitious rooting. |
AT3G16280 | encodes a member of the DREB subfamily A-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 17 members in this subfamily including TINY. |
AT3G20310 | Encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-7). The protein contains one AP2 domain. Phosphorylated by PKS3 in vitro. Involved in ABA-mediated responses. Acts as a repressor of GCC box?mediated transcription together with AtSin3 and HDA19. |
AT1G53170 | encodes a member of the ERF (ethylene response factor) subfamily B-1 of ERF/AP2 transcription factor family (ATERF-8). The protein contains one AP2 domain. There are 15 members in this subfamily including ATERF-3, ATERF-4, ATERF-7, and leafy petiole. |
AT5G43410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Expression of ERF96 is induced by pathogens, JA and ethylene and over expression leads to increased resistance to resistance to necrotrophic pathogens. It is a nuclear localized, transcriptional activator that binds to GCC elements that is involved in positive regulation of ABA responses. |
AT2G40940 | Ethylene receptor, subfamily 1. Has histidine kinase activity. |
AT4G17500 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family (ATERF-1). The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. The mRNA is cell-to-cell mobile. |
AT1G05010 | Encodes 1-aminocyclopropane-1-carboxylate oxidase |
AT3G20770 | Encodes EIN3 (ethylene-insensitive3), a nuclear transcription factor that initiates downstream transcriptional cascades for ethylene responses. EIN3 interacts with MYC2, MYC3 and MYC4 to inhibit jasmonate-induced expression of wound-responsive genes and herbivory-inducible genes, and plant defense against generalist herbivores. |
AT1G73730 | Encodes a putative transcription factor involved in ethylene and sulfate starvation signalling. Isolated DNA binding domain has been shown to bind DNA in vitro. |
AT1G04370 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT2G31230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT2G33860 | ettin (ett) mutations have pleiotropic effects on Arabidopsis flower development, causing increases in perianth organ number, decreases in stamen number and anther formation, and apical-basal patterning defects in the gynoecium. The ETTIN gene encodes a protein with homology to DNA binding proteins which bind to auxin response elements. ETT transcript is expressed throughout stage 1 floral meristems and subsequently resolves to a complex pattern within petal, stamen and carpel primordia. ETT probably functions to impart regional identity in floral meristems that affects perianth organ number spacing, stamen formation, and regional differentiation in stamens and the gynoecium. During stage 5, ETT expression appears in a ring at the top of the floral meristem before morphological appearance of the gynoecium, consistent with the proposal that ETT is involved in prepatterning apical and basal boundaries in the gynoecium primordium. It is a target of the ta-siRNA tasiR-ARF. ETT is also a target of AP2; integrateing the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Positive regulation of drought stress response genes. |
AT1G69410 | Encodes eIF5A-2, a putative eukaryotic translation initiation factor. There are three eIF5A coding genes in Arabidopsis: eIF5A-1/At1g13950, eIF5A-2/At1g26630 and eIF5A-3/At1g69410. |
AT5G25780 | member of eIF3b - eukaryotic initiation factor 3b |
AT3G26400 | member of eIF4B - eukaryotic initiation factor 4B The mRNA is cell-to-cell mobile. |
AT4G18040 | eIF4E protein. The cum1 mutation affects the local spreading of CMV within the inoculated leaf, delaying accumulation of cucumber mosaic virus coat protein. |
AT5G57870 | Encodes a putative eukaryotic translation initiation factor The mRNA is cell-to-cell mobile. |
AT5G27700 | Cytosolic ribosomal protein. Similar to EVR1 and redundant with EVR1. Also enhances VAR2 mutant varigation, but to a lesser extent than evr1. |
AT3G17330 | evolutionarily conserved C-terminal region 6;(source:Araport11) |
AT5G07280 | Encodes EMS1 (EXCESS MICROSPOROCYTES1), a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in Arabidopsis anther. |
AT3G54150 | Encodes a DNA methyltransferase required for pollen exine formation and male fertility via the regulation of callose wall and primexine formation. |
AT1G10180 | LOW protein: exocyst complex component-like protein;(source:Araport11) |
AT4G02350 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile. |
AT1G76850 | Encodes a member of the exocyst complex gene family. The exocyst is a protein complex involved in tethering vesicles to the plasma membrane during regulated or polarized secretion. The mRNA is cell-to-cell mobile. |
AT5G52350 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G58430 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. Targeted by AvrPtoB to manipulate the defense molecule secretion machinery. |
AT1G07000 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G13990 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. This particular member is expressed in pollen and is involved in pollen tube elongation. Found in the cytoplasm and surprisingly, not found in the plasma membrane and is not found to colocalize with or interact with core exocyst subunits. |
AT3G29400 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G61010 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G50380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT3G55150 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT2G39380 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT2G28640 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. |
AT5G59730 | A member of EXO70 gene family, putative exocyst subunits, conserved in land plants. Arabidopsis thaliana contains 23 putative EXO70 genes, which can be classified into eight clusters on the phylogenetic tree. The mRNA is cell-to-cell mobile. |
AT2G35150 | Encodes EXORDIUM LIKE 7. |
AT5G56320 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT2G03090 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT4G01630 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT3G29365 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G39280 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT2G39700 | putative expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT2G28950 | Encodes an expansin. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT2G40610 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio). Involved in the formation of nematode-induced syncytia in roots of Arabidopsis thaliana. |
AT5G02260 | member of Alpha-Expansin Gene Family. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT3G45960 | member of EXPANSIN-LIKE. Naming convention from the Expansin Working Group (Kende et al, 2004. Plant Mol Bio) |
AT5G17020 | Encodes a member of the exportin protein family (XPO1A) which functions as receptors for nuclear export. Binds to a variety of proteins having leucine rich export signals.Along with XPO1B involved with development of the male and female gametophytes. Sensitive to heat and oxidative stress. |
AT3G03110 | Encodes a member of the exportin family (XPO1B)which function as receptors for nuclear transport.Along with XPO1A involved in the development of male and female gametophytes. |
AT5G35190 | proline-rich extensin-like family protein;(source:Araport11) |
AT1G23720 | Proline-rich extensin-like family protein;(source:Araport11) |
AT3G28550 | Proline-rich extensin-like family protein;(source:Araport11) |
AT2G43150 | Proline-rich extensin-like family protein;(source:Araport11) |
AT4G08380 | Proline-rich extensin-like family protein;(source:Araport11) |
AT1G21310 | Encodes extensin 3. |
AT1G70990 | Short extensin family protein required during the first phase of dark-grown hypocotyl elongation, regulates the moment and extent of the growth acceleration by modulating cell wall extensibility. |
AT1G76930 | Encodes an Arabidopsis extensin gene that belongs to cell-wall hydroxyproline-rich glycoproteins. The cross-link of extensins enforces cell wall strength. Transgenic plants overexpressing this gene show an increase in stem thickness. |
AT3G57630 | Encodes a glycoprotein glycosyl transferase ExAD. Knockout mutants show truncated root hair phenotype. |
AT4G34390 | extra-large GTP-binding protein 2;(source:Araport11) |
AT1G31930 | Encodes XLG3 (extra-large G protein 3) that shows significant similarity to the G protein alpha subunit in its C terminal region. Involved in the regulation of root morphological and growth responses. |
AT1G75930 | member of Lipase proteins |
AT3G14100 | Triple RNA Recognition Motif protein involved in the dynamic and reversible aggregation of translationally repressed mRNAs during hypoxia.During hypoxia, UBP1C association with non? uracil-rich mRNAs is enhanced concomitant with its aggregation into microscopically visible cytoplasmic foci, referred to as UBP1 stress granules (SGs). This mRNA association occurs as global levels of protein synthesis decline during hypoxia. Upon reoxygenation, rapid UBP1 SG disaggregation coincides with the return of the stabilized mRNAs to polysomes. |
AT4G08980 | Encodes an F-box gene that is a novel negative regulator of AGO1 protein levels and may play a role in ABA signalling and/or response. It is a F-box subunit of the SCF E3 ubiquitin ligase complex that mediates the degradation of 14-3-3 proteins. |
AT2G17036 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT2G24250 | LOW protein: F-box/kelch-repeat protein (DUF295);(source:Araport11) |
AT2G24255 | LOW protein: F-box/kelch-repeat protein;(source:Araport11) |
AT4G35733 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT5G24040 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT1G57906 | F-box protein;(source:Araport11) |
AT2G05970 | F-box protein (DUF295);(source:Araport11) |
AT2G14290 | LL-diaminopimelate protein (DUF295);(source:Araport11) |
AT2G33200 | F-box family protein;(source:Araport11) |
AT4G14165 | F-box family protein-like protein;(source:Araport11) |
AT4G17565 | F-box protein (DUF295);(source:Araport11) |
AT4G22030 | F-box protein with a domain protein;(source:Araport11) |
AT4G22170 | F-box protein (DUF295);(source:Araport11) |
AT5G38270 | F-box family protein;(source:Araport11) |
AT1G27580 | F-box protein (DUF295);(source:Araport11) |
AT2G04810 | F-box only protein (DUF295);(source:Araport11) |
AT1G15910 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
AT1G13790 | Belongs to a subgroup of SGS3-like proteins that act redundantly in RNA-directed DNA methylation: AT1G15910 (FDM1), AT4G00380 (FDM2), AT3G12550 (FDM3), AT1G13790 (FDM4), AT1G80790 (FDM5). |
AT1G26380 | Functions in the biosynthesis of 4-hydroxy indole-3-carbonyl nitrile (4-OH-ICN), a cyanogenic phytoalexin in Arabidopsis. FOX1 acts as a dehydrogenase on indole cyanohydrin to form indole carbonyl nitrile. |
AT1G35530 | Encodes FANCM, a highly conserved helicase that functions as a major factor limiting meiotic crossover formation. It is not directly involved in the repair of DNA lesions but suppresses spontaneous somatic homologous recombination via a RecQ helicase (At-RECQ4A)-independent pathway. |
AT4G14970 | Encodes a protein that is required for meiotic homologous recombination and acts in parallel to both MUTS HOMOLOG 4 (AtMSH4), known for its role in promoting interfering cross-overs (COs) and MMS AND UV SENSITIVE 81 (AtMUS81), known for its role in the formation of non-interfering COs. |
AT1G03170 | A member of the FAF family proteins encoded by the FANTASTIC FOUR (FAF) genes: AT4G02810 (FAF1), AT1G03170 (FAF2), AT5G19260 (FAF3) and AT3G06020 (FAF4). FAFs have the potential to regulate shoot meristem size in Arabidopsis thaliana. FAFs can repress WUS, which ultimately leads to an arrest of meristem activity in FAF overexpressing lines. |
AT2G37678 | Positive regulator of photomorphogenesis in far-red light. Most abundant in young seedlings in the dark. Downregulated in the light and older as plants develop. Localized in the nucleus and the cytoplasm. Nuclear localization strongest in the dark. Degraded through the 26S proteasome. Regulated by PHYA. It is specifically required for the light-regulated nuclear accumulation of phyA ( but not phyB) likely by shuttling PHYA into the nucleus. |
AT4G19990 | FAR1-related sequence 1;(source:Araport11) |
AT1G76320 | FAR1-related sequence 4;(source:Araport11) |
AT3G59470 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. FRF1 has been shown to bind the RB-box in vitro. The RB-box contributes to restricting SHOOTMERISTEMLESS expression to the shoot apical meristem. |
AT3G07500 | Encodes one of four FRS (FAR1-RELATED SEQUENCE) factor-like genes in Arabidopsis. FRS factors are characterized by having an N-terminal C2H2-type chelating motif of the WRKY- Glial Cell Missing1 family, a central core transposase domain of Mutator-like element transposases, and a C-terminal SWIM domain. The four FRF-like genes in Arabidopsis share only the N-terminal motif with FRS proteins. |
AT4G33360 | Encodes an NAD+-dependent dehydrogenase that oxidizes farnesol more efficiently than other prenyl alcohol substrates. |
AT5G63530 | Farnesylated protein that binds metals. |
AT2G36305 | Encodes an endoprotease involved in the cleavage of prenylated CaaX-box proteins. In vitro, it can cleave a farnesylated tetrapeptide and it can promote membrane-localization of a farnesylated GFP:AtROP9 protein when both are expressed in yeast. |
AT5G63910 | Encodes a farnesylcysteine lyase (EC 1.8.3.5) involved in a salvage /detoxification pathway of farnesylcysteine (FC) residues that are liberated during the degradation of prenylated proteins. Because FC is a competitive inhibitor of prenylcysteine methyltransferases involved in the down-regulation of ABA signaling, fcly mutants with elevated FC levels are hypersensitive to ABA. The protein also appears to be glycosylated when translated in vitro in the presence of microsomal membranes and it likely requires FAD for enzymatic activity. |
AT5G64630 | Chromatin Assembly Factor-1 (CAF-1) p60 subunit. Involved in organization of the shoot and root apical meristems. In Arabidopsis, the three CAF-1 subunits are encoded by FAS1, FAS2 and, most likely, MSI1, respectively. Mutations in FAS1 or FAS2 lead to increased frequency of homologous recombination and T-DNA integration in Arabidopsis. |
AT5G55730 | Encodes fasciclin-like arabinogalactan-protein 1 (Fla1). fla1 mutants show defects in shoot regeneration. Possibly involved in embryogenesis and seed development. |
AT3G52370 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT3G11700 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT1G15190 | Fasciclin-like arabinogalactan protein. Possibly involved in embryogenesis and seed development. |
AT4G31370 | fasciclin-like arabinogalactan-protein, putative (FLA5) |
AT5G18580 | fass mutants have aberrant cell shapes due to defects in arrangement of cortical microtubules. Encodes a protein highly conserved in higher plants and similar in its C-terminal part to B' regulatory subunits of type 2A protein phosphatases. Interacts with an Arabidopsis type A subunit of PP2A in the yeast two-hybrid system. |
AT4G30950 | Chloroplastic enzyme responsible for the synthesis of 16:2 and 18:2 fatty acids from galactolipids, sulpholipids and phosphatidylglycerol. Uses ferredoxin as electron donor. Gene mutation resulted in reduced level of unsaturated fatty acids leading to susceptibility to photoinhibition. |
AT3G57280 | Encodes a chloroplast inner envelope localized member of the Tmemb_14 gene family. FAX1 is involved in fatty acid and lipid homeostasis and likely functions as a fatty acid transporter that exports fatty acids from the plastid. The mRNA is cell-to-cell mobile. |
AT2G38550 | Mediates fatty acid transport from plastid. |
AT2G34770 | encodes a fatty acid hydroxylase, required for the AtBI-1-mediated suppression of programmed cell death. |
AT5G22500 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. |
AT3G44540 | Encodes a member of the eight-member gene family encoding alcohol-forming fatty acyl-CoA reductases (FARs) identified in Arabidopsis thaliana. Three of the FARs, FAR1 (At5g22500), FAR4 (At3g44540) and FAR5 (At3g44550), are shown to generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. The mRNA is cell-to-cell mobile. |
AT4G13985 | FBD-associated F-box protein;(source:Araport11) |
AT1G57790 | F-box family protein;(source:Araport11) |
AT5G55150 | F-box SKIP23-like protein (DUF295);(source:Araport11) |
AT2G30766 | Functions in iron homeostasis, activates iron deficiency response genes such as bHLH38, bHLH39, IRT1, and FRO2. |
AT1G47400 | Involved in regulation of iron deficiency response genes. Overexpression results in hyperaccumulation of Fe and Mn. |
AT1G31420 | Encodes a plasma membrane localized leucine-rich repeat receptor kinase that is involved in cell wall elongation. Loss of function mutations of FEI1 and FEI2 exhibit defects in root and hypocotyl cell elongation. Double mutants are defective in cell wall biosynthesis and have thick hypocotyls, and short, thick roots. |
AT2G28160 | Encodes a putative transcription factor that regulates iron uptake responses. mRNA is detected in the outer cell layers of the root and accumulates in response to iron deficiency. The expression of many iron-regulated genes is dependent on FIT1. It specifically regulates FRO2 at the level of mRNA accumulation and IRT1 at the level of protein accumulation.Similar to FER in tomato and is a regulator of iron uptake. It is post-transcriptionally controlled. |
AT3G51550 | Encodes a synergid-expressed, plasma-membrane localized receptor-like kinase that accumulates asymetrically in the synergid membrnane at the filiform apparatus and mediates male-female gametophyte interactions during pollen tube reception. Also involved in powdery mildew infection. Mutants show faster root elongation under dim light, the protein is required for intracellular accumulation of AHA2 under dim-light growth conditions. Positively regulates flowering by modulating the transcript accumulation and mRNA alternative splicing of certain flowering-related genes, including FLOWERING LOCUS C (FLC) and its homolog MADS AFFECTING FLOWERING (MAF). However, the RALF1 ligand negatively regulates flowering compared with FER. |
AT2G27510 | ferredoxin 3;(source:Araport11) |
AT1G01590 | Encodes a ferric-chelate reductase that is expressed at extremely low levels in Fe deficiency-induced seedlings. |
AT1G01580 | Encodes the low-iron-inducible ferric chelate reductase responsible for reduction of iron at the root surface. It is likely to be the major Fe(III) chelate reductase in Arabidopsis iron metabolism. Coordinately regulated with IRT1, the major transporter responsible for high-affinity iron uptake from the soil, at both transcriptional and posttranscriptional levels. Steady state mRNA levels are regulated by several metals. Its transcription is regulated by FIT1. |
AT1G23020 | Encodes a ferric chelate reductase whose transcription is regulated by FIT1. Expressed in the root, shoot, flower and cotyledon. |
AT5G23990 | Encodes a ferric chelate reductase that is expressed at low levels in roots,shoots and flowers, but not cotyledons. |
AT5G50160 | Encodes a ferric chelate reductase that is expressed in shoots and flowers. |
AT5G26030 | encodes ferrochelatase I located in plastids. Involved in heme biosynthesis in non-photosynthetic tissues and induced by oxidative stress in photosynthetic tissues to supply heme for defensive hemoproteins The mRNA is cell-to-cell mobile. |
AT1G26870 | NAC-domain protein. Expressed in root cap stem cells, where it promotes periclinal root cap-forming divisions. Involved in a regulatory feedback loop with SMB. FEZ activates SMB in hte root cap daughter cells soon after division, and SMB in turn represses FEZ expression in these cells, thereby preventing further stem cell divisions. |
AT4G22910 | FIZZY-related 2;(source:Araport11) |
AT5G46330 | Encodes a leucine-rich repeat serine/threonine protein kinase that is expressed ubiquitously. FLS2 is involved in MAP kinase signalling relay involved in innate immunity. Essential in the perception of flagellin, a potent elicitor of the defense response. FLS2 is directed for degradation by the bacterial ubiquitin ligase AvrPtoB. The mRNA is cell-to-cell mobile. |
AT1G19250 | FMO1 is required for full expression of TIR-NB-LRR conditioned resistance to avirulent pathogens and for basal resistance to invasive virulent pathogens. Functions in an EDS1-regulated but SA-independent mechanism that promotes resistance and cell death at pathogen infection sites. FMO1 functions as a pipecolate N-hydroxylase and catalyzes the biochemical conversion of pipecolic acid to N-hydroxypipecolic acid (NHP). NHP systemically accumulates in the plant foliage and induces systemic acquired resistance to pathogen infection. |
AT1G62560 | belongs to the flavin-monooxygenase (FMO) family, encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates The mRNA is cell-to-cell mobile. |
AT1G12140 | Encodes a glucosinolate S-oxygenase that catalyzes the conversion of methylthioalkyl glucosinolates to methylsulfinylalkyl glucosinolates. It is a suppressor of the bp mutant phenotype. |
AT5G54500 | Encodes a flavin mononucleotide-binding flavodoxin-like quinone reductase that is a primary auxin-response gene. |
AT5G63595 | flavonol synthase 4;(source:Araport11) |
AT2G19190 | Encodes a receptor-like protein kinase that is involved in early defense signaling. Expression of this gene is strongly induced during leaf senescence. It is a target of the transcription factor AtWRKY6. |
AT3G12145 | A novel leucine-rich repeat protein. Interacts directly with MADS domain transcription factor. |
AT5G25260 | Belongs to the group of plant flotillins, which are plasma membrane proteins. Flot2 complexes are found in microdomains and may be involved in plant-pathogen interactions, water transport and intracellular trafficking. |
AT5G25250 | Encodes a protein that is involved in a membrane microdomain-dependent, but clathrin-independent, endocytic pathway required for optimal seedling development. The mRNA is cell-to-cell mobile. |
AT1G35460 | Encodes a bHLH transcription factor involved in CFL1-mediated regulation of cuticle development. Overexpression leads to abnormal cuticle development. |
AT5G10140 | MADS-box protein encoded by FLOWERING LOCUS C - transcription factor that functions as a repressor of floral transition and contributes to temperature compensation of the circadian clock. Expression is downregulated during cold treatment. Vernalization, FRI and the autonomous pathway all influence the state of FLC chromatin. Both maternal and paternal alleles are reset by vernalization, but their earliest activation differs in timing and location. Histone H3 trimethylation at lysine 4 and histone acetylation are associated with active FLC expression, whereas histone deacetylation and histone H3 dimethylation at lysines 9 and 27 are involved in FLC repression. Expression is also repressed by two small RNAs (30- and 24-nt) complementary to the FLC sense strand 3? to the polyA site. The small RNAs are most likely derived from an antisense transcript of FLC. Interacts with SOC1 and FT chromatin in vivo. Member of a protein complex. |
AT1G65480 | FT, together with LFY, promotes flowering and is antagonistic with its homologous gene, TERMINAL FLOWER1 (TFL1). Together with TSF, it plays an antagonistic role to TFL1 in the determination of inflorescence meristem identity. FT is expressed in leaves and is induced by long day treatment. Either the FT mRNA or protein is translocated to the shoot apex where it induces its own expression. Recent data suggests that FT protein acts as a long-range signal. FT is a target of CO and acts upstream of SOC1. |
AT3G63300 | Encodes a pleckstrin homology domain- and DUF828-containing protein. Mutants have defects in leaf vascular pattering, with vascular bundles that fail to meet distally in both the cotyledons and leaves. Necessary to the formation of the closed leaf vascular pattern characteristic of dicot leaves in response to auxin. Redundant with FKD2. FKD1 may influence PIN1 localization in an auxin dependent manner. proposed to be a key component of the auxin canalization pathway. FORKED-LIKE family member, part of Group 1 (FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT4G16670 | FORKED-LIKE family member, part of Group 3 (Group 1 consists of FKD1, FL1-FL3; Group 2 consists of FL4 and FL8 and Group 3 consists of FL5- FL7). May coordinate leaf size with vein density, where Group 1 members and Group 3 members have opposing functions. |
AT3G07540 | Actin-binding FH2 (formin homology 2) family protein;(source:Araport11) |
AT1G70140 | Encodes a group I formin. Binds to F-actin barbed ends. Has severing actin filaments activity. Binds profilin. Involved in the initiation and tip growth of root hairs through regulation of actin cytoskeleton. |
AT5G07770 | Actin-binding FH2 protein;(source:Araport11) |
AT5G07780 | Encodes a class II formin that nucleates actin assembly, binds to the barbed-end of actin filaments and antagonizes the effect of FH1 on actin dynamics. The mRNA is cell-to-cell mobile. |
AT1G24150 | Encodes a group I formin. Localized to cell junctions. Polymerizes actin. Binds profilin. Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. FORMIN4 is a spatial feedback element in a multi-layered, temporally defined sequence of cytoskeletal response, contributing to the distribution of actin filaments at the dynamic cell wall appositions boundary and to the outcomes of pre-invasion defense. |
AT1G59910 | Member of family of cytoskeletal-interacting proteins which have the ability to stimulate actin nucleation and barbed-end capping through the combined activity of conserved formin-homology 1 (FH1) and formin-homology 2 (FH2) domains. |
AT1G31810 | Encodes the Type II Arabidopsis formin14. Interacts with microtubules and microfilaments to regulate cell division. |
AT5G54650 | Encodes a protein with similarity to formins that is involved in cytokinesis. Loss of function mutations exhibit delayed cellularization during endosperm development. FH5 is expressed in the endosperm and the protein localizes to the cell plate. FH5 was shown to be a maternally expressed imprinted gene. |
AT4G33240 | Encodes a protein that is predicted to act as a 1-phosphatidylinositol-3-phosphate (PtdIns3P) 5-kinase based on its homology to Fab1 from yeast. It contains an FYVE domain required for binding to PtdIns3P-containing membranes in yeast, as well as a Cpn60_TCP1 homology domain plus a kinase domain. fab1a/fab1b pollen grains not viable and have defective vacuolar organization. FAB1A and FAB1B complement the enlarged vacuolar phenotype of the fission yeast ste12delta mutant. |
AT1G34260 | Encodes a protein that is predicted to act as a phosphatidylinositol-3P 5-kinase, but, because it lacks a FYVE domain, it is unlikely to be efficiently targeted to membranes containing the porposed phosphatidylinositol-3P substrate. Therefore, its molecular function remains unknown. The mRNA is cell-to-cell mobile. |
AT4G31380 | encodes a small protein with unknown function and is similar to flower promoting factor 1. This gene is not expressed in apical meristem after floral induction but is expressed in roots, flowers, and in low abundance, leaves. |
AT5G22940 | Homolog of FRA8 (AT2G28110), a member of a member of glycosyltransferase family 47; exhibits high sequence similarity to tobacco (Nicotiana plumbaginifolia) pectin glucuronyltransferase. |
AT5G47820 | Encodes a kinesin-like protein with an N-terminal microtubule binding motor domain. Protein is localized to the periphery of the cytoplasm and mutants in the gene exhibit altered orientation of cellulose microfibrils and reduced mechanical strength of fibers. |
AT5G51830 | Encodes one of the several Arabidopsis fructokinases. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). Important for seed oil accumulation and vascular development. |
AT1G06030 | Encodes a member of the fructokinase gene family. Nomenclature according to Riggs 2017 has been adopted for the family by the community (personal communication, Boernke, Callis, Granot, Boernke, and Smeekens). |
AT5G03690 | Aldolase superfamily protein;(source:Araport11) |
AT2G36460 | Aldolase superfamily protein;(source:Araport11) |
AT1G50250 | encodes an FTSH protease that is localized to the chloroplast. Involved in the D1 repair cycle of Photosystem II. FtsH1 and FtsH5 are interchangeable in thylakoid membranes. |
AT5G15250 | Encodes an FtsH protease that is localized to the chloroplast. AtFtsH6 is involved in the degradation of both Lhcb3 and Lhcb1 during senescence and high-light acclimation. |
AT1G06430 | encodes a FtsH protease that is localized to the chloroplast |
AT2G15350 | member of Glycosyltransferase Family- 37 |
AT2G15390 | Encodes an alpha-(1,2)-fucosyltransferase. |
AT2G15370 | Predicted fucosyltransferase, based on similarity to FUT1, but not functionally redundant with FUT1. |
AT4G24740 | a LAMMER-type protein kinase that co-precipitates with serine/arginine-rich (SR) proteins in vitro, interaction modulated by phosphorylation of the proteins. |
AT3G61140 | Represses photomorphogenesis and induces skotomorphogenesis in the dark. Component of the nuclear-localized COP9 complex. Mutants display striking purple coloration due to anthocyanin accumulation in their cotyledons, first become defective during embryogenesis and exhibit limited seedling development. |
AT3G26790 | Transcriptional factor with high similarity to the B3 region of the VP1/ABI3-like proteins. Full length FUS3 protein binds to the highly conserved RY motif [DNA motif CATGCA(TG)], present in many seed-specific promoters, and the B3 domains of this transcription factor is necessary for the specific interaction with the RY element. Transcriptional activity of FUS3 requires the B3 DNA-binding domain and an activation domain. FUS3 specifies cotyledon identity. Regulator of gene expression during late embryogenesis. Involved in the control foliar organ identity in Arabidopsis by regulating the synthesis of two hormones, abscisic acid and gibberellin. FUS3 together with LEC1 positively regulate the abundance of the ABI3 protein in the seed. |
AT2G46270 | encodes a bZIP G-box binding protein whose expression is induced by ABA. It has been shown to bind to Adh that contains the G-box and is induced by cold and water deprivation. GBF3 has been shown to be expressed mostly in the root and dark-grown leaves. GBF3 can act as homodimers and as heterodimers with GFB1, GBF2 and GBF4. In addition, GBF3!?s DNA binding activity is enhanced by GIP1, GPRI1 and GPRI2. |
AT4G34590 | Encodes a basic domain leucine zipper (bZip) transcription factor bZIP11. Translation is repressed by sucrose. Directly regulates gene expression of ASN1 and ProDH2, which are enzyme-coding genes involved in amino acid metabolism. Susceptibility factor during Pseudomonas syringae infection. |
AT5G10450 | Encodes a member of the 14-3-3 gene family that is a lambda isoform (14-3-3λ). Interacts with APX3 (ascorbate peroxidase) and AKR2 , suggesting a role in mediating oxidative metabolism in stress response. This protein was shown to colocalize and interact with SERK1 by which it is phosphorylated. This protein is also reported to interact with the phosphorylated form of the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Interacts with JAZ10.4 which lacks the Jas motif. It is also phosphorylated by CRPK1 as part of the response to cold and translocates to the nucleus after phosphorylation. |
AT5G45580 | GARP-G2-like transcription factor involved in low temperature regulation of flavonoid biosynthesis. |
AT3G05120 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. The DELLA region alone can interact with GID1A in GA-dependent manner in a Y2H assay. |
AT5G27320 | Encodes a gibberellin (GA) receptor ortholog of the rice GA receptor gene (OsGID1). Has GA-binding activity, showing higher affinity to GA4. Interacts with DELLA proteins in vivo in the presence of GA4. |
AT2G47180 | GolS1 is a galactinol synthase that catalyzes the formation of galactinol from UDP-galactose and myo-inositol. GolS1 transcript levels rise in response to methyl viologen, an oxidative damage-inducing agent. Plants over-expressing GolS1 have increased tolerance to salt, chilling, and high-light stress. |
AT1G60470 | Predicted to encode a galactinol synthase. |
AT5G23790 | Predicted to encode a galactinol synthase. |
AT3G53950 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT1G75620 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT3G10700 | Encodes a GHMP kinase family protein that acts as a galacturonic acid-1-phosphate kinase that catalyzes the production of galacturonic acid-1-phosphate. This is a precursor of the important cell wall building block UDP-galacturonic acid. Based on gene trap line GT8007, the gene appears to be expressed in a petal and stamen-specific manner, between flower stages 8 to 11, however, later RT-qPCR analysis demonstrates that the transcript is present throughout the plant in all tissues tested. |
AT1G06780 | Encodes a protein with putative galacturonosyltransferase activity. Required for synthesis of native homogalacturonan in growing pollen tubes; critical role in pollen tube growh and male fertility. |
AT3G28340 | Encodes a protein with putative galacturonosyltransferase activity. |
AT1G13250 | Encodes a protein with putative galacturonosyltransferase activity. |
AT1G02720 | Encodes a protein with putative galacturonosyltransferase activity. |
AT2G36830 | Encodes a tonoplast intrinsic protein, which functions as water channel. It has also been shown to be able to facilitate the transport of urea and hydrogen peroxide. Highly expressed in vascular tissues of the root, stem, cauline leaves and flowers but not in the apical meristems. The mRNA is cell-to-cell mobile. |
AT1G23900 | Encodes large subunit of the heterotetrameric adaptor protein complex AP-1. AP-1 is required for clathrin coated vesicles budding from the trans-Golgi network or plasma membrane. |
AT5G26220 | ChaC-like family protein;(source:Araport11) |
AT1G78660 | The Arabidopsis protein AtGGH1 is a gamma-glutamyl hydrolase cleaving pentaglutamates to yield di- and triglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
AT1G78680 | The Arabidopsis protein AtGGH2 is a gamma-glutamyl hydrolase acting specifically on monoglutamates. The enzyme is involved in the tetrahydrofolate metabolism and located to the vacuole. |
AT4G39640 | The gene encodes a gamma-glutamyltransferase (AKA gamma-glutamyl transpeptidase, EC 2.3.2.2) that is located in vascular tissues (predominantly phloem) of leaves and is involved in the degradation of glutathione. The encoded enzyme also mitigates oxidative stress by metabolizing GSSG (oxidized form of GSH - glutathione) in the apoplast. |
AT1G64970 | gamma-tocopherol methyltransferase (g-TMT) mRNA, nuclear; mutant has Deficient in alpha and beta tocopherol; Accumulates gamma tocopherol in leaves |
AT4G34450 | Member of the Coat Protein I (COPI) complex is a seven-subunit coatomer complex consisting of the α, β, β′, γ, δ, ε, and ζ proteins. COPI is required for retrograde transport from the Golgi to the endoplasmic reticulum, Golgi maintenance, and cell plate formation. |
AT5G44700 | Encodes GASSHO2 (GSO2), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO2 and a homolog GSO1 (At4g20140) are required for the formation of a normal epidermal surface during embryogenesis. |
AT4G20140 | Encodes GASSHO1 (GSO1), a putative leucine-rich repeat transmembrane-type receptor kinase. GSO1 and a homolog GSO2 (At5g44700) are required for the formation of a normal epidermal surface during embryogenesis. Necessary for localizing CASPARIAN STRIP DOMAIN PROTEINS (CASPs) - major players of endodermal differentiation - into an uninterrupted, ring-like domain. |
AT3G02885 | GASA5, is involved in the regulation of seedling thermotolerance. |
AT3G24050 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT2G28340 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT3G45170 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G49300 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G47140 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G66320 | Encodes GATA transcription factor gene GNC, involved in regulating carbon and nitrogen metabolism. Expression occurs in aerial tissue at an early stage of development and is inducible by nitrate. |
AT3G51080 | Encodes a member of the GATA factor family of zinc finger transcription factors. |
AT5G56860 | Encodes a member of the GATA factor family of zinc finger transcription factors. Modulate chlorophyll biosynthesis and glutamate synthase (GLU1/Fd-GOGAT) expression. |
AT4G16141 | GATA type zinc finger transcription factor family protein;(source:Araport11) |
AT5G37500 | Encodes a guard cell outward potassium channel. Belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). Mutants have increased water consumption and limited stomatal closure in response to abscisic and jasmonic acids. It forms a heteromeric K(out) channels with SKOR. The gene is expressed ubiquitously in root and the vasculature and guard cells of leaves. Expression is suppressed during agrobacterium-induced tumor formation and increased in response to water deprivation and cold. |
AT5G22990 | Member of a small family of zinc finger containing putative transcription factors.Similar to GAZ. |
AT4G19985 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT2G06025 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT4G28030 | Acyl-CoA N-acyltransferases (NAT) superfamily protein;(source:Araport11) |
AT1G73250 | encodes a bifunctional 3, 5-epimerase-4-reductase in L-fucose synthesis and converts GDP-D-mannose to GDP-L-fucose in vitro along with MUR1 (GDP-D-mannose 4,6-dehydratase). It is expressed in all tissues examined, but most abundantly in roots and flowers. |
AT5G66280 | GDP-D-mannose 4,6-dehydratase |
AT1G54000 | GDSL-motif esterase/acyltransferase/lipase. Enzyme group with broad substrate specificity that may catalyze acyltransfer or hydrolase reactions with lipid and non-lipid substrates. |
AT1G53940 | Encodes a lipase, has in vitro lipase activity with p-nitrophenyl acetate and p-nitrophenyl butyrate, gene expression induced by hormones, negatively regulates auxin signaling, involved in disease resistance |
AT3G14225 | Contains lipase signature motif and GDSL domain. |
AT3G45240 | Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. Involved in resistance to S. sclerotiorum, fungal sRNA target. |
AT5G60550 | Encodes a geminivirus Rep interacting kinase (GRIK; GRIK1/AT3G45240, GRIK2/AT5G60550). GRIKs are SnRK1 (SNF1-related kinases) activating kinases. Both GRIKs specifically bind to the SnRK1 catalytic subunit and phosphorylate the equivalent threonine residue in its activation loop in vitro. |
AT1G22300 | Encodes a 14-3-3 protein. This protein is reported to interact with the BZR1 transcription factor involved in brassinosteroid signaling and may affect the nucleocytoplasmic shuttling of BZR1. Might act as a stabilization factor to mediate the oligomerization of REM on the plasma membrane. |
AT3G02520 | Encodes GF14 ν, a 14-3-3 protein isoform (14-3-3ν). |
AT4G27600 | Encodes a phosphofructokinase B-type carbohydrate kinase family protein, NARA5. Regulates photosynthetic gene expression. |
AT2G18640 | Encodes an endoplasmic reticulum-targeted geranylgeranyl pyrophosphate synthase |
AT1G09560 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. The mRNA is cell-to-cell mobile. |
AT3G05930 | germin-like protein (GLP8) |
AT1G02335 | Encodes a plasodesmata-located protein involved in regulating primary root growth by controlling phloem-mediated allocation of resources between the primary and lateral root meristems. |
AT2G36690 | Protein belonging to the Fe-dependent 2-oxoglutarate dioxygenase superfamily, catalyzes the stereospecific hydration of GA12 to produce DHGA12, negatively regulates ABA sensitivity during germination, phototrophic establishment and seedling development. |
AT5G56300 | A member of the Arabidopsis SABATH methyltransferase gene family. Encodes GAMT2, a methyltransferase that uses S-adenosine-L-methionine (SAM) as a methyl donor to methylate the carboxyl group of GAs, resulting in the methyl esters of GAs (MeGAs). Expressed most highly in the siliques during seed development. |
AT1G47990 | Encodes a gibberellin 2-oxidase that acts on C19 gibberellins. AtGA2OX4 expression is responsive to cytokinin and KNOX activities. |
AT4G21200 | Encodes a protein with gibberellin 2-oxidase activity which acts specifically on C-20 gibberellins. |
AT5G07200 | encodes a gibberellin 20-oxidase. |
AT1G44090 | Encodes a gibberellin 20-oxidase. |
AT4G21690 | gibberellin 3-oxidase 3;(source:Araport11) |
AT5G41315 | Encodes a basic helix loop helix domain protein that interacts with GL1 in trichome development.GL3 interacts with JAZ and DELLA proteins to regulate trichome initiation. |
AT1G68360 | Encodes a nuclear localized member of the C2H2 family of TFIIIA transcription factors.GIS3 is involved in trichome initiation and development downstream of GA and cytokinin signaling. GIS regulates the expression GIS and GIS2. |
AT2G19880 | Encodes Glucosylceramide synthase (GCS) which catalyzes the final step in glucosylceramide (GlcCer) synthesis by transferring a glucosyl residue from UDP-Glc to the ceramide backbone. |
AT1G30540 | Actin-like ATPase superfamily protein;(source:Araport11) |
AT2G41760 | Controls the expression of specific defence-response genes, activates the synthesis pathway for the phytoalexin camalexin and influences basal resistance to Pseudomonas syringae pv tomato (Pst). |
AT1G65440 | Related to yeast Spt6 protein, which functions as part of a protein complex in transcription initiation and also plays a role in chromatin structure / assembly. It encodes a putative WG/GW-repeat protein involved in the regulation of apical-basal polarity of embryo |
AT5G10550 | This gene is predicted to encode a bromodomain-containing protein. A plant line expressing RNAi constructs targeted against GTE7 shows some resistance to agrobacterium-mediated root transformation. |
AT5G15770 | Encodes a putative glucose-6-phosphate acetyltransferase that is likely involved in UDP-N-acetylglucosamine biosynthesis. A GFP:GNA1 fusion protein localizes to the endoplasmic reticulum. |
AT5G13110 | Encodes a plastidic glucose-6-phosphate dehydrogenase that is sensitive to reduction by DTT and whose mRNA is most highly expressed in root. |
AT3G27300 | glucose-6-phosphate dehydrogenase 5;(source:Araport11) |
AT5G40760 | Encodes a cytosolic glucose-6-phosphate dehydrogenase that is insensitive to reduction by DTT and whose mRNA is expressed ubiquitously. The mRNA is cell-to-cell mobile. |
AT1G67490 | Encodes an alpha-glucosidase I enzyme that catalyzes the first step in N-linked glycan processing. Localized to the endoplasmic reticulum (ER). |
AT2G25450 | Encodes a 2-oxoacid-dependent dioxygenase involved in the production of 2-hydroxybut-3-enyl glucosinolate. |
AT1G70090 | Encodes a protein with putative galacturonosyltransferase activity. |
AT5G61250 | Belongs to the plant glycoside hydrolase family 79. Encodes a protein with several posttranslational modification sites including O-β-GlcNAc attachment sites and serine-, threonine- and tyrosine-phosphorylation sites, suggesting that this protein is extensively modified posttranslationally. The protein is predicted (WoLF PSORT program) to be secreted. |
AT1G33800 | Encodes a glucuronoxylan(GX)-specific 4-O-methyltransferase responsible for methylating GlcA residues in GX. Reduced methylation of GX ingxmt1-1 plants is correlated with altered lignin composition. The mRNA is cell-to-cell mobile. |
AT1G09610 | glucuronoxylan 4-O-methyltransferase-like protein (DUF579);(source:Araport11) |
AT5G17330 | Encodes one of two isoforms of glutamate decarboxylase. The mRNA is cell-to-cell mobile. |
AT1G65960 | glutamate decarboxylase (GAD2) The mRNA is cell-to-cell mobile. |
AT2G02010 | glutamate decarboxylase 4;(source:Araport11) |
AT5G18170 | Encodes the 43 kDa alpha-subunit of the glutamate dehydrogenase with a putative mitochondrial transit polypeptide and NAD(H)- and alpha-ketoglutarate-binding domains. Mitochondrial localization confirmed by subcellular fractionation. Combines in several ratios with GDH2 protein (GDH-beta) to form seven isoenzymes. Catalyzes the cleavage of glycine residues. May be involved in ammonia assimilation under conditions of inorganic nitrogen excess. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
AT5G07440 | Encodes the beta-subunit of the glutamate dehydrogenase. The enzyme is almost exclusively found in the mitochondria of stem and leaf companion cells. |
AT3G04110 | putative glutamate receptor (GLR1.1). Contains a functional cation - permeable pore domain. Involved in cellular cation homeostasis. |
AT5G48410 | member of Putative ligand-gated ion channel subunit family |
AT2G17260 | Encodes a glutamate receptor. Involved in calcium-programmed stomatal closure. |
AT5G27100 | member of Putative ligand-gated ion channel subunit family |
AT5G11210 | member of Putative ligand-gated ion channel subunit family |
AT1G42540 | member of Putative ligand-gated ion channel subunit family |
AT2G32400 | Glr5 |
AT3G48730 | glutamate-1-semialdehyde 2,1-aminomutase 2;(source:Araport11) |
AT5G63570 | Encodes a protein with homology to glutamate-1-semialdehyde 2,1-aminomutase catalyzing the conversion of glutamate-1-semialdehyde (GSA) into 5-amino levulinate. The expression of this gene was demonstrated to be light-induced. The mRNA is cell-to-cell mobile. |
AT5G57685 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT5G24920 | Encodes a member of the GDU (glutamine dumper) family proteins involved in amino acid export: At4g31730 (GDU1), At4g25760 (GDU2), At5g57685 (GDU3), At2g24762 (GDU4), At5g24920 (GDU5), At3g30725 (GDU6) and At5g38770 (GDU7). |
AT1G66200 | encodes a cytosolic glutamate synthetase, this enzyme has low affinity with substrate ammonium |
AT5G37600 | encodes a cytosolic glutamine synthetase, the enzyme has high affinity with substrate ammonium |
AT5G35630 | chloroplastic glutamine synthetase The mRNA is cell-to-cell mobile. |
AT3G15660 | Mitochondrial glutaredoxin involved in Fe-S cluster assembly. |
AT5G40370 | Glutaredoxin family protein;(source:Araport11) |
AT2G31570 | glutathione peroxidase GPx |
AT2G43350 | Glutathione peroxidase. Functions as both a redox transducer and a scavenger in abscisic acid and drought stress responses. Interacts with ABI2 and ABI1. |
AT3G63080 | Encodes glutathione peroxidase. |
AT4G31870 | Encodes glutathione peroxidase. Role in the degradation of H2O2 to water using glutathione as electron donor. |
AT1G02920 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). |
AT4G02520 | Encodes glutathione transferase belonging to the phi class of GSTs. Naming convention according to Wagner et al. (2002). The expression of this gene is upregulated by herbicide safeners such as benoxacor and fenclorim. |
AT1G74590 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G69930 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G59670 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT1G10360 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT3G43800 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). The mRNA is cell-to-cell mobile. |
AT2G29470 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT3G09270 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G62480 | Encodes glutathione transferase belonging to the tau class of GSTs. Naming convention according to Wagner et al. (2002). |
AT5G41220 | Encodes glutathione transferase belonging to the theta class of GSTs. Naming convention according to Wagner et al. (2002). |
AT2G02390 | Encodes glutathione transferase belonging to the zeta class of GSTs. Naming convention according to Wagner et al. (2002). The protein undergoes spontaneous thiolation following treatment with the oxidant tert-butylhydroperoxide. It functions in vitro as a maleylacetoacetate isomerase and is likely to be involved in tyrosine catabolism. |
AT1G12900 | glyceraldehyde 3-phosphate dehydrogenase A subunit 2;(source:Araport11) |
AT1G42970 | Encodes chloroplast localized glyceraldehyde-3-phosphate dehydrogenase that can use both NADH and NADPH to reduce 1,3-diphosphate glycerate. It forms A2B2 heterotetramers with GapA forms of the GADPH enzyme. These complexes are active in the light under reducing conditions, but show reduced NADPH-dependent activity in response to oxidized thioredoxins and increased NAD(H)/NADP(H) ratios due to the formation of inactive A8B8 hexadecamers. The mRNA is cell-to-cell mobile. |
AT1G16300 | Encodes one of the chloroplast/plastid localized GAPDH isoforms (GAPCp1/At1g79530 and GAPCp2/At1g16300). gapcp double mutants display a drastic phenotype of arrested root development, dwarfism and sterility. GAPCps are important for the synthesis of serine in roots. |
AT1G30560 | Encodes a member of the phosphate starvation-induced glycerol-3-phosphate permease gene family: AT3G47420(G3Pp1), AT4G25220(G3Pp2), AT1G30560(G3Pp3), AT4G17550(G3Pp4) and AT2G13100(G3Pp5). |
AT1G06520 | sn-glycerol-3-phosphate 2-O-acyltransferase. Expressed in flower buds and siliques. Homozygous mutant plants are male sterile. |
AT4G01950 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT5G06090 | putative sn-glycerol-3-phosphate 2-O-acyltransferase |
AT5G43300 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. |
AT5G45350 | proline-rich family protein;(source:Araport11) |
AT5G07530 | encodes a glycine-rich protein that has oleosin domain and is expressed specifically during flower stages 10 to 12. Protein is found on mature pollen coat. |
AT4G38680 | Encodes a glycine-rich protein that binds nucleic acids and promotes DNA melting. Its transcript and protein levels are up-regulated in response to cold treatment with protein levels peaking earlier in shoots (~10-14 days) than in roots (~21 days). It is normally expressed in meristematic regions and developing tissues where cell division occurs. RNAi and antisense lines with lower levels of CSP2/GRP2 transcripts flower earlier than wild type plants and have some defects in anther and seed development. |
AT2G22660 | Encodes a member of a family of DUF1399 domain containing proteins. GRDP1 is involved in germination and response to ABA. Loss of function mutants have reduced germination in the presence of osmotic stressors. |
AT5G07510 | encodes a glycine-rich protein that is expressed in low abundance in stems and leaves, and very low abundance in flowers. |
AT5G07550 | member of Oleosin-like protein family |
AT2G21060 | Glycine-rich protein (AtGRP2b). Also named as CSP4 (cold shock domain protein 4) containing a well conserved cold shock domain (CSD) and glycine-rich motifs interspersed by two retroviral-like CCHC zinc fingers. AtCSP4 is expressed in all tissues but accumulates in reproductive tissues and those undergoing cell divisions. Overexpression of AtCSP4 reduces silique length and induces embryo lethality. |
AT2G05520 | Encodes a glycine-rich protein that is expressed mainly in stems and leaves. AtGRP3 functions in root size determination during development and in Al stress. mRNA levels are upregulated in response to ABA, salicylic acid and ethylene but downregulated in response to desiccation. The mRNA is cell-to-cell mobile. |
AT2G05380 | glycine-rich protein 3 short isoform (GRP3S) mRNA, complete The mRNA is cell-to-cell mobile. |
AT4G18360 | Encodes a glycolate oxidase that modulates reactive oxygen species-mediated signal transduction during nonhost resistance. |
AT1G21360 | glycolipid transfer protein 2;(source:Araport11) |
AT1G70710 | endo-1,4-beta-glucanase. Involved in cell elongation. |
AT4G38990 | glycosyl hydrolase 9B16;(source:Araport11) |
AT4G39000 | glycosyl hydrolase 9B17;(source:Araport11) |
AT4G11050 | glycosyl hydrolase 9C3;(source:Araport11) |
AT2G27130 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G12360 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G14805 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT5G09370 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G70250 | Encodes a Protease inhibitor/seed storage/LTP family protein. |
AT1G36150 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G22650 | lipid transfer protein;(source:Araport11) |
AT4G08670 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT1G55260 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G37690 | Unlike its close paralog MUCI10 (At2g22900), GT6 is not required for the biosynthesis of seed coat mucilage. GT6 is preferentially expressed in sub-epidermal cell layers of the seed coat. |
AT1G32930 | Galactosyltransferase family protein;(source:Araport11) |
AT1G67290 | Galactose oxydase; may function in tissues that require mechanical reinforcements in the absence of lignification. |
AT2G31350 | Encodes a mitochondrial glyoxalase 2 that can accommodate a number of different metal centers and with the predominant metal center being Fe(III)Zn(II). |
AT5G57040 | Vicinal oxygen chelate (VOC) superfamily member. Responds to NaCl,drought and high light stress. |
AT1G64185 | Vicinal oxygen chelate (VOC) superfamily member. |
AT2G35110 | Component of the WAVE protein complex which act as activators of ARP2/3 complex involved in actin nucleation. Required for trichome morphogenesis. Mutant displays distorted trichomes, a phenotype that can be phenocopied by treatment of WT plants with actin-interacting drugs. Its ER localization is independent of upstream SPK1 activation signaling and the physical association with the WAVE/SCAR Regulatory complex binding partner SRA1. ER-localized NAP1 has little colocalization with actin and represent the inactive pool of NAP1 in these cell types. |
AT5G44190 | Encodes GLK2, Golden2-like 2, one of a pair of partially redundant nuclear transcription factors that regulate chloroplast development in a cell-autonomous manner. GLK1, Golden2-like 1, is encoded by At2g20570. GLK1 and GLK2 regulate the expression of the photosynthetic apparatus. |
AT5G14950 | Encodes a golgi alpha-mannosidase, an enzyme responsible for the formation of major complex-type N-glycans. |
AT1G18190 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC2 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (508?668 aa) portion of the protein. |
AT2G46180 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC4 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (169 aa) portion of the protein. |
AT3G02242 | root meristem growth factor-like protein;(source:Araport11) |
AT1G55325 | Encodes the Arabidopsis homolog of the transcriptional regulator MED13, is dynamically expressed during embryogenesis and regulates both developmental timing and the radial pattern formation. |
AT5G58960 | Mutant plants display impaired light-regulation of the hypocotyl randomization response. |
AT1G28130 | Encodes an IAA-amido synthase that conjugates Asp and other amino acids to auxin in vitro. Lines carrying insertions in this gene are hypersensitive to auxin. |
AT1G53130 | Encodes GRIM REAPER (GRI), involved in the regulation of cell death induced by extracellular ROS (reactive oxygen species). Secreted into the extracellular space. |
AT3G61570 | This gene is predicted to encode a protein that functions as a Golgi apparatus structural component known as a golgin in mammals and yeast. A fluorescently-tagged version of GC3 co-localizes with Golgi markers, and this localization appears to be replicated using the C-terminal (161 aa) portion of the protein. |
AT4G37740 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower |
AT2G36400 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Mutants result in smaller leaves indicating the role of the gene in leaf development. Expressed in root, shoot and flower. |
AT3G52910 | Growth regulating factor encoding transcription activator. One of the nine members of a GRF gene family, containing nuclear targeting domain. Involved in leaf development and expressed in root, shoot and flower. |
AT4G03190 | Encodes an F box protein belonging to the TIR1 subfamily. This protein forms SCF complexes with ASK1 and CUL1 and interacts with Aux/IAA proteins in an auxin-dependent manner. It also has sequence similarity to the yeast protein GRR1, which is involved in glucose repression. |
AT5G28300 | Encodes a Ca(2+)-dependent CaM-binding protein. AtGT2L specifically targets the nucleus and possesses both transcriptional activation and DNA-binding abilities, implicating its function as a nuclear transcription factor. |
AT5G64300 | encodes GTP cyclohydrolase II that can functionally complement E. coli mutant deficient in this gene. It also has 3,4-dihydroxy-2-butanone-4-phosphate synthase activity which makes it a bifunctional enzyme involved in the formation of the pyrimidine and of the carbohydrate from GTP and ribulose-5-phosphate, respectively The mRNA is cell-to-cell mobile. |
AT5G28050 | Cytidine/deoxycytidylate deaminase family protein;(source:Araport11) |
AT2G44100 | GDP dissociation inhibitor involved in vesicular membrane traffic |
AT3G57550 | guanylate kinase |
AT2G41880 | Guanylate kinase. Involved in nucleotide metabolism. |
AT1G03830 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Pseudo-GTPase which sequesters catalytically active GBPL3 under basal conditions but is displaced by GBPL3 LLPS when it enters the nucleus following immune cues to drive the formation of unique membraneless organelles. |
AT2G38840 | Guanylate-binding family protein;(source:Araport11) |
AT5G46070 | Assembles liquid?liquid phase separation (LLPS)-driven condensates within the nucleus to protect against infection and autoimmunity. Within membraneless organelles termed GBPL defence-activated condensates (GDACs), directly binds defence-gene promoters and recruited specifc transcriptional coactivators of the Mediator complex and RNA polymerase II machinery to massively reprogram host gene expression for disease resistance. |
AT5G60730 | One of 3 GET paralogs in Arabidopsis. GET3c is a mitochondrion localized protein with no obvious role in Tail Anchored (TA) protein insertion. |
AT2G18960 | Encodes a plasma membrane proton ATPase. Mutants have a reduced ability to close their stomata in response to drought and are affected in stomatal but not seed responsiveness to ABA. The mRNA is cell-to-cell mobile. |
AT5G62670 | H[+]-ATPase 11;(source:Araport11) |
AT4G30190 | Belongs to the P-type ATPase superfamily of cation-transporting ATPases, pumps protons out of the cell, generating a proton gradient that drives the active transport of nutrients by proton symport. has two autoinhibitory regions within the C-terminal domain. Its plasma membrane localization is light-dependent. |
AT2G24520 | plasma membrane H+-ATPase;(source:Araport11) |
AT2G07560 | H[+]-ATPase 6;(source:Araport11) |
AT3G60330 | H[+]-ATPase 7;(source:Araport11) |
AT1G80660 | H[+]-ATPase 9;(source:Araport11) |
AT5G20140 | Encodes a haem-binding protein, HBP5. HBP5 binds haem and interacts with the haem oxygenase, HY1. Disrupting the binding of HBP5 to HY1 leads to oxidative stress. |
AT4G28490 | Member of Receptor kinase-like protein family. Controls the separation step of floral organ abscission. The mRNA is cell-to-cell mobile. |
AT1G28440 | HAESA-like 1;(source:Araport11) |
AT3G19700 | Encodes leucine rich repeat (LRR) kinase. Iku2-3 identified in a screen for mutants with abnormal endosperm. Sporophytic recessive mutants have reduced embryo and endosperm size. Seed size is also reduced and the shape is abnormal suggesting an interaction between the endosperm and cell elongation in the integuments. |
AT1G60780 | ?1 adaptin component of heterotetrameric protein complex that regulates protein sorting at the trans-Golgi network/early endosome. The observed pleiotropic cellular and developmental defects in mutants are primarily due to defects in sorting of targets such as KNOLLE. |
AT4G21150 | ribophorin II (RPN2) family protein;(source:Araport11) |
AT5G56250 | hapless 8;(source:Araport11) |
AT3G05040 | Encodes member of importin/exportin family. Involved in timing of shoot maturation. Involved in miRNA transport. Mutants flower early and have small, curled leaves and reduced abundance of certain miRNA species. |
AT1G06840 | Homomultimers interact with cytoplasmic signaling molecule PBL27, resulting in herbivory resistance, in an ethylene-dependent manner. |
AT5G20470 | Encodes a headless derivative of myosin XI-K, which likely arose from a partial duplication of the XI-K gene and is developmentally regulated. |
AT4G13550 | Heat stress inducible plastid monogalactosyldiacylglycerol lipase. |
AT4G36990 | Encodes a protein whose sequence is similar to heat shock factors that regulate the expression of heat shock proteins. Transcript level is increased in response to heat shock. However, overexpression of this gene did not result in the increase of decrease of heat shock proteins. |
AT4G18880 | Encodes a member of Heat Stress Transcription Factor(Hsf) family that is a substrate of the MPK3/MPK6 signaling and regulates stress responses. |
AT3G51910 | member of Heat Stress Transcription Factor (Hsf) family The mRNA is cell-to-cell mobile. |
AT1G46264 | Encodes SCHIZORIZA, a member of Heat Shock Transcription Factor (Hsf) family. Functions as a nuclear factor regulating asymmetry of stem cell divisions. |
AT2G41690 | member of Heat Stress Transcription Factor (Hsf) family |
AT3G17210 | Encodes a heat stable protein with antimicrobial and antifungal activity. |
AT4G29770 | Target of trans acting-siR480/255. Testing. |
AT1G22990 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G35060 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G56210 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G28090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G28660 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT1G06330 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT2G36950 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G05220 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G06130 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT3G24450 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G16380 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT5G19090 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G23000 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT4G30120 | encodes a protein similar to Zn-ATPase, a P1B-type ATPases transport zinc |
AT1G63440 | The Arabidopsis P-type ATPase HMA5 is involved in Cu detoxification. hma5 mutant plants exhibit Cu hypersensitivity, which is especially dramatic in roots where HMA5 is mostly expressed. |
AT1G01490 | Heavy metal transport/detoxification superfamily protein;(source:Araport11) |
AT1G58300 | Encodes a member (HO4) of the heme oxygenase family. |
AT4G32690 | Encodes a hemoglobin (Hb) with a central domain similar to the 'truncated Hbs of bacteria, protozoa and fungi. The 3D structure of these types of Hbs is a 2-on-2 arrangement of alpha-helices as opposed to the 3-on-3 arrangement of the standard globin fold. This type of Hb is not found in animals or yeast. |
AT4G30850 | heptahelical transmembrane protein homologous to human adiponectin receptors and progestin receptors |
AT1G30570 | Encodes HERCULES2 (HERK2), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
AT5G63620 | Encodes an oxidoreductase involved in transducing the perception of E-2-hexenal, which changes the redox status of the mitochondria. |
AT4G29130 | Encodes a hexokinase (HXK1) in the plant glucose-signaling network. Functions as a glucose sensor to interrelate nutrient, light, and hormone signaling networks for controlling growth and development in response to the changing environment. |
AT2G19860 | Encodes a protein with hexokinase activity (AtHXK2) and acts as a sensor for plant sugar responses. |
AT1G47840 | Encodes a putative hexokinase. |
AT4G13420 | Encodes a protein of the KUP/HAK/KT potassium channel class that is upregulated in the roots by K levels. |
AT3G45060 | member of High affinity nitrate transporter family |
AT5G23120 | encodes a stability and/or assembly factor of photosystem II The mRNA is cell-to-cell mobile. |
AT3G09650 | RNA binding protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD transcript unit. |
AT4G31560 | Encodes HCF153, a 15-KDa protein involved in the biogenesis of the cytochrome b(6)f complex. Associated with the thylakoid membrane. |
AT4G37200 | Encodes thioredoxin-like protein with disulfide reductase activity that is involved in the biogenesis of the plastid cytochrome b6f complex. Protein is located in the thylakoid membrane with the C-terminal hydrophilic portion, containing the thioredoxin like domain, extending into the thylakoid lumen. |
AT4G35250 | HCF244 is a member of the atypical short-chain dehydrogenase/reductase superfamily, a modified group, which has lost enzyme activity.HCF244 interacts with unknown partners in a 200-400 kD membrane associated complex. |
AT3G17040 | It is a RNA tetratricopeptide repeat-containing protein required for normal processing of transcripts from the polycistronic chloroplast psbB-psbT-psbH-petB-petD operon coding for proteins of the photosystem II and cytochrome b6/f complexes. Localizes to the chloroplast membrane. Involved in regulating plastidial gene expression and biogenesis. It binds in the psbT?psbH intercistronic region and blocks the progression of 5′ → 3′ exoribonucleases, which defines the 5′ end of processed psbH transcripts and also stabilizes the downstream RNA segment. In addition, HCF107 binding remodels the structure of the psbH 5′ UTR in a way that can account for its ability to enhance psbH translation. |
AT3G54050 | Encodes a chloroplastic fructose 1,6-bisphosphate phosphatase. also known as HCEF1 (High Cyclic Electron Flow 1). hcef1 mutants have constitutively elevated electron flow (CEFI) and plants with antisense suppression of this enzyme have higher levels of net leaf photosynthesis and increased sucrose biosynthesis. The mRNA is cell-to-cell mobile. |
AT1G20693 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
AT1G20696 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Can be phosphorylated by CK2alpha. The mRNA is cell-to-cell mobile. |
AT4G35570 | Encodes a protein belonging to the subgroup of HMGB (high mobility group B) proteins that have a distinctive DNA-binding motif, the HMG-box domain. The motif confers non-sequence specific interaction with linear DNA and structure-specific binding to distorted DNA sites. The HMGB proteins are involved in the assembly of nucleoprotein complexes. Cannot be phosphorylated by CK2alpha. |
AT4G10310 | encodes a sodium transporter (HKT1) expressed in xylem parenchyma cells. Mutants over-accumulate sodium in shoot tissue and have increased sodium in the xylem sap and reduced sodium in phloem sap and roots. |
AT3G24430 | Encodes chloroplast protein HCF101 (high chlorophyll fluorescence 101). Serves as a chloroplast scaffold protein that specifically assembles [4Fe-4S] clusters and transfers them to the chloroplast membrane and soluble target proteins. |
AT2G30470 | HSI2 is a member of the ABI3 family of B3 domain proteins and functions as an active repressor of the Spo minimal promoter through the EAR motif. It contains a plant-specific B3 DNA-binding domain. It is expressed at similar levels in all organs. Treatment with 6% sucrose showed a slight increase in transcript levels after 24 h. No changes were observed after treatment with 50?M ABA. It is localized in the nucleus via a nuclear localization sequence located in the fourth conserved region of the C-terminal B3 domain. HSI2 is also an epigenetic repressor as it also contains functional plant homeodomain-like (PHD-L) and zinc-finger Cys- and Trp-containing (CW) domains associated with epigenetic regulation. The PHD-L domain of HSI2 is connected to promoting trimethylation of Lys-27 on histone 3 (H3K27me3), while the CW domain can bind directly to H3K4me3. Through these domains, HSI2 represses the seed maturation program during seed germination by repressing transcription of the core LAFL (LEC1, ABI3, FUS3, and LEC2) seed developmental transcriptional regulators. In developing A. thaliana embryos, HSI2 suppresses expression of a large number of genes, many identified as targets of FUS3. However, the absence of HSI2 had no effect on transcript levels of the LAFL regulators and the levels of measured metabolites and phytohormones (ABA, auxin, and JA derivatives) in developing Arabidopsis embryos. HSI2 likely fine-tunes seed maturation by repressing genes involved in early embryogenesis that are not required later for seed maturation and desiccation. |
AT5G23420 | Encodes HMGB6, a protein belonging to the subgroup of HMGB (high mobility group B) proteins. Localized in the nucleus. Binds to supercoiled DNA in vitro. HMGB6 is phosphorylated by protein kinase CK2alpha within its acidic C-terminal domain. |
AT5G62630 | hipl2 protein precursor;(source:Araport11) |
AT3G56490 | Encodes a protein that has adenylylsulfate sulfohydrolase activity (E.C. 3.6.2.1) in vitro. |
AT5G35750 | Encodes histidine kinase AHK2. |
AT5G10720 | member of Histidine Kinase |
AT1G61270 | Involved in transport of 1-Aminocyclopropane-1-carboxylic acid (ACC). |
AT1G03430 | Encodes AHP5, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT3G21510 | Encodes AHP1, one of the six Arabidopsis thaliana histidine phosphotransfer proteins (AHPs). AHPs function as redundant positive regulators of cytokinin signaling. Members of the AHP gene family include: AT3G21510 (AHP1), AT3G29350 (AHP2), AT5G39340 (AHP3), AT3G16360 (AHP4), AT1G03430 (AHP5) and AT1G80100 (AHP6). |
AT5G63890 | Encodes histidinol dehydrogenase. Up-regulated in response to UV-B. |
AT2G30620 | winged-helix DNA-binding transcription factor family protein;(source:Araport11) |
AT3G27360 | Histone superfamily protein;(source:Araport11) |
AT1G79000 | Homologous to CREB-binding protein, a co-activator of transcription with histone acetyl-transferase activity. No single prior lysine acetylation is sufficient to block HAC1 acetylation of the H3 or H4 peptides, suggesting that HAC1, HAC5, and HAC12 can acetylate any of several lysines present in the peptides. HAM2 acetylates histone H4 lysine 5. A plant line expressing an RNAi construct targeted against HAC1 has reduced rates of agrobacterium-mediated root transformation. |
AT1G67220 | histone acetyltransferase of the CBP family 2;(source:Araport11) |
AT1G55970 | HAC4 is most likely to be an expressed pseudogene that lacks HAT function. there is a single nucleotide deletion in both the HAC4 genomic and cDNA sequences relative to its homologs. The resulting frameshift within the open reading frame causes a stop codon to occur within the predicted acetyltransferase catalytic domain. |
AT3G12980 | Encodes an enzyme with histone acetyltransferase activity that can use both H3 and H4 histones as substrates. No single prior lysine acetylation is sufficient to block HAC5 acetylation of the H3 or H4 peptides, suggesting that HAC5 can acetylate any of several lysines present in the peptides. Di-acetylation of both lysines 9 and 14 on the H3 peptide significantly reduces the level of incorporated radioactive acetylation catalyzed by HAC5, indicating that HAC5 may acetylate either lysine 9 or lysine 14. The mRNA is cell-to-cell mobile. |
AT3G44490 | histone deacetylase 17;(source:Araport11) |
AT3G44680 | Encodes HDA9 (a RPD3-like histone deacetylase). Functions in promoting the onset of leaf senescence.The hda9 mutant shows enhanced H3K9 acetylation levels,based on immunodetection using H3K9ac antibodies. Negatively controls gene expression in concert with interacting proteins POWERDRESS (PWR), HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENES 15 (HOS15), WRKY53, ELONGATED HYPOCOTYL 5 (HY5), ABA INSENSITIVE 4 (ABI4) and EARLY FLOWERING 3 (ELF3). Involved in mutual negative feedback regulation with WRKY53. Mutations lead to a mild early flowering phenotype under SD. |
AT5G61070 | Encodes a protein with similarity to histone deacetylases, a class of chromatin remodeling factors which act on H3/H4 histones. Class II RPD3-like family HDAC member which controls negative responses to salinity stress. Expressed in roots where it appears to regulate the expression of epidermal cell fate genes controlling hair cell differentiation. |
AT3G54560 | Encodes HTA11, a histone H2A protein. Loss of all H2A.Z (triple mutant with HTA8 and HTA9) results in a reduction in DNA methylation of transposons but not that of genes. Loss of H2A.Z causes misregulation of many genes involved in the response to developmental and environmental cues, and that these genes tend to have high levels of gene-body H2A.Z. |
AT1G55250 | Encodes one of two orthologous E3 ubiquitin ligases in Arabidopsis that are involved in monoubiquitination of histone H2B. |
AT2G44150 | Encodes a protein-lysine N-methyltransferase. Located in ER. |
AT2G20000 | Required for cell division and cell differentiation in meristems. Encodes a homolog of the CDC27 subunit of the anaphase-promoting complex (APC). Unlike other CDC27 homologs in Arabidopsis, its transcription is cell cycle regulated. Strong hbt mutants give rise to seedlings that lack an anatomically recognizable quiescent center and differentiated columella root cap cells, the cell types derived from the wild-type hypophysis. Furthermore, they have no mitotically active root meristem and lack a differentiated lateral root cap. |
AT3G01470 | Encodes a homeodomain leucine zipper class I (HD-Zip I) transcriptional activator involved in leaf and hypocotyl development. Its promoter is bound by PIF1 which likely regulates its expression. Its translation is regulated by a conserved upstream ORF (CPuORF33). |
AT5G15150 | homeobox-containing gene with an unusual feature: a leucine zipper motif adjacent to the carboxyl-terminal of the homeodomain structure. This gene is expressed primarily in the cortex of the root and the stem. |
AT5G66700 | Encodes a homeodomain protein. Member of HD-ZIP 1 family, most closely related to HB5. AtHB53 is auxin-inducible and its induction is inhibited by cytokinin, especially in roots therefore may be involved in root development. |
AT4G40060 | Encodes a homeodomain leucine zipper class I (HD-Zip I) protein. |
AT4G16780 | Encodes a homeodomain-leucine zipper protein that is rapidly and strongly induced by changes in the ratio of red to far-red light. It is also involved in cell expansion and cell proliferation and in the response to auxin. The mRNA is cell-to-cell mobile. |
AT5G39760 | Functions together with TZP in co-regulation of the expression of blue-light dependent transcriptional regulators. Coassociates with and regulates the expression of light-regulated loci as well as transcriptional regulators to shape plant development in response to environmental stimuli with targets in RNA processing factors as well as proteins involved in salt stress and ABA signaling, in addition to embryo development. Acts downstream of TZP action with regard to blue-light-regulated hypocotyl elongation. |
AT2G18350 | homeobox protein 24;(source:Araport11) |
AT5G15210 | Encodes ZFHD3, a member of the zinc finger homeodomain transcriptional factor family. |
AT3G28920 | homeobox protein 34;(source:Araport11) |
AT2G33880 | Encodes a protein with similarity to WUS type homeodomain protein. Required for meristem growth and development and acts through positive regulation of WUS. Loss of function phenotypes include embryo lethality, hyponastic cotyledons, reduced root development and smaller meristems. Phenotypes can be rescued by addition of sucrose in the growth media. Overexpression can partially rescue the triple mutant cytokinin receptor phenotype suggesting HB-3 is a downstream effector of cytokinin signaling. |
AT5G46880 | homeobox-7;(source:Araport11) |
AT2G01430 | ATHB17 is a member of the HD-Zip transcription factor family. It is expressed most strongly in roots at different stages of development and induced by ABA, paraquat, drought, and NaCl treatments. Loss of function mutants are more sensitive to salt and drought stress.The protein is nuclear localized and has been shown to bind to the promoter of SIG5 and other genes. |
AT1G70920 | homeobox-leucine zipper protein 18;(source:Araport11) |
AT3G60390 | Encodes homeobox protein HAT3. |
AT2G44910 | Encodes a homeodomain protein whose expression displays a dependence on phyB for both red and far-red light response. Also involved in the shade avoidance syndrome. |
AT3G61150 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT1G34650 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT1G73360 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. It is involved in trichome branching. The transcription factor directly upregulates the expression of several cell-wall-loosening protein genes and reveals the important role that these target genes play in coordinating cell-wall extensibility with root development. |
AT1G05230 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Mutants have trichomes that appear glass-like under a dissecting microscope as compared to the wild-type trichomes. The mutations do not affect trichome growth or branch number. |
AT2G32370 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. Together with ATML1 and PDF2, it is involved in cotyledon development. |
AT5G52170 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT3G03260 | Encodes a homeobox-leucine zipper family protein belonging to the HD-ZIP IV family. |
AT5G54080 | Encodes a homogentisate 1,2-dioxygenase that can convert homogentisate to malylacetoacetate and is likely to be involved in tyrosine catabolism. |
AT2G18950 | Encodes homogentisate phytyltransferase involved in tocopherol biosynthesis. Has impact on seed longevity and plays a role in the adaptation to low temperature stress, notably phloem loading. |
AT3G11945 | Encodes a protein involved in plastoquinone-9 biosynthesis. The enzyme possesses homogentisate prenyltransferase activity and was shown to use solanesyl diphosphate, farnesyl diphosphate and geranylgeranyldiphosphate as prenyl donors, but not phytyldiphosphate. This gene At3g11945 derives from a split of At3g11950, publications Tian et al (2007) and Sadre et al (2006) refer to this gene as At3g11950. |
AT1G79050 | recA DNA recombination family protein;(source:Araport11) |
AT3G54420 | encodes an EP3 chitinase that is expressed during somatic embryogenesis in 'nursing' cells surrounding the embryos but not in embryos themselves. The gene is also expressed in mature pollen and growing pollen tubes until they enter the receptive synergid, but not in endosperm and integuments as in carrot. Post-embryonically, expression is found in hydathodes, stipules, root epidermis and emerging root hairs. |
AT4G25540 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH3 heterodimers bound 'insertion-deletion' DNA with three nucleotides (+AAG) or one nucleotide (+T) looped out much better than they bound DNA with a base/base mispair (T/G). |
AT5G11170 | One of two genes encoding an ATP-dependent RNA helicase that localizes predominantly to euchromatic regions of Arabidopsis nuclei, and associates with genes transcribed by RNA polymerase II independently from the presence of introns. It is not detected at non-transcribed loci. It interacts with ssRNA, dsRNA and dsDNA, but not with ssDNA. Its ATPase activity is stimulated by RNA and dsDNA and its ATP-dependent RNA helicase activity unwinds dsRNA but not dsDNA. |
AT1G56110 | NOP56-like protein |
AT3G19210 | Encodes RAD54, a member of the SWI2/SNF2 family of DNA-stimulated ATPases. Functions in DNA repair via homologous recombination. |
AT3G50470 | Homolog of RPW8 |
AT3G50480 | Homolog of RPW8 |
AT4G22970 | Encodes a separase (ESP), homologous to human and mouse separase protein. Separase is a capase family protease required for the release of sister chromatid cohesion during meiosis and mitosis. Arabidopsis separase contains a predicted 2Fe2S-ferredoxin domain that is not present in the proteins of other organisms. Also contains a putative EF-hand calcium binding domain. Mutant seeds exhibited embryo arrest at the globular stage. The endosperm also exhibited a weak titan-like phenotype. Transgenic plants expressing AESP RNA interference (RNAi) from the meiosis-specific DMC1 promoter exhibited alterations in chromosome segregation during meiosis I and II that resulted in polyads containing from one to eight microspores. Plays an essential role in embryo development. Required for the removal of cohesin from meiotic chromosomes and establishment of meiotic nuclear domains. This gene was also identified through the rsw4 mutant. Lines carrying recessive, temperature-sensitive mutations exhibit reduced anisotropic growth at 30 degrees Celsius. Microtubules and cellulose microfibrils are not depleted or disoriented in the mutants at the restrictive temperature. |
AT1G04050 | Encodes SUVR1, one of the four closely related Arabidopsis SUVR proteins that belong to the SU(VAR)3-9 subgroup of SET-domain proteins. Proteins containing the evolutionarily conserved SET domain are involved in regulation of eukaryotic gene expression and chromatin structure through their histone lysine methyltransferase (HMTase) activity. SUVR1, SUVR2 and SUVR4 proteins contain a novel domain at their N-terminus, and a SUVR specific region preceding the SET domain. Localized to the nucleolus, maybe involved in regulation of rRNA expression. |
AT3G23100 | A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. Yeast two-hybrid analysis demonstrated a strong interaction between A. thaliana DNA ligase IV and the A. thaliana homologue of the human DNA ligase IV-binding protein XRCC4. This interaction is shown to be mediated via the tandem BRCA C-terminal domains of A. thaliana DNA ligase IV protein. |
AT5G02410 | Encodes ALG10, an ER-resident alpha1,2-glucosyltransferase that is required for lipid-linked oligosaccharide biosynthesis and subsequently for normal leaf development and abiotic stress response. |
AT5G54730 | yeast autophagy 18 F-like protein;(source:Araport11) |
AT3G54710 | Encodes a cyclin-dependent protein kinase. Involved in nuclear DNA replication and plastid division. |
AT1G10030 | Encodes a protein that functions as a scaffolding platform for coassembling the sterol C4 demethylation enzyme complex. It also plays an essential role in the maintenance of polar auxin transport (PAT) by restricting the release and accumulation of 4-carboxy-4-methyl-24-methylenecycloartanol (CMMC), a PAT inhibitor. |
AT5G48120 | ARM repeat superfamily protein;(source:Araport11) |
AT4G16440 | Encodes a [FeFe]-hydrogenase-like protein named Gollum (for Growth in different Oxygen LeveLs inflUences Morphogenesis). Heterologous expression of Gollum in E. coli indicates that it probably contains two [Fe-S] clusters with different magnetic properties. Sequence alignment analysis indicates that these two clusters would be topologically equivalent to the mesial and proximal [Fe-S] centers of [FeFe]-hydrogenases. Knockdown mutants (RNAi) show a dwarf phenotype at the normal atmospheric partial oxygen pressure of 21 kPa. This dwarf phenotype could be rescued by growing the plant under low oxygen pressure (5kPa), suggesting a role for this gene in oxygen sensing. |
AT5G08110 | Plays a role in the maintenance of genome stability and the repair of aberrant replication intermediates in the root meristem. Is involved with RAD1, FAN1, and RECQ4A in the repair of DNA CLs. |
AT4G04330 | Encodes a chloroplast thylakoid localized RbcX protein that acts as a chaperone in the folding of Rubisco. |
AT4G13940 | Encodes a S-adenosyl-L-homocysteine hydrolase required for DNA methylation-dependent gene silencing. The mRNA is cell-to-cell mobile. |
AT2G17265 | Encodes a homoserine kinase (HSK) which produces O-phospho-L-homoserine (HserP), a compound at the branching point of methionine and threonine biosynthesis. HSK is found in the stromal fraction of chloroplasts. Mutation of this gene results in higher level of the amino acid homoserine and resistance to downy mildew pathogen Hyaloperonospora arabidopsidis. |
AT1G12270 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G18360 | Host immune receptor which recognizes the conserved effector HopB1. |
AT3G43300 | AtMIN7 is an immunity associated Arabidopsis protein targeted by HopM1, a conserved Pseudomonas syringae virulence protein. AtMIN7 encodes one of the eight members of the Arabidopsis adenosine diphosphate (ADP) ribosylation factor (ARF) guanine nucleotide exchange factor (GEF) protein family. The AFR GEF proteins are key components of the vesicle trafficking system in eukaryotic cells. HopM1 mediates the destruction of AtMIN7 via the host proteasome. Critical for cuticle formation and related leaf surface defense against the bacterial pathogen Pseudomonas syringae pathovar tomato (Pto). |
AT1G70690 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. The protein has two DUF26 domains and a single transmembrane domain. |
AT3G50950 | Encodes a canonical CC-type NLR protein that is required for the recognition of the T3SE HopZ1a as well as several other Hop effectors from the pathogenic bacteria P. syringae. |
AT5G59830 | Interacts with several P. syringae effectors. Regulates a wide range of pathogen-responsive biological processes. |
AT1G49560 | Homeodomain-like superfamily protein;(source:Araport11) |
AT4G32010 | Transcriptional repressor involved in the recruitment of PRC2 for genome-wide polycomb silencing. |
AT5G08230 | HUA and HUA-LIKE (HULK) genes act redundantly to regulate a subset of essential genes, with some (or all) family members also having specific functions. |
AT1G69700 | Part of the AtHVA22 family. Protein expression is ABA- and stress-inducible. The mRNA is cell-to-cell mobile. |
AT2G36020 | HVA22-like protein J;(source:Araport11) |
AT1G76490 | Encodes a 3-hydroxy-3-methylglutaryl coenzyme A reductase, which is involved in melavonate biosynthesis and performs the first committed step in isoprenoid biosynthesis. Expression is activated in dark in leaf tissue but not controlled by light in the root (confine The mRNA is cell-to-cell mobile. |
AT4G20930 | Encodes a 3-hydroxyisobutyrate dehydrogenase. |
AT4G11820 | Encodes a protein with hydroxymethylglutaryl-CoA synthase activity which was characterized by phenotypical complementation of the S. cerevisiae mutant. Involved in glucosinolate biosynthesis. |
AT1G79870 | Hydroxyphenylpyruvate reductase (HPPR), which catalyzes the reduction of 4-hydroxyphenylpyruvic acid (pHPP) to 4-hydroxyphenyllactic acid (pHPL). Together with HPPR3 and TAT1 involved in the biosynthesis of pHPL from tyrosine. |
AT2G45630 | Hydroxyphenylpyruvate reductase (HPPR) family member with low activity. |
AT1G69840 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT3G01290 | SPFH/Band 7/PHB domain-containing membrane-associated protein family;(source:Araport11) |
AT1G67700 | multidrug resistance protein;(source:Araport11) |
AT5G61460 | Encodes SMC6B (STRUCTURAL MAINTENANCE OF CHROMOSOMES 6B), a component of the SMC5/6 complex. SMC5/6 complex promotes sister chromatid alignment and homologous recombination after DNA damage. |
AT5G49230 | Identified in a screen for mutations hypersensitive to red and blue light. Mutants have shorter hypocotyls. Encodes a nuclear localized protein with similarity to drought induced proteins. Contains a ZZ zinc finger domain which is thought to mediate protein-protein interactions.May be involved in red and blue light signal transduction. |
AT1G13300 | Encodes a nuclear localized member of the GARP family of transcription factors. Involved in nitrate/phosphate signaling in roots. It is transcriptionally regulated by nitrate and post transcriptionally by phosphate and functions to integrate these two nutrient signaling pathways in the root. HRS1 and HHO2 are involved in Ni cross regulation of Pi signaling. They function as transcriptional repressors of SPX1, SPX2, and SPX4 as part of a cascade to regulate nitrogen and phosphorus balance. |
AT3G01100 | unknown protein, has cDNAs and ESTs associated to it |
AT5G55510 | PRAT protein family which has a unique system for importing and exporting proteins from chloroplasts. Acts in the export of proteins from chloroplasts during leaf senescence. |
AT4G27450 | aluminum induced protein with YGL and LRDR motifs;(source:Araport11) |
AT1G05575 | transmembrane protein;(source:Araport11) |
AT3G10020 | plant/protein;(source:Araport11) |
AT4G24110 | NADP-specific glutamate dehydrogenase;(source:Araport11) |
AT3G27220 | Galactose oxidase/kelch repeat superfamily protein;(source:Araport11) |
AT5G10040 | transmembrane protein;(source:Araport11) |
AT5G27760 | Hypoxia-responsive family protein;(source:Araport11) |
AT3G05550 | Hypoxia-responsive family protein;(source:Araport11) |
AT5G55250 | Encodes an enzyme which specifically converts IAA to its methyl ester form MelIAA. This gene belongs to the family of carboxyl methyltransferases whose members catalyze the transfer of the methyl group from S-adenosyl-L-methionine to carboxylic acid-containing substrates to form small molecule methyl esters. Expression of TCP genes is downregulated in mutant iamt1-D. SABATH methyltransferase. |
AT1G68100 | member of IAA-alanine resistance protein 1 |
AT1G44350 | encodes a protein similar to IAA amino acid conjugate hydrolase. |
AT5G54680 | basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11) |
AT5G54140 | encodes a protein similar to IAA amino acid conjugate hydrolase |
AT4G37550 | Indole-3-acetamide (IAM) hydrolase gene required for the auxin effects of IAM. |
AT4G30410 | sequence-specific DNA binding transcription factor;(source:Araport11) |
AT2G32320 | Interacts genetically with its homolog ICA1; alters growth and flowering time plasticity in relation to temperature. Mutants display effects on growth, flowering and plant development, and ploidy level depending on ambient temperature (effects specific at >27C). |
AT1G72270 | Encodes IDAP1. Acts together with IDAP2 and IDM1 to regulate active DNA demethylation. |
AT1G64790 | ILITHYIA (ILA) is a HEAT repeat protein involved in plant immunity. The gene is also involved in systemic acquired resistance induced by P. syringae expressing avrRps4. Loss-of-function mutants of ILA caused pleiotropic defects in the mutant plants. The mutant plants are smaller in size and the leaves are serrated and yellow to light green in color. Required for bacterium-triggered stomatal closure. |
AT4G09930 | Avirulence induced gene (AIG1) family protein;(source:Araport11) |
AT4G09950 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G33880 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
AT1G33900 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
AT1G33930 | One of a cluster of paralogs (IAN2-6) that are associated with variation in heat tolerance. |
AT1G33970 | IAN9 is a member of a small family of proteins. It's expression is repressed upon pathogen infection and loss of function mutants show increased resistance to bacterial pathogens. |
AT1G18670 | Encodes a cyclin-dependent kinase-like protein with a ser/thr protein kinase domain and an N-terminal myristoylation sequence. Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. |
AT1G51800 | The gene encodes a putative member of the LRR-RLK protein family. Expressin and mutant analysis revealed that it contributes to the interaction between Arabidopsis and Hyaloperonospora arabidopsidis. and The mRNA is cell-to-cell mobile. |
AT4G27640 | Nuclear import receptor for GRF-interacting factors (GIFs),roles in ovule development. |
AT1G48490 | Protein kinase which together with IREH1 plays an important role in controlling root skewing and maintaining the microtubule network. |
AT5G66730 | C2H2-like zinc finger protein;(source:Araport11) |
AT4G02670 | indeterminate(ID)-domain 12;(source:Araport11) |
AT1G68130 | Encodes the longer of two splice variants of a transcription factor involved in regulating starch metabolism in response to cold. |
AT2G02080 | C2H2 BIRD transcription factor family. |
AT2G02070 | RAVEN is part of the network regulated by BLJUEJAY, JACKDAW, SACRECROW and SHORT-ROOT to regulate root tissue patterning through cell lineage specification and asymmetric cell division. RAVEN is directly activated by SHORT-ROOT and directly repressed by JACKDAW. |
AT1G21100 | O-methyltransferase family protein;(source:Araport11) |
AT1G21120 | O-methyltransferase family protein;(source:Araport11) |
AT1G21110 | O-methyltransferase family protein;(source:Araport11) |
AT1G21130 | O-methyltransferase family protein;(source:Araport11) |
AT3G23050 | Transcription regulator acting as repressor of auxin-inducible gene expression. Plays role in the control of gravitropic growth and development in light-grown seedlings. Auxin induces the degradation of the protein in a dosage-dependent manner in a process mediated by AtRac1. Auxin induced the relocalization of the protein within the nucleus from a diffused nucleoplasmic pattern to a discrete particulated pattern named nuclear protein bodies or NPB in a process also mediated by Rac1. Colocalizes with SCF, CSN and 26S proteasome components. Pseudomonas syringae type III effector AvrRpt2 stimulates AXR2 protein turnover. |
AT4G14550 | IAA14 is a member of the Aux/IAA protein family. Involved in lateral root development. Gain of function mutation decreases auxin-inducible gene expression. Protein is localized to the nucleus. Expressed in stele and root tip epidermis. Functions as a negative regulator of ARF7/19. |
AT1G51950 | indole-3-acetic acid inducible 18;(source:Araport11) |
AT3G23030 | auxin inducible gene expressed in the nucleus |
AT5G25890 | encodes a protein that may be a negative regulator of lateral root formation in response to auxin. It is a member of IAA/ARF gene family and is plant-specific. Gain of function mutations in this gene suppresses lateral root formation and is resistant to inhibition of root elongation by auxin, cytokinin, and ethylene. |
AT3G62100 | Encodes a member of the Aux/IAA family of proteins implicated in auxin signaling. IAA30 lacks the conserved degron (domain II) found in many family members. IAA30 transcripts are induced by auxin treatment and accumulate preferentially in the quiescent center cells of the root meristem. Overexpression of IAA30 leads to defects in gravitropism, root development, root meristem maintenance, and cotyledon vascular development. Target of LEC2 and AGL15. Promotes somatyic embryogenesis. |
AT2G04550 | Encodes a protein phosphatase that interacts with MPK12, but not with other MAP kinases. It can dephosphorylate a dually phosphorylated MPK12 in vitro and can inactivate MPK12 in vivo. ibr5 mutants have reduced sensitivity to auxin and abscisic acid. IBR5 promotes auxin responses, including auxin-inducible transcription, differently than the TIR1 auxin receptor and without destabilizing Aux/IAA repressor proteins. It plays a role in male gametophyte development, auxin and TCP growth regulatory pathways. Regulates leaf serrations development via modulation of the expression of PIN1. |
AT2G22670 | Encodes a transcriptional repressor of the auxin response that is auxin inducible and is involved in lateral root formation. The mRNA is cell-to-cell mobile. |
AT3G09922 | Encodes a gene product whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT3G56370 | LRR-RLK with distinct polar localization within the plasma membrane in different cell types of the root. Mutants show defects in cell divisions within the root ground tissue. |
AT3G25655 | Similar to Inflorescence Deficient in Abscission (IDA). Involved in floral organ abscission. |
AT5G64667 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
AT5G09805 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
AT3G18715 | Similar to Inflorescance deficient in abscission (IDA). Involved in floral organ abscission. |
AT1G76952 | Similar to Inflorescence deficient in abscission (IDA). Involved in floral organ abscission. |
AT5G52200 | Encodes an inhibitor of protein phosphatase one (PP1). |
AT5G48820 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type and CDC2A cyclins and may inhibit cell cycle. Seven KRP genes were found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. |
AT2G46470 | inner membrane protein OXA1-like protein;(source:Araport11) |
AT4G33770 | Inositol pyrophosphate kinase. Catalyzes the phosphorylation of phytic acid (InsP6) to the symmetric InsP7 isomer 5-InsP7. |
AT4G16480 | Encodes a high affinity H+:myo-inositol symporter. The only other compound shown to be transported was pinitol, a methylated derivative of myo-inositol. The mRNA is cell-to-cell mobile. |
AT4G18010 | Encodes an inositol polyphosphate 5-phosphatase that appears to have Type I activity. It can dephosphorylate IP3(inositol(1,4,5)P3) and IP4 (inositol(1,3,4,5)P4), but it does not appear to be active against phosphatidylinositol 4,5 bisphosphate. Overexpression of this gene renders plants insensitive to ABA in germination and growth assays. |
AT5G42810 | Encodes an inositol tetra-/pentaphosphate 2-kinase, involved in the biosynthesis of phytic acid, a regulator of intracellular signaling, a highly abundant animal antinutrient, and a phosphate and mineral storage compound in plant seeds. Is also required for growth and modulates phosphate homeostasis at the transcriptional level. |
AT1G05630 | Encodes an inositol polyphosphate 5-phosphatase with phosphatase activity toward only Ins(1,4,5)P3. Induced in response to ABA and wounding treatments. Expressed in young seedlings and flowers, while no transcripts were detectable in maturated roots, stems, and rosette leaves Modulates the development of cotyledon veins through its regulation of auxin homeostasis. Involved in blue light light?stimulated increase in cytosolic calcium ion. |
AT5G46950 | One of of a pair of paralogous invertase with very high similarity.Expressed in female gametophyte and endosperm, particularly mycropylar endosperm. May function during embryogenesis to provide sugars to the developing embryo. |
AT1G29250 | Alba DNA/RNA-binding protein;(source:Araport11) |
AT3G09710 | Ca(2+)-dependent calmodulin-binding protein. Targeted to the nucleus. Involved in glucosinolate metabolism in response to biotic challenge. Expressed in vascular tissue.Member of IQ67 (CaM binding) domain containing family. |
AT3G59690 | Member of IQ67 (CaM binding) domain containing family. |
AT4G14750 | Member of IQ67 (CaM binding) domain containing family. |
AT3G49260 | IQ-domain 21;(source:Araport11) |
AT5G62070 | Member of IQ67 (CaM binding) domain containing family. |
AT4G29150 | Member of IQ67 (CaM binding) domain containing family. |
AT3G16490 | Member of IQ67 (CaM binding) domain containing family. |
AT2G26180 | Transient Expression of Pro35S:YFP-IQD5 in leaves of N. benthamiana alters microtubule organization.Member of IQ67 (CaM binding) domain containing family. |
AT5G26820 | Mutations in MAR1 confer resistance, while MAR1 overexpression causes hypersensitivity to multiple aminoglycoside antibiotics. Localizes to the chloroplast envelope. MAR1 may act as a plastid transporter involved in cellular iron homeostasis. The mRNA is cell-to-cell mobile. |
AT4G19690 | The gene encodes Fe2+ transporter protein. It is a member of the Zrt/Irt-like protein (ZIP) family of transporters. AtIRT1 has broad specificity for divalent heavy metals, mediating the transport of zinc, manganese, cobalt and cadmium under Fe-deficient conditions. IRT1 is monoubiquitinated to promote endocytic trafficking. The mRNA is cell-to-cell mobile. |
AT2G38080 | LAC4 appears to have laccase activity based on enzyme assays performed using lac4 mutants. These mutants also have reduced levels of lignin. LAC4 is expressed in vascular bundles and fibers and likely contributes to lignin biosynthesis, and hence cell wall biosynthesis, there. lac4/irx12 mutants have a mild irregular xylem phenotype. |
AT4G36890 | IRX14 was identified as MUCI64 in a reverse genetic screen for MUCILAGE-RELATED genes. IRX14/MUCI64 is a GT43 protein essential for xylan elongation in seed coat mucilage. The xylan backbone maintains the attachment of mucilage to the seed surface and the distribution of cellulose. It was identified based on its gene expression co-variance with the IRX3 gene involved in secondary cell wall synthesis. A biochemical assay using the irx14 mutant indicates that IRX14 might function in xylose chain elongation. |
AT5G67210 | Encode a DUF579 (domain of unknown function 579) containing protein essential for normal xylan synthesis and deposition in the secondary cell wall. |
AT2G39930 | Encodes an isoamylase-type debranching enzyme. Mutations in this gene cause the loss of detectable isoamylase activity and the disruption of normal starch structure. Mutants have reduced starch content and abnormally structured amylopectins and phytoglycogens. It has been postulated that AtISA1 interacts with AtISA2 to form the Iso1 complex. |
AT1G18870 | Encodes a protein with isochorismate synthase activity involved in phylloquinone biosynthesis. Mutant studies of this gene's function suggest that its function is redundant with that of ICS1 (AT1G7410). |
AT3G02780 | Encodes a protein with isopentenyl diphosphate:dimethylallyl diphosphate isomerase activity. There is genetic evidence that it functions in the mevalonate, but not the MEP biosynthetic pathway. |
AT1G68460 | Encodes a putative adenylate isopentenyltransferase. It catalyzes the formation of isopentenyladenosine 5'-monophosphate (iPMP) from AMP and dimethylallylpyrophosphate (DMAPP), but it has a lower Km for ADP and likely works using ADP or ATP in plants. It is involved in cytokinin biosynthesis. |
AT5G19040 | Encodes cytokinin synthase. |
AT3G23630 | Encodes an isopentenyl transferase involved in cytokinin biosynthesis. |
AT4G13430 | Encodes a methylthioalkylmalate isomerase involved in glucosinolate biosynthesis. |
AT2G14830 | Ist1p;(source:Araport11) |
AT1G51900 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT4G29440 | Regulator of Vps4 activity in the MVB pathway protein;(source:Araport11) |
AT1G75100 | Contains a J-domain at the C-terminus which is similar to the J-domain of auxilin, a clathrin-uncoating factor in cow, yeast and worm. Arabidopsis contains 6 other proteins similar to auxilin. Expressed in leaves and stems, but not in roots. Localized in the cytoplasm. Required for the chloroplast accumulation response, but not for the avoidance response. No molecular function known. Influences the composition of photosynthetic pigments, the efficiency of photosynthesis, and the CO2 uptake rate. Positive effect on water use efficiency (WUE) by reducing stomatal aperture and water vapor conductance; involved in the fine-tuning of H2O2 foliar levels, antioxidant enzymes activities and cell death after UV-C photooxidative stress. |
AT3G16430 | Encodes a protein that increases the beta-glucosidase activities of three scopolin glucosidases in vitro. |
AT3G16460 | Mannose-binding protein |
AT2G46370 | Encodes a jasmonate-amido synthetase that is a member of the GH3 family of proteins. JAR1 catalyzes the formation of a biologically active jasmonyl-isoleucine (JA-Ile) conjugate. JA-Ile promotes the interaction between JAZ1 and COI1 in the jasmonate signaling pathway. JAR1 localizes to the cytoplasm and is also a phytochrome A signaling component. JAR1 is an auxin-induced gene. Loss of function mutants are defective in a variety of responses to jasmonic acid. JAR1 has additional enzymatic activities in vitro, (e.g. the ability to synthesize adenosine 5'-tetraphosphate and other JA conjugates), but there are no data to show whether JAR1 catalyzes many of these reactions in vivo. JAR1 is involved in pathogen defense, sensitivity to ozone, and wound responses. |
AT3G22160 | VQ motif-containing protein. JAV1 is a repressor of jasmonate-mediated defense responses. |
AT2G38240 | One of 4 paralogs encoding a 2-oxoglutarate/Fe(II)-dependent oxygenases that hydroxylates JA to 12-OH-JA. |
AT1G19180 | JAZ1 is a nuclear-localized protein involved in jasmonate signaling. JAZ1 transcript levels rise in response to a jasmonate stimulus. JAZ1 can interact with the COI1 F-box subunit of an SCF E3 ubiquitin ligase in a yeast-two-hybrid assay only in the presence of jasmonate-isoleucine (JA-ILE) or coronatine. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ1:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. The Jas domain appears to be important for JAZ1-COI1 interactions in the presence of coronatine. Two positive residues (R205 and R206) in the Jas domain shown to be important for coronatine -dependent COI1 binding are not required for binding AtMYC2. The mRNA is cell-to-cell mobile. |
AT5G13220 | Plants overexpressing At5g13220.3, but not At5g13220.1 showed enhanced insensitivity to MeJa. |
AT3G17860 | JAZs are direct targets of the SCFCOI1 E3 ubiquitin-ligase and JA treatment induces their proteasome-mediated degradation. Furthermore, JAI3 negatively regulates the key transcriptional activator of JA responses, AtMYC2. The C-terminal portion of JAZ3, including the Jas domain, appears to be important for JAZ3-COI1 binding in the presence of coronatine. |
AT1G17380 | jasmonate-zim-domain protein 5;(source:Araport11) |
AT1G72450 | JAZ6 transcript levels rise in response to a jasmonate stimulus and a GFP:JAZ6 fusion protein localizes to the nucleus. Application of jasmonate methyl ester to Arabidopsis roots reduces the levels of a JAZ6:GUS fusion protein, presumably by stimulating ubiquitin-proteasome-mediated degradation. |
AT5G46910 | H3K27me3 demethylase involved in temperature and photoperiod dependent repressing of flowering. |
AT1G01790 | Encodes a member of the cation/proton antiporters-2 antiporter superfamily, the K efflux antiporter KEA1 that is localized to the chloroplast envelope. |
AT4G00630 | Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. |
AT5G11800 | member of Putative potassium proton antiporter family |
AT2G26650 | Encodes AKT1, a member of the Shaker family inward rectifying potassium channel predominantly expressed in predominantly in root hairs and root endodermis. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT1G31120 | potassium transporter |
AT1G70300 | potassium transporter |
AT5G16560 | Encodes a KANADI protein (KAN) that regulates organ polarity in Arabidopsis. KAN is required for abaxial identity in both leaves and carpels, and encodes a nuclear-localized protein in the GARP family of putative transcription factors. Together with KAN2, this gene appears to be involved in the development of the carpel and the outer integument of the ovule.Along with KAN2 and KAN4, KAN1 appears to be required for proper regulation of PIN1 in early embryogenesis. |
AT4G17695 | Homeodomain-like superfamily protein;(source:Araport11) |
AT1G11160 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT5G08390 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT5G23430 | One of four katanin p80 subunits. Involved in targeting of katanin complex to crossover and branch points to properly sever microtubules. |
AT3G61980 | Encodes a Kazal-type serine proteinase inhibitor that is highly expressed in seedlings and flowers. |
AT3G52890 | KCBP-interacting protein kinase interacts specifically with the tail region of KCBP |
AT2G17220 | Encodes a putative serine/threonine-specific protein kinase kin3. Protein is N-myristoylated. |
AT5G19280 | kinase associated protein phosphatase composed of three domains: an amino-terminal signal anchor, a kinase interaction (KI) domain, and a type 2C protein phosphatase catalytic region |
AT4G05190 | ATK5 encodes a kinesin protein involved in microtubule spindle morphogenesis. It acts as a minus-end directed motor as well as a plus-end tracking protein (+TIP). Localizes to mitotic spindle midzones and regions rich in growing plus-ends within phragmoplasts. |
AT1G21730 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G21380 | Kinesin motor family protein;(source:Araport11) |
AT5G10470 | Kinesin that binds cyclin-dependent kinase CDKA;1 as homodimer or as heterodimer with KCA2. Demarcates the division site in plant cells. |
AT3G44730 | kinesin-like protein 1;(source:Araport11) |
AT5G02520 | Arabidopsis KNL2 localizes at chromocenters during all stages of the mitotic cell cycle, except from metaphase to mid-anaphase, and its level is strictly regulated by the proteasome degradation pathway. Knockout of KNL2 via a T-DNA insertion resulted in a reduced amount of centromeric cenH3, mitotic and meiotic abnormalities, and reduced growth and fertility. |
AT3G19150 | Kip-related protein (KRP) gene, encodes CDK (cyclin-dependent kinase) inhibitor (CKI), negative regulator of cell division. Binds to D type cyclins. A member of seven KRP genes found in Arabidopsis thaliana. Differential expression patterns for distinct KRPs were revealed by in situ hybridization. KRP6 appears to be targeted for degradation by RHF1a and RHF2a to allow mitotic divisions during gametogenesis. In addition, KRP6 transcript levels rise prior to and drop following the meitotic divisions of gametogenesis. Elevated levels of KRP6 negatively affect plant development and fertility. |
AT1G15670 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB1, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. |
AT3G59940 | Encodes a member of a family of F-box proteins, called the KISS ME DEADLY (KMD) family, that targets type-B ARR proteins for degradation and is involved in the negative regulation of the cytokinin response. Also named as KFB50, a member of a group of Kelch repeat F-box proteins that negatively regulate phenylpropanoid biosynthesis by targeting the phenypropanoid biosynthesis enzyme phenylalanine ammonia-lyase. The mRNA is cell-to-cell mobile. |
AT1G70510 | A member of class I knotted1-like homeobox gene family (together with KNAT1). Similar to the knotted1 (kn1) homeobox gene of maize. KNAT2 acts synergistically with cytokinins and antagonistically with ethylene based on ectopic expression studies in different mutant backgrounds and hormone treatments. In addition, KNAT2 is negatively regulated by AS and YABBY genes. KNAT2 is strongly expressed in the shoot apex of seedlings, while in mature plants the gene is primarily expressed in flowers and inflorescence stems. |
AT1G74910 | KONJAC1 is imilar to sugar pyrophosphorylases but has an insertion of 2 AA in the pyrophosphorylase consensus motif that is highly conserved in GMPPs. It lacks GDP-mannose pyrophosphorylase activity but can simulate the GDP-mannose pyrophosphorylase activity of VTC1. |
AT1G65610 | Six-hairpin glycosidases superfamily protein;(source:Araport11) |
AT1G16970 | Ku80 and ku70 form the heterodimer complex Ku, required for proper maintenance of the telomeric C strand. Ku regulates the extension of the telomeric G strand. Interacts with WEX, and this interaction stimulates the WEX exonuclease activity. |
AT1G73260 | Encodes a trypsin inhibitor involved in modulating programmed cell death in plant-pathogen interactions. |
AT2G46750 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
AT5G11540 | Encodes a homolog of rat L-gulono-1,4-lactone (L-GulL) oxidase that is involved in the biosynthesis of L-ascorbic acid. |
AT2G46760 | D-arabinono-1,4-lactone oxidase family protein;(source:Araport11) |
AT1G01220 | Encodes a bifunctional enzyme that has both L-fucokinase and GDP-L-fucose pyrophosphorylase activities. It catalyzes the two steps of the L-fucose salvage pathway for the generation of activated GDP-L-fucose. This pathway seems to be of minor importance for cell wall polysaccharide biosynthesis compared to the de novo GDP-L-fucose biosynthesis pathway in Arabidopsis. |
AT3G24090 | Encodes a glutamine-fructose-6-phosphate transaminase that likely plays a role in UDP-N-acetylglucosamine biosynthesis. |
AT3G45330 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G60310 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G60320 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G45390 | LOW protein: L-type lectin-domain receptor kinase-like protein;(source:Araport11) |
AT3G45410 | encodes a receptor-like kinase that has serine/threonine kinase activity whose expression is induced by high salt stress. This induction is inhibited by tobacco ethylene receptor. |
AT3G45420 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G45440 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G60270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G60280 | Plasma membrane localized receptor kinase. Binds NAD+ and induces expression of disease resistance genes. |
AT5G59260 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G59270 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G29220 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G53810 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT4G02410 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G10530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT1G15530 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G32800 | protein kinase family protein;(source:Araport11) |
AT3G46760 | Protein kinase superfamily protein;(source:Araport11) |
AT3G55550 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G06740 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G43690 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT2G43700 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT3G59700 | Member of Receptor kinase-like protein family. Represses stomatal immunity induced by Pseudomonas syringae pv. tomato DC3000. |
AT5G01550 | Encodes LecRKA4.2, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
AT4G04960 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT4G28350 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G03140 | Concanavalin A-like lectin protein kinase family protein;(source:Araport11) |
AT5G01540 | Encodes LecRKA4.1, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. Positively regulates pattern-triggered immunity. |
AT4G28680 | Encodes a stress-induced tyrosine decarboxylase (TyrDC). Recombinant (His)6-TyrDC expressed in E. coli catalyzes the conversion of L-tyrosine to tyramine. Recombinant TyrDC forms tetramers. |
AT5G21160 | Encodes a protein with sequence similarity to mRNA binding proteins from humans. LARP1a is involved in mRNA degradation in response to heat stress. Upon heat stress LARP1a interacts with XRN4 and appears to be responsible for addressing XRN4 to the polysome. LARP1/XRN4 double mutants are impaired in thermotolerance and lower levels of heat induced RNA turnover. |
AT4G35890 | Encodes a cytoplasmic LAM domain containing protein that is involved in leaf senescence. The mRNA is cell-to-cell mobile. |
AT5G46250 | RNA-binding protein;(source:Araport11) |
AT5G01190 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G03260 | LAC11 is a putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G05390 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). |
AT5G60020 | LAC17 appears to have laccase activity based on enzyme assays performed using lac17 mutants. Notably, these mutants appear to have a reduced deposition of G lignin units. LAC17 is expressed in interfascicular fibers and likely contributes to lignin biosynthesis, and hence, cell wall biosynthesis, there. |
AT2G29130 | Putative laccase, knockout mutant had reduced root elongation under PEG-induced dehydration.miR397b regulates root lignin deposition by regulating LACCASE2 expression during drought and phosphate deficiency. |
AT2G40370 | putative laccase, a member of laccase family of genes (17 members in Arabidopsis). Together with DP1/DIR12 involved in neolignan biosynthesis via sinapoylcholine/feruloylcholine. |
AT3G25440 | RNA-binding CRS1 / YhbY (CRM) domain protein;(source:Araport11) |
AT1G13580 | Encodes a ceramide synthase that together with LOH1 is essential for production of ceramides containing Very Long Chain Fatty acid VLCFA-Ceramides(mainly C 22 to 26). |
AT1G18850 | PCP2 encodes a novel plant specific protein that is co-expressed with components of pre-rRNA processing complex. Co-localizes with NuGWD1 and SWA1. |
AT2G44060 | Late embryogenesis abundant protein, group 2;(source:Araport11) |
AT1G02820 | Late embryogenesis abundant 3 (LEA3) family protein;(source:Araport11) |
AT2G40170 | Encodes a group 1 LEA gene that is activated by direct binding of ABI5 to its promoter and is involved in response to ABA. Is required for normal seed development. Involved in regulating the timing of desiccation tolerance and rate of water loss during seed maturation. |
AT2G14560 | Encodes LURP1, a member of the LURP cluster (late upregulated in response to Hyaloperonospora parasitica) which exhibits a pronounced upregulation after recognition of the pathogenic oomycte H. parasitica. LURP1 is required for full basal defense to H. parasitica and resistance to this pathogen mediated by the R-proteins RPP4 and RPP5. The mRNA is cell-to-cell mobile. |
AT5G63090 | Involved in lateral organ development |
AT2G42430 | LOB-domain protein gene LBD16. This gene contains one auxin-responsive element (AuxRE). Regluates lateral root formation. |
AT1G55580 | Encodes a member of the GRAS family of putative transcriptional regulators. It is involved in the initiation of axillary meristems during both the vegetative and reproductive growth phases and functions upstream of REV and AXR1 in the regulation of shoot branching. |
AT1G77220 | LAZ1H1 is a DUF300 that is localized to the tonoplast. Along with LAZ1 it appears to play a role in maintaining the structural integrity of vacuoles and regulating BR signaling by modulating downstream subcellular distribution of BAK1. |
AT4G38360 | LAZ1 is a DUF300 domain protein that appears to function in vacuolar transport effecting brassinosteroid and programmed cell dealth signaling pathways. |
AT5G38210 | Protein kinase family protein;(source:Araport11) |
AT1G25390 | Protein kinase superfamily protein;(source:Araport11) |
AT1G66930 | Protein kinase superfamily protein;(source:Araport11) |
AT1G11755 | Encodes a cis-prenyltransferase, involved in dolichol biosynthesis. Wilted leaves in mutants due to cell membrane lesions. Mutants have increased drought tolerance, but hypersensitve to dark stress. |
AT5G01560 | Encodes LecRKA4.3, a member of the lectin receptor kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2 At5g01550; LecRKA4.3 At5g01560). Together with other members of the subfamily, functions redundantly in the negative regulation of ABA response in seed germination. |
AT1G02050 | Chalcone and stilbene synthase family protein;(source:Araport11) |
AT5G51410 | LUC7 N terminus domain-containing protein;(source:Araport11) |
AT3G59820 | LETM1-like protein;(source:Araport11) |
AT1G07650 | Leucine-rich repeat receptor-like kinase with extracellular malectin-like domain, which possesses cell death induction activity in plant leaves. |
AT4G22880 | encodes leucoanthocyanidin dioxygenase, which is involved in proanthocyanin biosynthesis. Mutant analysis suggests that this gene is also involved in vacuole formation. |
AT2G24200 | Cytosol aminopeptidase family protein;(source:Araport11) |
AT4G32551 | LEUNIG regulates floral organ identity,gynoecium and ovule development. Negatively regulates AGAMOUS . Encodes a glutamine-rich protein with seven WD repeats similar to transcriptional corepressors. |
AT2G32700 | Encodes a WD40 repeat and LUFS domain containing protein that is similar to LUG. Interacts physically with SEUSS and likely functions as part of a repressor complex that represses AG. Involved in cell wall modifications necessary for mucilage extrusion and mediates aluminium sensitivity through PECTIN METHYLESTERASE46-modulated root cell wall pectin methylesterification. |
AT3G04290 | Li-tolerant lipase 1;(source:Araport11) |
AT2G42610 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT1G07090 | LIGHT-DEPENDENT SHORT HYPOCOTYLS-like protein (DUF640);(source:Araport11) |
AT5G28490 | Encodes a nuclear protein that mediates light regulation of seedling development in a phytochrome-dependent manner. |
AT1G78600 | light-regulated zinc finger protein 1;(source:Araport11) |
AT3G01510 | Encodes a putative phosphatase, LSF1, required for normal starch turnover in leaves. |
AT2G15230 | Lipase active on medium and short chain triacylglycerols, but not on phospho- or galactolipids. Active between pH4 and 7 with an optimum at pH6. Knock-out mutant has not obvious phenotype. Predicted to be extracellular. |
AT3G50920 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon1) and LPPepsilon2, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
AT5G66450 | Encodes a phosphatidic acid phosphatase that can be detected in chloroplast membrane fractions. This gene (LPPepsilon2) and LPPepsilon1, appear to be less important for diacylglycerol formation in the plastids than LPPgamma. |
AT4G05210 | Trimeric LpxA-like enzymes superfamily protein;(source:Araport11) |
AT3G45140 | Chloroplast lipoxygenase required for wound-induced jasmonic acid accumulation in Arabidopsis.Mutants are resistant to Staphylococcus aureus and accumulate salicylic acid upon infection. The mRNA is cell-to-cell mobile. |
AT1G17420 | LOX3 encode a Lipoxygenase. Lipoxygenases (LOXs) catalyze the oxygenation of fatty acids (FAs). |
AT1G72520 | PLAT/LH2 domain-containing lipoxygenase family protein;(source:Araport11) |
AT5G65770 | Encodes a protein that localizes to the nuclear periphery and affects nuclear morphology. Member of a small gene family in Arabidopsis containing 4 proteins (LNC1-4 or CRWN 1-4) with redundant functions in protection from oxidative damage, control of nuclear morphology and degradation of ABI5. |
AT2G45450 | ZPR1, a small leucine zipper-containing protein that interacts with REV HD-ZIPIII and is involved in the establishment of leaf polarity. |
AT1G07900 | LOB domain-containing protein 1;(source:Araport11) |
AT2G28500 | LOB domain-containing protein 11;(source:Araport11) |
AT2G30340 | Lateral Organ Boundaries domain protein. LOB13 promotes lateral root formation. |
AT2G45410 | LOB domain-containing protein 19;(source:Araport11) |
AT3G11090 | LOB domain-containing protein 21;(source:Araport11) |
AT3G13850 | LOB domain-containing protein 22;(source:Araport11) |
AT3G26660 | LOB domain-containing protein 24;(source:Araport11) |
AT3G27940 | LOB domain-containing protein 26;(source:Araport11) |
AT4G00210 | LOB domain-containing protein 31;(source:Araport11) |
AT5G35900 | LOB domain-containing protein 35;(source:Araport11) |
AT3G02550 | LOB domain-containing protein 41;(source:Araport11) |
AT1G36000 | LOB domain-containing protein 5;(source:Araport11) |
AT2G19820 | LOB domain-containing protein 9;(source:Araport11) |
AT1G10920 | Encodes LOV1, a disease susceptibility gene that, paradoxically, is a member of the NBS-LRR resistance gene family. Conditions susceptibility to the fungus Cochliobolus victoriae and victorin-dependent induction of defense-associated proteins. Saturation mutagenesis identified 59 lov mutations that all display reduced susceptibility to vitorin. Mutations in known defense response pathways do not prevent susceptibility to C. victoriae. |
AT5G19080 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
AT3G06140 | Paralog of LOG2 (At3g09770), a ubiquitin ligase that regulates amino acid export. |
AT3G05780 | Encodes a member of the Lon protease-like proteins (Lon1/At5g26860, Lon2/At5g47040, Lon3/At3g05780, Lon4/At3g05790). Lon is a multifunctional ATP-dependent protease which exists in bacteria, archaea and within organelles in eukaryotic cells. Lon proteases are responsible for the degradation of abnormal, damaged and unstable proteins. |
AT2G28305 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT2G37210 | Encodes a protein of unknown function. It has been crystallized and shown to be structurally almost identical to the protein encoded by At5g11950. |
AT3G53450 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT4G35190 | Putative lysine decarboxylase family protein;(source:Araport11) |
AT5G03270 | lysine decarboxylase family protein;(source:Araport11) |
AT1G64625 | Encodes a plant-specific basic helix-loop-helix (bHLH) protein that is required for normal meiotic entry and the establishment of meiotic synchrony. It plays a role in xylem differentiation downstream of auxin. |
AT3G55850 | Encodes a product that might regulate nucleo-cytoplasmic trafficking of an intermediate(s) involved in phyA signal transduction. Differs from isoform 2 only in the first few N-terminal amino acids. |
AT1G77590 | Encodes major plastidic long chain acyl-CoA synthetase with a slight substrate preference of oleic acid over any of the other fatty acids. |
AT2G47240 | Encodes an acyl-CoA synthetase that acts on long-chain and very-long-chain fatty acids, involved in cuticular wax and cutin biosynthesis The mRNA is cell-to-cell mobile. |
AT1G49430 | Encodes a long chain acyl-CoA synthetase that catalyzes the synthesis of omega-hydroxy fatty acyl-CoA intermediates in the pathway to cutin synthesis. Required for repression of lateral root formation. |
AT1G64400 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT4G23850 | AMP-dependent synthetase and ligase family protein;(source:Araport11) |
AT2G46090 | Encodes a putative sphingosine kinase (SphK) containing the five conserved domains (C1-C5) previously identified in SphKs. |
AT5G15580 | Encodes LONGIFOLIA1 (LNG1). Regulates leaf morphology by promoting cell expansion in the leaf-length direction. The LNG1 homologue LNG2 (At3g02170) has similar function. |
AT4G28280 | LORELEI-LIKE-GPI ANCHORED PROTEIN 3;(source:Araport11) |
AT3G09770 | Encodes a ubiquitin E3 ligase LOG2 (LOSS OF GDU2). Required for GLUTAMINE DUMPER1(GDU1)-induced amino secretion. |
AT4G34120 | Encodes a single cystathionine beta-Synthase domain-containing protein. Modulates development by regulating the thioredoxin system. The mRNA is cell-to-cell mobile. |
AT1G56070 | encodes a translation elongation factor 2-like protein that is involved in cold-induced translation. Mutations in this gene specifically blocks low temperature-induced transcription of cold-responsive genes but induces the expression of CBF genes and mutants carrying the recessive mutations fail to acclimate to cold and is freezing sensitive. |
AT1G71040 | Encodes LPR2. Function together with LPR1 (AT1G23010) and a P5-type ATPase (At5g23630/PDR2) in a common pathway that adjusts root meristem activity to Pi (inorganic phosphate) availability. |
AT1G02910 | Mutants defective in this gene were shown to have a reduced PSII content (overall reduction in the levels of several PSII subunits) and a disrupted grana stack structure. The N-terminal half of the protein contains two tetratricopeptide repeat (TPR) motifs that are arranged tandemly, each consisting of a 34-residue degenerate consensus sequence. The N-terminal sequence is rich in positive and hydroxylated amino acid residues. |
AT1G75690 | Thylakoid Thiol/Disulfide-Modulating Protein. |
AT5G48905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G49435 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G11760 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G30074 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29285 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G29300 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G10535 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G28335 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G09984 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G09153 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G13095 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G19905 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G23167 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G14935 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G07005 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G42473 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT3G48231 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G28355 | low-molecular-weight cysteine-rich 5;(source:Araport11) |
AT4G30070 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT2G20208 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT4G30067 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT1G61070 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT2G02135 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G04425 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT2G14365 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
AT5G52300 | Encodes a protein that is induced in expression in response to water deprivation such as cold, high-salt, and desiccation. The response appears to be via abscisic acid. The promoter region contains two ABA-responsive elements (ABREs) that are required for the dehydration-responsive expression of rd29B as cis-acting elements. Protein is a member of a gene family with other members found plants, animals and fungi. Upregulation by P. polymyxa CR1 increases drought resistance. |
AT5G52310 | cold regulated gene, the 5' region of cor78 has cis-acting regulatory elements that can impart cold-regulated gene expression The mRNA is cell-to-cell mobile. |
AT1G32540 | Encodes a protein with 3 plant-specific zinc finger domains that acts as a positive regulator of cell death. |
AT4G21610 | Contains the same novel zinc finger motif with LSD1, a negative regulator of cell death and defense response. Due to differential splicing, it encodes two different proteins, one of which contains an additional, putative DNA binding motif. Northern analysis demonstrated that LOL2 transcripts containing the additional DNA binding motif are predominantly upregulated after treatment with both virulent and avirulent Pseudomonas syringae pv maculicola strains. |
AT5G57030 | Lutein-deficient 2 (LUT2) required for lutein biosynthesis, member of the xanthophyll class of carotenoids. Encodes lycopene epsilon cyclase |
AT4G35180 | LYS/HIS transporter 7;(source:Araport11) |
AT5G40780 | Encodes LHT1 (lysine histidine transporter), a high-affinity transporter for cellular amino acid uptake in both root epidermis and leaf mesophyll. |
AT4G33150 | This is a splice variant of the LKR/SDH locus. It encodes a bifunctional polypeptide lysine-ketoglutarate reductase and saccharopine dehydrogenase involved in lysine degradation. There is another splice variant that encodes a mono saccharopine dehydrogenase protein. Gene expression is induced by abscisic acid, jasmonate, and under sucrose starvation. |
AT3G14840 | Encodes LRR-RLK protein that is localized to the plasma membrane and is involved in regulation of plant innate immunity to microbes. LIK1 is phosphorylated by CERK1, a kinase involved in chitin perception. The mRNA is cell-to-cell mobile. |
AT2G17120 | Induction of chitin-responsive genes by chitin treatment is not blocked in the mutant. It contains a C-terminal GPI anchor signal and is an ortholog of OsCEBiP. |
AT2G23770 | Encodes a putative LysM-containing receptor-like kinase LYK4. Shares overlapping function with LYK5 in mediating chitin-triggered immune responses. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
AT2G33580 | Encodes a putative LysM-containing receptor-like kinase. LYK5 is a major chitin receptor and forms a chitin-induced complex with related kinase CERK1. Based on protein sequence alignment analysis, it was determined as a pseudo kinase due to a lack of the ATP-binding P-loop in the kinase domain. |
AT1G63050 | Encodes a lysophosphatidylcholine acyltransferase (LPCAT). Participates in the Lands cycle in developing seeds. Involved in triacylglycerol biosynthesis. |
AT4G15570 | Similar to yeast Sen1 (splicing endonuclease 1)helicase protein. Involved in female gametophyte development. The mRNA is cell-to-cell mobile. |
AT3G19640 | Transmembrane magnesium transporter. One of nine family members. |
AT1G03840 | MGP is a nuclear-localized putative transcription factor with three zinc finger domains. MGP can interact with three proteins implicated in root patterning: SCR, SHR, and JKD in Y2H assays, and these interactions depend on the first zinc finger in MGP. MGP appears to be a direct transcriptional target of SHR and SCR, based on promoter binding assays, though it is not expressed in the QC, based on in situ hybridizations. |
AT3G47810 | Homolog of yeast retromer subunit VPS29. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
AT3G47700 | Involved in transportation of seed storage proteins from the ER to the vacuole. Mutant seed cell accumulates the precursors of 12S globulin and 2S albumin instead of the vacuolar-located mature proteins. Member of MAG2 complex, involved in the development of vegetative organs. |
AT1G48120 | Encodes a nuclear localized aminotransferase-like protein containing a plant mobile domain. |
AT1G17930 | Mobile domain protein involved in silencing of transposable elements. Loss of function affects shoot and root meristem maintenance. Interacts and functions with MAIL1 and PP7L in gene silencing. |
AT4G34950 | Major facilitator superfamily protein;(source:Araport11) |
AT1G66170 | Encodes a PHD-domain containing protein required for male meiosis. Gene is expressed in developing male meiocytes and protein is localized to nuclear euchromatin specifically during diplotene. Required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. |
AT1G19890 | histone 3.3, male-gamete-specific expression. Direct target promoter of the male germline-specific transcription factor DUO1. |
AT4G20900 | Encodes a tetratricopeptide repeat protein required for cell cycle exit after meiosis II.ms5 mutants are male sterile, pollen tetrads undergo an extra round of division after meiosis II without chromosome replication, resulting in chromosome abnormalities. Gene product has some similarity to SCP1, a rat synaptonemal complex protein. |
AT4G27940 | manganese tracking factor for mitochondrial SOD2;(source:Araport11) |
AT1G51630 | O-fucosyltransferase family protein;(source:Araport11) |
AT1G78850 | curculin-like (mannose-binding) lectin family protein, low similarity to ser/thr protein kinase from Zea mays (GI:2598067); contains Pfam lectin (probable mannose binding) domain PF01453 but not the protein kinase domain of the Z. mays protein. Belongs to GNA domain lectin family. Enhances PAP26 function to facilitate Pi-scavenging by Pi-starved plants. |
AT5G43710 | Glycosyl hydrolase family 47 protein;(source:Araport11) |
AT1G01560 | Member of MAP Kinase family. Flg22-induced activation is blocked by AvrRpt2. |
AT2G01450 | MPK17 Map kinase family member. Mutants have increased numbers of peroxisomes a phenotype that can be suppressed by mutations in PMD1. This and other treatments, suggests a function in control of peroxisome proliferation in salt stress. |
AT3G14720 | member of MAP Kinase The mRNA is cell-to-cell mobile. |
AT2G42880 | member of MAP Kinase |
AT4G01370 | Encodes a nuclear and cytoplasmically localized MAP kinase involved in mediating responses to pathogens. Its substrates include MKS1 and probably MAP65-1.The MAP65-1 interaction is involved in mediating cortical microtuble organization. Required for male-specific meiotic cytokinesis. The mRNA is cell-to-cell mobile. |
AT2G43790 | Encodes a MAP kinase induced by pathogens, ethylene biosynthesis, oxidative stress and osmotic stress.Also involved in ovule development. Homozygous mutants in a MPK3 heterozygous background are female sterile due to defects in integument development.MPK6 appears to be associated with the microsomal compartment and may be involved in mediating secretory processes. The mRNA is cell-to-cell mobile. |
AT4G29810 | encodes a MAP kinase kinase 2 that regulates MPK6 and MPK4 in response to cold and salt stresses. Co-expression with MEKK1 in protoplasts activated MKK2 activity, suggesting that MEKK1 may be a regulator of MKK2. |
AT3G18690 | Encodes a nuclear-localized member of a plant specific gene family involved in mediating responses to pathogens. Interacts with WRKY transcriptional regulators. |
AT4G26070 | Member of MAP Kinase Kinase. Likely functions in a stress-activated MAPK pathway. Can phosphorylate the MAPK AtMPK4, in response to stress. Gets phosphorylated by MEKK1 in response to wounding. |
AT1G15400 | Tightly connected with MAPK signaling to fine-tune stomatal production and patterning. |
AT5G11850 | MAP3 kinase involved phosphorylation of a critical Ser171 for OST1/SnRK2.6 activation. |
AT2G41970 | Encodes MRI, a plasma membrane-localized member of the RLCK-VIII subfamily. Preferentially expressed in both pollen tubes and root hairs. mri-knockout mutants display spontaneous pollen tube and root-hair bursting. |
AT5G42600 | Encodes an oxidosqualene synthase that produces the monocyclic triterpene marneral. Crucial for growth and development. |
AT2G15890 | Encodes CBP1, a regulator of transcription initiation in central cell-mediated pollen tube guidance. |
AT2G18650 | RING/U-box superfamily protein;(source:Araport11) |
AT2G34790 | Encodes a BBE-like enzyme that acts in monolignol metabolism by catalyzing the oxidation of aromatic allylic alcohols, such as coumaryl-, sinapyl-, and coniferyl alcohol, to the corresponding aldehydes. |
AT2G34870 | hydroxyproline-rich glycoprotein family protein;(source:Araport11) |
AT3G06350 | Encodes a bi-functional dehydroquinate-shikimate dehydrogenase enzyme that catalyzes two steps in the chorismate biosynthesis pathway. |
AT3G11270 | Mov34/MPN/PAD-1 family protein;(source:Araport11) |
AT3G46330 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT1G04630 | GRIM-19 protein;(source:Araport11) |
AT4G00060 | Nucleotidyltransferase family protein;(source:Araport11) |
AT4G00950 | hypothetical protein (DUF688);(source:Araport11) |
AT4G13345 | Serinc-domain containing serine and sphingolipid biosynthesis protein;(source:Araport11) |
AT5G45800 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT2G02240 | F-box family protein;(source:Araport11) |
AT1G70170 | Matrix metalloprotease. Expression induced by fungal and bacterial pathogens. Mutants are late flowering with early senescence. |
AT4G08850 | MIK1 encodes a receptor kinase that forms a complex with MDIS1/MIK2 and binds LURE1, the female pollen guidance chemi-attractant. MIK1 phosphorylates MDIS1 and is autophosphorylated. |
AT1G78610 | mechanosensitive channel of small conductance-like 6;(source:Araport11) |
AT5G20170 | RNA polymerase II transcription mediator;(source:Araport11) |
AT1G23230 | Mediator tail subunit, involved in transcriptional regulation. Mediator Complex Subunit, interacts with MED2, MED5, MED16 in the Regulation of Phenylpropanoid Biosynthesis. |
AT5G09850 | Transcription elongation factor (TFIIS) family protein;(source:Araport11) |
AT5G38990 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT5G39000 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT5G39020 | Involved in growth adaptation upon exposure to metal ions. Contributes together with the other MDS genes to the complex network of CrRLK1Ls that positively and negatively affect growth. |
AT1G37140 | Amember of mei2-like gene family; phylogenetic analysis revealed that it belongs to the fourth clade of mei2-like proteins, with conserved C-terminal RNA recognition motif (RRM) only. MCT1 expression is increased in the presence of ABA and RNAi suppression showed increased germination rates in the presence of ABA. |
AT1G29400 | A member of mei2-like gene family, predominantly plant-based family of genes encoding RNA binding proteins with characteristic presence of a highly conserved RNA binding motif first described in the mei2 gene of the fission yeast S. pombe. In silico analyses reveal nine mei2 -like genes in A. thaliana. They were grouped into four distinct clades, based on overall sequence similarity and subfamily-specific sequence elements. AML5 is a member of two sister clades of mei2-like gene family, AML1 through AML5, and belongs to the clade named ALM235. Among mei2-like genes, AML5 is the transcript with highest frequency of alternative splicing. Expression was detected during embryo development (heart and torpedo stage) and in vegetative and floral apices. |
AT5G24290 | Vacuolar iron transporter (VIT) family protein;(source:Araport11) |
AT5G15460 | membrane-anchored ubiquitin-fold protein 2;(source:Araport11) |
AT3G26980 | membrane-anchored ubiquitin-fold protein 4 precursor;(source:Araport11) |
AT5G26230 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G52870 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G52900 | Encodes a member of the MAKR (MEMBRANE-ASSOCIATED KINASE REGULATOR) gene family. MAKRs have putative kinase interacting motifs and membrane localization signals. Known members include: AT5G26230 (MAKR1), AT1G64080 (MAKR2), AT2G37380 (MAKR3), AT2G39370 (MAKR4), AT5G52870 (MAKR5) and AT5G52900 (MAKR6). |
AT5G54110 | Encodes a highly polar protein with more than 60% hydrophilic amino acid residues that is associated with the plasma membrane. It has limited secondary structure similarity to VAP-33 from Aplysia, which may be involved in membrane trafficking. The mRNA is cell-to-cell mobile. |
AT2G36900 | member of Membrin Gene Family |
AT4G21750 | Encodes a homeobox protein similar to GL2. It is expressed in both the apical and basal daughter cells of the zygote as well as their progeny. Expression is detected starting the two-celled stage of embryo development and is later restricted to the outermost, epidermal cell layer from its inception. Its promoter is highly modular with each region contributing to specific aspects of the gene's spatial and temporal expression. Double mutant analysis with PDF2, another L1-specific gene, suggests that their functions are partially redundant and the absence of both of the genes result in abnormal shoot development. |
AT3G56100 | Protein kinase expressed in meristematic cells. Phosphorylates AGL24. |
AT5G11880 | Meso-diaminopimelate decarboxylase which catalyzes the decarboxylation of mesodiaminopimelate, the final reaction in the diaminopimelate L-lysine biosynthetic pathway. |
AT4G25110 | Encodes a type I metacaspase. Two Arabidopsis metacaspases, AT1G02170 (MC1) and AT4G25110 (MC2) antagonistically control programmed cell death in Arabidopsis. MC1 is a positive regulator of cell death and requires conserved caspase-like putative catalytic residues for its function. MC2 negatively regulates cell death. This function is independent of the putative catalytic residues. A third type I Arabidopsis metacaspase is MC3 (AT5g64240). |
AT1G79330 | Metacaspase AtMCPb2/AMC6. Caspase family protein. Arginine/lysine-specific cysteine protease activity. Induces apoptosis in yeast. Contains Pfam domain, PF00656: ICE-like protease (caspase) p20 domain. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
AT1G79320 | Encodes a putative metacaspase. Arabidopsis contains three type I MCP genes (MCP1a-c) and six type II MCP genes (MCP2a?f): AtMCP1a/At5g64240, AtMCP1b/At1g02170, AtMCP1c/At4g25110, AtMCP2a/At1g79310, AtMCP2b/At1g79330, AtMCP2c/At1g79320, AtMCP2d/At1g79340, AtMCP2e/At1g16420, AtMCP2f/At5g04200. |
AT3G58810 | Member of Zinc transporter (ZAT) family. Contributes to basic cellular Zn tolerance and controls Zn partitioning, particularly under conditions of high rates of Zn influx into the root symplasm. Localizes to the vacuolar membrane. |
AT3G12100 | Cation efflux family protein;(source:Araport11) |
AT1G07600 | metallothionein, binds to and detoxifies excess copper and other metals, limiting oxidative damage. |
AT3G25740 | Encodes a plastid localized methionine aminopeptidase. Formerly called MAP1C, now called MAP1B. |
AT2G44180 | Encodes a MAP2 like methionine aminopeptidase. In MAP1A mutant background plants show an increased sensitivity to fumagillin resulting in defects in development. Phenotype is similar to RNAi lines which knock out all MAP2/MAP1 loci. |
AT3G01120 | encodes a cystathionine gamma-synthase, which performs the first committed step in methionine biosynthesis. A conserved motif of 13 amino acids in the first exon is required for posttranscriptional autoregulation. This enzyme shares the same substrate as threonine synthase (TS) and its absence transcriptionally affects 8 genes in the genome. |
AT5G49810 | Arabidopsis thaliana methionine S-methyltransferase, an enzyme that catalyzes S -methylmethionine formation. The mRNA is cell-to-cell mobile. |
AT4G21830 | methionine sulfoxide reductase B7;(source:Araport11) |
AT4G21850 | methionine sulfoxide reductase B9;(source:Araport11) |
AT3G03780 | Encodes a cytosolic methionine synthase, involved in methionine regeneration via the activated methyl cycle (or SAM cycle) |
AT5G17920 | Encodes a cytosolic cobalamin-independent methionine synthase, involved in methionine regeneration via the activated methyl cycle (SAM cycle). The protein undergoes thiolation following treatment with the oxidant tert-butylhydroperoxide. The mRNA is cell-to-cell mobile. |
AT1G33990 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco. This protein does not act on methyl IAA, methyl JA, MeSA, MeGA4, or MEGA9 in vitro. |
AT1G69240 | Encodes a protein predicted to act as a carboxylesterase. It has similarity to the SABP2 methyl salicylate esterase from tobacco but no enzymatic activity has been identified for this protein. |
AT3G10870 | Encodes a methyl IAA esterase. Methyl IAA is believed to be an inactive form of auxin that needs to be demethylated to exert a biological effect. MES17 does not act on methyl JA, MeSA, MeGA4, or MEGA9 in vitro. This gene is expressed in several tissues of seedlings and adult plants, with a higher relative level of expression in the seedling shoot apex and the adult stem. |
AT4G22745 | Protein containing methyl-CpG-binding domain. |
AT3G15790 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT4G00416 | Protein containing methyl-CpG-binding domain.Has sequence similarity to human MBD proteins. |
AT3G02790 | zinc finger (C2H2 type) family protein;(source:Araport11) |
AT3G59970 | methylenetetrahydrofolate reductase MTHFR1 mRNA, complete |
AT2G44160 | methylenetetrahydrofolate reductase MTHFR2 mRNA, complete The mRNA is cell-to-cell mobile. |
AT1G18500 | Encodes an active Arabidopsis isopropylmalate synthase IPMS1. Involved in leucine biosynthesis. Do not participate in the chain elongation of glucosinolates. Expressed constitutively throughout the plant. Loss of IPMS1 can be compensated by a second isopropylmalate synthase gene IPMS2 (At1g74040). The mRNA is cell-to-cell mobile. |
AT5G49160 | Encodes a cytosine methyltransferase MET1. Required for silencing of FWA paternal allele in endosperm. Two lines with RNAi constructs directed against DMT1 have reduced agrobacterium-mediated tumor formation. The mRNA is cell-to-cell mobile. |
AT2G38700 | Encodes mevalonate diphosphate decarboxylase, the enzyme that catalyzes the synthesis of isopentenyl diphosphate, used in sterol and isoprenoid biosynthesis. The protein appears to form a homodimeric complex. Incidentally, it was shown that the Arabidopsis MVD protein could also interact with its yeast homolog to form a heterodimer. |
AT5G10945 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGACAGAAGAGAGUGAGCAC |
AT1G66783 | Encodes a microRNA that targets several SPL family members, including SPL3,4, and 5. By regulating the expression of SPL3 (and probably also SPL4 and SPL5), this microRNA regulates vegetative phase change. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGACAGAAGAUAGAGAGCAC |
AT2G39175 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). Hypomorphic mutants exhibit defects in embryo, vegetative and floral development.MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160a (converted to TAIR10 based on PMID19304749): Chr2: 16339853-16341886 (forward), length: 2034 bp; exon coordinates: exon 1: 16339853 to 16340469, exon 2: 16341621 to 16341886; mature miRNA and miRNA* are located on exon 1. |
AT4G17788 | Encodes a microRNA that targets several ARF family members (ARF10, ARF16, ARF17). MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCUGGCUCCCUGUAUGCCA. Pri-mRNA coordinates for MIR160b (converted to TAIR10 based on PMID19304749): Chr4: 9888799-9889176 (forward), length: 378 bp; exon coordinates: exon 1: 9888799-9889176; mature miRNA and miRNA* are located on exon 1.The miR160b pri-mRNA also encodes a regulatory peptide miPEP160b (AT4G17787) that regulates accumulation of its own miRNA |
AT5G08185 | Encodes a microRNA that targets DCL1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGAUAAACCUCUGCAUCCAG |
AT1G01183 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUCCCC. Accumulation of the pri-miRNA165a transcript is increased by the activity of the miPEP165 peptide which is encoded within the pri-miRNA165a transcript. |
AT2G46685 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. This particular miRNA is involved in the regulation of vascular development in inflorescence stems, primarily through the regulation of mRNA cleavage of the class III homeodomain-leucine zipper transcription factor ATHB15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166a (converted to TAIR10 based on PMID19304749): Chr2: 19175959-19177071 (forward), length: 1113 bp; exon coordinates: exon 1: 19175959 to 19176341, exon 2: 19176820 to 19177071; mature miRNA and miRNA* are located on exon 1. |
AT3G61897 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGGACCAGGCUUCAUUCCCC. Pri-mRNA coordinates for MIR166b (converted to TAIR10 based on PMID19304749): Chr3: 22921936-22923122 (forward), length: 1187 bp; exon coordinates: exon 1: 22921936 to 22922389, exon 2: 22922485 to 22922566, exon 3: 22922653 to 22923122; mature miRNA and miRNA* are located on exon 1. |
AT5G41905 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT5G43603 | Encodes a microRNA that targets several HD-ZIPIII family members including PHV, PHB, REV, ATHB-8, and ATHB-15. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCGGACCAGGCUUCAUUCCCC |
AT3G22886 | Encodes a microRNA that targets ARF family members ARF6 and ARF8. Essential for fertility of both ovules and anthers. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGAAGCUGCCAGCAUGAUCUA. Pri-mRNA coordinates for MIR167a (converted to TAIR10 based on PMID19304749): Chr3: 8108021-8108622 (forward), length: 602 bp; exon coordinates: exon 1: 8108021 to 8108622; mature miRNA and miRNA* are located on exon 1. |
AT4G19395 | Encodes a microRNA that targets AGO1. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCGCUUGGUGCAGGUCGGGAA. MIR168a is highly expressed and predominantly produces a 21-nt miR168 species. By contrast, MIR168b is expressed at low levels and produces an equal amount of 21- and 22-nt miR168 species. Only the 21-nt miR168 is preferentially stabilized by AGO1, and consequently, the accumulation of the 22-nt but not the 21-nt miR168 is reduced when DCL1 activity is impaired. mir168a mutants with strongly reduced levels of 21-nt miR168 are viable but exhibit developmental defects, particularly during environmentally challenging conditions. |
AT1G53687 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAGCCAAGGAUGACUUGCCG |
AT1G19371 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
AT3G26812 | Encodes a microRNA that targets several HAP2 family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAGCCAAGGAUGACUUGCCUG |
AT3G23125 | Encodes a microRNA that targets the TAS1 and TAS2 families of tasiRNA-generating transcripts. Cleavage of TAS1 and TAS2 transcripts by miR173 initiates processing of these transcripts in a 21-nucleotide register. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCGCUUGCAGAGAGAAAUCAC |
AT4G23713 | Encodes a microRNA that targets several TCP family members controlling leaf development. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGACUGAAGGGAGCUCCCU. The miR319a pri-mRNA also encodes a regulatory peptide miPEP319a (AT4G23712) that regulates accumulation of its own miRNA. |
AT1G76135 | Encodes a microRNA that targets one member of the F-box family. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGCAUUCUGUCCACCUCC. It targets F-box protein AT1g27340. It is involved in the regulation of leaf morphology. |
AT5G35407 | Encodes a microRNA that targets several GRF family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUCCACAGCUUUCUUGAACUU. Expression increased with leaf development, antagonizing with expression of GRFs. Transcript accumulates in the distal zone of young developing seeds, restricing the expression of GRF2 to the proximal part. miR396 attenuates cell proliferation in developing leaves through the repression of GRF activity and a decrease in the expression of cell cycle genes. |
AT4G05105 | Encodes a microRNA that targets several Laccase family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UCAUUGAGUGCAGCGUUGAUG |
AT2G34208 | Encodes a phosphate starvation-responsive microRNA that targets PHO2, an E2-UBC that negatively affects shoot phosphate content. Also modulates plant responses to salt, ABA, and drought. miR399 can be negatively regulated by members of the non-coding gene families IPS1 and At4. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGCCAAAGGAGAUUUGCCCGG |
AT1G32582 | Encodes a microRNA of unknown function that is predicted to target PPR family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UAUGAGAGUAUUAUAAGUCAC |
AT2G32698 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence:TTTAAATCATATACTTTTGGT |
AT4G03455 | Encodes a microRNA that targets several 2-phosphoglycerate kinase-related family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UUGGGGACGAGAUGUUUUGUUG |
AT1G35501 | Encodes a microRNA that targets MET2. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUGCUUCCAGCUUUUGUCUC |
AT2G41616 | Encodes a microRNA that targets several SET domain-containing genes including SUVH6. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UGGCUUGGUUUAUGUACACCG |
AT4G14811 | Encodes a microRNA that targets CHX18. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCUUCGUGAAUAUCUGGCA |
AT3G59884 | Encodes a microRNA that targets several SPX C3HC4 RING zinc finger family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUAGAUGACCAUCAACAAACU |
AT1G32713 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CAAAUUAAAGCUUCAAGGUAG |
AT1G67481 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UACCAACCUUUCAUCGUUCCC |
AT4G23387 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CGGCUCUGAUACCAAUUGAUG |
AT1G71002 | Encodes a microRNA that targets several MYB family members. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUUCGUUGUCUGUUCGACCUU. Regulates flavonoid-specific MYB transcription factor genes resulting in resistance to pathogen infection. |
AT4G13494 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UUGAGAGCAACAAGACAUAAU |
AT5G39693 | Encodes a microRNA of unknown function. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: UCUGGUGUUGAGAUAGUUGAC |
AT2G35630 | Member of the MAP215 family of microtubule-associated proteins required to establish interphase arrays of cortical microtubules.Mutants have defects in cytokinesis during pollen development. Vegetative phenotypes observed in temperature sensitive mutants include left-handed organ twisting, isotropic cell expansion and impairment of root hair polarity. The mRNA is cell-to-cell mobile. |
AT2G38720 | microtubule-associated protein 65-5;(source:Araport11) |
AT2G01750 | Encodes a microtubule associated protein (MAP70-3). Expressed in all tissues. |
AT1G14840 | Encodes a microtubule associated protein (MAP70-4). Expressed in all tissues. |
AT2G17780 | Encodes a mechanosensitive channel candidate MCA2. The three-dimensional structure of MCA2 was reconstructed and appears to comprise a small transmembrane region and large cytoplasmic region. |
AT3G51660 | Chemokine-like MDL protein; modulate flowering time and innate immunity in plants. |
AT2G39200 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in root tips and cotyledon vascular system, in floral organs (anthers and stigma), and in fruit abscission zone, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G26700 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO14 belongs to the clade I, with AtMLO4 and AtMLO11. The gene is expressed during early seedling growth, in developing primary root, and particularly in root tips of 10-day old seedlings; it was not expressed in leaves or flowers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT2G44110 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO15 belongs to the clade II, with ATMLO13 and ATMLO15. The gene is expressed during early seedling growth, in root tips and flower (papillae, anthers and pollen grains), as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G11310 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO2 belongs to the clade IV, with AtMLO3, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in roots, in vascular system of cotyledons and young leaves,and in fruit abscission zone; it was not expressed in anthers and pollen, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). mlo resistance in A. thaliana does not involve the signaling molecules ethylene, jasmonic acid or salicylic acid, but requires a syntaxin, glycosyl hydrolase and ABC transporter. It is a novel virulence target of the P. syringae type III secreted effector HopZ2. |
AT3G45290 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO3 belongs to the clade IV, with AtMLO2, AtMLO6 and AtMLO12. The gene is expressed during early seedling growth, in primary root and lateral root primordia, in fruit abscission zone, in vascular system of cotyledons and in trichomes of young leaves,; it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G11000 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO4 belongs to the clade I, with AtMLO11 and AtMLO14. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of root, cotyledons and young leaves, it was not expressed in mature rosette leaves, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G61560 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO6 belongs to the clade IV, with AtMLO2, AtMLO3 and AtMLO12. The gene is expressed during early seedling growth, in roots and lateral root primordia, in flower and fruit abscission zone, in vascular system of cotyledons, young leaves and petals, in mature rosette leaves, in anthers, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT2G17430 | A member of a large family of seven-transmembrane domain proteins specific to plants, homologs of the barley mildew resistance locus o (MLO) protein. Controls pollen tube reception in synergids. The Arabidopsis genome contains 15 genes encoding MLO proteins, with localization in plasma membrane. Phylogenetic analysis revealed four clades of closely-related AtMLO genes. ATMLO7 belongs to the clade III, with AtMLO5, AtMLO8, AtMLO9, and AtMLO10. The gene is expressed in vegetative organs (RT-PCR experiments)and in pollen grains, as shown by GUS activity patterns. The expression of several phylogenetically closely-related AtMLO genes showed similar or overlapping tissue specificity and analogous responsiveness to external stimuli, suggesting functional redundancy, co-function, or antagonistic function(s). |
AT1G74660 | Encodes MINI ZINC FINGER 1 (MIF1) which has a zinc finger domain but lacks other protein motifs normally present in transcription factors. MIF1 physically interact with a group of zinc finger-homeodomain (ZHD) transcription factors, such as ZHD5 (AT1G75240), that regulate floral architecture and leaf development. Gel mobility shift assays revealed that MIF1 blocks the DNA binding activity of ZHD5 homodimers by competitively forming MIF1-ZHD5 heterodimers. Constitutive overexpression of MIF1 caused dramatic developmental defects, seedlings were non-responsive to gibberellin (GA) for cell elongation, hypersensitive to the GA synthesis inhibitor paclobutrazol (PAC) and abscisic acid (ABA), and hyposensitive to auxin, brassinosteroid and cytokinin, but normally responsive to ethylene. |
AT3G14395 | Protein Involved in the Regulation of Herbivore-Associated Signaling Pathways, affecting the expression of genes involved in biosynthesis and signaling of the jasmonic acid and salicylic acid hormones. |
AT1G65290 | Encodes a member of the mitochondrial acyl carrier protein (ACP) family that forms part of the membrane arm of mitochondrial complex and contributes to the mitochondrial respiratory chain. The mRNA is cell-to-cell mobile. The designations of mtACP-1 and mtACP-2 in Klusch et al. 2021 (DOI:10.1093/plcell/koab092)are flipped with respect to the nomenclature published by Meyer et al. 2007 (DOI:10.1007/s11103-007-9156-9). |
AT4G37910 | mitochondrial heat shock protein 70-1;(source:Araport11) |
AT1G66345 | Pentatricopeptide Repeat Protein involved in splicing of nad4 intron which affects biogenesis of the respiratory complex I. |
AT5G64710 | Putative endonuclease or glycosyl hydrolase;(source:Araport11) |
AT5G20090 | MPC1 negatively regulates ABA enhanced slow anion channel function during stomatal closure. |
AT3G13930 | Encodes a subunit of the mitochondrial pyruvate dehydrogenase complex. |
AT4G35490 | mitochondrial ribosomal protein L11;(source:Araport11) |
AT1G74120 | Encodes a mitochondrial transcription termination factor mTERF15. Required for mitochondrial nad2 intron 3 splicing and functional complex I activity. |
AT1G59580 | encodes a mitogen-activated kinase involved in innate immunity The mRNA is cell-to-cell mobile. |
AT5G40440 | Encodes a mitogen-activated protein kinase kinase. Activates MPK8 and is a target of MPKKK20. Mutant root growth is sensitive oryzalin and suggestive of a role in signaling during microtubule organization. |
AT1G07150 | Member of MEKK subfamily. Involved in wound induced signaling where it interacts with At5g40440, and activates At1g59580. |
AT2G30040 | Member of MEKK subfamily. Induced by jasmonic acid and wounding in involved in insectivory response signaling. Iinteracts with At5g40440, and activates At1g59580. |
AT5G55090 | member of MEKK subfamily |
AT4G26890 | Member of MEKK subfamily. Involved in wound response signaling. Interacts with At5g40440, and activates At1g59580. |
AT5G66850 | Encodes a member of the MEKK subfamily that functions redundantly with MAPKKK3 to activate MPK3/6 downstream of multiple pattern recognition receptors and confer resistance to both bacterial and fungal pathogens. |
AT3G55270 | Encodes MAP kinase phosphatase 1 (MKP1). Loss of MKP1 results in hypersensitivity to acute UV-B stress, but without impairing UV-B acclimation. |
AT1G01453 | HeLo domain-containing mixed lineage kinase domain-like protein (MLKL). A pseudokinase, mediates necroptotic cell death in animals. |
AT2G01520 | Encodes a cis-cinnamic acid responsive gene that is a member of the major latex protein-like gene family and plays a role in promoting vegetative growth and delaying flowering. The mRNA is cell-to-cell mobile. |
AT1G70850 | MLP-like protein 34;(source:Araport11) |
AT1G70660 | MMZ2/UEV1B encodes a protein that may play a role in DNA damage responses and error-free post-replicative DNA repair by participating in lysine-63-based polyubiquitination reactions. UEV1A can form diubiquitin and triubiquitin chains in combination with UBC13A/UBC35 in vitro. It can also functionally complement an mms2 mutation in budding yeast, both by increasing mms2 mutant viability in the presence of the DNA damaging agent MMS, and by reducing the rate of spontaneous DNA mutation. However, a combination of MMZ2/UEV1B and UBC13A do not do a good job of rescuing an mms2 ubc13 double mutant in yeast. MMZ2/UEV1B transcripts are found in most plant organs, but not in the pollen or in seedlings 6 hours or 2 days post-germination. The transcript levels do not appear to be stress-inducible. The mRNA is cell-to-cell mobile. |
AT5G45550 | Encodes a gene product involved in both sporogenesis and gametogenesis and is required for the normal progression of megasporogenesis and microsporogenesis. Additional alleles were isolated in a screen for enhancers of PID and genetic analysis indicates a role for MOB1A in auxin mediated signaling. |
AT1G54030 | Encodes a vacuolar protein. Mutation causes organizational defects in the endoplasmic reticulum and aberrant protein trafficking in the plant secretory pathway. The mRNA is cell-to-cell mobile. |
AT4G24680 | Encodes MOS1 (MODIFIER OF snc1). MOS1 contains a BAT2 domain that is conserved in plants and animals. MOS1 associates with the promoter of SNC1 and regulates its expression. |
AT5G02770 | Encodes a conserved eukaryotic protein with homology to the human RNA binding protein CIP29 that localizes to the nucleus. Mutants accumulate more poly(A) mRNAs in the nucleus, likely resulting from reduced mRNA export activity. |
AT5G05680 | Encodes MOS7 (Modifier of snc1,7), homologous to human and Drosophila melanogaster nucleoporin Nup88. Resides at the nuclear envelope. Modulates the nuclear concentrations of certain defense proteins regulates defense outputs. |
AT5G62600 | Encodes a nuclear importer of serine-arginine rich (SR) proteins and is involved in the regulation of splicing of R genes by regulating the import of the SR proteins into the nucleus. |
AT1G31720 | chitin synthase, putative (DUF1218);(source:Araport11) |
AT4G19370 | chitin synthase, putative (DUF1218);(source:Araport11) |
AT2G25680 | Encodes a high-affinity molybdate transporter. Mutant has reduced concentrations of molybdate in roots and shoots, and reduced shoot and root length when growing on Mo-limited medium. |
AT1G80310 | MOT2 encodes a molybdate transporter which locates to the vacuolar membrane. Loss-of-function (knock out) mutants show elevated molydate levels in rosette leaves and in fully senescent leaves, but decreased MoO4 levels in seeds. Under conditions of molybdate deficiency leaves from mot2::tDNA mutants show strongly reduced nitrate reductase activity. The mot2 gene is slightly expressed in young and mature leaves, but strongly in senescing leaves. This observation points to a function of MOT2 in molybdate transfer from leaves to seeds during plant senescence. |
AT3G09940 | Encodes a member of the monodehydroascorbate reductase gene family. Critical for a mutualistic symbiosis between the host Arabidopsis and the root colonizing fungus Piriformospora indica. |
AT1G63940 | monodehydroascorbate reductase 6;(source:Araport11) |
AT4G15760 | Encodes a protein with similarity to monooxygenases that are known to degrade salicylic acid (SA). |
AT4G15670 | Encodes a member of the CC-type glutaredoxin (ROXY) family. |
AT1G02740 | MRG1 and MRG2 proteins act as readers of H3K4me3/H3K36me3 marked chromatin. They interact with each other as well as several other protein classes, to modulate the activity of flowering genes. |
AT1G21920 | MRF1 is related to SET7/9 proteins but contains an atypical SET domain. It is expressed in phloem and mutants have a weak late flowering phenotype. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G08060 | Encodes a transcriptional silencer that is required for proper expression of PRR/NLR immune receptor genes. |
AT3G54870 | Armadillo-repeat containing kinesin-related protein. Plays a role during transition to root-hair tip growth.Mutants have short, branched root hairs and an excess of endoplasmic microtubles. Phenotype suggests ARK1 plays a role in modulating microtubule depolymerization during root hair tip growth.An HKT2.4 (CS76404) - ARK1 variant causes root hair branching. |
AT1G07360 | Encodes MAC5A, a component of the MOS4-associated complex (MAC) that contributes to snc1- mediated autoimmunity. MAC is a highly conserved nuclear protein complex associated with the spliceosome. Homologues include AT1G07360 (MAC5A), AT2G29580 (MAC5B) and AT5G07060 (MAC5C). |
AT1G37113 | hypothetical protein;(source:Araport11) |
AT2G33780 | VQ motif-containing protein;(source:Araport11) |
AT5G53830 | VQ motif-containing protein;(source:Araport11) |
AT5G63800 | Involved in mucilage formation. Mutants form columella and outer cell wall architecture of the mucilage cells resembles wild-type. However, mum2 seeds completely lack seed coat mucilage. This mutation appears to represent a later step in the development of this cell-type. Encodes a beta-galactosidase involved in seed coat mucilage biosynthesis. Member of Glycoside Hydrolase Family 35 |
AT3G61300 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT5G03435 | Ca2+dependent plant phosphoribosyltransferase family protein;(source:Araport11) |
AT3G03680 | Member of a family of Multiple C2 Domain and Transmembrane Region Proteins. |
AT4G00700 | C2 calcium/lipid-binding plant phosphoribosyltransferase family protein;(source:Araport11) |
AT5G44780 | Member of MORF family consisting of of nine full-length proteins encoded in the nuclear genome. MORF proteins are required for all RNA editing events in plastids and for many, possibly also all, sites in mitochondria. Potential link between the RNA binding PPR protein and the protein contributing the enzymatic activity in RNA editing. |
AT3G51160 | Catalyzes the first step in the de novo synthesis of GDP-L-fucose. Loss of function mutations result in reduced levels of fucosylation and decreased freezing tolerance. |
AT1G30620 | encodes a type-II membrane protein that catalyzes 4-epimerization of UDP-D-Xylose to UDP-L-Arabinose in vitro, the nucleotide sugar used by glycosyltransferases in the arabinosylation of cell wall polysaccharides and wall-resident proteoglycans. |
AT1G75640 | Encodes a Leucine-Rich Repeat Receptor-Like Kinase MUSTACHES (MUS). Regulates stomatal bilateral symmetry. Mutants have abnormally shaped guard cells, absent or skewed stomatal pores. |
AT3G24320 | Encodes a DNA binding protein that promotes re-arrangements of mitochondrial genome. Mutations affects mitochondrial gene expression, and impairs mitochondrial function. Dual targeting of the protein to mitochondria and chloroplasts caused by alternative translation initiation. Plastid MSH1 depletion results in variegation, abiotic stress tolerance, variable growth rate, and delayed maturity. |
AT4G02070 | encodes a DNA mismatch repair homolog of human MutS gene, MSH6. There are four MutS genes in Arabidopsis, MSH2, MSH3, MSH6, and MSH7, which all act as heterodimers and bind to 51-mer duplexes. MSH2*MSH6 bound the (+T) substrate strongly, (T/G) well, and (+AAG) no better than it did a (T/A) homoduplex. |
AT3G09230 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT3G12820 | Member of the R2R3 factor gene family. |
AT1G63910 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT2G26950 | Member of the R2R3 factor gene family. |
AT3G02940 | Encodes a putative transcription factor (MYB107). |
AT3G55730 | putative transcription factor MYB109 (MYB109) mRNA, |
AT1G25340 | putative transcription factor (MYB116) |
AT5G58850 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB119). |
AT5G55020 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB120). |
AT3G30210 | Encodes a putative transcription factor, member of the R2R3 factor gene family (MYB121). |
AT1G06180 | member of MYB3R- and R2R3- type MYB- encoding genes |
AT3G23250 | Member of the R2R3 factor gene family. Key regulator of lignin biosynthesis in effector-triggered immunity |
AT5G15310 | Member of the R2R3 factor gene family; MIXTA-like transcription factor that controls trichome maturation and cuticle formation. |
AT3G61250 | LATE MERISTEM IDENTITY2 (LMI2) is a target of the meristem identity regulator LEAFY (LFY). Has a role in the meristem identity transition from vegetative growth to flowering. Member of the R2R3 factor gene family. |
AT2G47190 | Encodes a MYB transcription factor that possesses an R2R3 MYB DNA binding domain and is known to regulate the expression of salt- and dehydration-responsive genes. Has been shown to bind calmodulin. |
AT3G27810 | Encodes a member of the R2R3-MYB transcription factor gene family. Induced by jasmonate. Involved in jasmonate response during stamen development. MYB21 interacts with JAZ proteins, and functions redundantly with MYB24 and MYB57 to regulate stamen development. Promotes flavonol biosynthesis through regulation of FLS1 gene expression. |
AT5G40330 | Encodes a MYB gene that, when overexpressed ectopically, can induce ectopic trichome formation. It is a member of subgroup 15, together with WER and GL1. Members of this subgroup share a conserved motif of 19 amino acids in the putative transcription activation domain at the C-terminal end. The gene is expressed in leaves, stems, flowers, seeds and roots and quite strongly in trichomes. There is partial functional redundancy between ATMYB23 and GL1. The two proteins are functionally equivalent with respect to the regulation of trichome initiation but not with respect to trichome branching - which is controlled by MYB23 and not GL1. |
AT2G39880 | Encodes a putative transcription factor (MYB25). |
AT3G53200 | Member of the R2R3 factor gene family. |
AT5G07690 | Encodes a putative transcription factor (MYB29) that acts as a negative regulator of mitochondrial stress responses. |
AT1G22640 | MYB-type transcription factor (MYB3) that represses phenylpropanoid biosynthesis gene expression |
AT3G28910 | Encodes a MYB family transcriptional regulator.It is a a positive regulator of the pathogen-induced hypersensitive response and of brassinosteroid and abscisic acid signaling and a negative regulator of photomorphogenesis. Accumulation of MYB30 is light regulated and activity is modulated by SUMOlaytion. MYB30 can for complexes with different bHLH components to regulate expression of different pathways. |
AT3G24310 | snapdragon myb protein 305 homolog (myb) |
AT5G23000 | Putative homolog of the Blind gene in tomato. Together with RAX2 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB37, regulates axillary meristem formation. RAX1 is expressed in a small central domain within the boundary zone separating SAM and leaf primordia during early leaf primordium development and is currently the earliest spatial marker for future axillary meristems. Member of the R2R3 factor gene family. |
AT4G17785 | Encodes a putative transcription factor (MYB39) involved in the regulation of suberin biosynthetic genes. |
AT3G09370 | C-myb-like transcription factor (MYB3R3) mRNA. It is a target of CDK phosphorylation and blocks cell division in response to DNA damage. |
AT4G38620 | Encodes a R2R3 MYB protein which is involved in the response to UV-B. It functions as a repressor of target gene expression. One of its target genes encodes cinnamate 4-hydroxylase; mutants accumulate sinapate esters in their leaves. MYB4 binds to its own promoter and represses its own expression. Nuclear localization of MYB4 depends on the action of the beta importin SAD2. The mRNA is cell-to-cell mobile. |
AT4G28110 | Member of the R2R3 factor gene family. Expression is induced in response to desiccation, ABA and salt treatment. Overexpression of Myb41 results in abnormal cuticle development and decreased cell expansion. |
AT4G12350 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT5G16600 | Encodes a transcriptional regulator that directly activates lignin biosynthesis genes and phenylalanine biosynthesis genes during secondary wall formation. |
AT3G48920 | Member of the R2R3 factor gene family. |
AT5G12870 | Encodes MYB46, member of the R2R3 factor gene family. Modulates Disease Susceptibility to Botrytis cinerea. |
AT1G18710 | Member of the R2R3 factor gene family. Promotes seed longevity (viability of seed over time.) Expressed in the chalazal seed coat. Overexpresion enhances resistance of seed to deterioration (PMID:32519347). |
AT3G18100 | Member of the R2R3 transcription factor gene family. |
AT1G57560 | Member of the R2R3 factor gene family. |
AT1G18570 | Encodes a member of the R2R3-MYB transcription family. Involved in indole glucosinolate biosynthesis. The mRNA is cell-to-cell mobile. |
AT5G65230 | Member of the R2R3 factor gene family. |
AT4G01680 | Encodes a putative transcription factor (MYB55). |
AT3G01530 | Member of the R2R3 factor gene family.MYB57 interacts with JAZ proteins, and functions redundantly with MYB21 and MYB24 to regulate stamen development. Promote flavonol biosynthesis through regulation of FLS1 gene expression. |
AT1G16490 | Member of the R2R3 factor gene family. |
AT1G09540 | Encodes putative transcription factor. Mutants lack of mucilage extrusion from the seeds during imbibition. Reduced quantities of mucilage are deposited during the development of the seed coat epidermis in myb61 mutants. Expressed in guard cells,loss of function mutations show an increase in stomatal pore opening suggesting a role in ABA independent regulation of stomatal pore size. |
AT1G68320 | putative transcription factor: R2R3-MYB transcription family. Involved in regulation of phosphate starvation responses and gibberellic acid biosynthesis. |
AT1G79180 | Member of the R2R3 factor gene family. |
AT5G11050 | Member of R2R3-MYB transcription factor gene family. |
AT5G14750 | Encodes a MyB-related protein containing R2 and R3 repeats, involved in root and hypocotyl epidermal cell fate determination. Loss of function mutations make extra root hairs. Nuclear localized protein is a positive regulator for expression of CAPRICE (CPC). |
AT5G65790 | Encodes a MYB family protein with N-terminal R2R3 DNA-binding domains involved in root development. |
AT2G23290 | Member of the R2R3 factor gene family. |
AT4G37260 | Member of the R2R3 factor gene family. The mRNA is cell-to-cell mobile. |
AT5G49620 | Member of the R2R3 factor gene family. |
AT4G13480 | Member of the R2R3 factor gene family. |
AT3G49690 | Putative homolog of the Blind gene in tomato. Together with RAX1 and RAX3 belong to the class R2R3 MYB genes; encoded by the Myb-like transcription factor MYB84, regulates axillary meristem formation. |
AT5G26660 | myb domain protein 86;(source:Araport11) |
AT4G37780 | encoded by the Myb-like transcription factor MYB87, regulates axillary meristem formation, expressed throughout the plant. Member of the R2R3 factor gene family. |
AT5G16770 | Member of the R2R3 factor gene family. |
AT5G10280 | Encodes a putative transcription factor (MYB92). |
AT1G34670 | Encodes a member of the R2R3 transcription factor gene family that is a negative regulator of lateral root (LR) development. It has been proposed that this transcription factor is part of a novel negative feedback loop stimulated specifically in the endodermis upon LR initiation to ensure that LRs are formed only in the correct place. |
AT3G47600 | Encodes a putative transcription factor (MYB94). |
AT5G62470 | Encodes a R2R3 type Myb transcription factor whose expression is strongly induced by abscisic acid. Mediates abscisic acid signaling during drought stress response. |
AT4G18770 | MYB98 is a member of the R2R3-MYB gene family, the members of which likely encode transcription factors. Within an ovule, MYB98 is expressed exclusively in the synergid cells, and mutations in this gene affect the female gametophyte specifically. myb98 female gametophytes are affected in two unique features of the synergid cell, pollen tube guidance and the filiform apparatus, but are otherwise normal. This suggests that MYB98 controls the development of specific features within the synergid cell during female gametophyte development. MYB98 also is expressed in trichomes and endosperm. Homozygous myb98 mutants exhibit no sporophytic defects, including trichome and endosperm defects. |
AT5G62320 | Encodes a putative transcription factor (MYB99). |
AT4G21440 | Encodes a MYB transcription factor involved in wounding and osmotic stress response. Member of the R2R3 factor gene family. |
AT1G71030 | Encodes a putative myb family transcription factor. In contrast to most other myb-like proteins its myb domain consists of a single repeat. A proline-rich region potentially involved in transactivation is found in the C-terminal part of the protein. Its transcript accumulates mainly in leaves. |
AT5G18650 | Encodes a RING-type E3 ubiquitin ligase that interacts with and ubiquitinates MYB30, leads to MYB30 proteasomal degradation and downregulation of its transcriptional activity. Since MYB30 is a positive regulator of Arabidopsis HR and defence responses, MIEL1 is involved in the negative regulation of these processes. The mRNA is cell-to-cell mobile. |
AT3G61950 | MYC-type transcription factor which interacts with ICE1 and negatively regulates cold-responsive genes and cold tolerance. |
AT2G19800 | Encodes a myo-inositol oxygenase family gene. |
AT5G10170 | myo-inositol-1-phosphate synthase isoform 3.Expressed in leaf, root and silique. Immunolocaliazation experiments with an antibody recognizing MIPS1, MIPS2, and MIPS3 showed endosperm localization. |
AT3G19960 | member of Myosin-like proteins |
AT1G17580 | Encodes a member of the type XI myosin protein family involved in organelle trafficking and overall plant development. |
AT5G54280 | Type VII myosin gene |
AT5G43900 | Encodes a member of the type XI myosin protein family that binds F-actin and co-localizes with actin filaments and peroxisomes. Homozygous mutants are reported to have pleiotropic effects in growth and fertility and may also be lethal. This protein is also involved in root hair growth and organelle trafficking. This protein interacts with RabC2a and RabD1 in a GTP-dependent manner. |
AT1G04600 | member of Myosin-like proteins |
AT5G04540 | Myotubularin-like phosphatases II superfamily;(source:Araport11) |
AT5G66900 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.2. Exhibits autoimmunity. |
AT5G66910 | RPW8 -CNL gene is required for signal transduction of TNLs; functionally redundant to NRG1.1. |
AT5G16800 | Plasma membrane-anchored post-translationally acting N-acetyltransferase involved in high salt stress response. |
AT5G11790 | Plays a role in dehydration stress response. |
AT5G11340 | Encodes an N-terminal acetyltransferase involved in plant development and the suppression of stress responses, potentially through the regulation of ER stress. |
AT4G17830 | NAOD encodes a functional acetylornithine deacetylase. Silenced lines plants flower early but have reduced fertility (siliques do not develop) as well as reduced ornithine levels.NAOD mediates a linear pathway for ornithine biosynthesis. |
AT3G15510 | Note of caution: not to be confused with another protein (AtNAC6 locus AT5G39610) which on occasion has also been referred to as AtNAC2. |
AT5G39610 | Encodes a NAC-domain transcription factor. Positively regulates aging-induced cell death and senescence in leaves. This gene is upregulated in response to salt stress in wildtype as well as NTHK1 transgenic lines although in the latter case the induction was drastically reduced. It was also upregulated by ABA, ACC and NAA treatment, although in the latter two cases, the induction occurred relatively late when compared with NaCl or ABA treatments. Note: this protein (AtNAC6) on occasion has also been referred to as AtNAC2, not to be confused with the AtNAC2 found at locus AT3G15510. |
AT1G01010 | NAC domain containing protein 1;(source:Araport11) |
AT1G56010 | Encodes a transcription factor involved auxin-mediated lateral root formation. Acts downstream of TIR1 and is regulated post-transcriptionally by miRNA164 and by SINAT5-dependent ubiquitination. |
AT5G63790 | Encodes a member of the NAC family of transcription factors. ANAC102 appears to have a role in mediating response to low oxygen stress (hypoxia) in germinating seedlings. Its expression can be induced by beta-cyclocitral, an oxidized by-product of beta-carotene generated in the chloroplasts, mediates a protective retrograde response that lowers the levels of toxic peroxides and carbonyls, limiting damage to intracellular components. |
AT1G52890 | encodes a NAC transcription factor whose expression is induced by drought, high salt, and abscisic acid. This gene binds to ERD1 promoter in vitro. |
AT5G04410 | NAC family member, functions as a transcriptional activator, regulates flavonoid biosynthesis under high light. The mRNA is cell-to-cell mobile. |
AT1G61110 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
AT1G77450 | NAC domain transcriptional regulator that is induced by ROS in roots where it regulates the expression of downstream genes such as MYB30. |
AT3G01600 | NAC domain containing protein 44;(source:Araport11) |
AT3G04070 | NAC domain containing protein 47;(source:Araport11) |
AT3G04420 | NAC domain containing protein 48;(source:Araport11) |
AT3G10490 | Encodes a NAC transcription factor that physically associates with the histone H3K4 demethylase JMJ14 and through that association is involved in transcriptional repression and flowering time control. |
AT3G10500 | Encodes a transcriptional activator that is associated with the plasma membrane in a dormant form and is proteolytically cleaved to create a form that can enter the nucleus. It is thought to promote ROS production by binding directly to the promoters of genes encoding ROS biosynthetic enzymes during drought-induced leaf senescence. The mRNA is cell-to-cell mobile. |
AT3G44350 | NAC domain containing protein 61;(source:Araport11) |
AT3G49530 | Transcription factor that serves as a molecular link between cold signals and pathogen resistance responses. Undergoes proteolytic processing triggered by cold-induced changes in membrane fluidity.It relocates from the plasma membrane to the nucleus in response to ER stress. NAC062 is phosphorylated by SnRK2.8 at Thr-142. |
AT4G01520 | NAC domain containing protein 67;(source:Araport11) |
AT4G10350 | NAC domain protein. SMB, BRN1, and BRN2 act to regulate root cap maturation, in a partially redundant fashion.BRN1 and BRN2, control the cell wall maturation processes that are required to detach root cap layers from the root. |
AT4G28530 | Member of NAC family of transcription factors. Along with NAC2, KIR1 positively regulates programmed cell death of stigmatic tissue. |
AT5G13180 | Encodes a NAC domain transcription factor that interacts with VND7 and negatively regulates xylem vessel formation. |
AT5G17260 | NAC domain containing protein 86;(source:Araport11) |
AT5G22380 | NAC domain containing protein 90;(source:Araport11) |
AT5G39820 | NAC domain containing protein 94;(source:Araport11) |
AT3G12977 | NAC transcription regulator. Regulates endosperm cell expansion during germination. |
AT3G21070 | Encodes a protein with NAD(H) kinase activity. |
AT4G28220 | Encodes an external type II NADPH dehydrogenase in the plant mitochondrial electron transport chain that modulates NADP(H) reduction levels, which in turn affect central metabolism and growth, and interact with defense signaling. |
AT2G47490 | Encodes a chloroplast-localized NAD+ transporter that transports NAD+ in a counter exchange mode with ADP and AMP in vitro. |
AT2G13560 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the alpha family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the beta-type NAD-ME2 (At4g00570). NAD-ME1 transcript and protein levels are higher during the night than during the day. The mRNA is cell-to-cell mobile. |
AT4G00570 | Encodes an NAD-dependent malic enzyme (NAD-ME) that does not act on oxaloacetate, indicating that it belongs to EC 1.1.1.39. It is a member of the beta family of NAD-MEs in plants. It appears to function as a homodimer or as a heterodimer with the alpha-type NAD-ME2 (At2g13560). NAD-ME2 transcript and protein levels are higher during the night than during the day. |
AT5G21430 | Chaperone DnaJ-domain superfamily protein;(source:Araport11) |
AT5G11670 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME2 is presumably a cytosolic enzyme involved in malate metabolism and possibly assisting the oxidative pentose phosphate pathway. AtNADP-ME2 counts for the major part of NADP-ME activity in mature tissues of Arabidopsis. |
AT1G79750 | The malic enzyme (EC 1.1.1.40) encoded by AtNADP-ME4 is localized to chloroplasts. The gene is expressed throughout the whole plant and during embryogenesis and germination. A possible involvement in the fatty acid biosynthesis has been proposed. |
AT4G15545 | NAI1 interacting protein, involved in ER body formation. |
AT1G16520 | NAI1 interacting protein, involved in ER body and vesicle formation. |
AT1G56080 | NAI1 interacting protein, involved in ER body formation. |
AT4G37590 | A member of the NPY gene family (NPY1/AT4G31820, NPY2/AT2G14820, NPY3/AT5G67440, NPY4/AT2G23050, NPY5/AT4G37590). Involved in auxin-mediated organogenesis. |
AT3G12700 | Encodes an aspartic protease has an important regulatory function in chloroplasts that not only influences photosynthetic carbon metabolism but also plastid and nuclear gene expression. |
AT3G17850 | Protein kinase which together with IRE3 plays an important role in controlling root skewing and maintaining the microtubule network. |
AT2G27080 | Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family;(source:Araport11) |
AT3G11650 | Encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus and spermine. Overexpression of the gene induces the expression of PR-1 gene and shows light-dependent 'speck disease-like' symptom on leaves. The gene product is localized to the chloroplast |
AT5G36970 | NDR1/HIN1-like protein, expression induced during incompatible response to a pathogen, expression is at least partly dependent on the salicylic acid signaling pathway |
AT5G06320 | encodes a protein whose sequence is similar to tobacco hairpin-induced gene (HIN1) and Arabidopsis non-race specific disease resistance gene (NDR1). Expression of this gene is induced by cucumber mosaic virus, spermine and Pseudomonas syringae pv. tomato DC3000. The gene product is localized to the plasma membrane. |
AT1G65690 | Encodes NHL6 (NDR1/HIN1-like 6). Plays an important role in the abiotic stresses-induced ABA signaling and biosynthesis, particularly during seed germination and early seedling development. |
AT1G28380 | This gene is predicted to encode a protein involved in negatively regulating salicylic acid-related defense responses and cell death programs. nsl1 mutants develop necrotic lesions spontaneously and show other features of a defense response, such as higher levels of SA and disease resistance-related transcripts, in the absence of a biotic stimulus. The NSL1 protein is predicted to have a MACPF domain, found in proteins that form a transmembrane pore in mammalian immune responses. NSL1 transcript levels do not appear to change in response to biotic stresses, but are elevated by cycloheximide in seedlings, and by sodium chloride in roots. The mRNA is cell-to-cell mobile. |
AT4G05590 | Encodes NRGA1, a putative mitochondrial pyruvate carrier that mediates ABA regulation of guard cell ion channels and drought stress responses. |
AT1G74360 | NILR1 encodes a serine/threonine kinase involved in defense response to nematodes. |
AT1G53430 | Probable LRR receptor-like ser/thr-protein kinase; Commonly-enriched candidate LPS-interacting PM-associated proteins for both LPS chemotypes subsequent to the polymyxin B affinity chromatography strategy. |
AT2G17750 | Intrinsic thylakoid membrane protein that fixes RPOTmp on the stromal side of the thylakoid membrane. |
AT4G14760 | kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT4G02710 | Kinase interacting (KIP1-like) family protein;(source:Araport11) |
AT1G09720 | Member of NET domain family of actin binding proteins. Paralog of At3g22790 (NET2A). |
AT1G07380 | Encodes a neutral ceramidase that is involved in sphingolipid homeostasis and responses to oxidative stress. |
AT2G38010 | Neutral/alkaline non-lysosomal ceramidase;(source:Araport11) |
AT4G24690 | Encodes NBR1, a selective autophagy substrate. The mRNA is cell-to-cell mobile. |
AT3G11580 | SOD7 encodes nuclear localized B3 DNA binding domain and a transcriptional repression motif. Belongs to the RAV gene family. Functions in regulation of seed size and binds to and represses KLU. Transcription repressor involved in regulation of inflorescence architecture. |
AT2G46870 | Member of the RAV family of DNA binding proteins. Contains B3 domain. Recognizes 5'-CACCTG-'3 motif. |
AT3G61970 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT1G01030 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT4G01500 | AP2/B3-like transcriptional factor family protein;(source:Araport11) |
AT5G04950 | Encodes a nicotianamide synthase. |
AT5G56080 | Encodes a protein with nicotianamine synthase activity. Its transcript levels rise in roots in response to zinc deficiency and rise in leaves in response to elevated levels of zinc. |
AT1G56430 | Encodes a protein with nicotianamine synthase activity. |
AT3G13050 | Encodes a plant nicotinate transporter than can also transport trigonelline (N-methylnicotinate). |
AT5G64170 | LNK1 is a member of a small family (4 proteins) in Arabidopsis that have some overlap in function. LNK1 functions in the integration of light signaling and circadian clock. It is regulated by the clock TOC1 complex.Functions as a transcriptional coactivator. |
AT1G02450 | NIMIN1 modulates PR gene expression according the following model: NPR1 forms a ternary complex with NIMIN1 and TGA factors upon SAR induction that binds to a positive regulatory cis-element of the PR-1 promoter, termed LS7. This leads to PR-1 gene induction. NIMIN1 decreases transcriptional activation, possibly through its EAR motif, which results in fine-tuning of PR-1 gene expression. |
AT3G25882 | encodes a kinase that physically interacts with NPR1/NIM1 |
AT3G44200 | Encodes AtNek5, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes.Interacts physically with plant kinesins ARK1 and ARK2. Mutants show defects in root epidermal cell morphology, trichome branching and other epidermal cell abnormalities suggesting a rol e in epidermal cell differentiation. NEK6 co-localizes with cortical microtubules. |
AT5G28290 | Encodes AtNek3, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT3G20860 | Encodes a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT3G12200 | Encodes AtNek7, a member of the NIMA-related serine/threonine kinases (Neks) that have been linked to cell-cycle regulation in fungi and mammals. Plant Neks might be involved in plant development processes. |
AT4G24020 | Encodes NIN Like Protein 7 (NLP7). Modulates nitrate sensing and metabolism. Mutants of NLP7 show features of nitrogen-starved plants and are tolerant to drought stress. Localized in the nucleus and functions as a putative transcription factor. The mRNA is cell-to-cell mobile. |
AT1G20640 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT1G76350 | Plant regulator RWP-RK family protein;(source:Araport11) |
AT4G18350 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
AT3G14440 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. Regulated in response to drought and salinity. Expressed in roots, flowers and seeds. Localized to the chloroplast stroma and thylakoid membrane. |
AT1G30100 | Encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene increases during the first 6h of imbibition. |
AT3G24220 | A member of gene NCED-related gene family, encodes 9-cis-epoxycarotenoid dioxygenase, a key enzyme in the biosynthesis of abscisic acid. The expression of this gene declines during the first 12h of imbibition. |
AT1G77760 | Encodes the cytosolic minor isoform of nitrate reductase (NR). Involved in the first step of nitrate assimilation, it contributes about 15% of the nitrate reductase activity in shoots. Similar to molybdopterin oxidoreductases at the N-terminus, and to FAD/NAD-binding cytochrome reductases at the C-terminus. Cofactors: FAD, heme iron (cytochrome B-557), and molybdenum-pterin. |
AT1G37130 | Identified as a mutant resistant to chlorate. Encodes nitrate reductase structural gene. Involved in nitrate assimilation. Has nitrate reductase activity. Up-regulated by the fungus P. indica. Binds transcription factor At2g35940. The mRNA is cell-to-cell mobile. |
AT1G08100 | Encodes a high-affinity nitrate transporter. |
AT5G60780 | member of High affinity nitrate transporter family |
AT1G08090 | High-affinity nitrate transporter. Up-regulated by nitrate. Functions as a repressor of lateral root initiation independently of nitrate uptake. |
AT3G44300 | Encodes an enzyme that catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (nitrile aminohydrolase, EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. Mutants have reduced sensitivity to IAN and are sensitive to IAA. This enzyme likely participates in other non-auxin-related metabolic pathways. The mRNA is cell-to-cell mobile. |
AT3G44320 | This enzyme catalyzes the hydrolysis of indole-3-acetonitrile (IAN) to indole-3-acetic acid (IAA) (EC 3.5.5.1) and IAN to indole-3-acetamide (IAM) at lower levels. It is the only one of the four Arabidopsis nitrilases whose mRNA levels are strongly induced when plants experience sulphur deprivation. This enzyme likely participates in other non-auxin-related metabolic pathways. |
AT3G16410 | Encodes a nitrile-specifier protein NSP4. NSP4 is one out of five (At3g16400/NSP1, At2g33070/NSP2, At3g16390/NSP3, At3g16410/NSP4 and At5g48180/NSP5) A. thaliana epithiospecifier protein (ESP) homologues that promote simple nitrile, but not epithionitrile or thiocyanate formation. The mRNA is cell-to-cell mobile. |
AT1G02860 | Encodes a ubiquitin E3 ligase with RING and SPX domains that is involved in mediating immune responses and mediates degradation of PHT1s at plasma membranes. Targeted by MIR827. Ubiquitinates PHT1;3, PHT1;2, PHT1;1/AtPT1 and PHT1;4/AtPT2. |
AT2G43040 | encodes a calmodulin-binding protein that is expressed specifically in pollen and is required for pollen development. |
AT4G13750 | Encodes NO VEIN (NOV), a plant-specific nuclear factor required for leaf vascular development, cellular patterning and stem cell maintenance in the root meristem, as well as for cotyledon outgrowth and separation. nov mutations affect many aspects of auxin-dependent development without directly affecting auxin perception. |
AT4G18910 | Encodes an aquaporin homolog. Functions in arsenite transport and tolerance.When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
AT1G31885 | NOD26-like intrinsic protein 3;(source:Araport11) |
AT5G37820 | NOD26-like intrinsic protein 4;(source:Araport11) |
AT4G10380 | Boric acid channel. Essential for efficient boron uptake and plant development under boron limitation. Also functions in arsenite transport and tolerance. Localized preferentially in outer membrane domains of root cells. |
AT3G53180 | Encodes a protein that is the product of a fusion gene with a C-terminal GSI like sequence and an N-terminal part sharing homology with nodulins. It self-assembles into oligomers and its expression is increased in response to flagellin treatment. The protein co-localizes with microtubules and binds gamma-tubulin. RNAi lines are affected in root morphogenesis. |
AT4G25030 | Plastid localized protein of unknown function. Mutants are more susceptible to P. syringae and produce less callose upon infection. |
AT3G20600 | Required for non-race specific resistance to bacterial and fungal pathogens.Mediates systemic acquired resistance (SAR) response. The mRNA is cell-to-cell mobile. |
AT1G07230 | non-specific phospholipase C1;(source:Araport11) |
AT3G03540 | Encodes a nonspecific phospholipase C. Located in the cytosol. Involved in the conversion of phospholipids to glycolipids under phosphate deprivation conditions. |
AT1G80460 | Encodes a protein similar to glycerol kinase, which converts glycerol to glycerol 3-phosphate and performs a rate-limiting step in glycerol metabolism. This gene is required for both general and specific resistance against bacteria and fungi. Arabidopsis thaliana glycerol kinase (GLR1) mRNA.Involved in flagellin-induced non-host resistance to Pseudomonas. Coronatine partially suppresses flagellin-induced expression of NHO1. |
AT5G18110 | Putative cap-binding protein;(source:Araport11) |
AT1G48240 | member of NPSN Gene Family |
AT3G17440 | member of NPSN Gene Family |
AT1G09000 | NPK1-related protein kinase 1S |
AT1G54960 | member of MEKK subfamily |
AT5G45110 | Encodes NPR3, a paralog of NPR1. Involved in negative regulation of defense responses against bacterial and oomycete pathogens. npr3 mutants has elevated level of PR1 expression. Interacts with TGA2, TGA3, TGA5 and TGA6 in yeast two hybrid assays. NPR3 and NPR4 are receptors for the immune signal salicylic acid. The mRNA is cell-to-cell mobile. |
AT4G19660 | Encodes NPR4, a ankyrin repeat BTB/POZ domain-containing protein with 36% sequence identity with NPR1. Mutants are more susceptible to the bacterial pathogen Pseudomonas syringe pv. tomato DC3000 and to the fungal pathogen Erysiphe cichoracearum, but do not differ markedly from wild type in interaction with virulent and avirulent strains of the oomycete Peronospora parasitica. NPR4 is required for basal defense against pathogens, and may be implicated in the cross-talk between the SA- and JA-dependent signaling pathways. NPR3 and NPR4 are receptors for the immune signal salicylic acid. |
AT3G47960 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
AT5G62680 | Encodes a high-affinity, proton-dependent glucosinolate-specific transporter that is crucial for the transport of both methionine- and tryptophan-derived glucosinolates to seeds. |
AT1G69870 | Encodes a low affinity nitrate transporter NRT1.7. Expressed in phloem. Responsible for source-to-sink remobilization of nitrate. The mRNA is cell-to-cell mobile. |
AT3G45650 | Encodes a nitrate efflux transporter NAXT1 (for NITRATE EXCRETION TRANSPORTER1). Localized to the plasma membrane. NAXT1 belongs to a subclass of seven NAXT members from the large NITRATE TRANSPORTER1/PEPTIDE TRANSPORTER family and is mainly expressed in the cortex of mature roots. |
AT1G59740 | Major facilitator superfamily protein;(source:Araport11) |
AT1G33440 | Major facilitator superfamily protein;(source:Araport11) |
AT1G69850 | Encodes an inducible component of low-affinity nitrate uptake. mRNA found primarily in root hairs and the epidermis of roots. It also acts as an ABA importer at the site of ABA biosynthesis and is important for the regulation of stomatal aperture in inflorescence stems. |
AT1G72125 | Major facilitator superfamily protein;(source:Araport11) |
AT1G72120 | Major facilitator superfamily protein;(source:Araport11) |
AT5G46050 | Encodes a di- and tri-peptide transporter involved in responses to wounding, virulent bacterial pathogens, and high NaCl concentrations. The protein is predicted to have 12 transmembrane helicies. |
AT2G26690 | Major facilitator superfamily protein;(source:Araport11) |
AT1G12110 | Encodes NRT1.1 (CHL1), a dual-affinity nitrate transporter. The protein is expressed in guard cells and function in stomatal opening. Mutants have less transpiration and are more tolerant to drought. Expressed in lateral roots. Involved in nitrate signaling which enables the plant root system to detect and exploit nitrate-rich soil patches. Comparing to the wild type, the mutant displays a strongly decreased lateral root proliferation phenotype in nitrate rich patches on growth medium. Affects flowering time via interaction with the FLC dependent flowering pathway to influence its target gene FT. |
AT4G21680 | Encodes a nitrate transporter (NRT1.8). Functions in nitrate removal from the xylem sap. Mediates cadmium tolerance. |
AT3G54140 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. GFP-tagged PTR1 localizes to the plasma membrane and has 8 to 11 predicted transmembrane domains. PTR1 is expressed in a number of different vascular tissues throughout the plant based on promoter:GUS expression analysis. ptr1 mutants have a lower dry weight than wild type plants when both are grown with Pro-Ala or Ala-Ala dipeptides as their nitrogen source, suggesting that PTR1 plays a role in dipeptide uptake in the roots. Furthermore N content of ptr1 mutants is lower than that of wild type plants when grown with Pro-Ala or a mixture of dipeptides as nitrogen source |
AT2G02040 | Encodes a di- and tri-peptide transporter that recognizes a variety of different amino acid combinations. Expression of the transcripts for this gene can be detected in the embryo through in situ hybridization. This protein does not have nitrate transporter activity based on oocyte transport assays. Enhances water uptake during early seed germination. |
AT2G02020 | Major facilitator superfamily protein;(source:Araport11) |
AT4G13350 | Encodes a GTPase that interacts with nuclear shuttle proteins (NSPs) from a number of different plant viruses. The gene is widely expressed and NIG transcript levels do not rise in response to viral infection. This cytoplasmic protein does not directly interact with a viral movement protein (MP), but, it does promote the movement of NSP from the nucleus to the cytoplasm. Overexpression of NIG in Arabidopsis plants renders them more sensitive to geminivirus infection. |
AT1G13400 | Along with JAG, it is involved in stamen and carpel development. Expression is limited to the adaxial side of lateral organs. Activated by AGAMOUS in a cal-1, ap1-1 background. |
AT4G33080 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT1G30640 | Protein kinase family protein;(source:Araport11) |
AT5G06510 | nuclear factor Y, subunit A10;(source:Araport11) |
AT3G05690 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. |
AT1G72830 | Encodes a subunit of CCAAT-binding complex, binds to CCAAT box motif present in some plant promoter sequences. One of three members of this class (HAP2A, HAP2B, HAP2C), it is expressed in vegetative and reproductive tissues. Expression is upregulated in the shoot of cax1/cax3 mutant. |
AT1G17590 | Binds directly to CCAAT cis-elements in the promoters of multiple MIR156 genes and inhibits the juvenile-to adult transition by activating transcription of these MIR156s. |
AT5G58740 | Member of the family of NudC proteins. Over-expression improves free radical sacenving activity and antioxidant status, promotes root growth and branching under abiotic stress. |
AT4G32850 | Encodes a nuclear poly(A) polymerase. Located in the nucleus. The mRNA is cell-to-cell mobile. |
AT3G57660 | Encodes a subunit of RNA polymerase I (aka RNA polymerase A). The mRNA is cell-to-cell mobile. |
AT1G29940 | Encodes a subunit of RNA polymerase 1 (aka RNA polymerase A). |
AT1G06790 | Encodes a subunit of RNA polymerase III involved in maintaining global RNA homeostasis, not just that of genes transcribed by RNA pol III. |
AT5G45140 | Encodes a subunit of RNA polymerase III (aka RNA polymerase C). |
AT3G18090 | Encodes a subunit of RNA polymerase IV (aka RNA polymerase D). NRPD2b is closely related to NRPD2a, but has lower levels of transcription and does not affect endogenous siRNA when mutated. |
AT1G32070 | Encodes a acetyltransferase (NSI) that is localized in the nucleus and chloroplast. It interacts with the geminivirus movement protein NSP. This interaction is required for viral infection and systemic spread. Acetylates the viral coat protein (CP) in vitro, but not NSP. NSP inhibits NSI activity in vitro. In the chloroplast NSI functions in the dynamic reorganization thylakoid membrane complexes. NSI is highly transcribed in phloem and in xylem parenchyma cells, and in the apical meristem and guard cells, within young tissues in Arabidopsis, and its expression is turned off as tissues mature.Mutants have reduced melatonin and anthocyanin levels and do not accumulate the PSI-LHCII state transition complex.The protein has distinct lysine acetylation and relaxed N-terminal acetylation specificities on chloroplast proteins as determined by in vitro as well as in vivo analyses using quantitative protein mass spectrometry (PMID:32633465). |
AT1G74350 | Encodes nMAT4, a maturase factor required for nad1 pre-mRNA processing and maturation. Essential for holocomplex I biogenesis in Arabidopsis mitochondria. |
AT2G05760 | Xanthine/uracil permease family protein;(source:Araport11) |
AT5G03555 | Encodes PLUTO (plastidic nucleobase transporter), a member of the Nucleobase:Cation-Symporter1 protein family, capable of transporting purine and pyrimidine nucleobases. |
AT1G60030 | nucleobase-ascorbate transporter 7;(source:Araport11) |
AT1G79150 | binding protein;(source:Araport11) |
AT1G48920 | Encodes ATNUC-L1 (NUCLEOLIN LIKE 1), the predominant form of the two nucleolin proteins found in Arabidopsis. This protein is involved in rRNA processing, ribosome biosynthesis, and vascular pattern formation. PARL1 localizes to the nucleolus and parl1 mutants accumulate elevated levels of the unspliced 35S pre-rRNA. parl1 mutants also have defects in cotyledon, leaf, sepal, and petal vein patterning and have reduced stature, reduced fertility, increased bushiness, and reduced root length. The sugar-induced expression of ribosome proteins is also reduced in parl1 mutants. The mRNA is cell-to-cell mobile. |
AT5G20200 | Atypical nuceloporin-like protein. |
AT1G60420 | Reduce transmission through pollen. The mRNA is cell-to-cell mobile. |
AT5G18870 | Similar to N terminal region of NSH1 nucleoside hydrolase. |
AT5G56950 | Encodes a member of a small gene family of proteins with similarity to nucleosome assembly proteins.May function in nucleotide excision repair. Loss of function mutations have no obvious visible phenotypes but do seem to affect transcription of NER related genes. Plants mutated in three ubiquitously expressed NAP1 genes (NAP1;1~NAP1;3) and organ-specifically expressed NAP1;4 gene show hypersensitivity to genotoxic stresses including UV and DSB-inducing agent Bleomycin. The NAP1 genes act synergistically with NRP genes in promoting somatic homologous recombination. |
AT4G39390 | Encodes a golgi localized nucleotide sugar transporter. |
AT1G63000 | nucleotide-rhamnose synthase/epimerase-reductase;(source:Araport11) |
AT1G12880 | nudix hydrolase homolog 12;(source:Araport11) |
AT3G26690 | Encodes AtNUDT13, a mitochondrial Nudix hydrolase specific for long-chain diadenosine polyphosphates. |
AT1G14860 | nudix hydrolase homolog 18;(source:Araport11) |
AT5G20070 | nudix hydrolase homolog 19;(source:Araport11) |
AT2G33980 | nudix hydrolase homolog 22;(source:Araport11) |
AT1G30110 | Encodes a ppGpp pyrophosphohydrolase. |
AT3G10620 | Encodes a ppGpp pyrophosphohydrolase. |
AT5G06340 | nudix hydrolase homolog 27;(source:Araport11) |
AT1G79690 | Encodes a dual activity enzyme which catalyses the hydrolysis of a peptide bond and of a phosphate bond, acting both as a dipeptidyl peptidase III and an atypical Nudix hydrolase. |
AT1G18300 | nudix hydrolase homolog 4;(source:Araport11) |
AT2G04430 | nudix hydrolase homolog 5;(source:Araport11) |
AT2G04450 | Encodes a protein with NADH pyrophosphatase activity. Although this protein was also shown to have ADP-ribose diphosphatase activity in vitro, mutant analyses suggest that NUDX6 is involved in NADH metabolism in vivo. |
AT5G44160 | NUC is a member of the BIRD group of transcriptional regulators and is required for the formative divisions that pattern the root. the ground tissue into cortex and endodermis. |
AT5G04900 | Encodes a chlorophyll b reducatase involved in the degradation of chlorophyll b and LHCII (light harvesting complex II). |
AT4G14880 | Encodes a cytosolic isoform of cytosolic O-acetylserine(thiol)lyase, a key enzyme in cysteine biosynthesis and for the fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Gene expression is predominant in the root cortex and the xylem parenchyma. Gene expression is induced in leave, stems and roots by high salt and heavy metal stresses, mediated by ABA. Lines carrying semi-dominant mutations exhibit early senescence. Required for pollen tube growth and/or fertilization. |
AT3G22460 | Encodes a member of a family of genes with O-acetylserine(thiol)lyase activity. |
AT2G43750 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasB, the key enzyme for fixation of inorganic sulfide. It catalyzes the formation of cysteine from O-acetylserine and inorganic sulfide. Required for pollen tube growth and/or fertilization. |
AT3G59760 | Arabidopsis thaliana O-acetylserine (thiol) lyase (OAS-TL) isoform oasC. Required for pollen tube growth and/or fertilization. |
AT3G05320 | Golgi localized protein with similarity to protein O-fucosyltransferases. Mutants show lower seed set/reduced fertility. Mutant pollen fails to compete with wild type due to the inability to penetrate the stigma-style boundary. |
AT3G07780 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE2 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. The mRNA is cell-to-cell mobile. |
AT5G48160 | Encodes a nuclear PHD finger protein that is functionally redundant with OBE1 and plays an important role in the maintenance and/or establishment of the root and shoot apical meristems. |
AT5G60850 | Encodes a zinc finger protein. |
AT5G06960 | Encodes a basic leucine zipper (B-ZIP) containing protein that interacts with NPR1 to promote expression of salicylic acid induced genes. Binds the ocs-element. |
AT1G06160 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT3G46990 | DUF740 family protein, putative (DUF740);(source:Araport11) |
AT3G14360 | Lipid droplet-associated triacylglycerol lipase (TAG) involved in pollen tube growth. TAG is possibly a direct precursor for the synthesis of membrane lipids in pollen tubes. |
AT1G05510 | Protein is tyrosine-phosphorylated and its phosphorylation state is modulated in response to ABA in Arabidopsis thaliana seeds. |
AT4G33760 | Aminoacyl tRNA synthetase functions in SAM maintenance. |
AT5G51210 | Encodes oleosin3, a protein found in oil bodies, involved in seed lipid accumulation. |
AT5G55920 | Encodes a homolog of the S. cerevisiae Nop2 that is involved in ribosome biogenesis and plays a role on organ size control by promoting cell proliferation and preventing compensation in normal leaf development. |
AT5G55930 | oligopeptide transporter |
AT5G64410 | oligopeptide transporter |
AT4G10770 | oligopeptide transporter |
AT5G53520 | Encodes an oligopeptide transporter. Target promoter of the male germline-specific transcription factor DUO1. |
AT3G21140 | Pyridoxamine 5-phosphate oxidase family protein;(source:Araport11) |
AT1G20510 | OPC-8:0 CoA ligase1;(source:Araport11) |
AT4G33950 | Encodes calcium-independent ABA-activated protein kinase, a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Mutations disrupted ABA induction of stomatal closure as well as ABA inhibition of light-induced stomatal opening. However, regulation of stomatal opening/closing by light or CO(2) is not affected in these mutants. May act in the interval between ABA perception and reactive oxygen species production in the ABA signalling network. |
AT1G31040 | ORE15 is a nuclear localized member of the PLATZ family of transcription factors. Based on over expression and loss of function phenotypes, ORE15 functions in regulation of leaf cell proliferation and senescence. |
AT2G41225 | Encodes a protein of unknown function that is involved in regulation of cell expansion. Based on sequence similarity OSR2 is localized to the plasma membrane. It is expressed in organs that are undergoing cell expansion. Over-expression modifies plant sensitivity to ethylene, leading to improved drought tolerance. |
AT5G65620 | Zincin-like metalloproteases family protein;(source:Araport11) |
AT5G44785 | Organellar Single-stranded DNA Binding protein. Decreases MMEJ on long ssDNA templates. |
AT3G13880 | Encodes a pentatricopeptide repeat (PPR) protein involved in RNA editing in mitochondria. |
AT5G59200 | Encodes a chloroplast RNA editing factor. |
AT1G79360 | organic cation/carnitine transporter 2;(source:Araport11) |
AT1G16370 | organic cation/carnitine transporter 6;(source:Araport11) |
AT2G35720 | Encodes OWL1, a J-domain protein involved in perception of very low light fluences. |
AT4G12620 | Origin Recognition Complex subunit 1b. Involved in the initiation of DNA replication. Regulated transcriptionally during cell cycle, peaking at G1/S-phase. Target of E2F/DF family of transcription factors. Interacts with ORC2 and ORC5. Highly expressed in proliferating cells. Expression levels are independent of light regime. |
AT5G46180 | Encodes an ornithine delta-aminotransferase that is transcriptionally up-regulated in young seedlings and in response to salt stress. It is unlikely to play a role in salt-stress-induced proline accumulation, however, it appears to participate in arginine and ornithine catabolism. |
AT5G59420 | OSBP(oxysterol binding protein)-related protein 3C;(source:Araport11) |
AT4G25860 | OSBP(oxysterol binding protein)-related protein 4A;(source:Araport11) |
AT5G19620 | AtOEP80 is paralog to the chloroplastic protein translocation channel Toc75. Mutations in this locus result in embryo lethality. |
AT2G28900 | Encodes AtOEP16, a 16-KDa plastid outer membrane protein involved in plastid import of protochlorophyllide oxidoreductase A. Predominantly expressed in leaves and is also inducible by cold treatment. |
AT1G05420 | ovate family protein 12;(source:Araport11) |
AT5G04820 | ovate family protein 13;(source:Araport11) |
AT2G36050 | ovate family protein 15;(source:Araport11) |
AT2G32100 | ovate family protein 16;(source:Araport11) |
AT3G52540 | ovate family protein 18;(source:Araport11) |
AT5G19650 | Transcriptional repressor of KNOX family transcription factors. Encodes pluripotency and stemness, upregulated in LRP cells. |
AT5G52520 | Encodes a chloroplast and mitochondria localized prolyl-tRNA synthetase. |
AT1G25350 | glutamine-tRNA ligase, putative / glutaminyl-tRNA synthetase, putative / GlnRS;(source:Araport11) |
AT5G57780 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT4G24520 | Encodes a cyp450 reductase likely to be involved in phenylpropanoid metabolism. |
AT4G30210 | Encodes NADPH-cytochrome P450 reductase that catalyzes the first oxidative step of the phenylpropanoid general pathway. The mRNA is cell-to-cell mobile. |
AT3G28857 | Encodes a atypical member of the bHLH (basic helix-loop-helix) family transcriptional factors. |
AT4G32180 | Encodes a protein with pantothenate kinase activity. |
AT1G80190 | Similar to the PSF1 component of GINS complex, which in other organism was shown to be involved in the initiation of DNA replication. |
AT4G37060 | Patatin-related phospholipase A. Expressed weakly in roots, cotyledons, and leaves but is transcriptionally induced by auxin. Phosphorylation by calcium-dependent protein kinases in vitro enhances its activity. |
AT2G39220 | Phospholipase pPLAIIIa involved in seed germination and resistance to Turnip Crinkle Virus. |
AT3G54950 | Encodes pPLAIIIbeta, a member of the Group 3 patatin-related phospholipases. pPLAIIIbeta hydrolyzes phospholipids and galactolipids and additionally has acyl-CoA thioesterase activity. Alterations of pPLAIIIβ result in changes in lipid levels and composition. |
AT4G29940 | Homeodomain protein (PRHA). Expression of the gene differs in various vegetative and floral plant tissues and is positively influenced by the phytohormone auxin. It is often associated with regions of developing vascular tissue. The prha promoter is highly responsive to the synthetic auxin, naphthalene acetic acid, in transient assays using tobacco protoplasts. The PRHA protein has the capacity to bind to TAATTG core sequence elements but requires additional adjacent bases for high-affinity binding. |
AT2G14610 | PR1 gene expression is induced in response to a variety of pathogens. It is a useful molecular marker for the SAR response. Though the Genbank record for the cDNA associated to this gene is called 'PR-1-like', the sequence actually corresponds to PR1. Expression of this gene is salicylic-acid responsive. |
AT2G19990 | Encodes a PR-1-like protein homolog that is differentially expressed in resistant compared to susceptible cultivars by powdery mildew infection. The deduced amino acid sequence has 24 amino acids comprising the signal peptide and 140 amino acids of the mature peptide (15 kDa). Northern blot analysis showed accumulation of the corresponding mRNA 12 h after inoculation of resistant barley cultivars with Erysiphe graminis. Though the Genbank record for the cDNA associated to this gene model is called 'PR-1', the sequence actually corresponds to PR-1-like. Expression of this gene is not salicylic-acid responsive. |
AT3G09830 | Encodes a member of subfamily VIIa of the receptor-like cytoplasmic kinases (RLCKs). It contributes to pattern-triggered immunity in response to P. syringae. |
AT5G03320 | Protein kinase superfamily protein;(source:Araport11) |
AT5G06370 | PSE1 is a single copy gene that is induced in response to lead and confers increased tolerance to lead when overexpressed. It is localized to the cytoplasm. The protein has an NC domain. PSE1 appears to regulate tolerance via a GSH dependent phytochelatin synthesis pathway. |
AT3G55450 | PBS1-like 1;(source:Araport11) |
AT2G07180 | Protein kinase superfamily protein;(source:Araport11) |
AT1G69790 | Protein kinase superfamily protein;(source:Araport11) |
AT5G47070 | Encodes a member of the RLCK VII-4 subfamily of receptor-like cytoplasmic kinases that has been shown to phosphorylate MAPKKK5 Ser-599 and MEKK1 Ser-603, both players in PRR-mediated resistance to bacterial and fungal pathogens. |
AT4G17660 | Protein kinase superfamily protein;(source:Araport11) |
AT1G76370 | Protein kinase superfamily protein;(source:Araport11) |
AT3G20530 | Protein kinase superfamily protein, expressed in the peroxisome. |
AT2G28940 | Protein kinase superfamily protein;(source:Araport11) |
AT2G28590 | Protein kinase superfamily protein;(source:Araport11) |
AT5G56460 | Protein kinase superfamily protein;(source:Araport11) |
AT1G77510 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. This protein has been shown to be an attenuator of D1 synthesis, modulating photoinhibition in a light-regulated manner. |
AT3G16110 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Unlike several other PDI family members, transcript levels for this gene are not up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). |
AT1G04980 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. Transcript levels for this gene are up-regulated in response to three different chemical inducers of ER stress (dithiothreitol, beta-mercaptoethanol, and tunicamycin). AtIRE1-2 does not appear to be required for this response, but the atbzip60 mutant has a diminished response. |
AT4G27080 | putative protein |
AT4G14720 | PPD2 (and its paralog, PPD1) encode plant-specific putative DNA-binding proteins. Deletion of the PPD locus increases leaf lamina size and results in dome-shaped rather than flat leaves. Siliques are also altered in shape because of extra lamina growth. |
AT5G04310 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT3G09405 | Pectinacetylesterase family protein;(source:Araport11) |
AT3G09410 | Pectinacetylesterase family protein;(source:Araport11) |
AT5G45280 | Pectin acetylesterase involved in pectin remodelling. |
AT2G45220 | Pectin methylesterase involved in pectin remodelling. Regulated by its PRO region that triggers PME activity in the resistance to Botrytis cinerea. |
AT3G14310 | encodes a pectin methylesterase, targeted by a cellulose binding protein (CBP) from the parasitic nematode Heterodera schachtii during parasitism. |
AT3G29090 | Encodes an atypical pectin methylesterase that does not require salt for its activity and has a blockwise mode of pectin demethylesterification. |
AT4G12390 | pectin methylesterase inhibitor 1;(source:Araport11) |
AT3G17220 | Pectin methylesterase inhibitor AtPMEI2. Inactivates AtPPME1 in vitro. Localized to Brefeldin A-induced compartments, and was found in FYVE-induced endosomal aggregates. |
AT2G44490 | Encodes a glycosyl hydrolase that localizes to peroxisomes and acts as a component of an inducible preinvasion resistance mechanism. Required for mlo resistance. The mRNA is cell-to-cell mobile. |
AT1G59870 | ATP binding cassette transporter. Localized to the plasma membrane in uninfected cells. In infected leaves, the protein concentrated at infection sites. Contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration in a salicylic acid?dependent manner. Required for mlo resistance. Has Cd transporter activity (Cd2+ extrusion pump) and contributes to heavy metal resistance. The mRNA is cell-to-cell mobile. |
AT4G15340 | Encodes a protein that catalyzes the production of the tricyclic triterpene arabidiol when expressed in yeast. |
AT5G04810 | Pentatricopeptide which is essential during the early stages of embryo development and acts in the plastid nucleoids as the factor responsible of rps12 intron 1 trans-splicing and, indirectly, in the assembly of 70S ribosomes and plastid translation. |
AT5G07460 | ubiquitous enzyme that repairs oxidatively damaged proteins. Methionine sulfoxide reductase activity. Mutant lacking reductase activity showed increased protein oxidation, nitration and glycation of specific amino acid residues during darkness. |
AT1G31050 | Together with PFA2 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT3G20640 | Governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT3G32980 | Peroxidase superfamily protein;(source:Araport11) |
AT3G50990 | Encodes a class III peroxidase family protein that functions as a mucilage extrusion factor. Its polarized and developmental stage-dependent secretion plays a role in cell wall modification of the cells in the second layer of the outer integument. |
AT4G08770 | Encodes a putative apoplastic peroxidase Prx37. Primarily expressed in the vascular bundles. Overexpression renders a dwarf phenotype with smaller plants and delayed development. Plants overexpressing Prx37 also shows an increase in the amount of esterified phenolic material associated with their walls. |
AT4G11290 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT1G14540 | Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT4G33420 | Peroxidase superfamily protein;(source:Araport11) |
AT5G05340 | Encodes a protein with sequence similarity to peroxidases that is involved in lignin biosynthesis. Loss of function mutations show abnormal development of xylem fibers and reduced levels of lignin biosynthetic enxymes. |
AT5G42180 | Peroxidase required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT5G64120 | Encodes a cell wall bound peroxidase that is induced by hypo-osmolarity and is involved in the lignification of cell walls. Class III peroxidase cell wall-targeted protein localized to the micropylar endosperm facing the radicle. Involved in seed germination. |
AT5G66390 | Encodes a peroxidase that is involved in lignin biosynthesis. Required for casparian strip lignification as well as partially required for SGN-dependent compensatory lignification. |
AT3G49110 | Class III peroxidase Perx33. Expressed in roots. Located in the cell wall. Involved in cell elongation. Expression activated by light. May play a role in generating H2O2 during defense response. The mRNA is cell-to-cell mobile. |
AT1G47750 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
AT1G01820 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. |
AT2G45740 | member of the peroxin11 (PEX11) gene family, integral to peroxisome membrane, controls peroxisome proliferation. The mRNA is cell-to-cell mobile. |
AT5G56290 | Encodes the peroxisomal targeting signal type 1 receptor that facilitates peroxisomal protein translocation. It recognizes proteins with the PTS1 consensus sequence (tripeptide SKL or a conserved variant) at the extreme C terminus. The protein has several domains, including C-terminal tetratricopeptide repeat motifs which act in binding the C-terminal "SKL" targeting signal. The mechanism of transport has been worked out in other organisms: The receptor recognizes and binds cytosolic PTS1-containing proteins. The PEX5-PTS1 complex binds a PEX14/PEX13 receptor complex at the peroxisome membrane and is translocated into the peroxisome matrix in a process dependent on PEX2,PEX10, and PEX12. In the peroxisome matrix, PEX5 releases its cargo and is recycled to the cytosol in a process dependent on PEX1, PEX4, PEX6 and PEX22. It is also involved, in conjunction with PEX7, in PTS1- and PTS2-dependent peroxisomal protein import. RNAi experiments suggest that PEX5 is necessary for the maintenance of both glyoxysomal and leaf peroxisomal functions. |
AT3G52960 | Thioredoxin superfamily protein;(source:Araport11) |
AT2G33150 | Encodes an organellar (peroxisome, glyoxysome) 3-ketoacyl-CoA thiolase, involved in fatty acid b-oxidation during germination and subsequent seedling growth. Mutants have defects in glyoxysomal fatty acid beta-oxidation. EC2.3.1.16 thiolase. |
AT1G06530 | Encodes PEROXISOMAL AND MITOCHONDRIAL DIVISION FACTOR2. Involved in mitochondrial morphogenesis. |
AT5G14520 | Encodes a nucleolar protein that plays an essential role in cell growth and survival through its regulation of ribosome biogenesis and mitotic progression. |
AT1G71440 | Encodes tubulin-folding cofactor E. Mutant embryos consist of one or a few grossly enlarged cells, surrounded by an endosperm that fails to cellularize and contains a few big nuclei. |
AT2G34710 | Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functions with PHAVOLUTA, REVOLUTA and CORONA. |
AT1G30490 | Dominant PHV mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Has overlapping functions with PHABULOSA, REVOLUTA and CORONA/ATHB15 in patterning the apical portion of the embryo. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. |
AT2G37040 | Encodes PAL1, a phenylalanine ammonia-lyase. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT5G39050 | Encodes a malonyltransferase that may play a role in phenolic xenobiotic detoxification. |
AT5G04230 | Member of Phenylalanine ammonialyase (PAL) gene family. Differs significantly from PAL1 and PAL2 and other sequenced plant PAL genes. Arabidopsis has four PALs: AT2G37040 (PAL1), AT3G53260 (PAL2), AT5G04230 (PAL3) and AT3G10340 (PAL4). |
AT4G39230 | encodes a protein whose sequence is similar to phenylcoumaran benzylic ether reductase (PCBER), which catalyzes NADPH-dependent reduction of 8-5' linked lignans such as dehydrodiconiferyl alcohol to give isodihydrodehydrodiconiferyl alcohol. |
AT1G65390 | Phloem Protein2 family gene encoding a two-domain protein containing predicted lectin and Toll/Interleukin-1 receptor domains, which is induced upon spider mite attack and improves the ability to defend against T. urticae by participating in the tight regulation of hormonal cross talk upon mite feeding. |
AT3G61060 | phloem protein 2-A13;(source:Araport11) |
AT5G52120 | phloem protein 2-A14;(source:Araport11) |
AT2G26820 | phloem protein 2-A3;(source:Araport11) |
AT5G45080 | phloem protein 2-A6;(source:Araport11) |
AT5G45090 | phloem protein 2-A7;(source:Araport11) |
AT5G45070 | phloem protein 2-A8;(source:Araport11) |
AT2G02230 | phloem protein 2-B1;(source:Araport11) |
AT1G56240 | phloem protein 2-B13;(source:Araport11) |
AT1G56250 | Encodes an F-box protein that can functionally replace VirF, regulating levels of the VirE2 and VIP1 proteins via a VBF-containing SCF complex. It is thought to be involved in DNA integration and T-DNA degradation. |
AT2G02250 | phloem protein 2-B2;(source:Araport11) |
AT2G02300 | phloem protein 2-B5;(source:Araport11) |
AT2G02310 | phloem protein 2-B6;(source:Araport11) |
AT2G40180 | Encodes PP2C5, a member of the PP2C family phosphatases. PP2C5 acts as a MAPK phosphatase that positively regulates seed germination, stomatal closure and ABA-inducible gene expression. |
AT3G23430 | Encodes a protein with the mainly hydrophilic N-terminal and the C-terminal containing 6 potential membrane-spanning domains. The mutant is deficient in the transfer of phosphate from root epidermal and cortical cells to the xylem. Its expression is repressed by phosphate (Pi) in shoots, and transiently induced by phosphite (Phi) in roots and shoots. PHO is expressed in developing ovules and plays a role in the transfer of Ph from maternal tissues to filial tissues. |
AT2G33770 | Encodes a ubiquitin-conjugating E2 enzyme. UBC24 mRNA accumulation is suppressed by miR399f, miR399b and miR399c. Involved in phosphate starvation response and mediates degradation of PHO1 and PHT1s at endomembrane. Its expression is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT5G43350 | Encodes an inorganic phosphate transporter Pht1;1. Mutants display enhanced arsenic accumulation. Under high arsenate concentrations, PHT1;1 levels are reduced and it is delocalized from the plasma membrane. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341).PHT1;1 expression is transcriptionally regulated by WRKY6 and by PHR1. |
AT5G43360 | Encodes Pht1;3, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT2G38940 | Encodes Pht1;4, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). Expression is upregulated in the shoot of cax1/cax3 mutant and is responsive to phosphate (Pi) and not phosphite (Phi) in roots and shoots. The mRNA is cell-to-cell mobile. |
AT1G76430 | Encodes Pht1;9, a member of the Pht1 family of phosphate transporters which include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341). |
AT5G43370 | Encodes a phosphate transporter Pht1;2. Members of the Pht1 family of phosphate transporters include: Pht1;1/At5g43350, Pht1;2/At5g43370, Pht1;3/At5g43360, Pht1;4/At2g38940, Pht1;5/At2g32830, Pht1;6/At5g43340, Pht1;7/At3g54700, Pht1;8/At1g20860, Pht1;9/At1g76430 (Plant Journal 2002, 31:341) The mRNA is cell-to-cell mobile. |
AT2G29650 | Encodes an inorganic phosphate transporter (PHT4;1) that is localized to the thylakoid membrane. |
AT3G52190 | Encodes a plant specific protein structurally related to the SEC12 proteins of the early secretory pathway. Mutation of PHF1 impairs Pi transport. Expression was detected in all tissues, and was induced by Pi starvation. Localized in endoplasmic reticulum (ER), and mutation of PHF1 resulted in ER retention and reduced accumulation of the plasma membrane PHT1;1 transporter. Its expression is responsive to both phosphate (Pi) and phosphite (Phi) in shoots. |
AT2G01180 | Encodes phosphatidate phosphatase. Up-regulated by genotoxic stress (gamma ray or UV-B) and elicitor treatments with mastoparan and harpin. Expressed in roots and leaves. |
AT5G42870 | The PAH2 gene encodes a phosphatidate phosphohydrolase. Mutant analysis revealed its involvement in galactolipid synthesis pathway, and the membrane lipid remodeling. The pah1pah2 double-mutant showed enhanced Al-susceptibility under low-P conditions, but there was no significant differences in Al tolerance between pah1pah2 and wild type when they were grown in a solution containing 35 μM Pi. |
AT3G09920 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) family member. Family members are key enzymes in the process of phosphatidylinositol signaling pathway and have essential functions in growth, development, and biotic and abiotic stresses responses in plants |
AT2G39290 | Encodes a phosphatidylglycerolphosphate synthase 2C which is dual-targeted into chloroplasts and mitochondria. Mutant plants have mutant chloroplasts but normal mitochondria. |
AT5G09350 | Encodes a phosphatidylinositol 4-OH kinase, PI-4Kbeta2. Arabidopsis contains 12 PI-4Ks in three separate families: PI-4Kalphs, PI-4kbeta, and PI-4Kgamma. PI-4Kbeta2 is 83% identical to PI-4kbeta1 encoded by At5g64070. Important for polarized root hair growth as the loss of this gene and its close relative PI-4kbeta1, leads to the formation of abnormal root hairs. |
AT4G02650 | Phosphatidylinositol binding clathrin assembly protein 5A/B are recent paralogs with overlapping functions in recycling ANXUR proteins to the pollen tube membrane. |
AT3G47290 | phosphatidylinositol-speciwc phospholipase C8;(source:Araport11) |
AT4G16700 | Encodes a mitochondrial phosphatidylserine decarboxylase. Expressed mainly in roots and flowers. |
AT5G65690 | Encodes a putative phosphoenolpyruvate carboxykinase (ATP-dependent). The mRNA is cell-to-cell mobile. |
AT1G53310 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.Plays an important role in carbon and nitrogen metabolism. |
AT2G42600 | Encodes one of four Arabidopsis phosphoenolpyruvate carboxylase proteins.PPC1 and PPC2 are crucial for balancing carbon and nitrogen metabolism. |
AT1G12580 | phosphoenolpyruvate carboxylase-related kinase 1;(source:Araport11) |
AT1G12680 | phosphoenolpyruvate carboxylase-related kinase 2;(source:Araport11) |
AT1G48600 | Encodes a phosphoethanolamine N-methyltransferase that catalyses the last two methylation steps of the three sequential methylations of phosphoethanolamine (PEA) that are required for the synthesis of phosphocholine (PCho) in plants. |
AT4G29220 | phosphofructokinase 1;(source:Araport11) |
AT4G26270 | phosphofructokinase 3;(source:Araport11) |
AT4G16820 | Encodes a lipase that hydrolyzes phosphatidylcholine, glycolipids as well as triacylglycerols. |
AT3G55940 | Phospholipase C family member. Double mutants with PLC5 show defects in seed coat mucilage, leaf serration and over-expression improves drought tolerance. |
AT1G13680 | Encodes a phospholipase C-like protein that serves as a convergence point for fumonisin B1 and extracellular ATP signalling, and functions in Arabidopsis stress response to fumonisin B1. |
AT1G52570 | member of C2-PLD subfamily |
AT4G35790 | Encodes a protein with phospholipase D activity. Involved in phospolipase metabolism. Mutants are affected in hydrogen peroxide mediated cell death. |
AT4G11840 | member of C2-PLD subfamily |
AT4G39670 | Member of the glycolipid transfer protein (GLTP) superfamily, shuttles ceramide-1-phosphate (C1P) between membranes. |
AT4G35110 | phospholipase-like protein (PEARLI 4) family protein;(source:Araport11) |
AT1G04010 | phospholipid sterol acyl transferase 1;(source:Araport11) |
AT1G10700 | Encodes a P-independent phosphoribosyl pyrophosphate (PRPP) synthase. |
AT1G32060 | phosphoribulokinase;(source:Araport11) |
AT2G32260 | phosphorylcholine cytidylyltransferase;(source:Araport11) |
AT1G12370 | encodes an amino acid sequence with significant homology to the recently characterized type II photolyases. The uvr2-1 mutant is unable to remove CPDs in vivo, and plant extracts lack detectable photolyase activity , is sensitive to UV-B and is an allele |
AT3G12810 | Encodes a protein similar to ATP-dependent, chromatin-remodeling proteins of the ISWI and SWI2/SNF2 family. Genetic analyses suggest that this gene is involved in multiple flowering pathways. Mutations in PIE1 results in suppression of FLC-mediated delay of flowering and causes early flowering in noninductive photoperiods independently of FLC. PIE1 is required for expression of FLC in the shoot apex but not in the root.Along with ARP6 forms a complex to deposit modified histone H2A.Z at several loci within the genome. This modification alters the expression of the target genes (i.e. FLC, MAF4, MAF6). The mRNA is cell-to-cell mobile. |
AT3G47390 | Encodes a protein that is believed to function as a pyrimidine reductase involved in riboflavin and FAD biosynthesis. phs1 was identified as a photosensitive mutant that shows reduced growth, chloroplast developmental abnormalities, reduced chlorophyll levels, increased oxidative stress, reduced NADPH/NADP+ ratios, reduced photosystem I electron transport, and reduced photosynthetic protein levels under high light conditions. Many of these abnormal phenotypes likely arise from the reduction in the levels of FAD in the phs1 mutant. |
AT1G68650 | Member of the UPF0016 family of membrane proteins, belongs to the conserved group of Mn/Ca transporters. Might act to fine tune Mn allocation into the endoplasmic reticulum of specific cell types. |
AT2G46820 | Encodes the P subunit of Photosystem I. About 25% of the TMP14 pool appeared to be phosphorylated, and this ratio is not affected by light. Contains seven phosphorylation sites on threonine residue and chloroplast targeting signal. Located in the proximity of PSI-L, -H and -O subunits. Forms oligomers with other members of CURT1 family to modulate grana structure. |
AT1G03130 | Encodes a protein predicted by sequence similarity with spinach PsaD to be photosystem I reaction center subunit II (PsaD2) |
AT3G16140 | Encodes subunit H of photosystem I reaction center subunit VI. |
AT4G12800 | Encodes subunit L of photosystem I reaction center. |
AT1G67740 | PsbY precursor (psbY) mRNA. This single nuclear gene is imported into the chloroplasts where it is processed into two integral membrane proteins with identical topology (PsbY-1 and PsbY-2). The protein appears to bind manganese. Important for the redox control of cytochrome b559. |
AT2G30170 | Encodes a chloroplast PP2C phosphatase that is required for efficient dephosphorylation of PSII proteins and involved in light acclimation.Loss of function enhances immunity to bacterial pathogens. |
AT2G05070 | Encodes Lhcb2.2. Belongs to the Lhc super-gene family encodes the light-harvesting chlorophyll a/b-binding (LHC) proteins that constitute the antenna system of the photosynthetic apparatus. |
AT2G20890 | Chloroplast-localized Thylakoid formation1 gene product involved in vesicle-mediated formation of thylakoid membranes. Thf1 antisense lines contain abnormal chloroplasts early in leaf development (chloroplasts have loosely stacked thylakoid membranes). Expression was induced in the light and decreased under dark conditions. G-alpha interaction partner that functions downstream of the plasma membrane?delimited heterotrimeric G-protein (GPA1) in a D-glucose signaling pathway. Localized to both the outer plastid membrane and the stroma. Probably involved in the metabolic pathway that controls the assembly of the PS II complex. The mRNA is cell-to-cell mobile. |
AT2G30570 | Encodes PsbW, a protein similar to photosystem II reaction center subunit W. Loss of PsbW destabilizes the supramolecular organization of PSII. |
AT2G06520 | Encodes a protein with sequence similarity to the spinach photosystem II subunit PsbX. |
AT5G29000 | MYB-CC family member. PHL1 acts redundantly with PHR1 to regulate responses to Pi starvation. |
AT2G20400 | MYB-CC transcription factor. PHL4 is related to PHR1 (which regulates plant Pi starvation response) but it does not seem to have a significant role in Pi starvation. |
AT4G14150 | Microtubule motor kinesin PAKRP1/Kinesin-12A. Together with PAKRP1L/Kinesin-12B, serve as linkers of the plus ends of antiparallel microtubules in the phragmoplast. |
AT1G68890 | Homologous to the four eubacterial men genes involved in menanoquinone biosynthesis. Studies of mutants defective in this gene demonstrated its involvement in phylloquinone biosynthesis in Arabidopsis. The mRNA is cell-to-cell mobile. |
AT1G03980 | Encodes a protein with phytochelatin synthase activity which binds Cd2+ and Cd-glutathione complexes with high affinity. The protein has been postulated to be involved in Cd2+ tolerance. AtPCS2 expression appears to be less than that of AtPCS1, explaining the inability of endogenous AtPCS2 to substitute for AtPCS1 in the cad1-3 mutant (AtPCS1 null). |
AT5G48150 | Member of GRAS gene family. Semi-dominant mutant has a reduced response to far-red light and appears to act early in the phytochrome A signaling pathway. |
AT5G35840 | Encodes the apoprotein of phytochrome;one of a family of photoreceptors that modulate plant growth and development. The mRNA is cell-to-cell mobile. |
AT2G46970 | encodes a novel Myc-related bHLH transcription factor, which physically associated with APRR1/TOC1 and is a member of PIF3 transcription factor family. |
AT2G43010 | Isolated as a semidominant mutation defective in red -light responses. Encodes a nuclear localized bHLH protein that interacts with active PhyB protein. Negatively regulates phyB mediated red light responses. Involved in shade avoidance response. Protein abundance is negatively regulated by PhyB.Involved in the regulation of response to nutrient levels. Controls the resistance to B. cinerea in a COI1- and EIN2-dependent manner. |
AT3G16500 | phytochrome-associated protein 1 (PAP1) |
AT1G22280 | Encodes a phytochrome-associated protein, PAPP2C (phytochrome-associated protein phosphatase type 2C). PAPP2C interacts in the nucleus with phyA (phytochrome A) and phyB. Functions as a regulator of phytochrome-interacting factor PIF3 by dephosphorylating phytochromes in the nucleus. |
AT2G31980 | PHYTOCYSTATIN 2;(source:Araport11) |
AT4G16500 | Cystatin/monellin superfamily protein;(source:Araport11) |
AT1G13590 | Encodes a phytosulfokine-alpha (PSK) precursor, a unique plant peptide growth factor first described in Asparagus. |
AT2G22860 | Phytosulfokine 2 precursor, coding for a unique plant peptide growth factor. The mRNA is cell-to-cell mobile. |
AT3G44735 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. |
AT3G49780 | Phytosulfokine 3 precursor, coding for a unique plant peptide growth factor. Plants overexpressing this gene (under a 35S promoter), develop normal cotyledons and hypocotyls but their growth, in particular that of their roots, was faster than that of wildtype. |
AT4G37720 | Probable phytosulfokines 6 precursor, coding for a unique plant peptide growth factor. |
AT5G53890 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of phytosulfokine (PSK), which is a 5-aa tyrosine-sulfated peptide that primarily promotes cellular proliferation. |
AT3G26840 | Encodes a protein with phytyl ester synthesis and diacylglycerol acyltransferase activities that is involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. |
AT4G31900 | chromatin remodeling factor;(source:Araport11) |
AT2G39210 | Major facilitator superfamily transmembrane transporter responsible for the uptake of picolinate herbicides. |
AT5G12130 | integral membrane TerC family protein;(source:Araport11) |
AT4G30720 | Encodes a putative oxidoreductase/electron carrier detected in the chloroplast stroma that is essential to ensure a correct electron flow through the photosynthetic chain and, hence, photosynthesis efficiency and normal growth. Mutations in the Col-0 allele result in pale green pigmentation and defective growth. |
AT1G68450 | VQ motif-containing protein;(source:Araport11) |
AT1G76620 | Serine/Threonine-kinase, putative (Protein of unknown function, DUF547);(source:Araport11) |
AT1G77110 | Rate-limiting factor in saturable efflux of auxins. PINs are directly involved of in catalyzing cellular auxin efflux. |
AT1G23080 | Encodes a novel component of auxin efflux that is located apically in the basal cell and is involved during embryogenesis in setting up the apical-basal axis in the embryo. It is also involved in pattern specification during root development. In roots, it is expressed at lateral and basal membranes of provascular cells in the meristem and elongation zone, whereas in the columella cells it coincides with the PIN3 domain. Plasma membrane-localized PIN proteins mediate a saturable efflux of auxin. PINs mediate auxin efflux from mammalian and yeast cells without needing additional plant-specific factors. The action of PINs in auxin efflux is distinct from PGPs, rate-limiting, specific to auxins and sensitive to auxin transport inhibitors. PINs are directly involved of in catalyzing cellular auxin efflux. |
AT1G71090 | Auxin efflux carrier family protein;(source:Araport11) |
AT1G76520 | Auxin efflux carrier family protein;(source:Araport11) |
AT1G76530 | Auxin efflux carrier family protein;(source:Araport11) |
AT5G65980 | Auxin efflux carrier family protein;(source:Araport11) |
AT2G34650 | Encodes a protein serine/threonine kinase that may act as a positive regulator of cellular auxin efflux, as a a binary switch for PIN polarity, and as a negative regulator of auxin signaling. Recessive mutants exhibit similar phenotypes as pin-formed mutants in flowers and inflorescence but distinct phenotypes in cotyledons and leaves. Expressed in the vascular tissue proximal to root and shoot meristems, shoot apex, and embryos. Expression is induced by auxin. Overexpression of the gene results in phenotypes in the root and shoot similar to those found in auxin-insensitive mutants. The protein physically interacts with TCH3 (TOUCH3) and PID-BINDING PROTEIN 1 (PBP1), a previously uncharacterized protein containing putative EF-hand calcium-binding motifs. Acts together with ENP (ENHANCER OF PINOID) to instruct precursor cells to elaborate cotyledons in the transition stage embryo. Interacts with PDK1. PID autophosphorylation is required for the ability of PID to phosphorylate an exogenous substrate. PID activation loop is required for PDK1-dependent PID phosphorylation and requires the PIF domain. Negative regulator of root hair growth. PID kinase activity is critical for the inhibition of root hair growth and for maintaining the proper subcellular localization of PID. |
AT3G59220 | encodes a cupin-domain containing protein that is similar to pirins which interact with a CCAAT box binding transcription factor. The protein interacts with GPA1 (G protein alpha-subunit) in vitro. Mutants in the gene are affected in germination and early seedling development. |
AT5G18410 | distorted trichomes and exhibits a diffuse actin cytoskeleton |
AT4G02075 | RING/FYVE/PHD zinc finger superfamily protein;(source:Araport11) |
AT5G15930 | Encodes a putative plant adhesion molecule. |
AT2G32960 | Encodes an atypical dual-specificity phosphatase. |
AT1G14870 | PCR2 encodes a membrane protein involved in zinc transport and detoxification. |
AT1G18490 | 2-aminoethanethiol dioxygenase, putative (DUF1637);(source:Araport11) |
AT1G55010 | Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant defensin (PDF) family with the following members: At1g75830/PDF1.1, At5g44420/PDF1.2a, At2g26020/PDF1.2b, At5g44430/PDF1.2c, At2g26010/PDF1.3, At1g19610/PDF1.4, At1g55010/PDF1.5, At2g02120/PDF2.1, At2g02100/PDF2.2, At2g02130/PDF2.3, At1g61070/PDF2.4, At5g63660/PDF2.5, At2g02140/PDF2.6, At5g38330/PDF3.1 and At4g30070/PDF3.2. |
AT3G18660 | Plants expressing an RNAi construct specifically targeting PGSIP1 was shown to have a dramatically reduced amount of starch. Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
AT1G77130 | Encodes a glucuronyltransferase responsible for the addition of GlcA residues onto xylan and for secondary wall deposition. |
AT2G35710 | Nucleotide-diphospho-sugar transferases superfamily protein;(source:Araport11) |
AT5G05850 | Encodes PIRL1, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. PIRL1 (AT5G05850) and PIRL9 (AT3G11330) are genetically redundant and are required for differentiation of microspores into pollen. |
AT3G26500 | Encodes PIRL2, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT1G12970 | Encodes PIRL3, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT2G19330 | Encodes PIRL6, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. |
AT4G26050 | Encodes PIRL8, a member of the Plant Intracellular Ras-group-related LRRs (Leucine rich repeat proteins). PIRLs are a distinct, plant-specific class of intracellular LRRs that likely mediate protein interactions, possibly in the context of signal transduction. The mRNA is cell-to-cell mobile. |
AT5G58650 | Encodes PSY1, an18-aa tyrosine-sulfated glycopeptide that promotes cellular proliferation and expansion. PSY1 is widely expressed in various tissues, including shoot apical meristem, and is highly up-regulated by wounding. Perception of PSY1 depends on At1g72300, a leucine-rich repeat receptor kinase (LRR-RK). |
AT5G62190 | Encodes a ATP-dependent RNA unwinding protein targeted to the nucleolus and presumably involved in translation by assisting ribosome maturation. DEAD/DEAH box RNA helicase PRH75 |
AT2G28830 | Encodes a U-box E3 ubiquitin ligase involved in ubiquitination of pattern recognition receptor FLS2.pub12/pub13 double mutants enhanced chitin-induced ROS production and callose deposition suggesting they function redundantly to negatively regulate immune response to fungal elicitor. |
AT3G46510 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. Can be phosphorylated in vitro by MLPK, ARK1, and ARK2 but not by SD1-29. Involved in ubiquitination of pattern recognition receptor FLS2. |
AT3G54850 | Encodes a protein with a typical U-box domain followed by an Armadillo repeat region, a domain organization that is frequently found in plant U-box proteins. Displays ubiquitin ligase activity in vitro. Regulator of flowering time. |
AT1G29340 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity. It is required for cell death and full resistance specified by Arabidopsis RPM1 and RPS4 resistance proteins against Pseudomonas syringae pv tomato. The mRNA is cell-to-cell mobile. |
AT1G10560 | Encodes a protein containing a UND, a U-box, and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT3G52450 | Encodes a cytoplasmically localized U-box domain E3 ubiquitin ligase protein that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
AT2G35930 | Encodes a cytoplasmically localized U-box domain containing E3 ubiquitin ligase that is involved in the response to water stress and acts as a negative regulator of PAMP-triggered immunity. |
AT3G11840 | Encodes a U-box-domain-containing E3 ubiquitin ligase that acts as a negative regulator of PAMP-triggered immunity. |
AT3G19380 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
AT1G49780 | PUB25 and PUB26 are closely related paralogs that encode functional E3 ligases. They function in immune response pathway by targeting BIK1 for degradation. |
AT3G18710 | Encodes a protein containing a U-box and an ARM domain. This protein has E3 ubiquitin ligase activity based on in vitro assays. |
AT3G54790 | ARM repeat superfamily protein;(source:Araport11) |
AT3G47820 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G62560 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT1G76390 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT5G18320 | One of three tandemly located, paralogous plant U-box proteins. Mutants show increased sensitivity to water stress.Expression in roots is enhanced by auxin and to a lesser extent ABA and cytokinin treatment. |
AT1G01680 | Plant U-box type E3 ubiquitin ligase (PUB). |
AT4G21350 | Encodes a U-box/ARM repeat protein required fore self-incompatibility. |
AT2G01650 | encodes a peripheral membrane protein that contains UBX domain and interacts with AtCDC48 in vitro and co-fractionates with membrane-associated but not soluble AtCDC48 in vivo. |
AT3G17750 | Encodes a member of a plant-specific subgroup in the DYRK (dual-specificity tyrosine phosphorylation-regulated kinase) family. |
AT1G24560 | Effector molecule of the plant-unique RAB5, ARA6. Acts in the vacuolar/endocytic trafficking pathway with canonical RAB5 and SYP. Promotes recruitment of VSP9a onto the endosome, which is required for efficient RAB5 activation. Colocalizes with RAB5 on endosomes, where it coordinates transport with canonical RAB5. |
AT5G60660 | A member of the plasma membrane intrinsic protein subfamily PIP2.When expressed in yeast cells can conduct hydrogen peroxide into those cells. Mutants exhibit longer root hairs. |
AT3G53420 | a member of the plasma membrane intrinsic protein subfamily PIP2. localizes to the plasma membrane and exhibits water transport activity in Xenopus oocyte. expressed specifically in the vascular bundles and protein level increases slightly during leaf dev. When expressed in yeast cells can conduct hydrogen peroxide into those cells. |
AT4G20260 | Encodes a Ca2+ and Cu2+ binding protein. N-terminal myristylation on glycine 2 appears to enable it to associate tightly with the plasma membrane. Recombinant PCaP1 interacts strongly with phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2) and PtdIns (3,4,5)P3, and weakly with PtdIns(3,5)P2 and PtdIns(4,5). It also interacts with calmodulin (CaM) in a calcium-dependent manner. CaM does not interfere with PCaP1 membrane localization but does weaken interactions between it and the PtdInsPs. PCaP1 has an apparent Kd of 10 uM for Cu2+ and can bind six ions per protein. Transcript levels for PCaP1 first fall and then rise following exposure to CuCl2. Mannitol, sorbitol, and the flg22 oligopeptide also increase expression levels. The mRNA is cell-to-cell mobile. |
AT1G69295 | Encodes a member of the X8-GPI family of proteins. It localizes to the plasmodesmata and is predicted to bind callose. |
AT1G04520 | Encodes a plasmodesmal protein that may be involved in the intercellular movement of molecules through the plasmodesmata. |
AT5G53280 | An integral outer envelope membrane protein (as its homolog PDV2), component of the plastid division machinery. Similar to ARC5, PDV1 localized to a discontinuous ring at the division site in wild-type plants. PDV1 and PDV2 are required for localization of ARC5 at the chloroplast division site. Topological analysis showed that the large N-terminal region of PDV1 upstream of the transmembrane helix bearing a putative coiled-coil domain is exposed to the cytosol. Mutation of the conserved PDV1 C-terminal Gly residue did not block PDV1 insertion into the outer envelope membrane but did abolish its localization to the division site. The mRNA is cell-to-cell mobile. |
AT2G24090 | Ribosomal protein L35;(source:Araport11) |
AT5G65220 | Ribosomal L29 family protein;(source:Araport11) |
AT3G02150 | a chloroplast trans-acting factor of the psbD light-responsive promoter.TCP gene involved in heterochronic control of leaf differentiation. |
AT2G34640 | Present in transcriptionally active plastid chromosomes. Involved in plastid gene expression. |
AT3G46780 | plastid transcriptionally active 16;(source:Araport11) |
AT2G32180 | plastid transcriptionally active 18;(source:Araport11) |
AT1G68590 | Ribosomal protein PSRP-3/Ycf65;(source:Araport11) |
AT1G32440 | encodes a chloroplast pyruvate kinase beta subunit. The enzyme is less active than the other chloroplast pyruvate kinase beta subunit encoded by AT5G52920. Involved in seed oil biosynthesis. Can partially complement the AT5G52920 mutant. |
AT5G16150 | Encodes a putative plastidic glucose transporter. |
AT5G52920 | encodes a dominant chloroplast pyruvate kinase beta subunit. Important for seed oil biosynthesis. Ubiquitously expressed, with significantly increased expression in maturing seeds. The mutant plant has wrinkled seeds, with a 50-70% reduction in seed fatty acid content. The mRNA is cell-to-cell mobile. |
AT5G39570 | Protein of unknown function. Binds phosphatidic acid and acts downstream of PLDalpha. |
AT2G29700 | Encodes a protein containing one PH (pleckstrin homology) domain with a short N-terminal extension The mRNA is cell-to-cell mobile. |
AT1G22780 | S18 ribosomal protein involved in the binding of f-Met tRNA during initiation of mRNA translation. Expression restricted to meristems. Mutant phenotype-pointed first leaves,reduced fresh weight, growth retardation. |
AT1G71270 | Encodes a homolog of the yeast Vps52p/SAC2. Involved in pollen tube germination and growth. Located in multiple endomembrane organelles including the golgi. The yeast protein has been shown to be located at the late Golgi and to function in a complex involved in retrograde trafficking of vesicles between the early endosomal compartment and the trans-Golgi network. |
AT5G02400 | Encodes a protein with similarity to the POL locus which is a novel protein phosphatase 2C. Ubiquitously expressed. No phenotype observed in homozygous null mutant background. |
AT3G09400 | Similar to POLTERGEIST (POL) protein phosphatase 2C. No phenotype observed in plants homozygous for a null allele. Ubiquitously expressed. |
AT1G07630 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT2G29790 | Encodes a Maternally expressed gene (MEG) family protein [pseudogene] |
AT2G16535 | Encodes a Maternally expressed gene (MEG) family protein |
AT2G35350 | Encodes a protein most similar to the POLTERGEIST locus. Double mutant analysis of loss of function alleles indicate PLL1 functions redundantly with POL to regulate meristem size and pedicel length. Acts in a dose dependent manner with POL to suppress the clv1, clv2 and clv3 phenotypes. |
AT2G28890 | Encodes a protein phosphatase 2C like gene, similar to POL. Involved in leaf development. Knockout mutants have abnormally shaped leaves. |
AT4G34110 | Putative poly-A binding protein. Member of a gene family .Expressed in stele and root meristem and post-fertilization ovules.Member of the class II family of PABP proteins. The mRNA is cell-to-cell mobile. |
AT2G25850 | Encodes a poly(A) polymerase. Located in the nucleus. |
AT3G06560 | Encodes a poly(A) polymerase. Located in the cytoplasm. |
AT2G31865 | poly(ADP-ribose) glycohydrolase 2;(source:Araport11) |
AT4G02390 | Encodes a DNA dependent nuclear poly (ADP-ribose) polymerase (E.C.2.4.2.30), thought to be involved in post-translational modification . |
AT4G29720 | polyamine oxidase 5;(source:Araport11) |
AT1G31830 | Encodes POLYAMINE UPTAKE TRANSPORTER 2, an amino acid permease family protein. |
AT1G60390 | polygalacturonase 1;(source:Araport11) |
AT1G70370 | Polygalacturonase involved in cell wall modification. |
AT2G41850 | ADPG2. |
AT5G06860 | Encodes a polygalacturonase inhibiting protein involved in defense response. PGIPs inhibit the function of cell wall pectin degrading enzymes such as those produced by fungal pathogens. PGIP1 is induced by fungal infection. Suppressed in the proton sensitive stop1-mutant, but the transcription level was recovered by transformation of STOP2. Knockout mutant showed severe damage in the root tip in low Ca and low pH medium. |
AT3G26610 | Encodes an apoplast-localized polygalacturonase involved in cell elongation and flower development. |
AT1G78400 | PGX2 is a cell wall protein that codes for a polygalacturonase. |
AT1G48100 | Pectin lyase-like superfamily protein;(source:Araport11) |
AT2G16120 | polyol/monosaccharide transporter 1;(source:Araport11) |
AT3G18830 | This gene encodes a plasma membrane-localized polyol/cyclitol/monosaccharide-H+-symporter. The symporter is able to catalyze the energy-dependent membrane passage of a wide range of linear polyols (three to six carbon backbone), of cyclic polyols (myo-inositol), and of numerous monosaccharides, including pyranose ring-forming and furanose ring-forming hexoses and pentoses. This gene belongs to a monosaccharide transporter-like (MST-like) superfamily. |
AT2G16530 | Encodes polyprenol reductase involved in N-gylcosylation. Mutants are defective in pollen development. Knockouts are embryo lethal |
AT3G20160 | Terpenoid synthases superfamily protein;(source:Araport11) |
AT3G01150 | Encodes one of the two polypyrimidine tract-binding (PTB) protein homologs in the Arabidopsis genome. Double mutants have defects in pollen germination. |
AT1G10710 | Computational predictions suggested the presence of a small cysteine-rich protein beginning in intron 9 (Silverstein 2007), but subsequent analysis revealed that this region contains a tenth exon for the At1g10710 gene. PHS1 regulates recombination and pairing of homologous chromosomes during meiotic prophase by controlling transport of RAD50 from cytoplasm to the nucleus. |
AT5G46240 | Encodes a potassium channel protein (KAT1). ABA triggers KAT1 endocytosis both in epidermal cells as well as guard cells. Upon removal of ABA, KAT1 is recycled back to the plasma membrane. KAT1 is localized within 0.5?0.6 μm diameter microdomains at the plasma membrane surface. KAT1 belongs to the Shaker family K+ channel. This family includes five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT4G32650 | Encodes KAT3, a member of the Shaker family of voltage-gated potassium channel subunits. Does not form functional potassium channel on its own. Involved in down-regulating AKT1 and KAT1 channel activity by forming heteromers with AKT1 or KAT1. The Shaker family K+ ion channels include five groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inwardly rectifying conductance): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT4G22200 | Encodes AKT2, a photosynthate- and light-dependent inward rectifying potassium channel with unique gating properties that are regulated by phosphorylation. Expressed in guard cell protoplasts and in the phloem and xylem of aerial portions of the plant. The channel can coassemble with another K+ channel, KAT1, in vitro. In guard cells, AKT2/3 is responsible for the Ca2+ sensitivity of the K+ uptake channel. In the phloem, it regulates the sucrose/H+ symporters via the phloem potential. AKT2 belongs to the Shaker family K+ channels which include the following groups based on phylogenetic analysis (FEBS Letters (2007) 581: 2357): I (inward rectifying channel): AKT1 (AT2G26650), AKT5 (AT4G32500) and SPIK (also known as AKT6, AT2G25600); II (inward rectifying channel): KAT1 (AT5G46240) and KAT2 (AT4G18290); III (weakly inward rectifying channel): AKT2 (AT4G22200); IV (regulatory subunit involved in inwardly rectifying conductance formation): KAT3 (also known as AtKC1, AT4G32650); V (outward rectifying channel): SKOR (AT3G02850) and GORK (AT5G37500). |
AT3G52250 | Encodes a protein with a putative role in mRNA splicing. The mRNA is cell-to-cell mobile. |
AT5G51700 | Encodes a resistance signalling protein with two zinc binding (CHORD) domains that are highly conserved across eukaryotic phyla. Mutant has reduced RPS5 and RPM1 mediated resistance. Potentially involved in transduction of R gene mediated disease resistance. Required for R protein accumulation. |
AT1G44910 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. |
AT3G19670 | Binds the carboxyl-terminal domain (CTD) of the largest subunit of RNA polymerase II and functions as a scaffold for RNA processing machineries. Ubiquitously expressed and localize to the nucleus. |
AT1G15480 | PPR motif containing protein. Found in mitochondria. Mutants flower early and have reduced levels of the ABI5, a regulator of FLC expression. |
AT2G23270 | Encoding a precursor protein of a secreted peptide that is responsive to flg22 stimulus. Finetuning role in modulation of immunity through the regulation of SA and JA biosynthesis and signalling pathways. |
AT5G43066 | Homolog of prePIP1. |
AT5G44585 | Precursor of serine-rich endogenous peptide which regulates defense response and root elongation. Has properties of phytocytokines, activates the phospholipid signaling pathway, regulates reactive oxygen species response, and is perceived in a BAK1 co-receptor-dependent manner. |
AT5G49510 | prefoldin 3;(source:Araport11) |
AT5G56230 | prenylated RAB acceptor 1.G2;(source:Araport11) |
AT3G19170 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed only in siliques and flowers |
AT1G49630 | Zinc metalloprotease pitrilysin subfamily A. Signal peptide degrading enzyme targeted to mitochondria and chloroplasts. Expressed in flower, leaf and root. Not expressed in silique and shoot. |
AT1G29850 | Encodes a protein that by its interaction with HAM acetyltransferases plays an important role during DNA damage responses induced by UV-B radiation and participates in programmed cell death programs. |
AT5G40770 | prohibitin 3 |
AT4G02060 | Member of the minichromosome maintenance complex, involved in DNA replication initiation. Abundant in proliferating and endocycling tissues. Localized in the nucleus during G1, S and G2 phases of the cell cycle, and are released into the cytoplasmic compartment during mitosis. Binds chromatin. |
AT2G39890 | Encodes a proline transporter with affinity for gly betaine, proline and GABA. Protein is expressed in the vascular tissue, specifically the phloem. |
AT3G55740 | Encodes a proline transporter with affinity for gly betaine, proline, and GABA. Protein is expressed most highly in the roots. |
AT1G26150 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G52290 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G24400 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G24540 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT3G18810 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT1G68690 | Encodes a member of the proline-rich extensin-like receptor kinase (PERK) family. This family consists of 15 predicted receptor kinases (PMID: 15653807). |
AT4G38770 | Encodes one of four proline-rich proteins in Arabidopsis which are predicted to localize to the cell wall. Transcripts are most abundant in aerial organs of the plant. |
AT3G06300 | Encodes a prolyl-4 hydroxylase that can hydroxylate poly(L-proline)and other proline rich peptides, including those with sequences corresponding to those in arabinogalactan proteins and extensins. The mRNA is cell-to-cell mobile. |
AT2G17720 | Encodes a prolyl 4-hydroxylase that modifies the extensin proteins in root hair cells. |
AT3G62120 | Encodes a cytosolic prolyl-tRNA synthetase. |
AT3G13330 | Encodes a protein that interacts with the 26S proteasome. Mutants are phenotypically indistinguishable from wild type plants under a variety of growth conditions. Protein levels increase upon exposure of seedlings to MG132, a specific, potent, reversible, and cell-permeable proteasome inhibitor. |
AT1G16470 | Encodes 20S proteasome subunit PAB1 (PAB1). |
AT5G49020 | Encodes a type I protein arginine methyltransferase. PRMT4a can catalyze the asymmetric dimethylation of arginines 2,17, and 26 on histone 3 and can also methylate myelin basic protein in vitro. Double mutants lacking PRMT4a and 4b have reduced levels of histone 3 methylated at R17. These double mutants flower late due to defects in the autonomous pathway and they have elevated levels of FLC transcripts. |
AT5G47420 | PAWH2 along with PAWH1 is part of endoplasmic reticulum ubiquitin ligase complex with Arabidopsis HRD1 via interaction with EBS7. As such it plays a role in promoting protein degradation via the ERAD pathway. |
AT5G38900 | Thioredoxin superfamily protein;(source:Araport11) |
AT1G08910 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
AT5G41580 | Encodes an SP-RING domain containing protein that functions in sumolaytion and is involved in positive regulation of sulfur metabolism and stress response. |
AT1G14370 | Encodes protein kinase APK2a. Protein is N-myristoylated. |
AT1G51690 | 55 kDa B regulatory subunit of phosphatase 2A mRNA, |
AT5G36250 | Encodes a myristoylated 2C-type protein phosphatase that interacts with the catalytic subunit of SnRK1. The mRNA is cell-to-cell mobile. |
AT5G55260 | Encodes a protein with similarity to the catalytic subunit of the mammalian PPX protein phospatase. |
AT2G33640 | DHHC-type zinc finger family protein that encodes a functional s-acyl transferase. |
AT5G39790 | Encodes a chloroplast localized protein that is involved in protein translocation and starch metabolism. PTST helps localize GBSS to the starch granules where GBSS functions in amylose biosynthesis. |
AT2G35680 | Encodes a phosphatidylglycerophosphate (PGP) phosphatase involved in the synthesis of plastidial Phosphatidylglycerol (PG) in conjunction with PGPP1 and PTPMT2 in root. PTPMT1 levels were higher in node, cauline leaf, and flower than in root, leaf, and stem. |
AT1G03630 | Encodes for a protein with protochlorophyllide oxidoreductase activity. The enzyme is NADPH- and light-dependent. |
AT4G04890 | Encodes a homeodomain protein that is expressed in the LI layer of the vegetative, floral and inflorescence meristems. Binds to the L1 box promoter element which is required in some proteins for L1 specific expression. |
AT5G06970 | PATROL1 is a Munc13-like protein involved in mediating H[+]-ATPase translocation. It interacts with AHA1and is responsible for its translocation during stomatal movement. |
AT3G15340 | Encodes PPI2 (proton pump interactor 2), a homologue of PPI1, a protein that interacts with the plasma membrane H+ ATPase AHA1. |
AT5G49240 | member of Response Regulator: Pseudo |
AT5G24470 | Encodes a pseudo-response regulator whose mutation affects various circadian-associated biological events such as flowering time in the long-day photoperiod conditions, red light sensitivity of seedlings during early photomorphogenesis, and the period of free-running rhythms of certain clock-controlled genes including CCA1 and APRR1/TOC1 in constant white light. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR7 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
AT1G68210 | Similar to ARR response regulator proteins that function in two-component signal transduction but lacking a conserved D-D-K motif in the receiver domain |
AT5G02810 | PRR7 and PRR9 are partially redundant essential components of a temperature-sensitive circadian system. CCA1 and LHY had a positive effect on PRR7 expression levels. Acts as transcriptional repressor of CCA1 and LHY. Acts additively with EC, PRR5 and PRR9 to regulate hypocotyl growth under photoperiodic conditions. |
AT4G21370 | The Col-0 pseudoSRKA allele contains a frameshift mutation that introduces a premature stop codon within the fourth of seven exons found in SRK genes. Its SCR sequences consist of several truncated pseudoSCR sequences, the longest of which is designated pseudoSCR1. |
AT3G13175 | transmembrane protein;(source:Araport11) |
AT1G34320 | Ikzf5 (DUF668);(source:Araport11) |
AT1G30755 | elongation factor G, putative (DUF668);(source:Araport11) |
AT1G72300 | Encodes a leucine-rich repeat receptor kinase (LRR-RK) involved in the perception of PSY1. PSY1 is an 18-aa tyrosine-sulfated glycopeptide encoded by AT5G58650 that promotes cellular proliferation and expansion. |
AT3G50110 | Encodes a phosphatase with low in vitro tyrosine phosphatase activity that is NOT capable of dephosphorylating in vitro the 3'phosphate group of PI3P, PI(3,4)P2. |
AT4G08840 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G43090 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT5G60180 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT4G25880 | Encodes a member of the Arabidopsis Pumilio (APUM) proteins containing PUF domain (eight repeats of approximately 36 amino acids each). PUF proteins regulate both mRNA stability and translation through sequence-specific binding to the 3' UTR of target mRNA transcripts. |
AT2G32080 | similar to the conserved animal nuclear protein PUR alpha which was implicated in the control of gene transcription and DNA replication |
AT1G28230 | Encodes a transporter that transports purines,cytokinins and other adenine derivatives. Expressed in the leaf hydathodes where it may be involved in re-uptake of cytokinins during guttation. |
AT1G19770 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
AT1G75470 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G57990 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G47603 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT2G33750 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT4G18205 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT1G30840 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT4G18197 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. The mRNA is cell-to-cell mobile. |
AT4G18195 | Member of a family of proteins related to PUP1, a purine transporter. May be involved in the transport of purine and purine derivatives such as cytokinins, across the plasma membrane. |
AT1G13750 | Encodes a purple acid phosphatase whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in roots. |
AT2G46880 | purple acid phosphatase 14;(source:Araport11) |
AT1G14700 | purple acid phosphatase 3;(source:Araport11) |
AT1G52940 | Encodes a purple acid phosphatase that is induced under prolonged phosphate (Pi) starvation and is required for maintaining basal resistance against Pseudomonas syringae and Botrytis cinerea. |
AT2G03450 | purple acid phosphatase 9;(source:Araport11) |
AT1G62290 | Saposin-like aspartyl protease family protein;(source:Araport11) |
AT2G47750 | Encodes GH3.9, a member of the GH3 family auxin-responsive genes. gh3.9-1 mutants had greater primary root length, increased sensitivity to indole-3-acetic acid (IAA)-mediated root growth inhibition, but no obvious effects on apical dominance or leaf morphology. |
AT5G36150 | putative pentacyclic triterpene synthase 3;(source:Araport11) |
AT1G77720 | Encodes a predicted protein kinase based on sequence similarity. |
AT3G17410 | Positively regulates ABA-mediated physiological responses via phosphorylation on RCAR3/ RCAR11. |
AT5G27650 | PWWP domain protein involved in regulation of FLC and flowering time. |
AT3G16420 | The PBP1(PYK10-binding protein 1) assists the PYK10 (beta-glucosidase complex) in its activity and may act like a molecular chaperone that facilitates the correct polymerization of PYK10, when tissues are damaged and subcellular structures are destroyed by pests. The mRNA is cell-to-cell mobile. |
AT4G22930 | Encodes dihydroorotase (PYR4). |
AT3G17810 | Encodes a protein predicted to have dihydropyrimidine dehydrogenase activity. Its activity has not been demonstrated in vivo, but, it is required for efficient uracil catabolism in Arabidopsis. It localizes to the plastid. |
AT5G12200 | Encodes a protein with dihydropyrimidine amidohydrolase activity. It localizes to the secretory system and plays a role in uracil metabolism. |
AT4G01480 | Encodes a protein that might have inorganic pyrophosphatase activity. |
AT5G01330 | pyruvate decarboxylase |
AT1G59900 | encodes the e1 alpha subunit of the pyruvate dehydrogenase complex (PDC) The mRNA is cell-to-cell mobile. |
AT3G06483 | Pyruvate dehydrogenase kinase (PDK) specifically phosphorylates the E1α subunit of the pyruvate dehydrogenase complex (PDC) on a Ser residue using ATP as a phosphate donor. PDK is a unique type of protein kinase having a His-kinase-like sequence but Ser-kinase activity. Site-directed mutagenesis and structural analysis indicate that PDK belongs to the GHKL superfamily. |
AT3G07970 | Required for pollen separation during normal development. In qrt mutants, the outer walls of the four meiotic products of the pollen mother cell are fused, and pollen grains are released in tetrads.May be required for cell type-specific pectin degradation. |
AT1G15020 | Encodes a protein disulfide isomerase-like (PDIL) protein, a member of a multigene family within the thioredoxin (TRX) superfamily. This protein also belongs to the quiescin-sulfhydryl oxidase (QSOX) family, which possess an Erv1-like domain at the COOH terminus in addition to a TRX domain. |
AT1G49890 | Together with QWRF1 redundantly modulates cortical microtubule arrangement in floral organ growth and fertility. |
AT5G43160 | QWRF motif protein (DUF566);(source:Araport11) |
AT3G06540 | Encodes a cytoplasmic Rab escort protein that preferentially binds the GDP-bound form of Rab and stimulates geranylgeranylation of various Rab GTPases in Arabidopsis extracts in vitro. |
AT5G41820 | RAB geranylgeranyl transferase alpha subunit 2;(source:Araport11) |
AT1G16920 | small GTP-binding protein (Rab11)similar to YPT3/RAB11 proteins in yeast and mammals, respectively. YPT3/RAB11 is involved in intracellular protein trafficking. |
AT4G18430 | RAB GTPase homolog A1E;(source:Araport11) |
AT3G46830 | RAB GTPase homolog A2C;(source:Araport11) |
AT5G59150 | RAB GTPase homolog A2D;(source:Araport11) |
AT2G22390 | Encodes an unusual RabA family member as it has a Lysine the position of the highly conserved Glu of the WDTAGQE motif and has the sequence CVAA! at its C-ter rather than the conventional CCXX(X) or CXC motifs that promote geranylgeranylation and membrane anchoring. |
AT1G18200 | Rab GTPase-like A1I protein;(source:Araport11) |
AT4G17160 | RAB GTPase homolog B1A;(source:Araport11) |
AT3G09910 | RAB GTPase homolog C2B;(source:Araport11) |
AT5G53570 | Ypt/Rab-GAP domain of gyp1p superfamily protein;(source:Araport11) |
AT5G45130 | small GTP binding protein The mRNA is cell-to-cell mobile. |
AT5G06070 | Isolated as a mutation defective in petal development with specific effects on adaxial petals which are filamentous or absent. Encodes a Superman (SUP) like protein with zinc finger motifs. Transcript is detected in petal primordia and protein is localized to the nucleus. |
AT4G35950 | A member of ROP GTPases gene family-like. GTP binding protein Arac6. |
AT1G71100 | Encodes a ribose 5-phosphate isomerase involved in the formation of uridine used for the synthesis of UDP-sugars. Mutants of this gene are affected in cellulose biosynthesis. |
AT1G32230 | Encodes a protein belonging to the (ADP-ribosyl)transferase domain-containing subfamily of WWE protein-protein interaction domain protein family. Superoxide radicals are necessary and sufficient to propagate cell death or lesion formation in rcd1 mutants. Without stress treatment, RCD1 is localized in the nucleus. Under high salt or oxidative stress, RCD1 is found not only in the nucleus but also in the cytoplasm. The mRNA is cell-to-cell mobile. |
AT3G46930 | Encodes a Raf-Like Mitogen-Activated Protein Kinase Kinase Kinase Raf43. Required for tolerance to multiple abiotic stresses. |
AT3G04735 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT3G05490 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT4G13075 | Rapid alkalinization factor (RALF) family protein. Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT4G13950 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT4G14010 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. |
AT4G15800 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
AT5G67070 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. The mRNA is cell-to-cell mobile. |
AT1G28270 | Member of a diversely expressed predicted peptide family showing sequence similarity to tobacco Rapid Alkalinization Factor (RALF), and is believed to play an essential role in the physiology of Arabidopsis. Consists of a single exon and is characterized by a conserved C-terminal motif and N-terminal signal peptide. RALF4 and RALF19 act redundantly in the pollen tube to regulate pollen tube growth. |
AT5G01770 | Encodes one of two Arabidopsis RAPTOR/KOG1 homologs. RAPTOR proteins are binding partners of the target of rapamycin kinase that is present in all eukaryotes and play a central role in the stimulation of cell growth and metabolism in response to nutrients. Mutations in this gene have no visible effects on embryo or plant development. |
AT1G02130 | Belongs to the Rab1 GTPase subfamily. This small GTP-binding protein is required in ER to Golgi transportation. |
AT5G55080 | A member of RAN GTPase gene family. |
AT3G24560 | novel gene involved in embryogenesis |
AT4G34730 | ribosome-binding factor A family protein;(source:Araport11) |
AT5G08710 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT5G66160 | Encodes a receptor homology region transmembrane domain, ring H2 motif protein involved in transport of storage proteins to protein storage vacuoles. Localized to endoplasmic reticulum and co-localizes with DIP positive vesicles and to the trans-golgi network when complexed with RMR2. |
AT1G65790 | An alternatively spliced gene that encodes a functional transmembrane receptor serine/threonine kinase, alternate form may not have transmembrane domain. |
AT1G65800 | Encodes a putative receptor-like serine/threonine protein kinases that is similar to brassica self-incompatibility (S) locus. expressed in specifically in cotyledons, leaves, and sepals, in correlation with the maturation of these structures. Together with AtPUB9, it is required for auxin-mediated lateral root development under phosphate-starved conditions. The mRNA is cell-to-cell mobile. |
AT4G21380 | encodes a putative receptor-like serine/threonine protein kinases that is similar to Brassica self-incompatibility (S) locus. Expressed in root. Shoot expression limited to limited to the root-hypocotyl transition zone and at the base of lateral roots as well as in axillary buds, and pedicels. |
AT1G71390 | receptor like protein 11;(source:Araport11) |
AT1G74170 | receptor like protein 13;(source:Araport11) |
AT1G74180 | receptor like protein 14;(source:Araport11) |
AT1G74190 | receptor like protein 15;(source:Araport11) |
AT1G74200 | receptor like protein 16;(source:Araport11) |
AT2G15040 | pseudogene of receptor like protein 53;(source:Araport11) |
AT2G15080 | receptor like protein 19;(source:Araport11) |
AT1G17240 | Encodes a CLAVATA2 (CLV2)-related gene. Complements the clv2 mutant when expressed under the control of the CLV2 promoter. |
AT2G25440 | receptor like protein 20;(source:Araport11) |
AT2G25470 | receptor like protein 21;(source:Araport11) |
AT2G32680 | NLP20 LRR receptor protein involved in PAMP mediated immunity. |
AT3G05360 | receptor like protein 30;(source:Araport11) |
AT3G05370 | receptor like protein 31;(source:Araport11) |
AT3G05650 | receptor like protein 32;(source:Araport11) |
AT3G05660 | receptor like protein 33;(source:Araport11) |
AT3G11080 | receptor like protein 35;(source:Araport11) |
AT3G23010 | receptor like protein 36;(source:Araport11) |
AT3G23120 | receptor like protein 38;(source:Araport11) |
AT1G28340 | receptor like protein 4;(source:Araport11) |
AT3G49750 | receptor like protein 44;(source:Araport11) |
AT4G04220 | receptor like protein 46;(source:Araport11) |
AT4G13880 | receptor like protein 48;(source:Araport11) |
AT1G34290 | receptor like protein 5;(source:Araport11) |
AT4G13920 | receptor like protein 50;(source:Araport11) |
AT5G25910 | putative disease resistance protein induced by chitin oligomers. |
AT5G27060 | receptor like protein 53;(source:Araport11) |
AT1G45616 | receptor like protein 6;(source:Araport11) |
AT1G47890 | receptor like protein 7;(source:Araport11) |
AT1G58190 | receptor like protein 9;(source:Araport11) |
AT1G29750 | Receptor-like serine/threonine kinase (RKF1). The putative extracellular domain of the RKF1 protein contains 13 tandem repeats of leucine-rich sequences. Expressed in early flower primordial, stamen, and pollen grains. |
AT5G60900 | Encodes a receptor-like protein kinase. |
AT4G00340 | Encodes a receptor-like protein kinase that is expressed in roots. |
AT3G46530 | Confers resistance to the biotrophic oomycete, Peronospora parasitica. Encodes an NBS-LRR type R protein with a putative amino-terminal leucine zipper. Fungal protein ATR13 induces RPP13 gene expression and disease resistance. The mRNA is cell-to-cell mobile. |
AT4G16860 | Confers resistance to Peronospora parasitica. RPP4 is coordinately regulated by transcriptional activation and RNA silencing. |
AT4G16950 | Contains a putative nucleotide binding site and leucine-rich repeats. Similar to the plant resistance genes N and L6, and to the toll and interleukin-1 receptors. Confers resistance to Peronospora parasitica.Redundant function together with SIKIC1 and 3 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
AT5G43470 | Confers resistance to Peronospora parasitica. In arabidopsis ecotype Dijon-17, HRT-mediated signaling is dependent on light for the induction of hypersensitive response and resistance to turnip crinkle virus. |
AT1G67500 | Encodes the catalytic subunit of DNA polymerase zeta.Mutants are sensitive to UV-B radiation. Gene is involved in damage-tolerance mechanisms through translesion synthesis(TLS). |
AT1G60930 | AtRECQ4B mutant showed no sensitivity to DNA damaging agents.Involved in homologous recombination. |
AT4G34410 | Encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. Regulates programmed cell death (PCD) inhibitor genes. Involved in retarding programmed cell death under salt stress due to the regulation of processes participating in ROS inhibition. ERF-regulated transcripts belong to the tryptophan biosynthesis, tryptophan metabolism, and downstream plant hormone signal transduction pathways, where ERF109 potentially acts as a 'master switch' mediator of a cascade of consecutive events across the three pathways, promoting plant growth and re-adjustment to homeostasis due the direct participation in auxin biosynthesis leading to the plants ability to tolerate salt stress. |
AT4G28080 | Encodes REDUCED CHLOROPLAST COVERAGE 2 (REC2). Along with REC1 and REC3 it contributes to establishing the size of the chloroplast compartment. |
AT4G04340 | Encodes a plasma membrane localized hyperosmolality gated calcium channel that is expressed in guard cells and roots. |
AT5G41040 | Encodes a feruloyl-CoA transferase required for suberin synthesis. Has feruloyl-CoA-dependent feruloyl transferase activity towards substrates with a primary alcohol. |
AT1G19360 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
AT3G18990 | Required for vernalization. Essential for the complete repression of FLC in vernalized plants. Required for the methylation of histone H3 |
AT3G23590 | Encodes a protein shown to physically associate with the conserved transcriptional coregulatory complex, Mediator, and is involved in the regulation of phenylpropanoid homeostasis. Acts redundantly with REF4/MED5b (At2g48110). Required for expression of some dark-upregulated genes. RFR1 is the MED5a subunit of the mediator complex. |
AT3G17170 | Translation elongation factor EF1B/ribosomal protein S6 family protein;(source:Araport11) |
AT4G29040 | RPT2a encodes the 26S proteasome subunit. It is required for root meristem maintenance, and regulates gametogenesis. RPT2a is also shown to regulate gene silencing via DNA methylation. |
AT4G02260 | Displays guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity but not guanosine-3',5'-bis(diphosphate) 3'-diphosphate synthase activity. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
AT1G54130 | This gene appears to be at least partially redundant with RSH2 (At3g14050). Guanosine tetraphosphate synthesized by RSH2/RSH3 (and CRSH At3g17470) to an unknown extent can repress chloroplast gene expression, and also reduce chloroplast size. Involved in the maintenance of the (p)ppGp level to accustom plastidial gene expression to darkness. |
AT1G68840 | Rav2 is part of a complex that has been named `regulator of the (H+)-ATPase of the vacuolar and endosomal membranes' (RAVE) The mRNA is cell-to-cell mobile. |
AT4G36900 | Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.10). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.9 and RAP2.1. |
AT3G14230 | encodes a member of the ERF (ethylene response factor) subfamily B-2 of ERF/AP2 transcription factor family (RAP2.2). The protein contains one AP2 domain. There are 5 members in this subfamily including RAP2.2 AND RAP2.12. |
AT1G22190 | The gene encodes a putative transcription factor belongings to the abiotic stress-associated DREB A-6 clade. The mRNA is cell-to-cell mobile. |
AT5G13330 | encodes a member of the ERF (ethylene response factor) subfamily B-4 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 7 members in this subfamily. |
AT4G06746 | encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family (RAP2.9). The protein contains one AP2 domain. There are 16 members in this subfamily including RAP2.1 and RAP2.10. |
AT2G28550 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY2 to regulate CO and FT. TOE1 binds to activation domain of CO and binds CORE sequences of the FT promoter.TOE1/TOE2 are also targets of MiR172b and function in regulation of innate immunity. |
AT2G22010 | Encodes a protein predicted to act as a RING E3 ubiquitin ligase. It appears to regulate the stability of the KRP1/ICK1 cyclin dependent kinase inhibitor. Induced by beet severe curly virus (BSCTV) C4 protein. |
AT1G49480 | Encodes a nuclear-localized DNA-binding protein that interacts with ITN1 at the PM and nuclei in vivo and may regulate ITN's subcellular localization. |
AT2G45820 | Lipid raft regulatory protein, crucial for plasma membrane nanodomain assembly to control plasmodesmata aperture and functionality. |
AT3G57540 | Remorin family protein;(source:Araport11) |
AT1G77470 | Encodes a protein with high homology to the Replication Factor C, Subunit 3 (RFC3) of yeast and other eukaryotes. rfc3 mutants are hypersensitive to salicylic acid and exhibit enhanced induction of PR genes and resistance against virulent oomycete Hyaloperonospora arabidopsidis Noco2. The enhanced pathogen resistance in the mutant is NPR1-independent. |
AT2G01570 | Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development. |
AT5G52250 | Encodes a transducin protein whose gene expression is induced by UV-B. This induction is reduced in hy5 mutant and may be a target of HY5 during UV-B response. Functions as a repressor of UV-B signaling. |
AT5G23730 | Encodes REPRESSOR OF UV-B PHOTOMORPHOGENESIS 2 (RUP2). Functions as a repressor of UV-B signaling. |
AT5G67630 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT4G15720 | Tetratricopeptide repeat (TPR)-like superfamily protein;(source:Araport11) |
AT4G11170 | Encodes RMG1 (Resistance Methylated Gene 1), a NB-LRR disease resistance protein with a Toll/interleukin-1 receptor (TIR) domain at its N terminus. RMG1 is expressed at high levels in response to flg22 and in naive met1/nrpd2 relative to wild-type plants. Expression of this gene is controlled by DNA methylation in its promoter region. The RMG1 promoter region is constitutively demethylated by active DNA demethylation mediated by the DNA glycosylase ROS1. |
AT1G79670 | Encodes a receptor-like kinase that does not contain an extracellular leucine-rich repeat domain. A novel type of dominant disease-resistance protein that confers resistance to a broad spectrum of Fusarium races. |
AT3G07040 | Contains an N-terminal tripartite nucleotide binding site and a C-terminal tandem array of leucine-rich repeats. Confers resistance to Pseudomonas syringae strains that carry the avirulence genes avrB and avrRpm1. |
AT1G11330 | S-locus lectin protein kinase family protein;(source:Araport11) |
AT3G03710 | Encodes a chloroplast polynucleotide phosphorylase (PNPase). Involved in response to phosphorus (P) starvation. Mutants impaired in the expression of this gene have been selected through their resistance to fosmidomycin, a strong inhibitor of DXR, an enzyme of the methylerythritol-dependent IPP biosynthesis pathway. The pathway enzymes were upregulated in the mutant seedlings. |
AT5G05630 | Encodes POLYAMINE UPTAKE TRANSPORTER 3, an amino acid permease family protein. |
AT4G26090 | Encodes a plasma membrane protein with leucine-rich repeat, leucine zipper, and P loop domains that confers resistance to Pseudomonas syringae infection by interacting with the avirulence gene avrRpt2. RPS2 protein interacts directly with plasma membrane associated protein RIN4 and this interaction is disrupted by avrRpt2. The mRNA is cell-to-cell mobile. |
AT5G45250 | RPS4 belongs to the Toll/interleukin-1 receptor (TIR)-nucleotide binding site (NBS)-Leu-rich repeat (LRR) class of disease resistance (R ) genes. Confers specific resistance to Pseudomonas syringae pv. tomato carrying the avirulence gene AvrRPS4. Produces alternative transcripts with truncated open reading frames. |
AT1G12220 | Resistance gene, mediates resistance against the bacterial pathogen Pseudomonas syringae. Contains a putative nucleotide binding site composed of kinase-1a (or P-loop), kinase-2a, and putative kinase-3a domains, 13 imperfect leucine-rich repeats, a potential leucine zipper, and two uncharacterized motifs that are well conserved in products of previously isolated R genes. Confers resistance to Pseudomonas syringae strains that express avrPphB. |
AT5G46470 | Encodes RPS6 (RESISTANT TO P. SYRINGAE 6), a member of the TIR-NBS-LRR class resistance protein. The mRNA is cell-to-cell mobile. |
AT5G45260 | Confers resistance to Ralstonia solanacearum. Similar to NBLS-TIR resistance genes,and also contains similarity to transcription factors. Interacts with pathogen effector protein AvrPop2. |
AT5G07390 | respiratory burst oxidase homolog A;(source:Araport11) |
AT5G60010 | ferric reductase-like transmembrane component family protein;(source:Araport11) |
AT5G47910 | NADPH/respiratory burst oxidase protein D (RbohD).Interacts with AtrbohF gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. The mRNA is cell-to-cell mobile. |
AT1G64060 | Interacts with AtrbohD gene to fine tune the spatial control of ROI production and hypersensitive response to cell in and around infection site. |
AT4G31920 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
AT1G67710 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Affects ABA-JA crosstalk. |
AT2G25180 | Encodes an Arabidopsis response regulator (ARR) protein that acts in concert with other type-B ARRs in the cytokinin signaling pathway. Also involved in cytokinin-dependent inhibition of hypocotyl elongation and cytokinin-dependent greening and shooting in tissue culture. ARR1, ARR10, and ARR12 are redundant regulators of drought response, with ARR1 being the most critical.The retention of leaf water content, maintenance of cell membrane stability, and enhancement of anthocyanin biosynthesis were found to contribute to the enhanced drought tolerance of the arr1,10,12 triple mutant. ARR1, ARR10 and ARR12 redundantly bind to the promoter of WUSCHEL (WUS), directly activate its transcription. In parallel, ARR1, ARR10 and ARR12 repress the expression of YUCCAs (YUCs), which encode a key enzyme for auxin biosynthesis, indirectly promoting WUS induction. The regulation of ARR1, ARR10 and ARR12 on WUS and YUCs is required for regeneration and maintenance of shoot meristem. |
AT3G62670 | member of Response Regulator: B- Type |
AT5G07210 | member of Response Regulator: B- Type |
AT5G26594 | Encodes an atypical subtype of the ARR (Arabidopsis response regulator) protein family . It appears to be expressed in floral buds, mature flowers, and pollen. But, unlike the related ARR22 protein, it does not appear to be expressed at the seed:funiculus junction. |
AT1G59940 | Type A response regulator highly similar to bacterial two-component response regulators. Rapidly induced by cytokinin. Involved in red-light signaling. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT2G41310 | Encodes an A- type response Regulator that is primarily expressed in the root and is involved in cytokinin-mediated signalling. Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT1G10470 | Encodes a two-component response regulator. Acts redundantly with ARR3 in the control of circadian period in a cytokinin-independent manner. |
AT5G62920 | Encodes a Type-A response regulator that is responsive to cytokinin treatment. Its C-ter domain is very short in comparison to other Arabidopsis ARRs (17 total). Arr6 protein is stabilized by cytokinin. |
AT3G57040 | response regulator ARR9, A two-component response regulator-like protein with a receiver domain with a conserved aspartate residue and a possible phosphorylation site and at the N-terminal half. Appears to interact with histidine kinase like genes ATHP3 and ATHP2 |
AT3G49580 | response to low sulfur 1;(source:Araport11) |
AT5G24660 | response to low sulfur 2;(source:Araport11) |
AT5G24655 | response to low sulfur 4;(source:Araport11) |
AT1G47128 | Cysteine proteinase precursor-like protein/ dehydration stress-responsive gene (RD21). Has been shown to have peptide ligase activity and protease activity in vitro. RD21 is involved in immunity to the necrotrophic fungal pathogen Botrytis cinerea.Activity detected in root, leaf, flower and cell culture. |
AT5G25610 | responsive to dehydration 22 (RD22) mediated by ABA |
AT5G44790 | ATP dependent copper transporter vital for ethylene response pathway |
AT3G27670 | A novel protein, did not show high similarity to any protein of known function; reveals a novel genetic connection between lipid synthesis and embryo development. Expressed in all tissues examined including leaves, flowers, roots, stems, and siliques, but accumulation levels were not correlated with the degree to which different organs appeared affected by the mutation. Mutant plants showed alterations in the cuticular wax profiles and embryo development. The mRNA is cell-to-cell mobile. |
AT2G41945 | Encodes a novel protein found only in plants. RED1 has two isoforms RED1.1 and RED1.2. It is localized to the nucleus. Loss of function mutants are embryo lethal but can be rescued before desiccation by embryo culture. |
AT5G22790 | reticulata-related 1;(source:Araport11) |
AT5G58000 | Reticulon family protein;(source:Araport11) |
AT3G10260 | Reticulon family protein;(source:Araport11) |
AT3G61560 | Reticulon family protein;(source:Araport11) |
AT3G09600 | Encodes a MYB-like transcription factor similar to CIRCADIAN CLOCK-ASSOCIATED1 (CCA1) and ELONGATED HYPOCOTYL (LHY). Involved in the regulation of circadian clock by modulating the pattern of histone 3 (H3) acetylation. Functions as a transcriptional activator of evening element containing clock genes. Involved in heat shock response. |
AT3G02230 | RGP1 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It appears to be required for proper cell wall formation. rgp1/rgp2 (at5g15650) double mutants have a male gametophyte lethal phenotype. RGP1 fusion proteins can be found in the cytosol and peripherally associated with the Golgi apparatus. The mRNA is cell-to-cell mobile. |
AT3G08900 | RGP3 is a UDP-arabinose mutase that catalyzes the interconversion between the pyranose and furanose forms of UDP-L-arabinose. It is a reversibly autoglycosylated protein. Fluorescently-tagged RGP3 is found in the cytosol and associated with Golgi-like particles when expressed in tobacco leaves. An RGP3-YFP fusion protein under the control a native promoter can be found in the endosperm of Arabidopsis embryos during the linear and bent cotyledon stages of development. |
AT5G60690 | REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA. The mRNA is cell-to-cell mobile. |
AT2G22620 | Rhamnogalacturonate lyase family protein;(source:Araport11) |
AT1G56550 | Encodes a rhamnogalacturonan II specific xylosyltransferase. |
AT4G01750 | Encodes a protein with UDP-xylose-dependent xylosyltransferase activity, which transfers Xyl onto L-fucose and (albeit less efficiently) L-arabinose. The linkage to L-fucose was shown to be preferentially to the O-4 position. Analysis of mutant containing T-DNA insertion in this gene indicate that the RGXT2 protein might be involved in the synthesis of the α-D-Xyl-(1,3)-α-L-Fuc-(1,4)-L-Rha structure in pectic rhamnogalacturonan II. The mRNA is cell-to-cell mobile. |
AT1G78570 | Encodes a UDP-L-Rhamnose synthase involved in the biosynthesis of rhamnose, a major monosaccharide component of pectin. Catalyzes the conversion of UDP-D-Glc to UDP-L-Rha. The dehydrogenase domain of RHM1 was shown to catalyze the conversion of UDP-D-Glc to the reaction intermediate UDP-4-keto-6-deoxy-D-Glc using recombinant protein assay but the activity of the full-length protein was not determined as it could not be expressed in E. coli. |
AT3G14790 | rhamnose biosynthesis 3;(source:Araport11) |
AT5G45160 | Root hair defective 3 GTP-binding protein (RHD3);(source:Araport11) |
AT4G28950 | A member of ROP GTPase gene family. |
AT2G29050 | RHOMBOID-like 1;(source:Araport11) |
AT1G12750 | RHOMBOID-like protein 6;(source:Araport11) |
AT4G23070 | RHOMBOID-like protein 7;(source:Araport11) |
AT1G17160 | RBSK is a plastid localized ribokinase involved in nucleoside metabolism. It is the only member of this gene family in Arabidopsis. |
AT2G21790 | encodes large subunit of ribonucleotide reductase involved in the production of deoxyribonucleoside triphosphates (dNTPs) for DNA replication and repair |
AT4G36680 | Ribosomal pentatricopeptide repeat protein |
AT3G11940 | One of two genes encoding the ribosomal protein S5. Mutants have semi-dominant developmental phenotypes. Most cell-division processes are delayed or disturbed in the heterozygous mutant, and development is completely arrested at an early embryonic stage in the homozygous mutant. |
AT2G39460 | Encodes a 60S ribosomal protein L23aA (AtrpL23aA). Paralog of RLPL23aB. |
AT3G55280 | 60S ribosomal protein L23A (RPL23aB). Paralog of RPL23aA and functionally redundant to it. |
AT2G36620 | RPL24A encodes ribosomal protein L24, homolog of cytosolic RPL24, found in archaea and higher eukaryotes. Arabidopsis has two RPL24 homologs, RPL24A (AT2G36620) and RPL24B (AT3G53020). |
AT4G31700 | Encodes a putative ribosomal protein S6 (rps6a). RPS6A and RPS6B are fully redundant and essential during gametogenesis. |
AT3G07750 | 3-5-exoribonuclease family protein;(source:Araport11) |
AT3G46620 | Encodes an ABA- and drought-induced RING-DUF1117 gene whose mutation results in hyposensitive phenotypes toward ABA in terms of germination rate and stomatal closure and markedly reduced tolerance to drought stress relative to wild-type plants. |
AT1G79380 | Encodes a ubiquitin ligase that is an essential upstream modulator of JA signaling in response to various stimuli. |
AT5G14420 | Encodes RGLG2 (RING domain ligase 2), a RING domain ubiquitin E3 ligase that negatively regulates the drought stress response by mediating ERF53 transcriptional activity. |
AT4G28270 | Encodes a RING finger E3 ubiquitin ligase. Binds and ubiquitinates ABP1 in vivo and in vitro. |
AT4G11360 | Encodes a putative RING-H2 finger protein RHA1b. The mRNA is cell-to-cell mobile. |
AT4G35480 | Encodes a putative RING-H2 finger protein RHA3b. |
AT4G14220 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. RHF1a can interact with the cell cycle inhibitor ICK4/KRP6 in vitro. It apppears to target ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF1a is expressed in the carpels throughout floral development. It is expressed in various tissues of the anthers during the early stages of anther development but not in stage 12 flowers and beyond. The mRNA is cell-to-cell mobile. |
AT5G22000 | encodes a RING-type E3 ubiquitin ligase implicated in gametogenesis. Double mutant analyses with RHF1a suggests that RHF2a may be involved in targetting ICK4KRP6 for degradation following meiosis in order to allow the mitoses associated with megagametogenesis and microgametogenesis to occur. RHF2a is expressed in all four floral whorls and is present at ~8-fold higher levels than RHF1a in inflorescences by RT-PCR analyses. |
AT3G58510 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT3G61240 | DEA(D/H)-box RNA helicase family protein;(source:Araport11) |
AT5G05450 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT2G42520 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT1G74230 | encodes a glycine-rich RNA binding protein. The mRNA is cell-to-cell mobile. |
AT1G60650 | Encodes one of the zinc finger-containing glycine-rich RNA-binding proteins involved in cold tolerance: AT3G26420 (ATRZ-1A), AT1G60650 (AtRZ-1b), AT5G04280 (AtRZ-1c). It also, along with AtRZ-1c, plays important roles in plant development, pre- mRNA splicing, and general gene expression. |
AT1G17640 | Belongs to a member of the RNA-binding glycine-rich (RBG) gene superfamily. |
AT5G54900 | RNA-binding protein 45A;(source:Araport11) |
AT1G49600 | RNA-binding protein 47A;(source:Araport11) |
AT1G47490 | RNA-binding protein 47C;(source:Araport11) |
AT1G47500 | RNA-binding protein 47C;(source:Araport11) |
AT4G03110 | Encodes a putative RNA-binding protein that is located in the cytoplasm and is involved in the hypersensitive response and positively regulates salicylic acid-mediated immunity. |
AT1G07910 | Encodes a tRNA ligase that resembles the yeast Trl1 RNA ligase in structure and function but very different in sequence. Like Trl1, AtRNL consists of two domains, an N-terminal ligase component and a C-terminal 5'-kinase/2',3'-cyclic phosphodiesterase (CPD) component that can function in tRNA splicing in vivo when expressed as separate polypeptides. Requires a 2'-PO4 end for tRNA splicing in vivo. |
AT4G15417 | RNAse II-like 1;(source:Araport11) |
AT1G80650 | RNAse THREE-like protein 1;(source:Araport11) |
AT3G20420 | double-stranded RNA binding / ribonuclease III. Required for 3' external transcribed spacer (ETS) cleavage of the pre-rRNA in vivo. Localizes in the nucleus and cytoplasm. |
AT3G54280 | ROOT GROWTH DEFECTIVE 3;(source:Araport11) |
AT4G22080 | root hair specific 14;(source:Araport11) |
AT5G67400 | root hair specific 19;(source:Araport11) |
AT1G30850 | root hair specific 4;(source:Araport11) |
AT1G63450 | Encodes a xyloglucan-specific galacturonosyltransferase (XUT1) that forms the beta-d-galactosyluronic acid-(1->2)-alpha-d-xylosyl linkage. |
AT5G45710 | member of Heat Stress Transcription Factor (Hsf) family |
AT3G49180 | Transducin/WD40 repeat-like superfamily protein;(source:Araport11) |
AT5G60810 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). Controls root meristem size through ROS signalling. |
AT1G13620 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT3G02240 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT2G03830 | Encodes a root meristem growth factor (RGF). Belongs to a family of functionally redundant homologous peptides that are secreted, tyrosine-sulfated, and expressed mainly in the stem cell area and the innermost layer of central columella cells. RGFs are required for maintenance of the root stem cell niche and transit amplifying cell proliferation. Members of this family include: At5g60810 (RGF1), At1g13620 (RGF2), At2g04025 (RGF3), At3g30350 (RGF4), At5g51451 (RGF5), At4g16515 (RGF6), At3g02240 (RGF7), At2g03830 (RGF8) and At5g64770 (RGF9). |
AT2G26290 | root-specific kinase 1;(source:Araport11) |
AT4G38430 | Member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily, also known as DUF315). Interacts with ROP1 but the whole protein lacks Rho guanyl-nucleotide exchange factor activity in vitro. The DUF315/PRONE domain is sufficient to confer RopGEF catalytic activity. ropgef1 mutants have defects in auxin transport that result in abnormal development of embryos and growth defects. |
AT1G52240 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily . |
AT1G79860 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Coexpression of AtPRK2a with AtRopGEF12 resulted in isotropic pollen tube growth Growth. |
AT1G31650 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT1G01700 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT2G45890 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. Mutants exhibit longer root hairs under phosphate-deficient conditions. Involved in cell wall patterning. Encodes ROP activator, regulates the formation of ROP-activated domains; these in turn determine the pattern of cell wall pits. Forms a dimer that interacts with activated ROP11 in vivo, which could provide positive feedback for ROP activation. Required for periodic formation of secondary cell wall pits |
AT5G05940 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT3G55660 | Encodes a member of KPP-like gene family, homolog of KPP (kinase partner protein) gene in tomato. Also a member of the RopGEF (guanine nucleotide exchange factor) family, containing the novel PRONE domain (plant-specific Rop nucleotide exchanger), which is exclusively active towards members of the Rop subfamily. |
AT3G05140 | ROP binding protein kinases 2;(source:Araport11) |
AT2G46710 | ROP (Rho of plant GTPases) family member Involved in cell wall patterning. Encodes ROP inactivator, regulates the formation of ROP-activated domains; these in turn determined the pattern of cell wall pits. Positively regulates pit formation, but negatively regulates pit size, required for periodic formation of secondary cell wall pits. |
AT1G78430 | Encodes RIP2 (ROP interactive partner 2), a putative Rho protein effector, interacting specifically with the active form of ROPs (Rho proteins of plants). |
AT4G04900 | encodes a member of a novel protein family that contains contain a CRIB (for Cdc42/Rac-interactive binding) motif required for their specific interaction with GTP-bound Rop1 (plant-specific Rho GTPase). Most similar to RIC9 and RIC11 (subfamily group I). Gene is expressed predominantly in roots, leaves, and seedlings. |
AT4G38740 | Encodes cytosolic cyclophilin ROC1. |
AT4G36380 | Encodes a cytochrome P-450 gene that is involved in leaf blade expansion by controlling polar cell expansion in the leaf length direction. Member of the CYP90C CYP450 family. ROT3 was shown to be involved in brassinosteroid biosynthesis, most likely in the conversion step of typhasterol (TY) to castasterone (CS). As 6-deoxo-CS was unable to restore the phenotype of rot3-1, it has been postulated that ROT3 might be specifically involved in the conversion of TY to CS in the C6-oxidation pathway of brassinolide. Recently, CYP90C1 was shown to catalyse the C-23 hydroxylation of several brassinosteroids (the enzyme has a broad specificity for 22-hydroxylated substrates). |
AT1G17235 | This gene is predicted to encode a small protein with a DVL domain found in the DVL / RTFL protein family. Over-expression analyses using truncated versions of a related family member, ROT4, suggest that the DVL / RTF domain is involved in regulating cell proliferation. |
AT4G13395 | ROTUNDIFOLIA like 12;(source:Araport11) |
AT3G46613 | Encodes a small is a member of an angiosperm specific gene family. |
AT2G39705 | ROTUNDIFOLIA like 8;(source:Araport11) |
AT5G05780 | Encodes a putative 26S proteasome subunit RPN8a. The function of RPN8a and other 26S subunits may be required for specifying leaf adaxial identity. The mRNA is cell-to-cell mobile. |
AT5G26760 | Encodes RPAP2 IYO Mate (RIMA), a homologue of yeast and human proteins linked to nuclear import of selective cargo. Knockdown of RIMA causes delayed onset of cell differentiation. |
AT3G23390 | Zinc-binding ribosomal protein family protein;(source:Araport11) |
AT2G20310 | Encodes RPM1 Interacting Protein 13 (RIN13), a resistance protein interactor shown to positively enhance resistance function of RPM1. |
AT5G51450 | Encodes RING-finger type ubiquitin ligases. |
AT3G25070 | Encodes a member of the R protein complex and may represent a virulence target of type III pili effector proteins (virulence factors) from bacterial pathogens, which is 'guarded' by R protein complex (RPM1 and RPS2 proteins). RIN4 physically interacts with RPS2 and RPM1 in vivo. Bacterial avirulence (Avr) effectors AvrB, AvrRpm1, and AvrRpt2 induce a mobility shift in RIN4 and expression of AvrRpt2 induces rapid degradation of RIN4. RIN4 contains 2 sites for AvrRpt2 autocleavage, called RCS1 and RCS2. Overexpression of RIN4 inhibits multiple phenotypes associated with AvrRpt2 function and also inhibits PAMP-induced defense signaling. Attached to the plasma membrane at its carboxyl terminus. Cleaved by AvrRpt2 at two PxFGxW motifs, one releasing a large portion of RIN4 from the plasma membrane and both exposing amino-terminal residues that destabilized the carboxyl-terminal cleavage products by targeting them for N-end ubiquitylation and proteasomal degradation. Major virulence target of the TTSE HopF2Pto. The mRNA is cell-to-cell mobile. |
AT2G05940 | Encodes a receptor-like cytoplasmic kinase that phosphorylates the host target RIN4, leading to the activation of a plant innate immune receptor RPM1. |
AT5G35910 | Encodes a nuclear-localized RRP6-like protein whose mutation leads to accumulation of an rRNA maturation by-product. |
AT3G04550 | Encodes an ancillary chaperone protein that functions in Rubisco biogenesis. RAF1 dimers function in the assembly of the large subunit of Rubisco. Co-expression of RAF1 and rbcL in tobacco cells results in increased photosynthesis and plant growth. The mRNA is cell-to-cell mobile. |
AT5G53040 | Encodes GROUNDED (GRD), a putative RWP-RK-type transcription factor broadly expressed in early development. GRD promotes zygote elongation and basal cell fates. |
AT4G01850 | S-adenosylmethionine synthetase 2;(source:Araport11) |
AT4G32300 | S-domain-2 5;(source:Araport11) |
AT1G58250 | SABRE, putative gene of unknown function, homologous to maize apt1 gene. Required for normal cell expansion in the root cortex. The sabre mutation results in abnormal cell expansion. Encodes a rare message; very low level of expression was detected in roots and shoots. |
AT5G27927 | Member of Sadhu non-coding retrotransposon family |
AT5G14260 | Suppresses singlet oxygen-induced stress responses by protecting grana margins. |
AT5G02020 | Encodes a protein involved in salt tolerance, names SIS (Salt Induced Serine rich). |
AT5G35410 | encodes a member of the CBL-interacting protein kinase family, is a regulatory component controlling plant potassium nutrition |
AT1G06040 | Encodes salt tolerance protein (STO) which confers salt tolerance to yeast cells. Fully complements calcineurin deficient yeast but does not encode a phosphoprotein phosphatase. Sequence has similarities to CONSTANS. STO co-localizes with COP1 and plays a role in light signaling.STO transcript levels are regulated by photoperiod and phtyohormones. STO competes with FLC in the regulation of floral transition genes SOC1 and FT. |
AT1G27730 | Related to Cys2/His2-type zinc-finger proteins found in higher plants. Compensated for a subset of calcineurin deficiency in yeast. Salt tolerance produced by ZAT10 appeared to be partially dependent on ENA1/PMR2, a P-type ATPase required for Li+ and Na+ efflux in yeast. The protein is localized to the nucleus, acts as a transcriptional repressor and is responsive to chitin oligomers. Also involved in response to photooxidative stress. |
AT5G22270 | hypothetical protein;(source:Araport11) |
AT3G55980 | salt-inducible zinc finger 1;(source:Araport11) |
AT2G31870 | The gene encodes a poly(ADPribose) glycohydrolase (PARG1). Mutant analysis suggests that PARG1 plays a role in abiotic stress responses and DNA repair. Loss of function mutants accumulate poly(ADPribose) and have increased cell death when treated with bleomycin. |
AT5G60410 | Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation. Regulates leaf cell division and expansion through salicylic acid accumulation. signaling |
AT5G52810 | SAR-DEFICIENT4 (SARD4) alias ORNITHINE CYCLODEAMINASE/m-CRYSTALLIN (ORNCD1) is involved in the biosynthesis of pipecolic acid. The reductase converts dehydropipecolic acid intermediates generated from L-Lysine by AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) to pipecolic acid (PMID:28330936). |
AT4G17230 | Encodes a scarecrow-like protein (SCL13). Member of GRAS gene family. Regulated by heat shock. |
AT1G50420 | Encodes a scarecrow-like protein (SCL3) Putative transcription factors interacting with the gene product of VHA-B1 (vacuolar ATPase subunit B1; as shown through yeast two-hybrid assay). |
AT5G13300 | Belongs to 15-member small GTPase gene family, ARF-GAP domain proteins (AGD); corresponds to AGD3, and is one of four proteins belonging to class 1, together with AGD1, AGD2 and AGD4. The protein contains four domains: BAR domain, PH domain, an ARF-GAP domain, and two Ankyrin repeats. In sfc mutants, the secondary and tertiary veins of cotyledons, leaves, sepals and petals are largely replaced by small segments of discontinuous veins. sfc mutants have exaggerated responses to auxin. |
AT3G54990 | Encodes a AP2 domain transcription factor that can repress flowering. SMZ and its paralogous gene, SNARCHZAPFEN (SNZ), share a signature with partial complementarity to the miR172 microRNA, whose precursor is induced upon flowering. |
AT3G12900 | S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil.S8H hydroxylates scopoletin to generate fraxetin (8-hydroxyscopoletin). Fraxetin and its oxidized analog sideretin (5-hydroxyfraxetin) are catecholic coumarins secreted into the rhizosphere under conditions of low iron availability and help mobilize this nutrient from insoluble iron(III) pools in the soil. |
AT5G46410 | Encodes a SCP1-like small phosphatase (SSP). Three SSPs form a unique group with long N-terminal extensions: AT5G46410 (SSP4), AT5G11860 (SSP5), AT4G18140 (SSP4b). SSP4 and SSP4b were localized exclusively in the nuclei, whereas SSP5 accumulated in both nuclei and cytoplasm. All three SSPs encodes active CTD phosphatases like animal SCP1 family proteins, with distinct substrate specificities: SSP4 and SSP4b could dephosphorylate both Ser2-PO(4) and Ser5-PO(4) of CTD, whereas SSP5 dephosphorylated only Ser5-PO(4). The mRNA is cell-to-cell mobile. |
AT3G23727 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT3G27503 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT4G10767 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT2G05117 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
AT3G04240 | Protein O-GlcNAc transferase. Together with SPY functions to competitively regulate RGA1 (At2g01570). |
AT4G39180 | encodes a protein that complements the function of a sec14(ts) mutant of S. cerevisiae |
AT1G61250 | Encodes a putative secretory carrier membrane protein (SC3). The mRNA is cell-to-cell mobile. |
AT5G40390 | Encodes a protein which might be involved in the formation of verbascose. A T-DNA insertion mutant was shown to have a decreased amount of verbascose (as well as mannitol) whereas the levels of raffinose and stachyose remained unchanged. Enhances drought tolerance through raffinose synthesis or galactinol hydrolysis. |
AT3G10420 | P-loop containing nucleoside triphosphate hydrolases superfamily protein;(source:Araport11) |
AT5G13030 | Chloroplast localized homolog of SELO. Loss of function mutants have reduced production of reactive oxygen species (ROS) and higher ROS scavenging. |
AT3G47300 | SELT-like protein precursor;(source:Araport11) |
AT3G10985 | A senescence-associated gene whose expression is induced in response to treatment with Nep1, a fungal protein that causes necrosis. The mRNA is cell-to-cell mobile. |
AT1G66580 | senescence associated gene 24;(source:Araport11) |
AT1G20780 | Encodes a protein containing a U-box and an ARM domain. Homozygous mutant seedlings have a seedling lethal phenotype with widespread cell death lesions throughout the cotyledons and roots. |
AT5G14930 | encodes an acyl hydrolase involved in senescence . |
AT4G02380 | Encodes AtLEA5 (late embryogenesis abundant like protein). Also known as SENESCENCE-ASSOCIATED GENE 21 (SAG21). Has a role on oxidative stress tolerance. mRNA levels are elevated in response to various stresses. |
AT3G02040 | Encodes a member of the glycerophosphodiester phosphodiesterase (GDPD) family. Has glycerophosphodiester phosphodiesterase activity. Functions in maintaining cellular phosphate homeostasis under phosphate starvation. The mRNA is cell-to-cell mobile. |
AT1G27060 | Regulator of chromosome condensation (RCC1) family protein;(source:Araport11) |
AT4G04920 | Encodes a nuclear targeted protein that plays a role in the CBF pathway -downstream of CBF translation. Mutants have impaired cold responses, reduced levels of cold induced RNA transcripts, are sensitive to osmotic stress. Required for expression of CBF-controlled cold-upregulated genes and some, but not all, other cold up-regulated genes. Required for recruitment of the Mediator complex and RNA polymerase II to CBF-controlled cold-responsive genes. Required for expression of some dark-upregulated genes. SFR6 was isolated as a suppressor of cell wall defects in cob6 mutant background. |
AT3G26680 | involved in a SNM-dependent recombinational repair process of oxidatively induced DNA damage. |
AT1G34370 | Encodes a putative nuclear Cys(2)His(2)-type zinc finger protein involved in H+ and Al3+ rhizotoxicity. In mutants exposed to aluminum stress, there is no induction of AtALMT1, an malate transporter known to be involved in the mediation of aluminum toxicity. Cell wall of the mutant is unstable in low pH medium (pH 4.5) in low Ca solution. This would mediate Ca-alleviation of low pH stress through pectin-Ca interaction. In vitro binding and mutated-promoter-GUS assays identified that STOP1 directly activates AtALMT1 expression through the binding to the promoter by four zinc finger domains. Binding of STOP1 to promoter is an essential step of Al-inducible AtALMT1 expression. The mRNA is cell-to-cell mobile. |
AT1G55920 | Encodes a chloroplast/cytosol localized serine O-acetyltransferase involved in sulfur assimilation and cysteine biosynthesis. Expressed in the vascular system. The mRNA is cell-to-cell mobile. |
AT2G22970 | serine carboxypeptidase-like 11;(source:Araport11) |
AT3G12230 | serine carboxypeptidase-like 14;(source:Araport11) |
AT3G12240 | serine carboxypeptidase-like 15;(source:Araport11) |
AT3G12220 | serine carboxypeptidase-like 16;(source:Araport11) |
AT1G33540 | serine carboxypeptidase-like 18;(source:Araport11) |
AT5G09640 | encodes a serine carboxypeptidase-like (SCPL) protein. Mutants accumulate sinapoylglucose instead of sinapoylcholine, and have increased levels of choline and decreased activity of the enzyme sinapoylglucose:choline sinapoyltransferase. |
AT4G12910 | serine carboxypeptidase-like 20;(source:Araport11) |
AT3G25420 | serine carboxypeptidase-like 21;(source:Araport11) |
AT2G35780 | serine carboxypeptidase-like 26;(source:Araport11) |
AT2G35770 | serine carboxypeptidase-like 28;(source:Araport11) |
AT1G43780 | serine carboxypeptidase-like 44;(source:Araport11) |
AT1G15000 | serine carboxypeptidase-like 50;(source:Araport11) |
AT2G27920 | serine carboxypeptidase-like 51;(source:Araport11) |
AT5G26780 | Encodes a protein with serine hydroxymethyltransferase activity which is thought to be localized in the mitochondrial matrix. SHM2 expression fails to rescue the conditional lethal phenotype of the shm1-1 mutant, defective in SHM1. |
AT3G08720 | Encodes a ribosomal-protein S6 kinase. Gene expression is induced by cold and salt (NaCl). Activation of AtS6k is regulated by 1-naphthylacetic acid and kinetin, at least in part, via a lipid kinase-dependent pathway. Phosphorylates specifically mammalian and plant S6 at 25 degrees C but not at 37 degrees C. Involved in translational up-regulation of ribosomal proteins. |
AT5G08160 | Encodes a serine/threonine protein kinase. |
AT4G35780 | ACT-like protein tyrosine kinase family protein;(source:Araport11) |
AT2G14540 | serpin 2;(source:Araport11) |
AT5G37055 | Encodes SERRATED LEAVES AND EARLY FLOWERING (SEF), an Arabidopsis homolog of the yeast SWC6 protein, a conserved subunit of the SWR1/SRCAP complex. SEF loss-of-function mutants have a pleiotropic phenotype characterized by serrated leaves, frequent absence of inflorescence internodes, bushy aspect, and flowers with altered number and size of organs. sef plants flower earlier than wild-type plants both under inductive and non-inductive photoperiods. SEF, ARP6 and PIE1 might form a molecular complex in Arabidopsis related to the SWR1/SRCAP complex identified in other eukaryotes. |
AT5G53430 | Homology Subgroup III; Orthology Group 2 - A putative histone methyltransferase (predicted to methylate H3K4) related to the Drosophila trithorax group proteins TRX and TRR and the yeast gene SET1. A plant line expressing an RNAi construct directed against this gene has reduced agrobacterium-mediated tumor formation. |
AT3G61740 | Encodes SET domain containing protein that acts redundantly with ATX4/5 to regulate histone H3-K4 methylation. Involved in bolting/flowering time together with ATX1 and ATX4. |
AT4G27910 | Encodes a SET domain containing protein, putative H3K4 methyltransferase. Involved in bolting/flowering time together with ATX1 and ATX3. |
AT1G43850 | Encodes a transcriptional co-regulator of AGAMOUS, that functions with LEUNIG to repress AG in the outer floral whorls. |
AT4G25520 | SEUSS-like 1;(source:Araport11) |
AT1G78540 | Encodes a protein that contains an SH2 domain. It can pull down a 120-kD tyrosine-phosphorylated protein in vitro. It is predicted to act as a transcription factor. |
AT4G00720 | Encodes ASKtheta, a group III Arabidopsis GSK3/shaggy-like kinase. Functions in the brassinosteroid signalling pathway. |
AT5G26751 | Encodes a SHAGGY-related kinase involved in meristem organization. It regulates the redox stress response by phosphorylating glucose-6-phosphate dehydrogenase 6.Functions as a positive regulator of salt stress tolerance. Phosphorylates and enhances G6PD6 (At5g40760) activity |
AT2G30980 | Encodes a GSK3-like protein kinase. This protein can interact with the BZR1 protein involved in brassinosteroid-mediated signaling in a Y2H assay and promotes BZR1 phosphorylation in protoplasts. |
AT3G58780 | One of two genes (SHP1 and SHP2) that are required for fruit dehiscence. The two genes control dehiscence zone differentiation and promote the lignification of adjacent cells. |
AT5G49270 | Involved in successfully establishing tip growth in root hairs. |
AT4G26690 | Glycerophosphoryl diester phosphodiesterase-like protein involved in cell wall cellulose accumulation and pectin linking. Impacts root hair, trichome and epidermal cell development. |
AT1G75520 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis.SRS5 is a positive regulator of photomorphogenesis. |
AT1G19790 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
AT2G21400 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. |
AT5G11190 | Encodes a member of the ERF (ethylene response factor) subfamily B-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 12 members in this subfamily including RAP2.11. |
AT5G02750 | Encodes an E3 ligase, SHOOT GRAVITROPISM9. Modulates the interaction between statoliths and F-Actin in gravity sensing. |
AT5G39510 | Encodes a member of SNARE gene family. Homologous with yeast VTI1 and is involved in vesicle transport. Mutant alleles such as sgr4/zig are defective in the shoots response to gravity resulting in a zigzag growth pattern of the stem. Involved in protein trafficking to lytic vacuoles. Can conditionally substitute VTI12 in protein storage vacuole trafficking when plants are devoid of VTI12. The mRNA is cell-to-cell mobile. |
AT1G28560 | Encodes a protein similar to human SNAP50. Mutants display different temperature sensitivities in the dedifferentiation of cells from different organs. Mutation inhibits the dedifferentiation-associated accumulation of U-snRNAs and some other small RNA species encoded by independent-type genes carrying the USE and TATA box. Required for the elevation of cell proliferation competence in hypocotyl dedifferentiation. |
AT1G69935 | Encodes a nuclear localized serine-arginine-aspartate-rich protein that acts as a negative regulator of photomorphogenesis. |
AT4G25350 | SHB1 encodes a nuclear and cytosolic protein that has motifs homologous with SYG1 protein family members. Acts in cryptochrome signaling. Overexpression of SHB1 enhanced the expression of PHYTOCHROME-INTERACTING FACTOR4 (PIF4) under red light and promoted proteasome-mediated degradation of phytochrome A and hypocotyl elongation under far-red light. A knockout allele suppressed LONG HYPOCOTYL IN FAR-RED LIGHT1 (HFR1) expression and showed several deetiolation phenotypes. Acts upstream of HFR1. Regulates seed development. |
AT5G66350 | A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Shi mutant is dominant, has dwarf phenotype. Loss of function mutations have no observable phenotype. Putative zinc finger protein. Involved in the response to gibberellic acid. |
AT1G11185 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT3G06125 | Unknown gene The mRNA is cell-to-cell mobile. |
AT3G29644 | Natural antisense transcript overlaps with AT3G29642. Has been identified as a translated small open reading frame by ribosome profiling. |
AT5G10278 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT5G24735 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT3G52748 | Has been identified as a translated small open reading frame by ribosome profiling. |
AT4G37650 | Involved in radial organization of the root and shoot axial organs. Essential for normal shoot gravitropism. The protein moves in a highly specific manner from the cells of the stele in which it is synthesized outward. Movement requires sequences within the GRAS and VHIID domains. SHORT-ROOT forms a network in combination with JACKDAW, BLUEJAY AND SCARECROW to regulate tissue patterning through asymmetric cell division. The ground tissue lineage remains in shortroot mutant, while it is progressively lost in the triple mutant bluejay jackdaw scarecrow and double mutant jackdaw scarecrow. In addition, ground tissue basal identity remains in shortroot mutant while it is defective in the quadruple mutant bluejay jackdaw magpie nutcracker. |
AT2G47140 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT3G51680 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT2G47130 | Encodes a short-chain dehydrogenase/reductase that is not involved in ABA biosynthesis but plays an important role in plant defense response to bacteria. |
AT3G08800 | Encodes a nuclear and endosome localized protein with ARM and HEAT domains that interacts with SHR and other non-cell-autonomous proteins and may be involved in their intercellular movement. Hypomorphic mutant phenotypes suggest involvement of the protein in root patterning. |
AT1G66970 | Encodes a member of the glycerophosphodiester phosphodiesterase like (GDPD-like) family. |
AT5G02220 | cyclin-dependent kinase inhibitor;(source:Araport11) |
AT4G16960 | Redundant function together with SIKIC1 and 2 in SNC1-mediated autoimmunity. Protein levels controlled by MUSE1 and MUSE2. |
AT3G56710 | Sig1 binding protein; interacts with Sig1R4. As well as Sig1, SibI is imported into chloroplasts and its expression is light-dependent in mature chloroplasts. |
AT1G73990 | Encodes a putative protease SppA (SppA). |
AT2G43070 | SIGNAL PEPTIDE PEPTIDASE-LIKE 3;(source:Araport11) |
AT1G01650 | SIGNAL PEPTIDE PEPTIDASE-LIKE 4;(source:Araport11) |
AT1G05820 | SIGNAL PEPTIDE PEPTIDASE-LIKE 5;(source:Araport11) |
AT2G22300 | Encodes a putative CAM binding transcription factor. Loss of function mutations show enhanced resistance to fungal and bacterial pathogens suggesting that CAMTA functions to suppress defense responses.It acts in the cold response pathway, it can bind to and activate the expression of DREB1 genes. |
AT3G15390 | Encodes a novel protein that is similar to PRL1 interacting factor and is involved in virus induced silencing. |
AT2G35510 | Encodes a WWE domain-containing protein with 76% similarity to RCD1. The protein also contains a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
AT1G23550 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Its transcript level is up-regulated by tunicamycin (N-linked glycosylation inhibitor causing ER stress). |
AT3G47720 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. |
AT5G62520 | Encodes a protein with similarity to RCD1 but without the WWE domain. The protein does have a PARP signature upstream of the C-terminal protein interaction domain. The PARP signature may bind NAD+ and attach the ADP-ribose-moiety from NAD+ to the target molecule. Its presence suggests a role for the protein in ADP ribosylation. Up-regulated by NaCl. SRO5 and P5CDH (an overlapping gene in the antisense orientation) generate 24-nt and 21-nt siRNAs, which together are components of a regulatory loop controlling reactive oxygen species (ROS) production and stress response. |
AT1G70060 | Encodes a homolog of the transcriptional repressor SIN3 (AT1G24190). The mRNA is cell-to-cell mobile. |
AT5G16270 | Encodes a SCC1/REC8 ortholog that may be involved in mitosis and may represent a mitotic cohesin. Plays a role in somatic DNA double strand break damage repair. The mRNA is cell-to-cell mobile. |
AT2G47310 | Functions in an antagonistic manner to its close homolog FCA. The SSF414N protein variant interacts more strongly with CUL1, a component of the E3 ubiquitination complex, than the SSF414D form, mediating differences in SSF protein degradation and FLC expression. |
AT3G25650 | SKP1-like 15;(source:Araport11) |
AT2G03190 | one of SKP1 homologs. Gene is expressed specifically in the silique. |
AT1G10230 | Involved in protein degradation. One target is PHR1. |
AT1G06110 | SKP1/ASK-interacting protein 16;(source:Araport11) |
AT3G54480 | Encodes an SKP1 interacting partner (SKIP5). |
AT5G48450 | Encodes a protein with two DUF26 domains and a signal peptide for secretion. The protein is transported to the apoplast when it is expressed as a GFP fusion protein. |
AT4G22010 | SKU5 similar 4;(source:Araport11) |
AT1G21860 | SKU5 similar 7;(source:Araport11) |
AT1G21850 | SKU5 similar 8;(source:Araport11) |
AT1G41830 | SKU5-similar 6;(source:Araport11) |
AT1G62262 | Predicted to encode a protein with similarity to the SLAC1 protein involved in ion homeostasis in guard cells. |
AT5G48170 | encodes an F-box protein whose protein sequence is similar to SLY1, which belongs to SCF-SLY1 E3 ligase complex. SCF-SLY1 E3 ligase degrades DELLA proteins that are involved in promoting growth. Overexpression of SLY2 can partially compensate sly1-10 mutant phenotype of dwarfism. |
AT1G55040 | SED1 is a protein of unknown function that is located in the mitochondrion. sed1 mutants are embryo lethal. |
AT3G59810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT2G43810 | Small nuclear ribonucleoprotein family protein;(source:Araport11) |
AT4G13520 | Encodes a small acid protein (SMAP1) that mediates responses Arabidopsis root to the synthetic auxin 2,4-Dichlorophenoxyacetic acid. The mRNA is cell-to-cell mobile. |
AT3G04090 | Belongs to a family of plant aquaporins. Similar to yeast and radish aquaporins. Located on ER. |
AT3G56950 | One of the Major Intrinsic Proteins(MIPs) which facilitate the passive transport of small molecules across membranes.Belongs to a family of plant aquaporins.Similar to yeast and radish aquaporins. Located on ER. Probably involved in the alleviation of ER stress; the lack of SIP2;1 reduces both pollen germination and pollen tube elongation. |
AT1G55270 | SAGL1 is a member of a small family of KELCH domain containing proteins. Loss of function mutants show increased lignin and anthocyanin production suggesting a role in regulation of phenylpropanoid biosynthesis. |
AT2G45210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G79130 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G16510 | Encodes a clade III SAUR gene with a distinctive expression pattern in root meristems. It is normally expressed in the quiescent center and cortex/endodermis initials and upon auxin stimulation, the expression is found in the endodermal layer. Overexpression studies suggest roles in cell expansion and auxin transport. |
AT2G18010 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G66260 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G09530 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G53590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G00880 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G46690 | Regulates ABA-mediated responses to drought stress. |
AT4G12410 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G28085 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT2G36210 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G34810 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G75590 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G19840 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G50760 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT3G53250 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT5G20820 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT4G36110 | SAUR-like auxin-responsive protein family;(source:Araport11) |
AT1G19020 | Modulates defense against bacterial pathogens and tolerance to oxidative stress. |
AT4G20440 | small nuclear ribonucleoprotein associated protein B;(source:Araport11) |
AT4G30220 | small nuclear ribonucleoprotein F;(source:Araport11) |
AT5G55170 | Encodes a small ubiquitin-like modifier (SUMO) polypeptide that becomes covalently attached to various intracellular protein targets, much like ubiquitination, leading to post-translational modification of those targets. |
AT1G56580 | Encodes SMALLER WITH VARIABLE BRANCHES (SVB), a protein with a conserved domain of unknown function (DUF538). The trichomes of the SVB mutants are smaller and exhibit branches of variable length and number. ABA responsive trichome formation regulator. |
AT4G30350 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. Regulates root and root hair development downstream of KAI2-mediated signaling. |
AT3G52490 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
AT1G07200 | Encodes a member of an eight-gene family (SMAX1 and SMAX1-like) that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. |
AT3G48880 | Encodes an F-box protein, SNIPER4, that regulates the turnover of MUSE13 and MUSE14, redundant TRAF proteins serving as adaptors in the SCFCRP1 complex to facilitate the turnover of nucleotide-binding domain and leucine-rich repeats (NLR) immune receptors. |
AT3G50500 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. |
AT2G23030 | encodes a member of SNF1-related protein kinases (SnRK2) |
AT3G48530 | SNF1-related protein kinase regulatory subunit gamma 1;(source:Araport11) |
AT1G50410 | Encodes a member of the SNF2 family of helicase-like proteins and is involved in RNA-directed DNA methylation. It is functionally redundant with FRG1. |
AT5G60750 | Encodes a chloroplast endoproteinase, SNOWY COTYLEDON4 (SCO4), required for photosynthetic acclimation to higher light intensities. |
AT1G26470 | chromatin modification-like protein;(source:Araport11) |
AT1G26210 | AtSOFL1 acts redundantly with AtSOFL2 as positive regulator of cytokinin levels. |
AT4G32400 | Encodes a plastidial nucleotide uniport carrier protein required to export newly synthesized adenylates into the cytosol. |
AT2G37390 | Chloroplast-targeted copper chaperone protein;(source:Araport11) |
AT1G17050 | Encodes one of the two paralogous solanesyl diphosphate synthases - SPS1 (At1g78510) and SPS2 (At1g17050) - that assemble the side-chain of plastoquinone-9 in plastids. |
AT2G26740 | Encodes a soluble epoxide hydrolase whose expression is induced by auxin and water stress. |
AT5G61210 | membrane localized t-SNARE SNAP25 homologue, probably involved in cytokinesis and cell plate formation The mRNA is cell-to-cell mobile. |
AT2G13790 | somatic embryogenesis receptor-like kinase 4;(source:Araport11) |
AT2G13800 | somatic embryogenesis receptor-like kinase 5;(source:Araport11) |
AT3G48195 | Encodes a member of the Arabidopsis sorting nexin family. |
AT4G30960 | Encodes CBL-interacting protein kinase 6 (CIPK6). Required for development and salt tolerance. The mRNA is cell-to-cell mobile. |
AT1G05577 | SOK1 is a DUF966 domain containing protein. It is expressed during embryogenesis in the apical-lateral plasma membrane. SOK1 can form homodimers and it's polar localization of SOK1 depends on N terminal domains within the protein. Misexpression of SOK1 or delocalization alters cell division planes. |
AT5G10150 | SOK2 is a DUF966 domain containing protein of unknown function. Expressed in discrete domains of the PM. In root endodermis and embryo, expression is in inner basal edges and in basal |
AT3G46110 | DUF966 domain containing protein, expressed during embryogenesis. |
AT5G59790 | SOK5 is a DUF966 domain containing protein expressed in early embryos. |
AT1G09070 | SRC2 specifically binds the peptide PIEPPPHH, and moves from ER to a vacuole fraction where it gets internalized. Involved in Protein Storage Vacuole targeting. The mRNA is cell-to-cell mobile. |
AT3G15354 | Encodes a member of the SPA (suppressor of phyA-105) protein family (SPA1-SPA4). SPA proteins contain an N-terminal serine/threonine kinase-like motif followed by a coiled-coil structure and a C-terminal WD-repeat domain. SPA proteins function redundantly in suppressing photomorphogenesis in dark- and light-grown seedlings. SPA3 (and SPA4) predominantly regulates elongation growth in adult plants. |
AT5G53120 | encodes a novel spermine synthase and is a paralog of previously characterized spermidine synthases, SPDS1 and SPDS2. SPDS3 forms heterodimers with SDPS2, which in turn forms heterodimers with SDPS1 in vivo. The gene does not complement speDelta3 deficiency of spermidine synthase in yeast but DOES complement speDelta4 deficiency. |
AT3G61580 | Fatty acid/sphingolipid desaturase;(source:Araport11) |
AT4G21534 | Diacylglycerol kinase family protein;(source:Araport11) |
AT3G02180 | SPIRAL1-LIKE3 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
AT5G15600 | SPIRAL1-LIKE4 belongs to a six-member gene family in Arabidopsis; all members share high sequence similarity in amino- and carboxy-terminal regions. Regulates cortical microtubule organization. Mutant plants exhibit altered patterns of root, leaf and petal growth as a result of defective anisotropic cell expansion. |
AT1G03060 | Encodes a WD/BEACH domain protein involved in cell morphogenesis and ribonucleoprotein particle formation. It interacts with the P-body core component DCP2, associates to mRNA processing bodies (P-bodies), and regulates their assembly upon salt stress. It accumulates at the root hair apex via post-Golgi compartments and positively regulates tip growth by maintaining tip-focused vesicle secretion and filamentous-actin integrity. |
AT1G17070 | Encodes a homologue of spliceosome disassembly factor NTR1. Required for correct expression and splicing of DOG1, a regulator of seed dormancy. The mRNA is cell-to-cell mobile. |
AT3G45590 | Encodes a catalytic subunit of tRNA splicing endonuclease. |
AT4G27330 | Encodes a putative transcription factor that is required for the initiation of both micro- and megagametogenesis and is expressed in the sporogenous tissue of the anther and the ovule. SPL is a chalaza identity gene that share overlapping functions in establishing the prospective chalaza of the ovule. It also plays a central role in patterning both the proximal-distal and the adaxial-abaxial axes in the ovule and generally interacts with YABBY proteins in vitro. Mutant is defective in the differentiation of primary sporogenous cells into microsporocytes, and does not properly form the anther wall. Regulator of anther cell differenctiation. Interacts with TPL and TCP proteins. |
AT5G63670 | Transcription elongation factor SPT4 homolog 2. T-DNA mutant is more susceptible to the biotroph Hpa. |
AT5G15330 | Encodes a protein with a single SYG1/Pho81/XPR1 (SPX) domain that localizes to both the cytosol and nucleus, acting as a dose-dependent modulator of PHR1-dependent and PHR1-independent phosphate-starvation responses in shoots. SPX4 prevents translocation of PHR1 (AT4G28610) to the nucleus in a dose- and Pi-dependent manner. In contrast to SPX1, SPX4 modulates rather than suppresses phosphate-starvation response (PSR) gene expression. |
AT4G37760 | squalene epoxidase 3;(source:Araport11) |
AT2G47070 | member of SPL gene family, encodes DNA binding proteins and putative transcription factors. All have the SBP-box, which encodes the SBP-domain, required for and sufficient for interaction with DNA. |
AT1G20980 | Encodes a nuclear plant-specific protein with features characteristic of a transcriptional regulator, including a nuclear localization signal sequence, a plant-specific DNA binding domain (the SBP box), and a protein interaction motif (ankyrin repeats). It unctions as a transcriptional regulator that plays a role not only in sensitivity to FB1, but also in the development of normal plant architecture. The mRNA is cell-to-cell mobile. |
AT5G43270 | Member of the SPL (squamosa-promoter binding protein-like) gene family, a novel gene family encoding DNA binding proteins and putative transcription factors. In conjunction with SPL10 and SPL11, SPL2 redundantly controls proper development of lateral organs in association with shoot maturation in the reproductive phase. SPL2, SPL10, and SPL11, suppress root regeneration with age by inhibiting wound-induced auxin biosynthesis. |
AT3G60030 | squamosa promoter-binding protein-like 12;(source:Araport11) |
AT4G01970 | Encodes a a raffinose and high affinity stachyose synthase as well as a stachyose and Gol specific galactosylhydrolase enzyme activity.AtRS4 is a sequential multifunctional RafS and StaS as well as a high affinity StaS, accepting only Raf and Gol for Sta product formation. AtRS4 possesses a Sta and Gol specific galactosylhydrolase enzyme activity. |
AT5G03650 | Encodes starch branching enzyme (E.C.2.4.1.18) similar to SBE2 from maize and rice. Expressed throughout the plant and highest in seedlings and cauline leaves. |
AT1G11720 | Encodes a starch synthase that in addition to its role in starch biosynthesis also has a negative regulatory function in the biosynthesis of transient starch. The protein apparently contains a starch-binding domain (SBD). |
AT5G19690 | encodes an oligosaccharyl transferase involved response to high salt. Mutants are hypersensitive to high salt conditions The mRNA is cell-to-cell mobile. |
AT5G35770 | A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. |
AT5G42890 | sterol carrier protein 2;(source:Araport11) |
AT3G07020 | encodes a 3beta-hydroxy sterol UDP-glucosyltransferase. ugt80a2 mutant plants have reduced steryl glycoside and acyl steryl glycoside levels and reduced seed size. ugt80a2/b1 double mutants have normal levels of celluose and normal cold stress tolerance. |
AT1G20330 | Encodes a sterol-C24-methyltransferases involved in sterol biosynthesis. Mutants display altered sterol composition, serrated petals and sepals and altered cotyledon vascular patterning as well as ectopic endoreduplication. This suggests that suppression of endoreduplication is important for petal morphogenesis and that normal sterol composition is required for this suppression. |
AT1G76090 | Encodes S-adenosyl-methionine-sterol-C-methyltransferase, an enzyme in the sterol biosynthetic pathway. |
AT2G02480 | STICHEL mutant shows trichomes with fewer than normal branches. |
AT1G79200 | Encodes a nuclear localized protein involved in auxin-dependent control of cell proliferation in pistil development. Loss of function mutations have increased cell proliferation in the stigma. |
AT2G26770 | Encodes a plant-specific actin binding protein SCAB1 (STOMATAL CLOSURE-RELATED ACTIN BINDING PROTEIN1). SCAB1 stabilizes actin filaments and regulates stomatal movement. |
AT3G48860 | coiled-coil protein;(source:Araport11) |
AT3G57480 | SAP1 is a protein of unknown function whose expression is responsive to abiotic stressors including metals, salt, and ABA. Over expression confers increased tolerance to a variety of abiotic stressors. |
AT1G51850 | Malectin-like receptor-like kinase involved in MAMP mediated stomatal immunity. Interacts with BAK1/FLS2 signaling complex and subsequently phosphorylates and activates SLAC1. |
AT1G51805 | Leucine-rich repeat protein kinase family protein;(source:Araport11) |
AT4G25380 | stress-associated protein 10;(source:Araport11) |
AT4G12040 | A20/AN1-like zinc finger family protein;(source:Araport11) |
AT1G74000 | encodes a protein similar to strictosidine synthase, which is involved in the production of monoterpene indole alkaloids. This gene belongs to a family of 13 members in Arabidopsis. |
AT1G11130 | Encodes an atypical receptor-like kinase protein with a predicted extracellular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain expressed throughout the developing root but whose kinase activity is not essential for its function in vivo. Regulates expression of GLABRA2, CAPRICE, WEREWOLF, and ENHANCER OF GLABRA3. Required for floral organ shape, the development of the outer integument of ovules, and stem development. Regulates cell shape and cell division planes in the L2 layer of floral meristems and the L1-derived outer integument of ovules. Controls specification of epidermal root hairs. Participates in the coordination of cell morphogenesis between cell layers during floral development. |
AT1G78980 | STRUBBELIG-receptor family 5;(source:Araport11) |
AT5G48600 | member of SMC subfamily |
AT1G68830 | STN7 protein kinase; required for state transitions, phosphorylation of the major antenna complex (LHCII) between PSII and PSI, and light adaptation. STN7 is involved in state transitions. |
AT2G22740 | Encodes a SU(VAR)3-9 homolog, a methyltransferase involved in histone methylation. The protein was shown to bind to methylated cytosines of CG, CNG and CNN motifs but has a preference for the latter two. This is a member of a subfamily of SET proteins that shares a conserved SRA domain. |
AT4G10540 | Proteolytic enzyme of that phytaspase family which at pH 5.5 is strictly Asp-specific. Strongly preferred cleavage motifs are YVAD and IETD. |
AT5G59090 | subtilase 4.12;(source:Araport11) |
AT5G59120 | SBT4.13 subtilase. Activity is inhibited by SPI-1. |
AT1G71950 | SPI-1 is a member of the I9 inhibitor family. It is an inhibitor of SBT4.13 subtilase. |
AT3G10380 | Subunit of the Putative Arabidopsis Exocyst Complex |
AT2G18450 | Nuclear encoded mitochondrial flavoprotein subunit of succinate dehydrogenase complex . |
AT5G66880 | encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress. Enzyme involved in the ABA signaling during seed germination, dormancy and seedling growth. The mRNA is cell-to-cell mobile. |
AT5G20280 | Encodes a sucrose-phosphate synthase activity. This is the major leaf isoform. |
AT5G20830 | Encodes a protein with sucrose synthase activity (SUS1). |
AT3G52340 | sucrose-phosphatase (SPP2) |
AT1G71880 | Sucrose transporter gene induced in response to nematodes; member of Sucrose-proton symporter family. The mRNA is cell-to-cell mobile. |
AT1G22710 | Encodes for a high-affinity transporter essential for phloem loading and long-distance transport. A major sucrose transporter, AtSUC2 can also transport a wide range of physiological and synthetic glucose conjugates with both α- or β-linkage. |
AT2G14670 | sucrose-proton symporter 8;(source:Araport11) |
AT1G11260 | Encodes a H+/hexose cotransporter. The mRNA is cell-to-cell mobile. |
AT3G19930 | Encodes a sucrose hydrogen symporter that is induced by wounding. The mRNA is cell-to-cell mobile. |
AT1G78000 | Encodes a sulfate transporter that can restore sulfate uptake capacity of a yeast mutant lacking sulfate transporter genes. |
AT4G02700 | sulfate transporter 3;(source:Araport11) |
AT3G15990 | Vascular cambium-localized sulfate transporter, mediates xylem-to-phloem transfer of phosphorus. 2 for its preferential distribution |
AT5G19600 | Encodes sulfate transporter Sultr3;5. |
AT5G13550 | Encodes a sulfate transporter. |
AT3G01910 | Encodes a homodimeric Mo-enzyme with molybdopterin as organic component of the molybdenum cofactor. It lacks the heme domain that other eukaryotic Mo-enzymes possess and has no redox-active centers other than the molybdenum. SO protein has been found in all parts of the plant. The plant SO combines its enzymatic sulfite oxidation with a subsequent nonenzymatic step using its reaction product H2O2 as intermediate for oxidizing another molecule of sulfite. |
AT5G01220 | Encodes a UDP-sulfoquinovose:DAG sulfoquinovosyltransferase that is involved in sulfolipid biosynthesis and whose expression is responsive to both phosphate (Pi) and phosphite (Phi) in both roots and shoots. |
AT3G45070 | Encodes a sulfotransferase with sulfating activity toward flavonoids. |
AT4G08620 | Encodes a high-af?nity sulfate transporter. Contains STAS domain. Expressed in roots and guard cells. Up-regulated by sulfur deficiency. |
AT2G03760 | Encodes a brassinosteroid sulfotransferase. In vitro experiements show that this enzyme has a preference for 24-epibrassinosteroids, particularly 24-epicathasterone, but does not act on castasterone and brassinolide. It also shows sulfating activity toward flavonoids. It is differentially expressed during development, being more abundant in young seedlings and actively growing cell cultures. Expression is induced in response to salicylic acid and methyl jasmonate and bacterial pathogens. |
AT5G48850 | Homologous to the wheat sulphate deficiency-induced gene sdi1. Expression in root and leaf is induced by sulfur starvation. Knockout mutants retained higher root and leaf sulfate concentrations, indicating a role in regulation of stored sulfate pools. |
AT3G57870 | Encodes a SUMO ligase that directs the attachment of the small protein SUMO to target proteins via an isopeptide bond. This enzyme is localized to the nucleus and plants with reduced levels of this protein show higher sensitivity to ABA in root growth inhibition assays. It has high similarity to the yeast UBC9 SUMO ligase and is sometimes referred to by that name. |
AT4G33620 | Encodes a SUMO protease that, along with ASP1,is required for fertility as asp1/spf2 double mutants have defects in gametogenesis and embroygenesis. |
AT2G21470 | Encodes one of the two subunits of the SUMO activation enzyme required during sumolation. Sumolation is a post-translational protein modification process similar to ubiquitination during which a polypeptide (SUMO) is covalently attached to a target protein. |
AT4G23950 | Encodes a member of the mid-SUN subfamily of SUN-domain proteins. It is involved in early seed development and nuclear morphology. |
AT3G23130 | Flower-specific gene controlling the boundary of the stamen and carpel whorls. Similar to zinc finger transcription factors. Involved in shoot regenaration from root explants. |
AT5G48870 | SAD1 encodes a polypeptide similar to multifunctional Sm-like snRNP proteins that are required for mRNA splicing, export, and degradation. Mutation in this gene increases plant sensitivity to drought stress and ABA in seed germination, root growth, and the expression of some stress-responsive genes. |
AT1G14320 | Encodes a ribosomal protein L10 and may be involved in translation regulation. Semi-dominant mutations in SAC552 can suppress defects in acaulis5, which encodes a thermospermine synthase, by enhancing translation of acl5 and itself. |
AT5G66020 | Mutants in this gene are unable to express female sterility in response to beta-aminobutyric acid, as wild type plants do. non-consensus AT donor splice site at exon 7, TA donor splice site at exon 10, AT acceptor splice at exon 13. |
AT3G43220 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT1G17340 | Phosphoinositide phosphatase family protein;(source:Araport11) |
AT3G59770 | Encodes a phosphoinositide phosphatase. The sac9 null mutant accumulates elevated levels of PtdIns(4,5)P2 and Ins(1,4,5)P3. The mutant plants have characteristics of constitutive stress responses. |
AT4G22305 | Encodes SOBER1, a carboxylesterase that inhibits AvrBsT-triggered phenotypes in Arabidopsis. SOBER1 was formerly linked to AT4G22300 but this locus was split in the TAIR10 annotation into AT4G22300 and AT4G22305. AT4G22300 is now known as TIPSY1 and AT4G22305 corresponds to SOBER1. |
AT2G31880 | Encodes a putative leucine rich repeat transmembrane protein that is expressed in response to Pseudomonas syringae. Expression of SRRLK may be required for silencing via lsiRNAs. Regulates cell death and innate immunity. |
AT1G25580 | Encodes suppressor of gamma response 1 (SOG1), a putative transcription factor governing multiple responses to DNA damage. |
AT5G57710 | SMAX1 (SUPPRESSOR OF MAX2 1) is a member of an eight-gene family in Arabidopsis that has weak similarity to AtHSP101, a ClpB chaperonin required for thermotolerance. SMAX1 is an important component of KAR/SL signaling during seed germination and seedling growth, but is not necessary for all MAX2-dependent responses. The mRNA is cell-to-cell mobile. |
AT1G56500 | Encodes a thylakoid membrane protein with thioredoxin-like and beta-propeller domains located in the lumen and a haloacid-dehalogenase domain exposed to the chloroplast stroma. The protein's role may be to prevent formation of a slowly reversible form of antenna quenching, thereby maintaining the efficiency of light harvesting. The mRNA is cell-to-cell mobile. |
AT4G37460 | Encodes a tetratricopeptide repeat domain containing protein that shows sequence similarity to those of transcriptional repressors in other organisms. Involved in mediating effector-triggered immunity. |
AT5G11310 | The SOAR1 gene encodes a pentatricopeptide repeat (PPR) protein which localizes to both the cytosol and nucleus. Down-regulation of SOAR1 strongly enhances, but up-regulation of SOAR1 almost completely impairs, ABA responses, revealing that SOAR1 is a critical, negative, regulator of ABA signalling. Further genetic evidence supports that SOAR1 functions downstream of ABAR and probably upstream of an ABA-responsive transcription factor ABI5. Changes in the SOAR1 expression alter expression of a subset of ABA-responsive genes including ABI5. These findings provide important information to elucidate further the functional mechanism of PPR proteins and the complicated ABA signalling network. |
AT5G46580 | pentatricopeptide (PPR) repeat-containing protein;(source:Araport11) |
AT5G25440 | Receptor like kinase involved in HopZ1a effector triggered immunity. Interacts with ZAR1. Localization to membrane is dependent on N-terminal myristoylation domain. |
AT5G63020 | Nucleotide binding leucine rich repeat protein of the C-NB-LRR (CNL) type. Involved in TOPP4 mediated immune response. |
AT1G67140 | HEAT repeat-containing protein;(source:Araport11) |
AT1G31760 | SWIB/MDM2 domain superfamily protein;(source:Araport11) |
AT2G33610 | Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Interacts with BSH, AtSWI3A, SWI3C and FCA. Expressed ubiquitously. |
AT1G21700 | a member of the Arabidopsis SWI3 gene family. Protein physically interacts with ATSWI3B and ATSWI3A, the other two members of the SWI3 family. Homologous to yeast SWI3 & RSC8, components of the SWI/SNF and RSC chromatin remodeling complexes. Referred to as CHB3 in Zhou et al (2003). |
AT5G07880 | member of mammalian SNAP25 Gene Family, a type of SNARE proteins with two chains. There are three members in Arabidopsis: SNAP30, SNAP29, and SNAP33. |
AT1G08560 | member of SYP11 syntaxin Gene Family |
AT3G24350 | member of Glycoside Hydrolase Family 17 |
AT2G18260 | member of SYP11 Gene Family |
AT3G11820 | Encodes a syntaxin localized at the plasma membrane. SYR1/PEN1 is a member of the SNARE superfamily and functions in positioning anchoring of the KAT1 K+ channel protein at the plasma membrane. Transcription is upregulated by abscisic acid, suggesting a role in ABA signaling. Also functions in non-host resistance against barley powdery mildew. It is a nonessential component of the preinvasive resistance against Colletotrichum fungus. Required for mlo resistance. The syp121 point mutation results in stomatal phenotypes that reduce CO2 assimilation, slow vegetative growth and increase water use efficiency in the whole plant, conditional upon high light intensities and low relative humidity. The R20R21 motif of SYP121 are essential for SEC11 interaction. Mutation of the R20R21 motif blocks vesicle traffic without uncoupling the effects of SYP121 on solute and K+ uptake associated with the F9xRF motif; the mutation also mimicks the effects on traffic block observed on coexpression of the dominant negative SEC11?149 fragment. |
AT1G11250 | member of SYP12 Gene Family |
AT3G03800 | member of SYP13 Gene Family |
AT4G02195 | Encodes a member of SYP4 Gene Family that is a plant ortholog of the Tlg2/syntaxin16 Qa-SNARE. Together with SYP43, it regulates the secretory and vacuolar transport pathways in the post-Golgi network and maintains the morphology of the Golgi apparatus and TGN and is required for extracellular resistance responses to a fungal pathogen. |
AT3G61450 | syntaxin of plants 73 (SYP73) |
AT5G12850 | CCCH-type zinc finger protein with ARM repeat domain-containing protein;(source:Araport11) |
AT5G43630 | Encodes a zinc knuckle protein that negatively regulates morning specific growth. The role of TZP in hypocotyl elongation was established through a QTL analysis of BayXSha RIL populations. The Bay-0 allele contains a deletion causing a frameshift mutation. TZP is under circadian control and acts to regulate morning-specific hypocotyl growth. The mRNA is cell-to-cell mobile. |
AT4G34270 | TOR signaling pathway protein. |
AT4G24972 | Encodes a novel small protein which is similar to proteins of unknown function from other plant species. TPD1 is involved in cell specification during anther and pollen development. Identified in a screen for male steriles. Mutants lack tapetal cells and have an increased number of microsporocytes. Expressed in flower buds, leaves and young seedlings. In anthers, TPD1 is expressed throughout pollen development in parietal cells and sporocytes. Physically interacts with the LRR kinase EMS1 and that interaction results in phosphorylation of TPD1. |
AT5G60120 | AP2 family transcription factor that is involved in regulation of flowering and innate immunity.Interacts with CRY1 and CRY2 during flowering as part of a regulatory circuit including FT and CO. TOE1/TOE2 are also targets of MiR172b repression and functions in regulation of innate immunity via repression of FLS. |
AT4G34400 | B3-type transcription factor, which promotes floral transition and is repressed by FLC/SVP and promoted by SOC1. |
AT1G50030 | Related to TOR proteins from yeast and mammals, regulators of cell growth in response to nutrient availability. TOR proteins belong to the family of phosphatidylinositol 3-kinase and are targets of the antiproliferative drug rapamycin. AtTOR binds the yeast FKBP12 protein in the presence of Rapamycin, is involved in embryogenesis and is expressed in embryos, endosperm and meristems. Participates in negatively modulating ethylene signals and the molecular mechanism is likely involved in the regulation of ethylene biosynthesis by affecting ACSs in transcription and protein levels |
AT2G20562 | Encodes a putative signalling peptide with similarity to TAX1. No known function has been demonstrated yet. |
AT1G54360 | Encodes one of two Arabidopsis proteins with significant similarity to the histone fold TBP-associated factor TAF6. |
AT3G45150 | TCP domain protein 16;(source:Araport11) |
AT1G72010 | Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT1G58100 | Encodes TCP8, belongs to the TCP transcription factor family known to bind site II elements in promoter regions. Modulates GA-dependent stamen filament elongation by direct activation of SAUR63 subfamily genes through conserved target sites in their promoters. |
AT1G29010 | verprolin;(source:Araport11) |
AT5G13820 | Encodes a protein that specifically binds plant telomeric DNA repeats. It has a single Myb telomeric DNA-binding (SANT) domain in C-terminus that prefers the sequence TTTAGGG. Single Myb Histone (SMH) gene family member. |
AT1G30210 | TCP family protein involved in heterochronic regulation of leaf differentiation. |
AT3G27010 | Belongs to a TCP protein transcription factor family. Members of this family contain a predicted basic-helix-loop-helix domain involved in DNA binding. Related to rice PCF1 and PCF2 genes. Binds to the GCCCR element of CYCB1;1. Involved in regulation of expression of cell cycle control and ribosomal protein genes. |
AT1G67770 | Similar to terminal ear1 in Zea mays. A member of mei2-like gene family; phylogenetic analysis revealed that TEL2 belongs to the third clade of mei2-like proteins (TEL clade), with conserved two N-terminal RNA recognition motifs (RRM), in addition to the C-terminal RRM, shared among all mei2-like proteins. Expression patterns were similar to TEL1, with lower expression levels in most tissues examined. |
AT5G03840 | Controls inflorescence meristem identity. Involved in the floral initiation process. Ortholog of the Antirrhinum gene CENTRORADIALIS (CEN). Involved in protein trafficking to the protein storage vacuole. TFL1 plays an antagonistic role to FT/TSF in the determination of inflorescence meristem identity. |
AT1G61120 | Encodes a geranyllinalool synthase that produces a precursor to TMTT, a volatile plant defense C16-homoterpene. GES transcript levels rise in response to alamethicin, a fungal peptide mixture that damages membranes. This transcriptional response is blocked in JA biosynthetic and JA signaling mutants, but GES transcript levels still rise in response to alamethicin in mutants with salicylic acid and ethylene biosynthetic and/or signaling defects. GES transcripts also accumulate in response to a larval infestation. This enzyme does not localize to the plastids, and it may be present in the cytosol or endoplasmic reticulum. The mRNA is cell-to-cell mobile. |
AT4G14770 | Regulates fate transition and cell Divisions in the stomatal lineage. |
AT1G62080 | Encodes a member of a mucilage protein family. Predicted in silico to be glycosylated. |
AT5G23030 | Member of TETRASPANIN family |
AT2G03840 | TET13 encodes a member of the TETRASPANIN gene family that is expressed in the hypophysis, QC, root stem cells, lateral root primordia and is involved in primary root growth and lateral root development. |
AT2G01960 | Member of TETRASPANIN family |
AT5G60220 | Member of TETRASPANIN family |
AT3G17880 | Encodes a thioredoxin-like disulfide reductase. The protein interacts with the yeast Hsp70 protein Ssb2 in vitro. This interaction is sensitive to the redox status of the thioredoxin domain of AtTDX. |
AT3G04710 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G10090 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT2G41520 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G04190 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT2G42580 | Encodes a member of the TTL family and contains a thioredoxin like domain and three tandom TPRs. Interacts physically with BRL2/VH1 and appears to play a role in brassiosteroid and auxin signaling. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. The mRNA is cell-to-cell mobile. |
AT3G58620 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. The TTL family is required for osmotic stress tolerance and male sporogenesis. |
AT1G08320 | bZIP transcription factor family protein;(source:Araport11) |
AT3G12250 | basic leucine zipper transcription factor involved in the activation of SA-responsive genes. |
AT5G65210 | Encodes TGA1, a redox-controlled regulator of systemic acquired resistance. TGA1 targets the activation sequence-1 (as-1) element of the promoter region of defense proteins. TGA1 are S-nitrosylated. |
AT5G54380 | Encodes THESEUS1 (THE1), a receptor kinase regulated by Brassinosteroids and required for cell elongation during vegetative growth. |
AT1G02880 | Encodes a thiamine pyrophosphokinase capable of producing thiamine pyrophosphate from free thiamine. |
AT1G22940 | Encodes a bifunctional enzyme required for thiamine (vitamin B1) biosynthesis. TH1 can phosphorylate HMP-P to produce HMP-PP, the pyrimidine heterocyclic subunit of thiamine. TH1 also catalyzes the condensation of HMP-PP and HET to form thiamine monophosphate (TMP). TH1 also appears capable of phosphorylating HMP based on E.coli mutant complementation assays. th1 mutants are thiamine auxotrophs that die as seedlings on unsupplemented media. |
AT5G39950 | encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells. |
AT1G59730 | Thioredoxin H-type 7 , oxidoreductase located in cytosol and ER. Interacts with GPT1. |
AT1G69880 | thioredoxin H-type 8;(source:Araport11) |
AT3G08710 | Associated to plasma membrane. Moves cell to cell, suggesting a role in intercellular communication. The redox reaction between oxidized AtGPX3 and reduced AtTRXh9 is realized through the forming and breaking of disulfide bonds via the active sites of Cys4 and Cys57 in AtTRXh9. |
AT1G31020 | thioredoxin O2;(source:Araport11) |
AT1G76760 | Encodes a y-type thioredoxin (Trx-y1) localized in chloroplast stroma. |
AT1G43560 | thioredoxin Y2;(source:Araport11) |
AT2G30440 | Encodes a thylakoidal processing peptidase that removes signal sequences from proteins synthesized in the cytoplasm and transported into the thylakoid lumen. The mRNA is cell-to-cell mobile. |
AT3G55160 | THADA is an orphan gene in Arabidopsis thaliana. It is the only DUF2428 domain containing protein in the genome. |
AT4G32570 | TIFY domain protein 8;(source:Araport11) |
AT3G22380 | Encodes a nucleus-acting plant-specific clock regulator working close to the central oscillator and affecting the circadian gating of light responses. Circadian gating is the alteration of circadian phase according to the photoperiod of the entraining day/light cycle and the rhythmic antagonism of light responses in the early subjective night. TIC differentially regulates CCA1 and PRR9 from LHY, with LHY expression as a dominant genetic target of TIC action. Also shown to be invoved in the maintenance of Arabidopsis thaliana metabolic homeostasis. |
AT5G20350 | Encodes a protein containing ankyrin and DHHC-CRD domain. Acts to restrict the size of the swelling that forms at the beginning of root hair cell growth, possibly by a mechanism that requires RHD1. Mutant displays defects in both root hair and pollen tube growth. The mRNA is cell-to-cell mobile. |
AT5G44920 | Encodes a KASH domain protein that localizes to the nuclear envelope and affects nuclear morphology. |
AT1G72950 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT4G09420 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT4G23440 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT5G48780 | disease resistance protein (TIR-NBS class);(source:Araport11) |
AT1G66090 | Disease resistance protein (TIR-NBS class);(source:Araport11) |
AT1G72870 | TIR-NBS gene. |
AT1G72890 | NBS TIR protein. |
AT2G27170 | Encodes a member of the Arabidopsis cohesin complex that is essential for viability and sister chromatid alignment. |
AT1G14740 | Encodes a PHD-finger protein that, with TTA1, is redundantly required for MP-dependent embryonic root meristem initiation. |
AT1G14530 | tobamovirus multiplication-like protein (DUF1084);(source:Araport11) |
AT5G16880 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT1G21380 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT1G76970 | Encodes a member of the Arabidopsis TOL (TOM1-LIKE) family of ubiquitin binding proteins that acts redundantly in the recognition and further endocytic sorting of a PIN-FORMED (PIN)-type auxin carrier protein at the plasma membrane, modulating dynamic auxin distribution and associated growth responses. |
AT5G05570 | transducin family protein / WD-40 repeat family protein;(source:Araport11) |
AT3G61380 | Phosphatidylinositol N-acetyglucosaminlytransferase subunit P-like protein;(source:Araport11) |
AT5G43880 | methyl-coenzyme M reductase II subunit gamma, putative (DUF3741);(source:Araport11) |
AT4G25430 | hypothetical protein;(source:Araport11) |
AT2G36420 | nucleolin-like protein;(source:Araport11) |
AT1G18620 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
AT1G74160 | Member of a small gene family in Arabidopsis. Quadruple mutants in this family display defects in cell elongation. |
AT5G26910 | Encodes a member of the TRM superfamily, that plays a role in preprophase band formation during plant cell division and controls the robustness of the orientation of that cell division. |
AT4G00770 | DUF4378 domain protein;(source:Araport11) |
AT4G01470 | Encodes AtTIP1;3, functions as water and urea channels in pollen. |
AT2G25810 | tonoplast intrinsic protein 4;(source:Araport11) |
AT5G46700 | Encodes a transmembrane protein of the tetraspanin (TET) family, one of 17 members found in Arabidopsis. Double mutant analysis showed that TRN1 and TRN2 act in the same pathway. Required for the maintenance of both the radial pattern of tissue differentiation in the root and for the subsequent circumferential pattern within the epidermis. |
AT3G16720 | RING-H2 protein induced after exposure to chitin or inactivated crude cellulase preparations. The mRNA is cell-to-cell mobile. |
AT4G11990 | TPX2-LIKE Group A family with aurora binding andTPX2 domains. Activator of aurora kinase activity. |
AT3G18280 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT2G39675 | Trans-acting siRNA1c primary transcript (TAS1c). Gb: AY922999 |
AT3G17185 | Encodes a trans-acting siRNA (tasi-RNA) that regulates the expression of auxin response factor genes (ARF2, ARF4, ETT). One of 3 genomic loci that encode the TAS3 siRNA. Has been identified as a translated small open reading frame by ribosome profiling. |
AT5G49615 | trans-acting siRNA (tasi-RNA) |
AT2G38560 | Encodes RNA polymerase II transcript elongation factor TFIIS. Complements yeast TFIIS mutation. Mutant plants display essentially normal development, but they flower slightly earlier than the wild type and show clearly reduced seed dormancy. |
AT3G10330 | Cyclin-like family protein;(source:Araport11) |
AT3G23230 | encodes a member of the ERF (ethylene response factor) subfamily B-3 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 18 members in this subfamily including ATERF-1, ATERF-2, AND ATERF-5. |
AT1G10840 | Encodes eukaryotic initiation factor 3H1 subunit (TIF3H1). |
AT4G18270 | Encodes protein similar to similar to bacterial translocase I (mra Y). Expressed during flower bud development. |
AT5G43970 | Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion. |
AT1G06950 | Encodes a protein thought to be a part of the translocon at the chloroplast inner envelope. Involved in protein import into the chloroplast and chloroplast biogenesis. C-terminal half of Tic110 functions as scaffolds for protein-protein interactions. |
AT4G23430 | NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11) |
AT5G16620 | chloroplast protein import (Tic40) |
AT5G05000 | Outer membrane GTPase protein that may function in import of nuclear encoded proteins into the chloroplast. Phosphorylation of the G-domains regulate translocon assembly. |
AT3G17970 | Integral chloroplast outer membrane protein. Belongs to one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT5G09420 | Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones. |
AT1G36060 | encodes a member of the DREB subfamily A-6 of ERF/AP2 transcription factor family. The protein contains one AP2 domain. There are 8 members in this subfamily including RAP2.4.Overexpression results in increased drought tolerance and vitrified leaves. Binds to DRE/GCC promoter elements and activates expression of aquaporin genes AtTIP1;1, AtTIP2;3, and AtPIP2;2. |
AT3G24660 | member of Receptor kinase-like protein family |
AT3G13772 | Encodes an Arabidopsis Transmembrane nine (TMN) protein. Transmembrane nine (TM9) proteins are localized in the secretory pathway of eukaryotic cells and are involved in cell adhesion and phagocytosis. Overexpression of this protein in yeast alters copper and zinc homeostasis. |
AT5G48100 | Encodes a protein that is similar to laccase-like polyphenol oxidases. Involved in lignin and flavonoids biosynthesis. It has four conserved copper binding domains. Expressed in developing testa, where it colocalizes with the flavonoid end products proanthocyanidins and flavonols. Mutant plants exhibited a delay in developmentally determined browning of the testa, characterized by the pale brown color of seed coat. The tt10 mutant seeds accumulate more epicatechin monomers and more soluble proanthocyanidins than wild-type seeds. Flavonol composition was also affected in tt10 seeds, which exhibited a higher ratio of quercetin rhamnoside monomers versus dimers than wild-type seeds. |
AT3G59030 | Encodes a proton antiporter. Involved in the transportation of proanthocyanidin precursors into the vacuole. In vitro transport experiments showed that cyanidin-3-O-glucoside (anthocyanin) was an effective substrate, whereas the proanthocyanidin precursor epicatechin was not transported. However catechin-3-O-glucoside inhibited anthocyanin transport in a dose-dependent manner suggesting that glycosylated epicatechin is the in vivo substrate. Recessive mutation has strong reduction of proanthocyanidin deposition in vacuoles and has reduced dormancy. Expressed in the endothelium of ovules and developing seeds. |
AT5G35550 | TT2 encodes a R2R3 MYB domain putative transcription factor that acts as a key determinant in the proanthocyanidin accumulation of developing seed. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. |
AT5G07990 | Required for flavonoid 3' hydroxylase activity. Enzyme abundance relative to CHS determines Quercetin/Kaempferol metabolite ratio. The mRNA is cell-to-cell mobile. |
AT4G09820 | TT8 is a regulation factor that acts in a concerted action with TT1, PAP1 and TTG1 on the regulation of flavonoid pathways, namely proanthocyanidin and anthocyanin biosynthesis. Affects dihydroflavonol 4-reductase gene expression. It is thought that a ternary complex composed of TT2, TT8 and TTG1 is necessary for correct expression of BAN in seed endothelium. Also important for important for marginal trichome development. It binds the promoter of both AT3G26790 and AT1G28300.TT8 interacts with JAZ proteins to regulate anthocyanin accumulation. TT8 acts maternally to affect seed FA biosynthesis and inhibits seed FA accumulation by down-regulating a group of genes either critical to embryonic development or important in the FA biosynthesis pathway. TT8 represses the activities of LEAFY COTYLEDON1, LEAFY COTYLEDON2, and FUSCA3, the critical transcriptional factors important for seed development. |
AT3G28430 | Encodes a peripheral membrane protein localized at the Golgi apparatus that is involved in membrane trafficking, vacuole development and in flavonoid accumulation in the seed coat. Mutant seed color is pale brown. |
AT3G62980 | Encodes an auxin receptor that mediates auxin-regulated transcription. It contains leucine-rich repeats and an F-box and interacts with ASK1, ASK2 and AtCUL1 to form SCF-TIR1, an SCF ubiquitin ligase complex. Related to yeast Grr1p and human SKP2 proteins, involved in ubiquitin-mediated processes. Required for normal response to auxin and repressed in response to flagellin. As part of the SCF complex and in the presence of auxin, TIR1 interacts with Aux/IAA transcriptional repressor proteins and mediates their degradation. Mutations in TIR1 block auxin stimulation of flavonoid synthesis. |
AT4G24040 | Encodes a trehalase, member of Glycoside Hydrolase Family 37. |
AT1G60140 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain that may or may not be active as well as a trehalose phosphatase (TPP)-like domain. |
AT1G70290 | Encodes an enzyme putatively involved in trehalose biosynthesis. Though the protein has both trehalose-6-phosphate synthase (TPS)-like and trehalose-6-phosphate phosphatase (TPP)-like domains, neither activity has been detected in enzymatic assays nor has the protein been able to complement yeast TPS or TPP mutants. |
AT1G78090 | homologous to the C-terminal part of microbial trehalose-6-phosphate phosphatases |
AT4G22590 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT5G65140 | Haloacid dehalogenase-like hydrolase (HAD) superfamily protein;(source:Araport11) |
AT1G78580 | Encodes an enzyme putatively involved in trehalose biosynthesis. The protein has a trehalose synthase (TPS)-like domain but no trehalose phosphatase (TPP)-like domain. ATTPS1 is able to complement yeast tps1 mutants in vivo. The gene product modulates cell growth but not cell differentiation by determining cell wall deposition and cell division. The N-terminal domain of TPS1 has a nuclear localization signal and an autoinhibitory function. The C-terminal domain is important for catalytic fidality of TPS1 and for appropriate signaling of the sucrose status by trehalose 6-phosphate levels in the plant (10.1105/tpc.19.00837). |
AT3G46590 | Encodes a protein that specifically binds plant telomeric DNA (TTTAGGG)n repeats. Involved in bending DNA. Expressed throughout the plant with highest levels in flowers. |
AT5G03780 | Encodes a protein whose sequence is similar to human telomere proteins. This belongs to TRFL family 2, which do not show DNA binding in vitro. |
AT2G19450 | Encodes Acyl-CoA:diacylglycerol acyltransferase (DGAT) catalyzes the final step of the triacylglycerol synthesis pathway. An insertion mutation in the TAG1 gene results in altered lipid phenotype. Role in senescence and seed development. Its preferred substrate is linolenoyl-CoA (C18:3-CoA). |
AT5G06700 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). A tbr mutant is impaired in its ability to deposit secondary wall cellulose in specific cell types, most notably in trichomes. |
AT3G06080 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G37720 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G60790 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT5G15890 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT2G40150 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11030 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication).The chemical evidence for function comes from xylan NMR analysis. Secondary wall thickening phenotype can be observed only in double or triple mutant combinations with esk1. |
AT1G78710 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G48880 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT3G11570 | Encodes a member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G19835 | TCS1 encodes a coiled-coil domain protein that binds to microtubules and co-localizes with the cortical microtubules. Mutants have defects in trichome branching and hypocotyl elongation. TCS1 interacts with ZWI and appears to be involved in microtubule assembly. |
AT1G27695 | TGD5 encodes a small glycine rich protein that is localized to the chloroplast envelope and is a component of the ER to plastid lipid trafficking pathway. TGD5 interacts with other components of this pathway including TGD1, TGD2, TGD3, and TGD4. |
AT1G45231 | Encodes a trimethylguanosine synthase that is required for chilling tolerance. tgs1 mutant have a striking chilling sensitive phenotype in which leaf and flower development are dramatically disrupted after long-term chilling treatment. |
AT2G21170 | Encodes a plastidic triose phosphate isomerase. Mutants with reduced pdTPI levels have difficulty transitioning from heterotrophic to autotrophic growth. The related phenotypes, such as chlorosis in light-grown seedlings may result from an accumulation of dihydroxyacetone phosphate (DHAP) and methylglyoxal (MG) in these mutants. Both splice variants appear to be expressed, but the At2g21170.2 variant appears to have a much narrower expression range limited to roots. |
AT4G20850 | Tripeptidyl Peptidase II. Ser protease that assembles into a large oligomeric complex containing two proteins of 153 and 142 kD that are derived from a single TPP2 gene, with the smaller version missing part of the C-terminal end. Not essential, based on the lack of phenotype of a T-DNA disruption mutant. |
AT5G53200 | Encodes a R3MYB transcription inhibitor that regulates trichome patterning. Mutants produce trichome clusters whereas other transcriptional inhibitors involved in this patterning are involved in trichome density regulation. Natural hypofunctional alleles producing trichome development in fruits have been found. |
AT1G05830 | Encodes a homolog of trithorax, a histone-lysine N-methyltransferase. Paralog of ATX1. Unlike ATX1 which is involved in trimethylating of histone H3-mysine 4, ATX2 is involved in dimethylating of histone H3-lysine 4. ATX1 and ATX2 influence the expression of largely nonoverlapping gene sets. The expression pattern of ATX2 is also different from that of ATX1. |
AT1G68720 | Encodes the chloroplastic A-to-I tRNA editing enzyme. |
AT1G78190 | Trm112p-like protein;(source:Araport11) |
AT3G21300 | RNA methyltransferase family protein;(source:Araport11) |
AT4G04670 | Met-10+ like family protein / kelch repeat-containing protein;(source:Araport11) |
AT1G52160 | Encodes a tRNase Z. |
AT2G43510 | Member of the defensin-like (DEFL) family. Encodes putative trypsin inhibitor protein which may function in defense against herbivory. |
AT4G24670 | Encodes a protein with similarity to the TAA1 trytophan aminotransferase involved in IAA biosynthesis. Double mutant analyses suggest that this protein is involved in regulating many aspects of plant growth and development from embryogenesis to flower formation and plays a role in ethylene-mediated signaling.TAR2 is required for reprogramming root architecture in response to low nitrogen conditions. |
AT5G38530 | TSBtype2 encodes a type 2 tryptophan synthase beta subunit that catalyzes a condensation reaction between serine and indole to generate tryptophan.It appears to form a homodimer. Its biological role has not yet been determined, but it has a very high affinity for indole which may be involved in allowing TSBtype2 to carefully limit free indole build-up. But, to date no overall change in plant morphology or seedling root growth have been observed in tsbtype2 mutants, indicating that this gene is not essential under optimum conditions. n most organs, TSBtype2 is transcripts are expressed at a lower level than TSB1 but in dry seeds they are expressed at comparable levels. |
AT2G36960 | Arabidopsis thaliana myb/SANT domain protein |
AT1G76900 | Member of plant TLP family. Contains terminal F-box domain, interacts with ASK proteins. Tethered to the PM. |
AT1G25280 | Member of TLP family |
AT1G61940 | Member of TLP family |
AT1G53320 | Member of plant TLP family. TLP7 is tethered to the PM but detaches upon stimulus and translocates to the nucleus. Has DNA binding activity but lacks conservation of the transcription activation domain. |
AT3G06380 | Member of plant TLP family which differs in having an F box domain. Interacts with ASK proteins.Plasma membrane tethering is mediated by PIP2 binding domain. Mutants are insensitive to ABA. May act redundantly with its paralog TPL3. |
AT1G04820 | Encodes an alpha tubulin isoform that is expressed in roots, leaves and flowers. |
AT5G07350 | RNA binding protein with nuclease activity essential for stress response. Involved in mechanisms acting on mRNAs entering the secretory pathway. Functionally redundant with TSN2. |
AT1G78240 | Encodes TSD2 (TUMOROUS SHOOT DEVELOPMENT2), a putative methyltransferase with an essential role in cell adhesion, anthocyanin accumulation, and coordinated plant development. |
AT1G14610 | Required for proper proliferation of basal cells. |
AT3G02140 | Encodes a protein that acts in the nucleus and is an important negative regulator of ABA and salt stress responses, and could play a critical role in controlling root elongation, floral initiation and starch degradation. |
AT4G03560 | Encodes a depolarization-activated Ca(2+) channel. Anti-sense experiments with this gene as well as Sucrose-H(+) symporters and complementation of yeast sucrose uptake mutant cch1 suggest that this protein mediates a voltage-activated Ca(2+ )influx. Mutants lack detectable SV channel activity suggesting TPC1 is essential component of the SV channel. Patch clamp analysis of loss of function mutation indicates TPC1 does not affect Ca2+ signaling in response to abiotic and biotic stress. |
AT3G62260 | Type 2C protein phosphatase (PP2C) which negatively regulates AtHKT1;1 activity and thus determines systemic Na+ allocation during salt stress. |
AT2G29400 | Type 1 protein phosphatase, expressed in roots, rosettes and flowers |
AT3G05580 | Encodes a Type One Protein Phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. Mutants affect pollen germination, pollen tube growth, and root hair growth. It acts genetically downstream of ANX1 (AT3G04690) and ANX2 (AT5G28680) and is functionally redundant with TOPP8 (AT5G27840). |
AT1G08030 | Encodes a tyrosylprotein sulfotransferase (TPST). This protein is a 500-aa type I transmembrane protein that shows no sequence similarity to animal TPSTs. Activity confirmed by protein expression in yeast. TPST is expressed throughout the plant body, and the highest levels of expression are in the root apical meristem. TPST acts in the auxin pathway to maintain postembryonic root stem cell niche by defining the expression of the PLETHORA stem cell transcription factor genes. A loss-of-function mutant TPST displayed a marked dwarf phenotype accompanied by stunted roots, pale green leaves, reduction in higher order veins, early senescence, and a reduced number of flowers and siliques. TPST suppresses ethylene production through the action of PSK (phytosulfokine). |
AT3G49810 | Encodes a protein with E3 ubiquitin ligase activity that is involved in negative regulation of salt stress tolerance during germination. |
AT3G57645 | U2-2;(source:Araport11) |
AT5G09585 | U2;(source:Araport11) |
AT3G14735 | U6;(source:Araport11) |
AT3G06910 | Encodes a deSUMOylating enzyme. In vitro it has both peptidase activity and isopeptidase activity: it can cleave the C-terminal residues from SUMO to activate it for attachment to a target protein and it can also act on the isopeptide bond between SUMO and another protein. In vitro assays suggest that this enzyme is active against SUMO1 and SUMO2. It has weak activity with SUMO3 and cannot act on SUMO5. The N-terminal regulatory region of this protein is required for full activity. Suppresses growth during salt stress. |
AT5G06460 | Encodes a ubiquitin-activating enzyme (E1), involved in the first step in conjugating multiple ubiquitins to proteins targeted for degradation. Gene is expressed in most tissues examined. The mRNA is cell-to-cell mobile. |
AT3G17205 | ubiquitin protein ligase 6;(source:Araport11) |
AT5G53300 | Encodes a ubiquitin conjugating enzyme. |
AT1G50490 | Encodes one of two ubiquitin-conjugating enzymes belonging to the E2-C gene family (the other being UBC19). Transcript is always found in diving cells, but also in other non-dividing cells. |
AT3G15355 | ubiquitin-conjugating enzyme 25;(source:Araport11) |
AT1G53020 | Cognate nuclear E2 enzyme that interacts with the RFA4 E3 ligase and forms UBC26-RFA4-Receptor complexes in nuclear speckles. |
AT5G50430 | ubiquitin-conjugating enzyme 33;(source:Araport11) |
AT1G63800 | ubiquitin-conjugating enzyme 5;(source:Araport11) |
AT3G45180 | Ubiquitin like protein that appears to play a role in pre-mRNA splicing. |
AT2G32780 | ubiquitin-specific protease 1;(source:Araport11) |
AT1G32850 | ubiquitin-specific protease 11;(source:Araport11) |
AT1G17110 | Encodes a ubiquitin-specific protease, and its activity has been confirmed in an in vitro assay. ubp15 mutants have defects in cell proliferation, and the associated processes of leaf, root, stem, flower, and silique development. UBP15 can be found in the nucleus and cytoplasm in transient assays. Though UBP15 is expressed in many tissues, UBP15 transcript levels are higher in rosette leaves and inflorescences than in other parts of the plant. Together with CUC2/CUC3-DA1 part of a regulatory module controls the initiation of axillary meristems, thereby determining plant architecture. As a direct substrate of DA1 peptidase, it represses the initiation of axillary meristems. |
AT4G24560 | Encodes a ubiquitin-specific protease. There is no evidence for a phenotype in ubp16-1 mutants, however, double mutant analysis with ubp15 mutants reveals a role for UBP16 in plant development and cell proliferation. |
AT5G46740 | Encodes a ubiquitin-specific protease. |
AT2G22310 | Encodes a ubiquitin-specific protease. |
AT2G44790 | Encodes a uclacyanin, a protein precursor that is closely related to precursors of stellacyanins and a blue copper protein from pea pods. |
AT3G60280 | Encodes blue copper-binding protein III. |
AT5G03490 | Encodes a dihydroxybenzoic acid (DHBA) glycosyltransferase. The Col-0 enzyme is responsible for biosynthesis of 2,3-DHBA xyloside and 2,5-DHBA xyloside. The Col-0 enzyme is specific for UDP-xylose and the C24 enzyme uses both UDP-glucose and UDP-xylose. This difference in sugar donor specificity was shown to be largely due to a single amino acid change between the two isoforms. |
AT1G63180 | Encodes a protein with UDP-D-glucose 4-epimerase activity. Involved in pollen development. |
AT4G30440 | Encodes a UDP-D-glucuronate 4-epimerase involved in pectin biosynthesis in the cell wall and affects cell wall integrity and immunity to fungi and bacteria. |
AT3G11340 | Encodes a uridine diphosphate-dependent glucosyltransferase that conjugates isoleucic acid and modulates plant defense via glucosylation of N-hydroxypipecolic acid. |
AT4G23010 | UDP-galactose transporter 2;(source:Araport11) |
AT1G14360 | UDP-galactose transporter 3;(source:Araport11) |
AT4G31600 | Encodes a Golgi-localized UDP?glucose/UDP?galactose transporter that affects lateral root emergence. |
AT3G29360 | Encodes one of four UDP-glucose dehydrogenase UGD) genes. Mutation of this gene in combination with UGD3 leads to swollen plant cell walls and severe developmental defects associated with changes in pectic polysaccharides. |
AT3G03250 | Is thought to encode a cytosolic UDP-glucose pyrophosphorylase with strong similarity to potato UTP--glucose-1-phosphate uridylyltransferase. Downregulated by flooding. |
AT5G17310 | UDP-glucose pyrophosphorylase 2;(source:Araport11) |
AT4G15280 | UDP-glucosyl transferase 71B5;(source:Araport11) |
AT2G29750 | UDP-glucosyl transferase 71C1;(source:Araport11) |
AT2G29730 | UDP-glucosyl transferase 71D1;(source:Araport11) |
AT1G01420 | Phosphatidylinositol 4-phosphate 5-kinase (PIP5K) enzyme family member. |
AT3G50740 | UGT72E1 is an UDPG:coniferyl alcohol glucosyltransferase which specifically glucosylates sinapyl- and coniferyl aldehydes. The enzyme is thought to be involved in lignin metabolism. |
AT2G15480 | UDP-glucosyl transferase 73B5;(source:Araport11) |
AT2G26480 | UDP-glucosyl transferase 76D1;(source:Araport11) |
AT5G59590 | UDP-glucosyl transferase 76E2;(source:Araport11) |
AT5G17050 | The At5g17050 encodes a anthocyanidin 3-O-glucosyltransferase which specifically glucosylates the 3-position of the flavonoid C-ring. Anthocyanidins such as cyanidin and pelargonidin as well as flavonols such as kaempferol and quercetin are accepted substrates. |
AT3G21560 | Encodes a protein with sinapic acid:UDP-glucose glucosyltransferase activity. Mutants defective in this gene are hyper-fluorescent (which accumulate in their trichomes a compound that is likely to be 3',5'-dimethoxynaringenin chalcone or sinapoyltriacetic acid lactone, potential products of the concerted action of 4-coumarate CoA ligase and chalcone synthase on sinapic acid). Also shown to be required for Arabidopsis nonhost resistance to the Asian soybean rust pathogen Phakopsora pachyrhizi. |
AT1G22360 | UDP-glucosyl transferase 85A2;(source:Araport11) |
AT2G43820 | Encodes a nicotinate-O-glycosyltransferase. Induced by Salicylic acid, virus, fungus and bacteria. Also involved in the tryptophan synthesis pathway. Independent of NPR1 for their induction by salicylic acid. UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside (SAG) and a glucose ester (SGE)), benzoic acid, and anthranilate in vitro. UGT74F2 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. |
AT1G05560 | A UDP-glucose transferase localized in the phragmoplast. It has been co-purified with the callose synthase complex and may transfer UDP-glucose from sucrose synthase to the callose synthase and thus help form a substrate channel for the synthesis of callose at the forming cell plate. Induced by salicylic acid. Independent of NPR1 for their induction by salicylic acid. UGT1 encodes a protein with glucosyltransferase activity with high sequence homology to UGT2 (AT1G05530). It belongs to an UGT subfamily that binds UDP-glucose but not UDP-glucuronate, UDP-galactose, or UDP-rhamnose as the glycosyl donor. UGT1 was shown to be able to use abscisic acid as glycosylation substrate in the presence of UDP-glucose. UGT1/UGT75B1 catalyzes the formation of the p-aminobenzoate-glucose ester in vitro and in vivo. It appears to be the enzyme predominantly responsible for pABA-Glc formation in Arabidopsis based on assays in leaves, flowers, and siliques. |
AT2G43840 | UGT74F1 transfers UDP:glucose to salicylic acid (forming a glucoside), benzoic acid, quercetin, and athranilate in vitro. UGT74F1 shows a weak ability to catalyze the formation of the p-aminobenzoate-glucose ester in vitro. But, UGT75B1 appears to be the dominant pABA acylglucosyltransferase in vivo based on assays in leaves, flowers, and siliques. The true biological substrate(s) of UGT74F1 are not known, but mutant plants lacking UGT74F1 have a decreased level of salicylate glucoside. |
AT3G55700 | UDP-Glycosyltransferase superfamily protein;(source:Araport11) |
AT5G42420 | Nucleotide-sugar transporter family protein;(source:Araport11) |
AT3G46440 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT2G28760 | Encodes a cytosolic isoform of UDP-glucuronic acid decarboxylase. |
AT2G47650 | Encodes a Golgi localized isoform of UDP-glucuronic acid decarboxylase. UDP-glucuronic acid decarboxylase produces UDP-xylose, which is a substrate for many cell wall carbohydrates including hemicellulose and pectin. UDP-xylose is also known to feedback regulate several cell wall biosynthetic enzymes. |
AT4G02500 | Encodes a protein with xylosyltransferase activity, which is specific for UDP-xylose as donor substrate and for oligosaccharides with a degree of polymerization >4. Although the enzyme utilizes either cellopentaose or cellohexaose, its activity is four-fold higher with cellohexaose as an acceptor compared to cellopentaose. The enzyme is able to add several xylosyl residues to the acceptor forming mono-, di- and trixylosylated polysaccharides. The mRNA is cell-to-cell mobile. |
AT4G37180 | UIF1 is a nuclear and cytoplasmically localized myb-domain containing member of the GARP G2-like subfamily of transcription factors. Interacts with ULT1 and binds to the WUS promoter. UIF1 binding domains are also found in CUC and AG promoters suggesting they are also direct targets. This locus was also identified as a putative cytoskeletal protein in a yeast screen. |
AT5G41150 | Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins |
AT3G28030 | Required for repair of pyrimidine-pyrimidinone (6-4) dimers. The mRNA is cell-to-cell mobile. |
AT2G22500 | Encodes one of the mitochondrial dicarboxylate carriers (DIC): DIC1 (AT2G22500), DIC2 (AT4G24570), DIC3 (AT5G09470). |
AT1G33430 | UPEX1 is arabinogalactan b-(1,3)-galactosyltransferase involved in the formation of pollen exine. Belongs to GT31 family. Mutants have reduced levels of AGPs. GALT8 has some but not complete functional overlap with KNS4/UPEX1. |
AT3G20830 | AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein;(source:Araport11) |
AT1G49320 | Encodes USPL1, a BURP domain protein targeted to the protein storage vacuoles. Overexpression of USPL1 affects seed development, protein storage vacuoles and lipid vesicles morphology and function. |
AT2G20100 | Together with PFA1 and PFA3 governs the competence of pericycle cells to initiate lateral root primordium formation. |
AT5G43580 | Predicted to encode a PR (pathogenesis-related) peptide that belongs to the PR-6 proteinase inhibitor family. Functions in resistance to necrotrophic fungi and insect herbivory. Six putative PR-6-type protein encoding genes are found in Arabidopsis: At2g38900, At2g38870, At5g43570, At5g43580, At3g50020 and At3g46860. |
AT2G47270 | Encodes UPBEAT1 (UPB1), a transcription factor with a bHLH domain. Regulates the expression of a set of peroxidases that modulate the balance of reactive oxygen species (ROS) between the zones of cell proliferation and the zone of cell elongation where differentiation begins. Disruption of UPB1 activity alters this ROS balance, leading to a delay in the onset of differentiation. Regulates growth by mediating cell cycle progression. |
AT2G26230 | Encodes a urate oxidase that is involved in peroxisome maintenance. |
AT2G35035 | Encodes a urease accessory protein which is essential for the activation of plant urease. |
AT2G03590 | Encodes a member of a class of allantoin transporters. |
AT2G03600 | Encodes UPS3 (ureide permease 3), similar to UPS1, an allantoin transporter. |
AT1G26440 | Encodes a ureide permease, uptake assays in yeast mutants indicated the longer splice variant is a cellular importer for allantoin, uracil and xanthine. Encodes 2 splice variants, UPS5L and UPS5S, which under nonstress conditions may function in allantoin degradation for nutrient recycling, whereas under stress, both genes may be involved in vesicular export allowing allantoin translocation from roots to shoots. |
AT2G36310 | Encodes a cytoplasmic nucleoside hydrolase. It has the highest levels of activity with uridine followed by xanthosine. It shows little activity with inosine and none with cytidine. Mutant analyses indicate that it plays a role in purine and pyrimidine catabolism. |
AT3G56620 | nodulin MtN21-like transporter family protein |
AT2G37450 | nodulin MtN21-like transporter family protein |
AT1G25270 | nodulin MtN21-like transporter family protein |
AT1G60050 | nodulin MtN21-like transporter family protein |
AT5G40230 | nodulin MtN21-like transporter family protein |
AT5G40212 | Pseudogene of AT5G40240; nodulin MtN21 family protein |
AT5G40210 | nodulin MtN21-like transporter family protein |
AT3G28100 | nodulin MtN21-like transporter family protein The mRNA is cell-to-cell mobile. |
AT3G28070 | nodulin MtN21-like transporter family protein |
AT3G15620 | Required for photorepair of 6-4 photoproducts in Arabidopsis thaliana. |
AT5G63860 | UV-B-specific signaling component that orchestrates expression of a range of genes with vital UV-protective functions. Located in the nucleus and the cytosol. Associates with chromatin via histones. UV-B light promotes URV8 protein accumulation in the nucleus. UVR8 interaction with COP1 is negatively regulated by RUP1 and RUP2. |
AT1G78900 | Encodes catalytic subunit A of the vacuolar ATP synthase. Mutants are devoid of vacuolar ATPase activity as subunit A is encoded only by this gene and show strong defects in male gametophyte development and in Golgi stack morphology. The mRNA is cell-to-cell mobile. |
AT1G75630 | vacuolar H+-pumping ATPase 16 kD proteolipid (ava-p) mRNA, The mRNA is cell-to-cell mobile. |
AT1G62660 | Glycosyl hydrolases family 32 protein;(source:Araport11) |
AT1G76800 | The gene encodes nodulin-like2 whose transcript abundance was repressed under conditions of Fe-deficient growth. |
AT3G01390 | Subunit G of the vacuolar membrane ATPAse complex |
AT5G53530 | Homolog of yeast retromer subunit VPS26. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
AT3G61770 | Acid phosphatase/vanadium-dependent haloperoxidase-related protein;(source:Araport11) |
AT1G08190 | Might be involved in protein sorting to the vacuole. The mRNA is cell-to-cell mobile. |
AT2G28520 | Vacuolar proton ATPase subunit VHA-a isoform 1. Localized in the trans-Golgi network. The mRNA is cell-to-cell mobile. |
AT2G21410 | Vacuolar proton ATPase subunit VHA-a isoform 2. Localized in the tonoplast. Required for efficient nutrient storage but not for sodium accumulation. |
AT4G39080 | Vacuolar proton ATPase subunit VHA-a isoform 3. Localized in the tonoplast. The mRNA is cell-to-cell mobile. |
AT2G32760 | Homolog of yeast VPS38P. Interacts with PI3K.Mutants have defects in late endosome morphology and retromer function. |
AT2G34940 | VACUOLAR SORTING RECEPTOR 5;(source:Araport11) |
AT1G30900 | VACUOLAR SORTING RECEPTOR 6;(source:Araport11) |
AT4G20110 | VACUOLAR SORTING RECEPTOR 7;(source:Araport11) |
AT2G38020 | necessary for proper vacuole formation and morphogenesis in Arabidopsis |
AT2G17740 | VACUOLELESS GAMETOPHYTES (VLG) as a DC1 domain containing protein that is found in the endomembrane system. It is essential for both female and male gametophyte development. |
AT5G16290 | Encodes a regulatory subunit of acetohydroxy acid synthase (AHAS), the first committed enzyme in the branched chain amino acid biosynthesis pathway. |
AT3G60600 | Encodes VAP27 (for Vesicle-Associated Protein). VAP27 has high homology to the VAP33 family of SNARE-like proteins from animals. May be involved in vesicular transport to or from the ER. Located exclusively in limiting membrane of protein storage vacuoles. Binds SRC2. |
AT5G46510 | Disease resistance protein (TIR-NBS-LRR class) family;(source:Araport11) |
AT1G71930 | Encodes a NAC-domain transcription factor with transcriptional activation activity that is involved in xylem formation. Induces transdifferentiation of various cells into protoxylem vessel elements. Located in the nucleus. Expression induced in the presence of auxin, cytokinin and brassinosteroids. |
AT5G54790 | CTD small phosphatase-like protein;(source:Araport11) |
AT5G24780 | encodes an acid phosphatase similar to soybean vegetative storage proteins. Gene expression is induced by wounding and jasmonic acid. |
AT4G29260 | VSP3 is a secreted acid phosphatase. |
AT5G40270 | VEN4 is homologous to human SAMHD1 and functions in chloroplast biogenesis. |
AT3G24440 | Encodes Vernalization Insensitive 3-like 1 (VIL1). VIL1 is involved in the photoperiod and vernalization of Arabidopsis by regulating expression of the related floral repressors Flowering Locus C (FLC) and Flowering Locus M (FLM). VIL1, along with VIN3 (Vernalization Insensitive 3) is necessary for the chromatin modification to FLC and FLM. |
AT4G29830 | VIP3 protein is composed of repeats of WD motif which is involved in protein complex formation. The gene is involved in flower timing and flower development. This gene is predicted to encode a protein with a DWD motif. It can bind to DDB1a in Y2H assays, and DDB1b in co-IP assays, and may be involved in the formation of a CUL4-based E3 ubiquitin ligase. Loss of gene function leads to a redistribution of H3K4me3 and K3K36me2 modifications within genes but not a change in the overall abundance of these modifications within chromatin. Also known as SKI8, a component of the SKI complex involved in exosome mediated RNA degredation. Member of PAF-C complex. |
AT5G61150 | Encodes highly hydrophilic protein involved in positively regulating FLC expression. Mutants are early flowering and show a loss of FLC expression in the absence of cold. Member of PAF-C complex. |
AT4G30200 | Encodes a protein with similarity to VRN5 and VIN3.Contains both a fibronectin III and PHD finger domain. VEL1 is a part of a polycomb repressive complex (PRC2) that is involved in epigenetic silencing of the FLC flowering locus. |
AT1G77580 | filament-like protein (DUF869);(source:Araport11) |
AT4G32150 | AtVAMP711 is a member of Synaptobrevin-like AtVAMP7C, v-SNARE (soluble N-ethyl-maleimide sensitive factor attachment protein receptors) protein family. SNAREs have been divided into four subgroups: Qa-, Qb-, Qc- and R-SNAREs. R-SNAREs are classified into three groups, the Sec22-, YKT6- and VAMP7-like R-SNAREs. One R-SNARE and three Q-SNAREs (one of each subgroup) form the trans-SNARE complex, which governs specific membrane fusions. VAMP7 proteins consist of three distinct domain, the N-terminal longin-domain (LD), the SNARE motif (SNM) and a transmembrane domain. In spite of the high similarities among the VAMP7 proteins, they show different subcellular localizations. VAMP7C is vacuolar-localized and its LD is essential for the correct localization. Generally, it is suggested that the complete LD is the determinant of subcellular sorting in both animal and plant R-SNAREs. |
AT2G33110 | member of VAMP72 Gene Family |
AT2G32670 | member of Synaptobrevin -like protein family |
AT3G54300 | Encodes a member of Synaptobrevin -like protein family. VAMP727 is a R-SNARE and interacts with SYP22/VTI11/SYP51. It is required for trafficking of storage proteins to the protein storage vacuoles (PSV) and also for PSV organization and biogenesis. Loss of function mutations have no phenotype but double mutants with SYP22 are embryo lethal. |
AT1G14000 | Encodes a protein with similarity to members of the C1 subgroup of MAP kinase kinase kinases. Interacts physically with the receptor kinase BRL2/VH1 and appears to be involved in auxin and brassinosteriod signaling. The mRNA is cell-to-cell mobile. |
AT3G50080 | Encodes an F-box protein. Based on genetic analysis appears to be functionally redundant with VFB1,3, and 4. When expression of all 4 genes is reduced plants show defects in growth and reduced expression of auxin response genes. |
AT5G55120 | Encodes a GDP-L-galactose phosphorylase, with similar biochemical properties as VTC2. |
AT3G01280 | Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol. The mRNA is cell-to-cell mobile. |
AT1G75850 | VPS35 homolog B;(source:Araport11) |
AT3G51310 | Homolog of yeast retromer subunit VPS35. Part of a retromer-like protein complex involved in endosome to lysosome protein transport. |
AT4G37710 | VQ motif-containing protein;(source:Araport11) |
AT1G78310 | VQ motif-containing protein;(source:Araport11) |
AT2G44340 | VQ18 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ26, it is involved in negative regulation of ABA responses during early seedling development. |
AT3G60090 | VQ26 is an ABA responsive gene and interacts with the ABI5 transcription factor. Along with its paralog VQ18, it is involved in negative regulation of ABA responses during early seedling development. |
AT1G53700 | The WAG1 and its homolog, WAG2 each encodes a protein-serine/threonine kinase that are nearly 70% identical to PsPK3 protein. All three together with CsPK3 belong to PsPK3-type kinases. At the N-terminus, all four possess a serine/threonine-rich domain. They are closely related to Arabidopsis kinases PINOID. wag1/wag2 double mutants exhibit a pronounced wavy root phenotype when grown vertically on agar plates (while wild-type plants develop wavy roots only on plates inclined to angles less than 90 degrees), indicating an overlapping role for WAG1 and WAG2 as suppressors of root waving. Simultaneous disruption of PID(AT2G34650) and its 3 closest homologs (PID2/AT2G26700, WAG1/AT1G53700, and WAG2/AT3G14370) abolishes the formation of cotyledons. |
AT1G79680 | Encodes a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that is critically dependent on the second messenger cGMP. |
AT1G16120 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16130 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. |
AT1G16150 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. Likely involved in Arabidopsis root mineral responses to Zn2+, Cu2+, K+, Na+ and Ni+. The mRNA is cell-to-cell mobile. |
AT1G16160 | WAK-like kinase The mRNA is cell-to-cell mobile. |
AT1G16110 | Encodes a WAK-like receptor-like kinase with a cytoplasmic Ser/Thr protein kinase domain and an extracellular domain with EGF-like repeats. It has been shown to be localized to the cell wall. |
AT1G21270 | cytoplasmic serine/threonine protein kinase induced by salicylic acid. mutant plants exhibit a loss of cell expansion and dependence on sugars and salts for seedling growth, affecting the expression and activity of vacuolar invertase. |
AT1G75500 | An Arabidopsis thaliana homolog of Medicago truncatula NODULIN21 (MtN21). The gene encodes a plant-specific, predicted integral membrane protein and is a member of the Plant-Drug/Metabolite Exporter (P-DME) family (Transporter Classification number: TC 2.A.7.3) and the nodulin MtN21-like transporter family. |
AT5G65683 | Zinc finger (C3HC4-type RING finger) family protein;(source:Araport11) |
AT3G23090 | Member of the microtubule regulatory protein WVD2/WDL family WDL3 stabilizes cortical microtubules and is involved in light induced hypocotyl elongation. WDL3 is ubiquinated by COP1, leading to its degadation in the dark, |
AT5G06690 | Encodes a thioredoxin (WCRKC1) localized in chloroplast stroma. Contains a WCRKC motif. Functions in redox cascade with 2CPA and 2CPB via the ferredoxin-thioredoxin reductase (FTR)/thioredoxin (Trx) pathway to mediate the light-responsive reductive control of target proteins. Oxidizes redox-regulated proteins. |
AT3G07760 | Ortholog of Peach WEEP gene containing a sterile alpha motif. In peach, WEEP is responsible for pendulous branching phenotype. However in Arabidopsis no morphological branching defect has been observed in mutant lines. |
AT1G56510 | TIR-NB-LRR protein that confers resistance to four races of Albugo candida. The mRNA is cell-to-cell mobile. |
AT5G53080 | WTG1 is a chloroplast localized TPR protein required for chloroplast biogenesis. Mutants are delayed in greening and defective in splicing petL and ndhG. WTG1 does not itself bind RNA but it does bind known editing factors MORF8 and MORF9. |
AT2G41420 | proline-rich family protein;(source:Araport11) |
AT3G49845 | cysteine-rich TM module stress tolerance protein;(source:Araport11) |
AT1G11060 | Encodes one of two redundant proteins (the other is WAPL2) that are involved in prophase removal of cohesion during meiosis. Double mutants with wapl2 exhibit reduced fertility due to defects in meiosis and also some abnormal embryo development in rare cases where embryos are formed. |
AT1G08290 | WIP domain protein 3;(source:Araport11) |
AT3G20880 | WIP4 is a paralog of NTT and along with WIP5,acts redundantly in cell fate determination during primary root development. MP binds to AuxRE motifs within the WIP4 gene and likely regulates its expression. |
AT2G34150 | Encodes a member of the SCAR family.These proteins are part of a complex (WAVE) complex.The SCAR subunit activates the ARP2/3 complex which in turn act as a nucleator for actin filaments. |
AT3G22420 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
AT3G48260 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. |
AT5G58350 | Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Its transcription is under the control of circadian rhythms. |
AT3G55770 | Encodes a member of the Arabidopsis LIM proteins: a family of actin bundlers with distinct expression patterns. WLIM1, WLIM2a, and WLIM2b are widely expressed, whereas PLIM2a, PLIM2b, and PLIM2c are predominantly expressed in pollen. Regulates actin cytoskeleton organization. |
AT2G01830 | Histidine kinase: cytokinin-binding receptor that transduces cytokinin signals across the plasma membrane |
AT5G50200 | Wound-responsive gene 3 (WR3). Encodes a high-affinity nitrate transporter. Up-regulated by nitrate. Involved in jasmonic acid-independent wound signal transduction. |
AT4G26455 | Encodes an outer nuclear membrane protein that anchors RanGAP1 to the nuclear envelope. It interacts with SUN proteins and is required for maintaining the elongated nuclear shape of epidermal cells. |
AT5G11390 | Encodes one of the WPP domain-interacting proteins (WIT1/AT5G11390, WIT2/AT1G68910) required for RanGAP nuclear envelope association in root tip cells. Ran GTPase plays essential roles in multiple cellular processes, including nucleocytoplasmic transport, spindle formation, and postmitotic nuclear envelope reassembly. The cytoplasmic Ran GTPase activating protein RanGAP is critical to establish a functional RanGTP/RanGDP gradient across the nuclear envelope and is associated with the outer surface of the nuclear envelope in metazoan and higher plant cells. Arabidopsis thaliana RanGAP association with the root tip nuclear envelope requires a family of likely plant-specific nucleoporins combining coiled-coil and transmembrane domains (CC-TMD) and WPP domain-interacting proteins (WIPs). WIT1 and WIT2 have been identified as a second family of CC-TMD proteins, structurally similar, yet clearly distinct from the WIP family, that is required for RanGAP nuclear envelop association in root tip cells. |
AT4G31550 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT1G30650 | member of WRKY Transcription Factor; Group II-e |
AT2G23320 | Encodes WRKY DNA-binding protein 15 (WRKY15). |
AT2G24570 | member of WRKY Transcription Factor; Group II-d; negative regulator of basal resistance to Pseudomonas syringae. |
AT2G47260 | Encodes a member of WRKY Transcription Factor; Group I. Involved in nematode feeding site establishment and auxin mediated PIN polar localization in roots. Expression is induced by auxin. |
AT5G07100 | Encodes WRKY DNA-binding protein 26 (WRKY26). |
AT5G52830 | Encodes a WRKY transcription factor WRKY27. Mutation in Arabidopsis WRKY27 results in delayed symptom development in response to the bacterial wilt pathogen Ralstonia solanacearum. |
AT2G03340 | Encodes WRKY DNA-binding protein 3 (WRKY3). |
AT5G24110 | member of WRKY Transcription Factor; Group III |
AT4G22070 | member of WRKY Transcription Factor; Group II-b |
AT2G38470 | Member of the plant WRKY transcription factor family. Regulates the antagonistic relationship between defense pathways mediating responses to P. syringae and necrotrophic fungal pathogens. Located in nucleus. Involved in response to various abiotic stresses - especially salt stress. Regulates cytochrome P450 gene CYP94B1 to control apoplastic barrier formation in roots to confer salt tolerance. |
AT2G34830 | member of WRKY Transcription Factor; Group II-e |
AT1G69810 | member of WRKY Transcription Factor; Group II-b |
AT1G13960 | Encodes WRKY DNA-binding protein 4 (WRKY4). |
AT1G80840 | Pathogen-induced transcription factor. Binds W-box sequences in vitro. Forms protein complexes with itself and with WRKY40 and WRKY60. Coexpression with WRKY18 or WRKY60 made plants more susceptible to both P. syringae and B. cinerea. WRKY18, WRKY40, and WRKY60 have partially redundant roles in response to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea, with WRKY18 playing a more important role than the other two. The mRNA is cell-to-cell mobile. |
AT5G49520 | Encodes WRKY48, a member of the WRKY Transcription Factor. WRKY48 is a stress- and pathogen-induced transcriptional activator that represses plant basal defense. The mRNA is cell-to-cell mobile. |
AT5G43290 | member of WRKY Transcription Factor; Group II-c |
AT5G26170 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
AT5G64810 | member of WRKY Transcription Factor; Group II-c. Involved in jasmonic acid inducible defense responses. |
AT2G40750 | member of WRKY Transcription Factor; Group III. Together with WRKY70 positively regulates SARD1 and CBP60g expression in plant immunity. |
AT2G40740 | member of WRKY Transcription Factor; Group III |
AT3G01080 | member of WRKY Transcription Factor; Group I |
AT4G24240 | Encodes a Ca-dependent calmodulin binding protein. Sequence similarity to the WRKY transcription factor gene family. |
AT1G29860 | member of WRKY Transcription Factor; Group II-c |
AT5G15130 | member of WRKY Transcription Factor; Group II-b; contribute to basal immunity. The mRNA is cell-to-cell mobile. |
AT5G13080 | WRKY75 is one of several transcription factors induced during Pi deprivation. It is nuclear localized and regulated differentially during Pi starvation. RNAi mediated suppression of WRKY75 made the plants more susceptible to Pi stress as indicated by the higher accumulation of anthocyanin during Pi starvation. |
AT5G46350 | member of WRKY Transcription Factor; Group II-c |
AT1G68150 | member of WRKY Transcription Factor; Group II-b The mRNA is cell-to-cell mobile. |
AT3G49210 | WSD6 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
AT5G12420 | WSD7 can function in vitro as wax ester synthase but does not appear to be essential for cuticular wax biosynthesis. |
AT3G18010 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Its mRNA is expressed in the initiating vascular primordium of the cotyledons during heart and torpedo stages. |
AT1G20710 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT4G35550 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. WOX13 is the only family member that does not contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT1G20700 | Encodes WOX14, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. Functions in the shoot meristem organizing center to maintain the stem cells in an undifferentiated state. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
AT1G46480 | Encodes WOX4, a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. This protein also contains an acidic domain approximately 10 residues upstream of the WUS box. Part of the TDIF-TDR-WOX4 signaling pathway that plays a crucial role in the maintenance of the vascular meristem organization during secondary growth. WOX4 and WOX14 act downstream of the PXY receptor kinase to regulate plant vascular proliferation independently of any role in vascular organisation. |
AT5G05770 | Encodes a WUSCHEL-related homeobox gene family member with 65 amino acids in its homeodomain. Proteins in this family contain a sequence of eight residues (TLPLFPMH) downstream of the homeodomain called the WUS box. |
AT5G48720 | Encodes XRI1 (X-ray induced 1). Required for post-meiotic stages of pollen development and male and female meiosis. Maybe required for meiotic DNA repair. Inducible by X-ray. Homozygous xri1 mutants are sterile due to extensive chromosome fragmentation. |
AT4G34890 | Encodes a xanthine dehydrogenase, involved in purine catabolism. Ubiquitously expressed, but the transcript level is altered during aging, senescence, salt and cold stress, ABA treatment, and dark treatment. RNAi lines that suppress both XDH1 and XDH2 produce small plants with reduced fertility and accelerated leaf senescence. Role in drought tolerance. |
AT2G28840 | Putative E3 Ub protein ligase; regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3. |
AT4G14365 | hypothetical protein;(source:Araport11) |
AT1G15470 | WD40 nucleoplasmic shuttling protein that positively regulates the Abscisic acid (ABA) response by interacting with and maintaining the stability of ABI5 in the nucleus. Nuclear export of XIW1 is XPO1-dependent. Involved in regulating seed germination, primary root growth, and drought stress resistance. |
AT5G64530 | xylem NAC domain 1;(source:Araport11) |
AT5G33290 | Acts as a xylogalacturonan xylosyltransferase within the XGA biosynthesis pathway. Involved in pectin biosynthesis. |
AT2G13820 | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein;(source:Araport11) |
AT4G30280 | Encodes a xyloglucan endotransglucosylase/hydrolase with only only the endotransglucosylase (XET; EC 2.4.1.207) activity towards xyloglucan and non-detectable endohydrolytic (XEH; EC 3.2.1.151) activity. Expressed in the mature or basal regions of both the main and lateral roots, but not in the tip of these roots where cell division occurs. |
AT4G13090 | xyloglucan endotransglucosylase/hydrolase 2;(source:Araport11) |
AT5G48070 | putative xyloglucan endotransglycosylase/hydrolase, expressed primarily in the stele of mature non-elongating regions of both the main and the lateral root. Is expressed in lateral root primordia but expression ceases after lateral root begins to grow. Involved in cell proliferation in incised inflorescence stems. |
AT4G18990 | xyloglucan endotransglucosylase/hydrolase 29;(source:Araport11) |
AT1G32170 | xyloglucan endotransglycosylase-related protein (XTR4) The mRNA is cell-to-cell mobile. |
AT3G44990 | Encodes a xyloglucan endotransglycosylase/hydrolase. Protein sequence and phylogenetic analysis indicates that this enzyme resides in Group III-A of the XTH family, with high similarity to Tropaeolum majus (nasturtium) xyloglucanase 1 (TmNXG1).Enzyme kinetic analysis indicates predominant xyloglucan endo-hydrolase activity (EC 3.2.1.151) with only limited potential to act as a xyloglucan endo-transglycosylase (EC 2.4.1.207). |
AT1G10550 | Encodes a membrane-localized protein that is predicted to function during cell wall modification.Overexpression of XTH33 results in abnormal cell morphology. It's expression is under epigenetic control by ATX1. |
AT2G35610 | Encodes an arabinosyltransferase that modifies extensin proteins in root hair cells. |
AT2G26580 | plant-specific transcription factor YABBY family protein;(source:Araport11) |
AT3G54380 | SAC3/GANP/Nin1/mts3/eIF-3 p25 family;(source:Araport11) |
AT3G22690 | YS1 is a PPR protein involved in RNA editing of plastid encoded genes. Natural variation in this locus is associated with increased photosynthetic acclimation. |
AT5G24380 | closest Arabidopsis homolog of Zea maize metal-phytosiderophore/metal-nicotianamine transporter ZmYS1 |
AT5G53550 | YELLOW STRIPE like 3;(source:Araport11) |
AT5G51640 | Encodes leaf-senescence-related protein. A member of the TBL (TRICHOME BIREFRINGENCE-LIKE) gene family containing a plant-specific DUF231 (domain of unknown function) domain. TBL gene family has 46 members, two of which (TBR/AT5G06700 and TBL3/AT5G01360) have been shown to be involved in the synthesis and deposition of secondary wall cellulose, presumably by influencing the esterification state of pectic polymers. A nomenclature for this gene family has been proposed (Volker Bischoff & Wolf Scheible, 2010, personal communication). |
AT1G63700 | Member of MEKK subfamily, a component of the stomatal development regulatory pathway. Mutations in this locus result in embryo lethality. |
AT4G32540 | Mutant has elevated levels of free IAA in dominant mutant allele; Flavin Monooxygenase-Like Enzyme; Auxin Biosynthesis |
AT1G04610 | Encodes a member of the YUC family that is expressed in the root apex and is ethylene inducible in the root. |
AT4G28720 | Auxin biosynthetic gene regulated by RVE1. Overexpression leads to suppression of bri1 phenotype. |
AT4G13260 | Encodes YUC2. Catalyzes conversion of IPA (indole-3-pyruvic acid) to IAA (indole-3-acetic acid) in auxin biosynthesis pathway. |
AT5G43890 | Encodes a YUCCA-like putative flavin monooxygenase, the activation tagging mutant has increased level of IAA, increased auxin response and phenotype of auxin overproduction, rescues erecta mutant phenotype |
AT5G57360 | Encodes clock-associated PAS protein ZTL; Also known as FKF1-like protein 2 or ADAGIO1(ADO1). A protein containing a PAS domain ZTL contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. ZTL is the F-box component of an SCF complex implicated in the degradation of TOC1. |
AT1G64760 | ZERZAUST is an atypical β-1,3 glucanase. The protein is localized to punctate regions of the apoplast, near cellular junctions. Mutants in Ler background display aberrant floral morphology and twisted siliques and stems. Biochemcial analysis of mutant cell wall composition indicates cell wall defects. However, in Col background, there is no phenotype due to compensatory effect of ZETH gene expression. |
AT2G19440 | Homolog of ZET, an atypical β-1,3 glucanase. Differentially expressed in Ler (very low) vs Col (very high) backgrounds. |
AT5G59440 | Encodes thymidylate kinase which exists in two isoforms in plants. The longer variant of 263 amino acids with a N-terminal extension that is required for localization to the mitochondrion. The second isoform of 224 residues is localized to the cytoplasm and nucleoplasm. Peak of expression occurs during G1/S phase transition. |
AT1G69600 | Encodes ZFHD1, a member of the zinc finger homeodomain transcriptional factor family. Binds to the 62 bp promoter region of ERD1 (early responsive to dehydration stress 1). Expression of ZFHD1 is induced by drought, high salinity and abscisic acid. |
AT2G32930 | Encodes a zinc finger protein. |
AT2G37430 | Encodes a member of the zinc finger family of transcriptional regulators. It is expressed in many root tips, primary roots, cotyledons and hypocotyl. The protein is localized to the nucleus. Overexpression of ZAT11 causes increased root growth and increased sensitivity to nickel ions. The mRNA is cell-to-cell mobile. |
AT5G04340 | Encodes a C2H2 zinc finger transcription factor that coordinately activates phytochelatin-synthesis related gene expression and directly targets GSH1 by binding to its promoter to positively regulate Cd accumulation and tolerance. |
AT3G02830 | Encodes a zinc finger protein that binds to PORA mRNA in vivo and recruits the Pfr form of phytochrome to the 5′-UTR of PORA mRNA to regulate translation of the mRNA. |
AT1G10480 | Encodes a zinc finger protein containing only a single zinc finger that acts downstream of ZFP6 in regulating trichome development by integrating GA and cytokinin signaling. |
AT2G41940 | Encodes a zinc finger protein containing only a single zinc finger. |
AT5G13740 | Encodes ZIF1 (ZINC-INDUCED FACILITATOR1), a member of the Major Facilitator Superfamily (MFS) of membrane proteins which are found in all organisms and transport a wide range of small, organic molecules. Involved in a mechanism of Zn sequestration, possibly by transport of a Zn ligand or Zn-ligand complex into vacuoles. The mRNA is cell-to-cell mobile. |
AT1G55910 | member of Putative zinc transporter ZIP2 - like family |
AT1G05300 | member of Fe(II) transporter isolog family |
AT2G04032 | zinc transporter 7 precursor;(source:Araport11) |
AT5G45105 | zinc transporter 8 precursor;(source:Araport11) |
AT1G49590 | Encodes a novel nucleic acid-binding protein that is required for both RdDM (RNA-directed DNA methylation) and pre-mRNA splicing. |
AT5G67450 | Encodes zinc-finger protein. mRNA levels are elevated in response to low temperature, cold temperatures and high salt. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT1G80730 | Encodes a zinc finger protein and is expressed at high levels in the shoot apex, including the apical meristem, developing leaves and the developing vascular system. expression induced three days post germination. T-DNA insertion mutant has a dominant phenotype in leaf initiation. |
AT3G19580 | Encodes zinc finger protein. mRNA levels are upregulated in response to ABA, high salt, and mild desiccation. The protein is localized to the nucleus and acts as a transcriptional repressor. |
AT5G59520 | encodes a metal ion transporter whose expression is regulated by copper. |
AT5G65930 | encodes a novel member of the kinesin superfamily of motor proteins. recessive mutations have reduced number of trichome branches. |